Target biomarker detection

Abstract

The invention relates generally to the field of detecting target biomarkers using aptamers. In particular, the invention is directed to methods for detecting target biomarkers using aptamers attached to beads. The invention enables the detection of a target biomarker in a sample fluid. The invention is particularly useful for detecting the presence of target biomarkers at low concentrations. Products, ensembles, and kits for carrying out such methods are provided. Processes for generating products used in the ensembles, kits, and methods of the invention are provided. In addition, conjugates comprising at least one target biomarker, and methods for releasing the at least one target biomarker, are provided.

Description

[0001] TARGET BIOMARKER DETECTION

[0002] FIELD

[0003] The invention relates generally to the field of detecting target biomarkers. In particular, the invention is directed to methods for detecting target biomarkers. The invention enables the detection of a target biomarker in a sample fluid. The invention is particularly useful for detecting the presence of target biomarkers at low concentrations. Products, ensembles, and kits for carrying out such methods are provided. Processes for generating products used in the ensembles, kits, and methods of the invention are provided. In addition, conjugates comprising at least one target biomarker, and methods for releasing the at least one target biomarker, are provided.

[0004] BACKGROUND

[0005] The detection of biomarkers, e.g. nucleic acids is critical in various fields, including life sciences research and clinical diagnostics. Existing methods suffer from limitations related to sensitivity, specificity, and signal amplification, all of which are at least partly constrained by the need for involved extraction and purifications. Further, traditional molecular probes, primarily used as primers in PCR or attached to magnetic beads for extractions, offer only a static response to the presence of biomarkers in a sample. There is clearly a need for a highly sensitive, cost-efficient, easily customisable, and rapid method for the detection of biomarkers. It is an object of the present invention to address one or more of the above problems, by providing a tool for the detection of biomarkers.

[0006] SUMMARY

[0007] The present invention pertains to the field of nanotechnology, molecular diagnostics, particularly focusing on the design and functionality of programmable, computationally and rationally designed polymer aptameric composite structures named "nanites". The invention relates to the use of such “nanites” to generate dynamic molecular interactions, and hence in methods for the amplification and detection of a target of interest.

[0008] In particular, the inventors have demonstrated that target biomarkers may be detected using an ensemble comprising a “sentry nanite” comprising a plurality of first aptamer sequences bound to a support in particle form, wherein the plurality of first aptamer sequences are adapted for hybridisation with a target biomarker, at least one “stabiliser nanite” comprising a second aptamer sequence adapted for hybridisation with the target biomarker and a third aptamer sequence, and at least one “signaller nanite” comprising a third aptamer sequence adapted for hybridisation with the second aptamer sequence, wherein the third aptamer sequence comprises a first label. The ensemble may be used on an unpurified sample, therefore greatly reducing analysis time and minimising waste. The method of using the ensemble to detect a target biomarker is highly sensitive and quantitative, therefore offering a significant benefit when compared with existing methods of biomarker detection that are often expensive, time consuming, insensitive, require purification of a sample prior to analysis, and qualitative rather than quantitative in nature.

[0009] Accordingly, the invention provides an ensemble for detecting a target biomarker, the ensemble comprising:

[0010] A) a “sentry nanite” comprising a plurality of first aptamer sequences bound to a support in particle form, wherein the plurality of first aptamer sequences are adapted for hybridisation with a target biomarker;

[0011] B) at least one “stabiliser nanite” comprising a second aptamer sequence adapted for hybridisation with the target biomarker and a third aptamer sequence; and

[0012] C) at least one “signaller nanite” comprising a third aptamer sequence adapted for hybridisation with the second aptamer sequence, wherein the third aptamer sequence comprises a first label.

[0013] Optionally, the ensemble defined herein is provided wherein:

[0014] A) the second aptamer sequence is capable of simultaneously hybridising with: (i) both the target biomarker and the third aptamer sequence; and (ii) two copies of the third aptamer sequence; and / or

[0015] B) the third aptamer sequence is capable of simultaneously hybridising with two copies of the second aptamer sequence; and / or

[0016] C) the first aptamer sequence is not capable of hybridising with the second aptamer sequence or the third aptamer sequence.

[0017] Optionally, the ensemble defined herein is provided wherein:

[0018] A) the second aptamer sequence comprises a first toehold domain which is capable of hybridising with the target biomarker and is capable of hybridising with the third aptamer sequence; and / or

[0019] B) the third aptamer sequence comprises a second toehold domain which is capable of hybridising with the second aptamer sequence; and / or

[0020] C) the first aptamer sequence comprises a third toehold domain which is capable of hybridising with the target biomarker.

[0021] Optionally, the ensemble defined herein is provided wherein:

[0022] A) the second aptamer sequence is adapted to release a first trigger domain on hybridisation of the second aptamer sequence to the target biomarker or the third aptamer sequence, wherein the release is by competitive hybridisation; and

[0023] B) the first trigger domain is capable of hybridising with the second toehold domain of the third aptamer sequence.

[0024] Optionally, the ensemble defined herein is provided wherein: A) the third aptamer sequence is adapted to release a second trigger domain on hybridisation of the third aptamer sequence to the second aptamer sequence, wherein the release is by competitive hybridisation; and

[0025] B) the second trigger domain is capable of hybridising with a second copy of the second aptamer sequence.

[0026] Optionally, the ensemble defined herein is provided wherein:

[0027] A) the first aptamer sequence comprises a domain “a” which is adapted for hybridisation to a domain “a*” of the target biomarker;

[0028] B) the second aptamer sequence comprises: a) a first toehold domain “b” which is adapted for hybridisation to a domain “b*” of the target biomarker; b) a domain “c” which is adapted for hybridisation to a domain “c*” of the third aptamer sequence and a domain “c*” of the target biomarker; c) a domain “c*” which is adapted for hybridisation to a domain “c” of the third aptamer sequence; and d) a first non-complementary loop structure “d” which is adapted for hybridisation to a second toehold domain “d*” of the third aptamer sequence; whereby hybridisation of the first toehold domain “b” of the second aptamer sequence to domain “b*” of the target biomarker releases the first trigger domain; wherein the release is by competitive hybridisation and the first trigger domain comprises domain “c*” and preferably further comprises domain “d”; and

[0029] C) the third aptamer sequence comprises: a) a second toehold domain “d*” which is which is adapted for hybridisation to a domain “d” of the second aptamer; b) a domain “c” which is adapted for hybridisation to domain “c*” of the second aptamer sequence and domain “c*” of the target biomarker; c) a domain “c*” which is adapted for hybridisation to domain “c” of the second aptamer sequence; and d) a second non-complementary loop structure “b*” which is adapted for hybridisation to a first toehold domain “b” of the second aptamer sequence; whereby hybridisation of domain “d*” of the third aptamer sequence to domain “d” of the second aptamer sequence releases the second trigger domain, wherein the release is by competitive hybridisation and the second trigger domain comprises domain “c” and preferably further comprises domain “b*”.

[0030] Optionally, the ensemble defined herein is provided wherein: A) the sentry nanite plurality of first aptamer sequences comprise one or more non- complementary loop structures and one or more complementary stem structures, preferably wherein the one or more non-complementary loop structures are from about 6 bases to about 8 bases in length, more preferably wherein the one or more non-complementary loop structures are about 6 bases or about 8 bases in length, optionally wherein the one or more complementary stem structures are shorter than the one or more non-complementary loop structures; and / or

[0031] B) the stabiliser nanite second aptamer sequence comprises one or more non- complementary loop structures and one or more complementary stem structures, preferably wherein the one or more non-complementary loop structures are from about 6 bases to about 8 bases in length, more preferably wherein the one or more non-complementary loop structures are about 6 bases or about 8 bases in length, optionally wherein the one or more complementary stem structures are longer than the one or more non-complementary loop structures; and / or

[0032] C) the signaller nanite third aptamer sequence comprises one or more non- complementary loop structures and one or more complementary stem structures, preferably wherein the one or more non-complementary loop structures are from about 6 bases to about 8 bases in length, more preferably wherein the one or more non-complementary loop structures are about 6 bases or about 8 bases in length, optionally wherein the one or more complementary stem structures are longer than the one or more non-complementary loop structures.

[0033] Optionally, the ensemble defined herein is provided wherein the one or more complementary stem structures of the first and / or second and / or third aptamer sequences comprise one or more nucleotide base mismatches, optionally wherein:

[0034] A) the one or more complementary stem structures of the first and / or second and / or third aptamer sequences comprises from about 1 to about 5 nucleotide base mismatches;

[0035] B) the one or more nucleotide base mismatches are present within 5, preferably within 3, more preferably within 1 nucleotide of the 5’ and / or 3’ end of one or more non- complementary loop structures.

[0036] The invention also provides an ensemble as defined herein, wherein the support:

[0037] A) is spherical; and / or

[0038] B) comprises silica; and / or

[0039] C) comprises or consists of one or more ferromagnetic metals, compounds thereof, or alloys thereof; and / or

[0040] D) comprises a polymer coating.

[0041] The invention also provides an ensemble as defined herein, wherein: A) the one or more ferromagnetic metals, compounds thereof, or alloys thereof, are selected from iron, cobalt, nickel, steel, stainless steel, hematite, and magnetite (FesC ), preferably magnetite; and / or

[0042] B) the one or more ferromagnetic metals, compounds thereof, or alloys thereof, are encapsulated by the support material; and / or

[0043] C) the one or more ferromagnetic metals, compounds thereof, or alloys thereof, are present as a dispersion throughout the support, preferably as a microcrystalline dispersion, more preferably as a microcrystalline magnetite dispersion, most preferably as about a 20% microcrystalline magnetite dispersion; and / or

[0044] D) the plurality of first aptamer sequences are bound to the support via the polymer coating, e.g., via a plurality of amide groups, preferably wherein the polymer coating is a surface polymer coating comprising carboxylic acid functional groups, e.g., (poly)methacrylic acid (PMAA).

[0045] Optionally, the ensemble defined herein is provided wherein domain “a” of the first aptamer sequence consists of a nucleotide sequence that is greater than about 15 nucleotides in length, preferably wherein the nucleotide sequence is from about 20 to about 50 nucleotides in length, e.g., about 45 nucleotides in length.

[0046] Optionally, the ensemble defined herein is provided wherein the stabiliser second aptamer sequence consists of a nucleotide sequence that is greater than or equal to 12 nucleotides in length, preferably greater than or equal to 18 nucleotides in length, for example between 18 and 20 nucleotides in length.

[0047] Optionally, the ensemble defined herein is provided wherein:

[0048] A) the first toehold domain consists of a nucleotide sequence that is greater than or equal to 6 nucleotides in length, for example between 6 and 8 nucleotides in length; and / or

[0049] B) the second toehold domain consists of a nucleotide sequence that is greater than or equal to 6 nucleotides in length, for example between 6 and 8 nucleotides in length; and / or

[0050] C) the third toehold domain consists of a nucleotide sequence that is greater than or equal to 6 nucleotides in length, for example between 6 and 8 nucleotides in length.

[0051] Optionally, the ensemble defined herein is provided wherein:

[0052] A) the first label is a fluorophore, preferably wherein the fluorophore is Cy3 or more preferably 6-FAM (fluorescein), e.g., 3’ 6-FAM; and / or

[0053] B) the stabiliser nanite comprises a second label, optionally wherein the label is a fluorophore, preferably wherein the fluorophore is Cy3, more preferably wherein the second fluorophore is 6-FAM (fluorescein), e.g., 5’ 6-FAM; and / or

[0054] C) the sentry nanite comprises a third label, optionally wherein the label is a fluorophore, preferably wherein the fluorophore is Cy5, e.g., 5’ Cy5; and / or D) the sentry nanite comprises fourth label, optionally wherein the label is a dye, preferably wherein the dye is a fluorescent dye, more preferably wherein the fluorescent dye is selected from (i) 4',6-diamidino-2-phenylindole (DAPI) or (ii) a lanthanide or lanthanide complex e.g., Eu3+or a complex thereof.

[0055] Optionally, the ensemble defined herein is provided wherein:

[0056] A) the third label is different to the first label and the second label; and / or

[0057] B) the first label and the second label are the same.

[0058] Optionally, the ensemble defined herein is provided wherein the sentry nanite, stabiliser nanite, and / or the signaller nanite do not comprise a quencher.

[0059] Optionally, the ensemble defined herein is provided wherein the first, second, and third aptamer sequences are nucleic acid aptamer sequences, e.g. DNA aptamer sequences.

[0060] Optionally, the ensemble defined herein is provided wherein the target biomarker is a polynucleotide, e.g., an oligonucleotide.

[0061] Optionally, the ensemble defined herein is provided wherein:

[0062] A) the “a*” domain of the target biomarker consists of a nucleotide sequence that: a) is greater than or equal to 30 nucleotides in length; and / or b) does not comprise one or more palindromic structures of 5 or more nucleotides; and / or c) does not comprise one or more consecutive sequences of more than four identical nucleotides; and / or d) is located: i) at the 5’ end of the target biomarker; and / or ii) closer to the 5’ end of the target biomarker than the “b*” and “c*” domains, preferably wherein the “a*” domain is located no more than 10, more preferably no more than 5, yet more preferably no more than 3 nucleotides from the 5’ end of the target biomarker; and / or e) has a 3’ end located at least 10 nucleic acids, preferably at least 20 nucleic acids from the 5’ end of the “c*” domain of the target biomarker; and / or

[0063] B) the “c*” domain of the target biomarker consists of a nucleotide sequence that: f) is greater than or equal to 17 nucleotides in length; and / or g) differs to the “a*” domain of the target biomarker by at least 4, preferably at least 6, more preferably at least 8, yet more preferably at least 10 nucleotides; and / or h) is located: i) at the 3’ end of the target biomarker; and / or ii) closer to the 3’ end of the target biomarker than the “a*” and “b*” domains, preferably wherein the “c*” domain is located no more than 10, more preferably no more than 5, yet more preferably no more than 3 nucleotides from the 3’ end of the target biomarker; and / or

[0064] C) the “b*” domain of the target biomarker consists of a nucleotide sequence that: i) is greater than or equal to 8 nucleotides in length; and / or j) has less than 40% G- and / or C-containing nucleotides; and / or k) differs to the “c*” domain of the target biomarker by at least 1 , preferably at least 3, more preferably at least 5, yet more preferably at least 10 nucleotides; and / or l) is located further from the 5’ end of the target biomarker than the “a*” domain and is located further from the 3’ end of the target biomarker than the “c*” domain; and / or m) is located adjacent to the “c*” domain of the target biomarker with no intervening nucleotides; and / or

[0065] D) the “a*”, “b*”, and “c*” domains of the target biomarker are arranged in this order, preferably arranged in this order from the 5’ to the 3’ end; and / or

[0066] E) the “b*” and “c*” domains of the target biomarker do not overlap, preferably wherein the “a*”, “b*”, and “c*” domains of the target biomarker do not overlap.

[0067] The polynucleotide may be greater than or equal to 55 nucleotides in length.

[0068] Optionally, the ensemble defined herein is provided wherein:

[0069] A) the second aptamer sequence comprises domains “b”, “c”, “d”, and “c*” arranged in this order, preferably arranged in this order from the 5’ to the 3’ end; and / or

[0070] B) the third aptamer sequence comprises domains “d*”, “c”, “b*”, and “c*” arranged in this order, preferably arranged in this order from the 3’ to the 5’ end.

[0071] Optionally, the ensemble defined herein is provided wherein:

[0072] A) the “b” domain of the second aptamer sequence consists of a nucleotide sequence that has less than 40% G- and / or C-containing nucleotides; and / or

[0073] B) the “c” domain of the second aptamer sequence consists of a nucleotide sequence that: b) has less than 40% G- and / or C-containing nucleotides; and / or c) is at least 10 nucleotides in length, preferably between 12 and 30 nucleotides, for example 17 nucleotides; and / or

[0074] C) the “d” domain of the second aptamer sequence consists of a nucleotide sequence that: d) is about 6 bases to about 8 bases in length, preferably wherein the one or more non-complementary loop structures are about 6 bases or about 8 bases in length; and / or e) differs from the length of the “b” domain by less than 5, preferably less than 3, more preferably less than 1 , yet more preferably 0 nucleotides; and / or f) is not self-complementary, preferably wherein it does not have more than 6, preferably not more than 4, yet more preferably not more than 2 consecutive nucleotides which are complementary with the same number of consecutive nucleotides elsewhere in the “d” domain; and / or g) differs from the length of the “d*” domain by less than 5, preferably less than 3, more preferably less than 1 , yet more preferably 0 nucleotides; and / or

[0075] D) the “b*” domain of the third aptamer sequence consists of a nucleotide sequence that: h) is about 6 bases to about 8 bases in length, preferably wherein the one or more non-complementary loop structures are about 6 bases or about 8 bases in length; and / or i) is not self-complementary, preferably wherein it does not have more than 6, preferably not more than 4, yet more preferably not more than 2 consecutive nucleotides which are complementary with the same number of consecutive nucleotides elsewhere in the “b*” domain; and / or j) differs from the length of the “b” domain by less than 5, preferably less than 3, more preferably less than 1 , yet more preferably 0 nucleotides; and / or k) is located adjacent to the “c*” domain of the third aptamer sequence with no intervening nucleotides; and / or

[0076] E) the “b” domain of the third aptamer sequence consists of a nucleotide sequence that has less than 40% G- and / or C-containing nucleotides; and / or

[0077] F) the “a” domain of the first aptamer sequence consists of a nucleotide sequence that: l) does not have more than 4 consecutive nucleotides which are complementary with 4 consecutive nucleotides in the “b”, “c”, “d”, and / or “c*” domains of the second aptamer sequence and / or the “d*”, “c”, “b*”, and / or “c*” domains of the third aptamer sequence; and / or m) is linear, i.e. it is not self-complementary.

[0078] The invention also provides the sentry nanite, the stabiliser nanite, and / or the signaller nanite as defined herein.

[0079] The invention also provides a conjugate comprising:

[0080] A) a sentry nanite;

[0081] B) at least one stabiliser nanite;

[0082] C) at least one signaller nanite; and

[0083] D) at least one target biomarker; wherein the sentry nanite, stabiliser nanite, signaller nanite, and target biomarker are as defined herein.

[0084] The invention also provides a conjugate as defined herein, wherein: A) domain “a” of the first aptamer sequence is hybridised to domain “a*” of the at least one target biomarker;

[0085] B) the first toehold domain “b” of a first stabiliser nanite is hybridised to domain “b*” of the at least one target biomarker;

[0086] C) domain “c” of the first stabiliser nanite is hybridised to domain “c*” of the at least one target biomarker;

[0087] D) the first non-complementary loop structure “d” of the first stabiliser nanite is hybridised to the second toehold domain “d*” of a first signaller nanite; and

[0088] E) domain “c*” of the first stabiliser nanite is hybridised to domain “c” of the first signaller nanite.

[0089] The conjugate may comprise one or more polymer chains extending from the plurality of first aptamer sequences bound to the support of the sentry nanite; wherein the one or more polymer chains comprise the first aptamer sequence, at least one target biomarker, two or more copies of the stabiliser nanite, and two or more copies of the signaller nanite.

[0090] The conjugate may also comprise one or more polymer chains each comprising two or more copies of the stabiliser nanite and two or more copies of the signaller nanite; wherein each of the one or more polymer chains comprise hybridisation between:

[0091] A) the second non-complementary loop structure “b*” of the two or more copies of the signaller nanite and the first toehold domain “b” of the two or more copies of the stabiliser nanite;

[0092] B) domain “c*” of the two or more copies of the signaller nanite and domain “c” of the two or more copies of the stabiliser nanite;

[0093] C) the first non-complementary loop structure “d” of the two or more copies of the stabiliser nanite and the second toehold domain “d*” of the two or more copies of the signaller nanite; and

[0094] D) domain “c*” of the two or more copies of the stabiliser nanite and domain “c” of the two or more copies of the signaller nanite; optionally wherein the polymer is a linear polymer.

[0095] The conjugate may have a diameter of less than about 10 pm, preferably between about 2.7 pm and about 4 pm, more preferably about 3 pm.

[0096] The invention also provides a method for releasing the hybridised at least one target biomarker from the conjugate defined herein, wherein the method is not a photochemical process; optionally wherein the released target biomarker is isolated e.g., as a conjugate with one or more of the sentry, stabiliser, and / or signaller nanites, or in isolation.

[0097] The invention also provides a kit for detecting the presence of a target biomarker in a sample fluid comprising: A) a sentry nanite;

[0098] B) at least one stabiliser nanite;

[0099] C) at least one signaller nanite; and

[0100] D) instructions for use; wherein the sentry nanite, stabiliser nanite, and signaller nanite are as defined herein.

[0101] The invention also provides a method for detecting the presence of a target biomarker in a sample fluid, the method comprising the use of an ensemble as defined herein, the sentry nanite, the stabiliser nanite, and / or the signaller nanite as defined herein, the conjugate as defined herein, or the kit as defined herein.

[0102] The method may comprise the formation of one or more polymer chains extending from the plurality of first aptamer sequences bound to the support of the sentry nanite; wherein each of the one or more polymer chains comprise the first aptamer sequence, at least one target biomarker, two or more copies of the stabiliser nanite, and two or more copies of the signaller nanite; preferably wherein each of the polymer comprises: a) two or more first labels; b) two or more second labels; c) a third label; and / or d) a fourth label; wherein the two or more first labels, two or more second labels, third label, and / or fourth label are as defined herein.

[0103] The method may comprise the use of a sentry nanite comprising a support comprising or consisting of one or more ferromagnetic metals, compounds thereof, or alloys thereof; wherein the method additionally comprises the following steps:

[0104] A) contacting the sample fluid with an ensemble as defined herein or components A) to C) of the kit as defined herein, in a vessel, preferably wherein the sample fluid is diluted with a liquid medium, e.g., an aqueous buffer solution;

[0105] B) agitating the mixture in the vessel;

[0106] C) exposing the vessel to a magnetic field;

[0107] D) decanting the liquid from the vessel while retaining the exposure to the magnetic field;

[0108] E) rinsing the contents of the vessel while retaining the exposure to the magnetic field;

[0109] F) removing the magnetic field;

[0110] G) resuspending the mixture;

[0111] H) dispensing the resuspended mixture on to a microchamber array microfluidic chip; and

[0112] I) visualising the array, e.g., by monitoring fluorescence.

[0113] Optionally, the microchamber array microfluidic chip is a femtolitre array. Optionally, the method defined herein is provided wherein:

[0114] A) the concentration of the sentry nanite is about 1 pM; and / or

[0115] B) the concentration of each of the stabiliser nanite and signaller nanite is between about 1 nM and about 1 pM; and / or

[0116] C) the concentration of the stabiliser nanite and signaller nanite is about the same, preferably where it is the same, for example about 1 pM; and / or

[0117] D) the concentration of the stabiliser nanite and / or signaller nanite is greater than the concentration of the sentry nanite, preferably about 2 times greater, more preferably about 5 times greater than the concentration of the sentry nanite; and / or

[0118] E) each of the concentrations of the sentry nanite, stabiliser nanite, and signaller nanite are greater than the concentration of the target, e.g., in excess; and / or

[0119] F) the temperature is greater than or equal to 20 °C, and / or less than or equal to 85 °C; and / or

[0120] G) the salt concentration is greater than or equal to 0.05 M Na+.

[0121] The invention also provides a method as defined herein, wherein the sample fluid is selected from: blood, plasma, saliva, serum, sputum, urine, joint fluid, cerebral spinal fluid, synovial fluid, cells, a cellular extract, a tissue sample, a tissue biopsy, lymph, milk, pleural effusion, tissue infiltration, and stool sample and the like.

[0122] Optionally, the method additionally determines the concentration of the target biomarker, wherein the limit of detection of the method is 1 x 10'18M.

[0123] The invention also provides a method for determining one or more of the first, second, and third aptamer sequences as defined herein, the method comprising the selection of a target biomarker and the use of a computer algorithm.

[0124] The invention also provides a process for making a sentry nanite, the process comprising the steps of:

[0125] A) providing a support, optionally wherein: a) the support comprises or consists of one or more ferromagnetic metals, compounds thereof, or alloys thereof; or b) the support comprises silica and a microcrystalline dispersion of one or more ferromagnetic metals, compounds thereof, or alloys thereof, for example a microcrystalline magnetite dispersion;

[0126] B) coating the support with a polymer coating, preferably a surface polymer coating comprising carboxylic acid functional groups, e.g., (poly)methacrylic acid (PMAA); and

[0127] C) contacting the coated support with a plurality of first aptamer sequences and a coupling agent, preferably wherein the first aptamer sequences comprise a free amine group e.g., an amino modifier modification such as 3’AmMO. BRIEF DESCRIPTION OF THE FIGURES

[0128] FIGURE 1 shows a sentry, a stabiliser, and a signaller nanite of the present invention in addition to a target biomarker that may be detected using the methods of the invention. FIGs 1A and 1B show alternative target biomarkers.

[0129] FIGURE 2 shows a stabiliser-sentry-biomarker adduct. FIG. 2A shows a first aptamer sequence of the sentry nanite comprising a domain “a” (SEQ ID NO: 5), hybridised with the “a*” domain of the target biomarker (SEQ ID NO: 6). Also shown are the “b*” and “c*” domains (SEQ ID NO: 7) of the target biomarker hybridised with the “b” and “c” domains of the stabiliser nanite second aptamer sequence (SEQ ID NO: 8). FIG. 2B shows an alternative stabiliser-sentry-biomarker adduct showing inter alia, the “b*” and “c*” domains (SEQ ID NO: 9) of the target biomarker and the stabiliser nanite second aptamer sequence (SEQ ID NO: 10).

[0130] FIGURE 3 shows a conjugate of the present invention. FIG. 3A shows a conjugate comprising a first aptamer sequence of the sentry nanite comprising a domain “a”, hybridised with the “a*” domain of the target biomarker. Also shown are the “b*” and “c*” domains of the target biomarker hybridised with the “b” and “c” domains of the stabiliser nanite second aptamer sequence, and the “d” and “c*” domains of the stabiliser nanite second aptamer sequence hybridised with the “d*” and “c*” domains of the signaller nanite third aptamer sequence (SEQ ID NO: 11). FIG. 3B shows an alternative conjugate.

[0131] FIGURE 4 shows i) the sentry nanite comprising a plurality of first aptamer sequences comprising a domain “a”; ii) target biomarker comprising domains “a*”, “b*”, and “c*”; iii) partial hybridisation of the “a” domain of the first aptamer sequence with the “a*” domain of the target biomarker; iv) hybridisation of the “a” domain of the first aptamer sequence with the “a*” domain of the target biomarker; v) the “b” and “c” domains of the stabiliser nanite second aptamer sequence, and the “d*” and “c*” domains of the signaller nanite third aptamer sequence; vi) a conjugate of the present invention.

[0132] FIGURE 5 shows a general schematic illustrating a method of detecting a target biomarker.

[0133] FIGURE 6 shows a cross section of a femtolitre microfluidic array in which one well comprises an unhybridised sentry nanite (left) and another well comprises a conjugate of the present invention (right).

[0134] FIGURE 7 shows a flowchart and schematic representing the computer program product designed to simulate Nanite interactions. The software simulates experimental conditions and takes specific user-entered inputs to produce a tailored nanite sequence composition to the given target of interest. Inputs include the target sequence, reaction conditions such as ion concentration or workable temperature range as well as specified sub-domains of interest on the target. The software simulations provide an outputted Nanite sequence composition which can then be experimentally verified, and feedback / validations fed back into the software.

[0135] FIGURE 8 shows the nanites of and conjugates in more detail. FIG. 8A shows the assembly of a conjugate of the present invention. FIG. 8B shows the assembly of an alternative conjugate of the present invention. FIG. 8C shows a sentry nanite of the present invention. FIGURE 9 shows a sentry of the present invention in more detail.

[0136] FIGURE 10 shows some illustrative sentry (SEQ ID NO: 13), stabiliser (SEQ ID NO: 14), and signaller (SEQ ID NO: 15) nanite sequences together with a target biomarker sequence (SEQ ID NO: 16).

[0137] FIGURE 11 shows a fluorescence microscopy image of an array of Cy5 labelled sentry nanites.

[0138] FIGURE 12 shows a log-log plot of the average number of captured and tagged target molecules per nanite (A) as a function of the target concentration enzyme / direct target-free amplification down to 1 aM in 20 pL, equal to detection and absolute quantification of just 12 target molecules.

[0139] FIGURE 13 shows a gel electrophoresis image illustrating the method of the invention.

[0140] DETAILED DESCRIPTION

[0141] Definitions

[0142] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Singleton, et al., DICTIONARY OF MICROBIOLOGY AND MOLECULAR BIOLOGY, 20 ED., John Wiley and Sons, New York (1994), and Hale & Marham, THE HARPER COLLINS DICTIONARY OF BIOLOGY, Harper Perennial, NY (1991) provide the skilled person with a general dictionary of many of the terms used in this disclosure.

[0143] This disclosure is not limited by the exemplary methods and materials disclosed herein, and any methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of this disclosure. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of the present invention, which is defined solely by the claims.

[0144] The description of embodiments of the disclosure is not intended to be exhaustive or to limit the disclosure to the precise form disclosed. While specific embodiments of, and examples for, the disclosure are described herein for illustrative purposes, various equivalent modifications are possible within the scope of the disclosure, as those skilled in the relevant art will recognise. For example, while method steps or functions are presented in a given order, alternative embodiments may perform functions in a different order, or functions may be performed substantially concurrently. The teachings of the disclosure provided herein can be applied to other procedures or methods as appropriate. The various embodiments described herein can be combined to provide further embodiments. Aspects of the disclosure can be modified, if necessary, to employ the compositions, functions and concepts of the above references and application to provide yet further embodiments of the disclosure. Moreover, due to biological functional equivalency considerations, some changes can be made in protein structure without affecting the biological or chemical action in kind or amount. These and other changes can be made to the disclosure in light of the detailed description. All such modifications are intended to be included within the scope of the appended claims.

[0145] The headings provided herein are not limitations of the various aspects or embodiments of this disclosure.

[0146] As used herein, the term “aptamer” refers in general to an oligonucleotide or mixture thereof which is capable of binding specifically to a target. The terms “aptamer” and “aptamer sequence” are used interchangeably herein. The target may be another aptamer of the invention e.g. a first, second, or third aptamer sequence, or it could be a target biomarker. Oligonucleotide aptamers will be discussed here, but the skilled reader will appreciate that other aptamers having equivalent binding characteristics can also be used, such as peptide aptamers. Preferably, the aptamer is not present in nature in isolated form. Aptamers are preferably single-stranded or double-stranded. Aptamers may comprise one or more single-stranded region (also referred to as “loops”) and / or one or more doublestranded region (also referred to as “stems”). A single-stranded oligonucleotide may comprise regions of nucleotide sequences which are reverse complementary to each other, such that when the oligonucleotide adopts a particular conformation, those regions of nucleotide sequences are brought into proximity and form a double-stranded region. Intervening regions of nucleotide sequences without a reverse complementary nucleotide sequence form loops. These structures are referred to in the art as “stem-loop” structures, “hairpins” or “hairpin loops”.

[0147] As used herein, the term “nanite” refers to a component of the ensemble described herein. In more detail, the nanite may be a “sentry nanite”, a “stabiliser nanite”, or a “signaller nanite” as exemplified herein. The nanites interact synergistically to enable the detection of one or more target biomarkers. The “sentry nanite” comprises a plurality of first aptamer sequences bound to a support in particle form, wherein the plurality of first aptamer sequences are adapted for hybridisation with a target biomarker. The sentry nanite binds to the target biomarker - this adduct acts as an anchor point from which a chain of stabiliser and signaller nanites may grow. The “stabiliser nanite” comprises a second aptamer sequence adapted for hybridisation with the target biomarker and a third aptamer sequence. The “signaller nanite” comprises a third aptamer sequence adapted for hybridisation with the second aptamer sequence. The third aptamer sequence of the signaller nanite comprises a first label.

[0148] In general, aptamers may comprise oligonucleotides that are at least 5, at least 10 or at least 15 nucleotides in length. Aptamers may comprise sequences that are up to 30, up to 40, up to 45, up to 50, up to 60, up to 70, up to 80, up to 90, or up to 100 or more nucleotides in length. For example, aptamers may be from 5 to 100 nucleotides, from 10 to 40 nucleotides, from 15 to 45 nucleotides, from 30 to 100 nucleotides or from 40 to 80 nucleotides in length. Where possible, aptamers of shorter length are preferred as these will often lead to less interference by other molecules or materials.

[0149] Aptamers are generally oligonucleotides that bind a specific target molecule. Aptamers can be engineered completely in vitro and are readily produced by chemical synthesis.

[0150] The term “label” refers to a compound that is directly or indirectly detectable (e.g. due to its spectral properties, conformation or activity) when attached to a target or compound, e.g. a first, second, or third aptamer sequence or sentry nanite of the invention, and used in the present methods. The label can be directly detectable e.g. a fluorophore or indirectly detectable e.g. a hapten or enzyme. In such situations, molecules can be tagged (or "labelled") with the compound producing the signal (the "label") by any number of methods known to those of ordinary skill in the art, including covalent or ionic coupling, aggregation, affinity coupling (including, e.g., using primary and / or secondary antibodies, either or both of which may comprise a label), and the like.

[0151] The term "fluorophore" when used in the context of a label, e.g. a fluorescent label, as used herein refers to a reporter tag that can be excited by electromagnetic radiation, and that emits electromagnetic radiation in response in an amount sufficient to be detected in an assay. The skilled person will understand that a fluorophore absorbs and emits over a number of wavelengths, referred to as an "absorbance spectrum" and an "emission spectrum", respectively. A fluorophore will exhibit a peak emission wavelength that is a longer wavelength than its peak absorbance wavelength. The term "peak" refers to the highest point in the absorbance or emission spectrum. A dye is an example of a fluorophore.

[0152] The term "chemiluminescent label" refers to any compound that can be attached to a nucleotide capable of causing a chemiluminescence reaction by contact with a target, thereby generating a detectable optical signal without the need for excitation light.

[0153] The term "bioluminescent label" refers to a label which is capable of emitting light due to a biochemical reaction. The term may refer to the production of light due to the reaction of a luciferin and a luciferase. In such a reaction scheme, the luciferase catalyses the oxidation of luciferin resulting in light and an inactive oxyluciferin. A light emission may be triggered when a particular compound is present, e.g. a specific type of ion, preferably calcium. Examples of luciferin include bacterial luciferin, dinoflagellate luciferin, vargulin, coelenterazine and firefly luciferin. Another example of a bioluminescent label is streptavidin beta-galactosidase.

[0154] The term "redox active label" refers to any label that may be detected using a reduction potential for electrochemical readout.

[0155] The term "luminescence label" refers to a label which is capable of emitting light due to a chemical reaction.

[0156] The term "radioactivity label" relates to labels emitting radioactive radiation, preferably composed of radioactive isotopes. The term "radioactive isotope" in the context of the label relates to any such factor known to the person skilled in the art.

[0157] The term "enzyme" when used in the context of a label relates to labels which comprise enzymatic activities. Examples include horseradish peroxidase enzyme (HRP) and streptavidin beta-galactosidase. In particular, enhanced chemiluminescence, which may be used in this context, allows detection of minute quantities of labelled molecules.

[0158] As used herein the term "hair-pin structure" or "hair-pin" refers to a particular secondary structure of a nucleic acid sequence, preferably an aptamer, which comprises two sequence parts that are complementary to each other and form a stem structure. The hairpin structure comprises an additional sequence, positioned between the two complementary sequences, forming a loop structure.

[0159] As used herein the term "conjugate” refers to a moiety comprising a sentry nanite, at least one stabiliser nanite, at least one signaller nanite and at least one target biomarker.

[0160] As used herein the term "adduct” refers to a product resulting from the hybridisation of two or more moieties capable of hybridisation as defined herein. For example, hybridisation between the sentry nanite and second aptamer sequence affords an adduct “a sentry-biomarker adduct”. As will be appreciated, adducts may hybridise with other moieties to afford conjugates as defined herein.

[0161] As used herein, the term "capable of when used with a verb, encompasses, or means the action of the corresponding verb. For example, "capable of activating" also means activates, "capable of hybridising" also means hybridises, "capable of binding" also means binds and "capable of specifically activating..." also means specifically activates.

[0162] Numeric ranges are inclusive of the numbers defining the range. Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limits of that range is also specifically disclosed. Each smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in that stated range is encompassed within this disclosure. The upper and lower limits of these smaller ranges may independently be included or excluded in the range, and each range where either, neither or both limits are included in the smaller ranges is also encompassed within this disclosure, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in this disclosure.

[0163] The term “nanoparticle” as used herein refers to a particle having a z-average mean diameter from 1 to 1000 nm, as measured by dynamic light scattering. The term "z-average" as used herein refers to the z-average mean diameter, i.e. the intensity weighted mean hydrodynamic size of the ensemble collection of particles of a sample, as determined by dynamic light scattering. References to "z-average" and "z-average mean diameter" and “diameter” as used herein refer to z-average mean diameter as determined by dynamic light scattering.

[0164] Z-average mean diameter may be determined by DLS analysis of aqueous suspensions performed at 25 °C using a Malvern Zetasizer Ultra instrument. Samples may be prepared by mixing 40-50 pL dispersions with an appropriate dispersant (1 mL). Measurements may be performed using polystyrene cuvettes at 25 °C, measuring the scattered light at an angle of 173°.

[0165] As used herein, the articles "a" and “an” may refer to one or to more than one (e.g., to at least one) of the grammatical object of the article. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. In this application, the use of "or" means "and / or" unless stated otherwise. Furthermore, the use of the term "including", as well as other forms, such as "includes" and "included", is not limiting.

[0166] “About” may generally mean an acceptable degree of error for the quantity measured given the nature or precision of the measurements. Exemplary degrees of error are within 20 percent (%), typically, within 10%, and more typically, within 5% of a given value or range of values. Preferably, the term “about” shall be understood herein as plus or minus (±) 5%, preferably ± 4%, ± 3%, ± 2%, ± 1%, ± 0.5%, ± 0.1%, of the numerical value of the number with which it is being used.

[0167] The term "consisting of' refers to compositions, methods, and respective components thereof as described herein, which are exclusive of any element not recited in that description of the invention.

[0168] As used herein the term "consisting essentially of" refers to those elements required for a given invention. The term permits the presence of elements that do not materially affect the basic and novel or functional characteristic(s) of that invention (i.e., inactive, or non- immunogenic ingredients). Embodiments described herein as “comprising” one or more features may also be considered as disclosure of the corresponding embodiments “consisting of” and / or “consisting essentially of” such features, of the corresponding embodiments "consisting of" such features.

[0169] Concentrations, amounts, volumes, percentages and other numerical values may be presented herein in a range format. It is also to be understood that such range format is used merely for convenience and brevity and should be interpreted flexibly to include not only the numerical values explicitly recited as the limits of the range but also to include all the individual numerical values or sub-ranges encompassed within that range as if each numerical value and sub-range is explicitly recited.

[0170] As used herein, the terms “polynucleotides”, "nucleic acid" and "nucleic acid sequence" refers to any molecule, preferably a polymeric molecule, incorporating units of ribonucleic acid, deoxyribonucleic acid, or an analogue thereof. The nucleic acid can be either single-stranded or double-stranded, preferably single-stranded. A single-stranded nucleic acid can be one nucleic acid strand of a denatured double-stranded DNA. Alternatively, it can be a single-stranded nucleic acid not derived from any double-stranded DNA. In one aspect, the nucleic acid can be DNA. In another aspect, the nucleic acid can be RNA Suitable nucleic acid molecules are DNA, including genomic DNA or cDNA. Other examples of nucleic acid molecules are RNA, including siRNA, shRNA, and antisense oligonucleotides. Typically, the methods of the invention relate to the production of oligonucleotides (short DNA or RNA sequences typically less than about 300 bases in length).

[0171] Unless otherwise indicated, any nucleic acid sequences are written left to right in 5' to 3' orientation.

[0172] The aptamer sequences of the present invention may be prepared by any means known in the art. For example, large amounts of the aptamer sequences may be produced by replication in a suitable host cell. The natural or synthetic DNA fragments coding for a desired fragment will be incorporated into recombinant nucleic acid constructs, typically DNA constructs, capable of introduction into and replication in a prokaryotic or eukaryotic cell. Usually, the DNA constructs will be suitable for autonomous replication in a unicellular host, such as yeast or bacteria, but may also be intended for introduction to and integration within the genome of a cultured insect, mammalian, plant, or other eukaryotic cell lines.

[0173] The aptamer sequences of the present invention may also be produced by chemical synthesis, e.g., by the phosphoramidite method or the tri-ester method and may be performed on commercial automated oligonucleotide synthesisers. A double-stranded fragment may be obtained from the single stranded product of chemical synthesis either by synthesising the complementary strand and annealing the strand together under appropriate conditions or by adding the complementary strand using DNA polymerase with an appropriate primer sequence.

[0174] The terms "decrease", "reduce", "reduction", or "inhibit" are all used herein to mean a decrease by a statistically significant amount. The terms "reduce," "reduction" or "decrease" or "inhibit" typically means a decrease by at least 10% as compared to a reference level (e.g. the absence of a given treatment) and can include, for example, a decrease by at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99% , or more. As used herein, "reduction" or "inhibition" encompasses a complete inhibition or reduction as compared to a reference level. "Complete inhibition" is a 100% inhibition (i.e. , abrogation) as compared to a reference level.

[0175] The terms "increased", "increase", "enhance", or "activate" are all used herein to mean an increase by a statically significant amount. The terms "increased", "increase", "enhance", or "activate" can mean an increase of at least 25%, at least 50% as compared to a reference level, for example an increase of at least about 50%, or at least about 75%, or at least about 80%, or at least about 90%, at least about 95%, or at least about 98%, or at least about 99%, or at least about 100%, or at least about 250% or more compared with a reference level, or at least about a 1.5-fold, or at least about a 2-fold, or at least about a 2.5- fold, or at least about a 3-fold, or at least about a 4-fold, or at least about a 5-fold or at least about a 10-fold increase, or any increase between 1.5-fold and 10-fold or greater as compared to a reference level.

[0176] The terms "individual”, "subject”, and "patient”, are used interchangeably herein to refer to a mammalian subject for whom diagnosis, prognosis, disease monitoring, treatment, therapy, and / or therapy optimisation is desired. The mammal can be (without limitation) a human, non-human primate, mouse, rat, dog, cat, horse, or cow. In some preferred embodiments, the individual, subject, or patient is a human. An “individual” may be an adult, juvenile or infant. An “individual” may be male or female.

[0177] A "subject in need" of treatment for a particular condition can be an individual having that condition, diagnosed as having that condition, or at risk of developing that condition.

[0178] A subject can be one who has been previously diagnosed with or identified as suffering from or having a condition in need of treatment or one or more complications or symptoms related to such a condition, and optionally, have already undergone treatment for a condition as defined herein or the one or more complications or symptoms related to said condition. Alternatively, a subject can also be one who has not been previously diagnosed as having a condition as defined herein or one or more or symptoms or complications related to said condition. For example, a subject can be one who exhibits one or more risk factors for a condition, or one or more or symptoms or complications related to said condition or a subject who does not exhibit risk factors.

[0179] As used herein, the term “healthy individual” refers to an individual or group of individuals who are in a healthy state, e.g. individuals who have not shown any symptoms of the disease, have not been diagnosed with the disease and / or are not likely to develop the disease e.g. a viral infection. Preferably said healthy individual(s) is not on antiviral medication and has not been diagnosed with any other disease. The one or more healthy individuals may have a similar sex, age, and / or body mass index (BMI) as compared with the test individual. Application of standard statistical methods used in medicine permits determination of normal levels of expression in healthy individuals, and significant deviations from such normal levels.

[0180] Herein the terms “control” and “reference population” are used interchangeably.

[0181] The term “pharmaceutically acceptable” as used herein means approved by a regulatory agency of the Federal or a state government, or listed in the U.S. Pharmacopeia, European Pharmacopeia or other generally recognized pharmacopeia.

[0182] As used herein, the term “sample” refers to a sample of biological materials (cells, tissue, fluid, etc.) obtained from an individual. The sample may be any suitable biological material, for example blood, plasma, saliva, serum, sputum, urine, joint fluid, cerebral spinal fluid (CSF), synovial fluid, cells, a cellular extract, a tissue sample, a tissue biopsy, lymph, milk, pleural effusion, tissue infiltration, and stool sample and the like. Typically, the sample may be serum, plasma, CSF or urine. The precise biological sample that is taken from the individual may vary, but the sampling preferably is minimally invasive and is easily performed by conventional techniques.

[0183] The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that such publications constitute prior art to the claims appended hereto. All documents cited herein are each entirely incorporated by reference herein, including all data, tables, figures, and text presented in the cited documents.

[0184] Ensembles

[0185] As illustrated herein in more detail, an ensemble comprising a “sentry nanite”, at least one “stabiliser nanite”, and at least one “signaller nanite” may be used to detect a target biomarker. FIG. 1 shows a representative sentry nanite (top left), stabiliser nanite (top centre), signaller nanite (top right) and a target biomarker (bottom). The “sentry nanite” comprises a plurality of first aptamer sequences that are bound to a support in particle form, and the plurality of first aptamer sequences are adapted for hybridisation with the target biomarker. The at least one “stabiliser nanite” comprises a second aptamer sequence adapted for hybridisation with the target biomarker and a third aptamer sequence. The at least one “signaller nanite” comprises a third aptamer sequence adapted for hybridisation with the second aptamer sequence, and the third aptamer sequence comprises a first label.

[0186] At its heart, the ensemble described herein can detect a target biomarker and this is achieved via a cooperative hybridisation mechanism between the sentry, stabiliser, and signaller nanites and the target biomarker. An illustrative example of the ensemble in the presence of a target biomarker is shown in FIG. 4. In FIG. 4iii and iv, the sentry nanite contacts the target biomarker and the first aptamer sequence of the sentry nanite hybridises with the target biomarker. After the biomarker and first aptamer sequence have hybridised, the stabiliser nanite second aptamer sequence preferentially hybridises with part of the target biomarker that has not already hybridised with the first aptamer sequence. Thermodynamically, hybridisation of the second aptamer sequence with the sentrybiomarker adduct is preferred to intramolecular self-hybridisation. After the second aptamer sequence has hybridised with the sentry-biomarker adduct, the signaller nanite third aptamer sequence preferentially hybridises with part of the second aptamer sequence that has not already hybridised with the target biomarker (FIG. 4vi). Thermodynamically, hybridisation of the third aptamer sequence with the stabiliser-sentry-biomarker adduct is preferred to intramolecular self-hybridisation. Advantageously, the third aptamer sequence of the adduct may further hybridise with a copy of the second aptamer sequence. For the avoidance of any doubt, this means that the third aptamer sequence is simultaneously hybridised to two copies of the second aptamer sequence. The stabiliser-signaller chain may grow further with the addition of a copy of the third aptamer sequence, and so on, and this is discussed in more detail herein.

[0187] As stated above, the third aptamer sequence comprises a first label, e.g. a fluorophore. The formation of the signaller-stabiliser-sentry-biomarker conjugate enables the detection of the target biomarker because the fluorophore may be visualised using a number of different techniques. Further, the use of the particle support within the structure of the sentry nanite enables separation of the signaller-stabiliser-sentry-biomarker conjugate from excess signaller nanite (also comprising the label). More detail regarding the advantageous methods of use of the ensemble is provided herein.

[0188] A person of ordinary skill in the art will readily appreciate that the above-described mechanism is simply illustrative and that many different variations and pathways are possible.

[0189] Accordingly, the invention provides an ensemble for detecting a target biomarker, the ensemble comprising: A) a “sentry nanite” comprising a plurality of first aptamer sequences bound to a support in particle form, wherein the plurality of first aptamer sequences are adapted for hybridisation with a target biomarker;

[0190] B) at least one “stabiliser nanite” comprising a second aptamer sequence adapted for hybridisation with the target biomarker and a third aptamer sequence; and

[0191] C) at least one “signaller nanite” comprising a third aptamer sequence adapted for hybridisation with the second aptamer sequence, wherein the third aptamer sequence comprises a first label.

[0192] As shown in FIG. 4vi, the third aptamer sequence of the adduct may further hybridise with a copy of the second aptamer sequence. The stabiliser-signaller chain may grow further with the addition of a copy of the third aptamer sequence, and so on. As such, it is advantageous that the second aptamer sequence is capable of simultaneously hybridising with: (i) both the target biomarker and the third aptamer sequence; and (ii) two copies of the third aptamer sequence. Alternatively or in addition, the third aptamer sequence is capable of simultaneously hybridising with two copies of the second aptamer sequence. Alternatively or in addition, the first aptamer sequence should not be capable of hybridising with the second aptamer sequence or the third aptamer sequence because otherwise this could result in an extended adduct forming in the absence of a target biomarker.

[0193] Conceptually, the first, second, and third aptamer sequences, in addition to the target biomarker, may be divided into different regions or “domains”. Different domains may have different roles within the ensemble defined herein. For example, toehold domains may usefully be incorporated within the structure of the first and / or second and / or third aptamer sequences. These toehold domains increase the ease with which hybridisation occurs between different hybridising partners. For example, the second aptamer sequence may comprise a first toehold domain which is capable of hybridising with the target biomarker and is capable of hybridising with the third aptamer sequence. Alternatively or in addition, the third aptamer sequence may comprise a second toehold domain which is capable of hybridising with the second aptamer sequence. Alternatively or in addition, the first aptamer sequence comprises a third toehold domain which is capable of hybridising with the target biomarker.

[0194] A trigger domain may be released upon hybridisation of two aptamer sequences by a competitive hybridisation process. For example, the second aptamer sequence may be adapted to release a first trigger domain on hybridisation of the second aptamer sequence to the target biomarker or the third aptamer sequence, wherein the release is by competitive hybridisation. Alternatively or in addition, the first trigger domain may be capable of hybridising with the second toehold domain of the third aptamer sequence. The release of the first trigger domain is advantageous because this permits (further) hybridisation between the second aptamer sequence and (copies of) the third aptamer sequence, and thus facilitates elongation of the growing chain. As a consequence of the release of the first trigger domain by competitive hybridisation, the third aptamer sequence (via the second toehold domain) is able to hybridise to the second aptamer sequence (via the first trigger domain).

[0195] Similarly, the third aptamer sequence may be adapted to release a second trigger domain on hybridisation of the third aptamer sequence to the second aptamer sequence, wherein the release is by competitive hybridisation. Alternatively or in addition, the second trigger domain may be capable of hybridising with a second (or further) copy of the second aptamer sequence.

[0196] The first and / or second and / or third toehold domain may consist of a nucleotide sequence that is greater than or equal to 3 nucleotides, greater than or equal to 4 nucleotides, greater than or equal to 5 nucleotides, greater than or equal to 6 nucleotides, greater than or equal to 7 nucleotides, greater than or equal to 8 nucleotides, greater than or equal to 9 nucleotides, or greater than or equal to 10 nucleotides in length. The first and / or second and / or third toehold domain may consist of a nucleotide sequence that is 3 nucleotides, 4 nucleotides, 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, or 10 nucleotides in length. The length of the first, second and third toehold domains may be selected independently from each other.

[0197] Preferably, the first toehold domain consists of a nucleotide sequence that is greater than or equal to 6 nucleotides in length, for example between 6 and 8 nucleotides in length. Alternatively or additionally, the second toehold domain may consist of a nucleotide sequence that is greater than or equal to 6 nucleotides in length, for example between 6 and 8 nucleotides in length. Alternatively or additionally, the third toehold domain may consist of a nucleotide sequence that is greater than or equal to 6 nucleotides in length, for example between 6 and 8 nucleotides in length.

[0198] For ease of reference, the domains of the first, second, and third aptamer sequences, in addition to the target biomarker, may be assigned letters (reference characters). By way of illustration, FIG. 1 shows the “a” domains of the first aptamer sequences of an example sentry nanite (top left), the “b”, “c”, “d”, and “c*” domains of the second aptamer sequence of an example stabiliser nanite (top centre), the “d*”, “c”, “b*”, and “c*” domains of the third aptamer sequence of an example signaller nanite (top right) and the “a*”, “b*”, and “c*” domains of an example target biomarker (bottom). By the convention used herein, domains of a particular letter are adapted for hybridising with domains marked with the same letter and an asterisk (*). For example, a domain marked “a” is adapted for hybridisation with a domain “a*”.

[0199] Optionally, the ensemble defined herein is provided wherein: A) the first aptamer sequence comprises a domain “a” which is adapted for hybridisation to a domain “a*” of the target biomarker;

[0200] B) the second aptamer sequence comprises: a) a first toehold domain “b” which is adapted for hybridisation to a domain “b*” of the target biomarker; b) a domain “c” which is adapted for hybridisation to a domain “c*” of the third aptamer sequence and a domain “c*” of the target biomarker; c) a domain “c*” which is adapted for hybridisation to a domain “c” of the third aptamer sequence; and d) a first non-complementary loop structure “d” which is adapted for hybridisation to a second toehold domain “d*” of the third aptamer sequence; whereby hybridisation of the first toehold domain “b” of the second aptamer sequence to domain “b*” of the target biomarker releases the first trigger domain; wherein the release is by competitive hybridisation and the first trigger domain comprises domain “c*” and preferably further comprises domain “d”; and

[0201] C) the third aptamer sequence comprises: a) a second toehold domain “d*” which is which is adapted for hybridisation to a domain “d” of the second aptamer; b) a domain “c” which is adapted for hybridisation to domain “c*” of the second aptamer sequence and domain “c*” of the target biomarker; c) a domain “c*” which is adapted for hybridisation to domain “c” of the second aptamer sequence; and d) a second non-complementary loop structure “b*” which is adapted for hybridisation to a first toehold domain “b” of the second aptamer sequence; whereby hybridisation of domain “d*” of the third aptamer sequence to domain “d” of the second aptamer sequence releases the second trigger domain, wherein the release is by competitive hybridisation and the second trigger domain comprises domain “c” and preferably further comprises domain “b*”.

[0202] As discussed above, the domains of the first, second, and / or third aptamer sequences defined herein may comprise one or more single-stranded regions (also referred to as “loops” or “non-complementary loops”) and / or one or more double-stranded regions (also referred to as “stems” or “complementary stem structures”). A single-stranded aptamer may comprise regions of nucleotide sequences which are reverse complementary to each other, such that when the aptamer adopts a particular conformation, those regions of nucleotide sequences are brought into proximity and form a double-stranded region. Intervening regions of nucleotide sequences without a reverse complementary nucleotide sequence form loops. These structures are referred to in the art as “stem-loop” structures, “hairpins” or “hairpin loops”.

[0203] Advantageously, the incorporation of at least one non-complementary structure, for example a loop, has the effect of fine tuning the binding of the aptamer sequence to itself (intramolecular binding) relative to the strength of intermolecular binding interactions e.g. those between the first aptamer sequence and the target biomarker. The inclusion of non- complementary structures reduces the energy barrier for the aptamer sequence to rehybridize from intramolecular binding to intermolecular binding, so the energetic driving force to bind in an intermolecular way (i.e. to form an extended adduct) is increased, and so too is the binding affinity.

[0204] The first, second, and / or third aptamer sequences may comprise one, two, three, or four non-complementary loop structures. In preferred embodiments, the first, second, and / or third aptamer sequences comprise a non-complementary loop structure.

[0205] The one or more non-complementary loop structures may be at least about a 1 base, at least about a 2 base, at least about a 3 base, at least about a 4 base, at least about a 5 base, at least about a 6 base, at least about a 7 base, at least about an 8 base, at least about a 9 base, or at least about a 10 base non-complementary loop structure. The one or more complementary stem structures may be at least about a 3 base, at least about a 4 base, at least about a 5 base, at least about a 6 base, at least about a 7 base, or at least about an 8 base complementary stem structure.

[0206] The one or more non-complementary loop structures may be about a 1 base, about a 2 base, about a 3 base, about a 4 base, about a 5 base, about a 6 base, about a 7 base, about an 8 base, about a 9 base, or about a 10 base non-complementary loop structure. Preferably the one or more non-complementary loop structures are from about 6 bases to about 8 bases in length, more preferably wherein the one or more non-complementary loop structures are about 6 bases or about 8 bases in length. The one or more complementary stem structures may be about a 3 base, about a 4 base, about a 5 base, about a 6 base, about a 7 base, or about an 8 base complementary stem structure. Preferably, the one or more complementary stem structures are shorter than the one or more non-complementary loop structures.

[0207] Where an aptamer of the invention comprises two or more non-complementary loop structures, the length of each non-complementary loop structures may be independent of the length of the other non-complementary loop structures. Thus, the length of a non- complementary loop structure within the first and / or second and / or third aptamer sequence may be the same as or different from the length of any other non-complementary loop structure within said aptamer sequence. By way of non-limiting example, if an aptamer comprises a first non-complementary loop structure which is a 4 base loop, it may comprise a second non-complementary loop structure which is an 8 base loop.

[0208] Accordingly, the first and / or second and / or third aptamer sequence may comprise at least one, at least two, at least three, at least four, or at least five hair-pin structures. In preferred embodiments, the first and / or second and / or third aptamer sequence comprise one hair-pin structure.

[0209] The ensemble defined herein may be provided wherein:

[0210] A) the sentry nanite plurality of first aptamer sequences comprise one or more non- complementary loop structures and one or more complementary stem structures, preferably wherein the one or more non-complementary loop structures are from about 6 bases to about 8 bases in length, more preferably wherein the one or more non-complementary loop structures are about 6 bases or about 8 bases in length, optionally wherein the one or more complementary stem structures are shorter than the one or more non-complementary loop structures; and / or

[0211] B) the stabiliser nanite second aptamer sequence comprises one or more non- complementary loop structures and one or more complementary stem structures, preferably wherein the one or more non-complementary loop structures are from about 6 bases to about 8 bases in length, more preferably wherein the one or more non-complementary loop structures are about 6 bases or about 8 bases in length, optionally wherein the one or more complementary stem structures are longer than the one or more non-complementary loop structures; and / or

[0212] C) the signaller nanite third aptamer sequence comprises one or more non- complementary loop structures and one or more complementary stem structures, preferably wherein the one or more non-complementary loop structures are from about 6 bases to about 8 bases in length, more preferably wherein the one or more non-complementary loop structures are about 6 bases or about 8 bases in length, optionally wherein the one or more complementary stem structures are longer than the one or more non-complementary loop structures.

[0213] As described herein, by way of illustration, FIG. 1 shows the “a” domains of the first aptamer sequences of an example sentry nanite (top left), the “b”, “c”, “d”, and “c*” domains of the second aptamer sequence of an example stabiliser nanite (top centre), the “d*”, “c”, “b*”, and “c*” domains of the third aptamer sequence of an example signaller nanite (top right) and the “a*”, “b*”, and “c*” domains of an example target biomarker (bottom).

[0214] The domain “a” of the first aptamer sequence may consist of a nucleotide sequence that is greater than about 15 nucleotides, greater than about 16 nucleotides, greater than about 17 nucleotides, greater than about 18 nucleotides, greater than about 19 nucleotides, greater than about 20 nucleotides, greater than about 21 nucleotides, greater than about 22 nucleotides, greater than about 23 nucleotides, greater than about 24 nucleotides, greater than about 25 nucleotides, greater than about 26 nucleotides, greater than about 27 nucleotides, greater than about 28 nucleotides, greater than about 29 nucleotides, greater than about 30 nucleotides, greater than about 31 nucleotides, greater than about 32 nucleotides, greater than about 33 nucleotides, greater than about 34 nucleotides, greater than about 35 nucleotides, greater than about 36 nucleotides, greater than about 37 nucleotides, greater than about 38 nucleotides, greater than about 39 nucleotides, greater than about 40 nucleotides, greater than about 41 nucleotides, greater than about 42 nucleotides, greater than about 43 nucleotides, greater than about 44 nucleotides, greater than about 45 nucleotides, greater than about 46 nucleotides, greater than about 47 nucleotides, greater than about 48 nucleotides, greater than about 49 nucleotides, or greater than about 50 nucleotides in length.

[0215] The domain “a” of the first aptamer sequence may consist of a nucleotide sequence that is from about 10 to about 60 nucleotides, from about 12 to about 58 nucleotides, from about 14 to about 56 nucleotides, from about 16 to about 54 nucleotides, from about 18 to about 52 nucleotides, from about 20 to about 50 nucleotides in length, from about 22 to about 50 nucleotides in length, from about 24 to about 50 nucleotides in length, from about 26 to about 50 nucleotides in length, from about 28 to about 50 nucleotides in length, from about 30 to about 50 nucleotides in length, from about 32 to about 50 nucleotides in length, from about 34 to about 50 nucleotides in length, from about 36 to about 50 nucleotides in length, from about 38 to about 50 nucleotides in length, from about 40 to about 50 nucleotides in length, from about 40 to about 48 nucleotides in length, from about 42 to about 48 nucleotides in length, or from about 44 to about 46 nucleotides in length, e.g., about 45 nucleotides in length.

[0216] In some embodiments, the domain “a” of the first aptamer sequence consists of a nucleotide sequence that is greater than about 15 nucleotides in length, preferably wherein the nucleotide sequence is from about 20 to about 50 nucleotides in length, e.g., about 45 nucleotides in length.

[0217] The “a” domain of the first aptamer sequence may consist of a nucleotide sequence that does not have more than 8, does not have more than 7, does not have more than 6, does not have more than 5, or does not have more than 4 consecutive nucleotides which are complementary with the same number of consecutive nucleotides in the “b”, “c”, “d”, and / or “c*” domains of the second aptamer sequence and / or the “d*”, “c”, “b*”, and / or “c*” domains of the third aptamer sequence. Optionally, the “a” domain of the first aptamer sequence consists of a nucleotide sequence that does not have more than 4 consecutive nucleotides which are complementary with 4 consecutive nucleotides in the “b”, “c”, “d”, and / or “c*” domains of the second aptamer sequence and / or the “d*”, “c”, “b*”, and / or “c*” domains of the third aptamer sequence.

[0218] The “a” domain of the first aptamer sequence may consist of a nucleotide sequence that is linear, i.e. it is not self-complementary.

[0219] The stabiliser second aptamer sequence may consist of a nucleotide sequence that is greater than or equal to 18 nucleotides in length, greater than or equal to 20 nucleotides in length, greater than or equal to 22 nucleotides in length, greater than or equal to 24 nucleotides in length, greater than or equal to 26 nucleotides in length, greater than or equal to 28 nucleotides in length, greater than or equal to 30 nucleotides in length, greater than or equal to 32 nucleotides in length, greater than or equal to 34 nucleotides in length, greater than or equal to 36 nucleotides in length, greater than or equal to 38 nucleotides in length, greater than or equal to 40 nucleotides in length, greater than or equal to 42 nucleotides in length, greater than or equal to 44 nucleotides in length, greater than or equal to 48 nucleotides in length, or greater than or equal to 50 nucleotides in length.

[0220] Optionally, the ensemble defined herein is provided wherein the stabiliser second aptamer sequence consists of a nucleotide sequence that is greater than or equal to 12 nucleotides in length, preferably greater than or equal to 18 nucleotides in length, for example between 18 and 20 nucleotides in length.

[0221] The ensemble defined herein may be provided wherein the second aptamer sequence comprises domains “b”, “c”, “d”, and “c*” arranged in this order, preferably arranged in this order from the 5’ to the 3’ end. Alternatively or in addition, the third aptamer sequence may comprises domains “d*”, “c”, “b*”, and “c*” arranged in this order, preferably arranged in this order from the 3’ to the 5’ end. For reference, FIG. 4 shows these preferred arrangements of the domains present in the second and third aptamer sequences.

[0222] The b domain of the second aptamer sequence may consist of a nucleotide sequence that has less than 40%, less than 35%, less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, or less than 5% G- and / or C-containing nucleotides. Optionally, the b domain of the second aptamer sequence may consist of a nucleotide sequence that has less than 40% G- and / or C-containing nucleotides.

[0223] The c domain of the second aptamer sequence may consist of a nucleotide sequence that has less than 40%, less than 35%, less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, or less than 5% G- and / or C-containing nucleotides. Optionally, the c domain of the second aptamer sequence may consist of a nucleotide sequence that has less than 40% G- and / or C-containing nucleotides.

[0224] The c domain of the second aptamer sequence may consist of a nucleotide sequence that is at least 10, at least 11 , at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 nucleotides in length. Optionally, the c domain of the second aptamer sequence consists of a nucleotide sequence that is at least 10 nucleotides in length.

[0225] The c domain of the second aptamer sequence may consist of a nucleotide sequence that is between 12 and 50, between 12 and 45, between 12 and 40, between 12 and 35, between 12 and 30 nucleotides in length, e.g. 17 nucleotides. Optionally, the c domain of the second aptamer sequence consists of a nucleotide sequence that is at least 10 nucleotides in length, preferably between 12 and 30 nucleotides, for example 17 nucleotides.

[0226] The d domain of the second aptamer sequence may consist of a nucleotide sequence that is about 6 bases to about 8 bases in length, preferably wherein the one or more non-complementary loop structures are about 6 bases or about 8 bases in length.

[0227] The d domain of the second aptamer sequence may consist of a nucleotide sequence that differs from the length of the “b” domain by less than 10, less than 9, less than

[0228] 8, less than 7, less than 6, less than 5, less than 4, less than 3, less than 2, less than 1, or by 0 nucleotides. Optionally, the d domain of the second aptamer sequence may consist of a nucleotide sequence that differs from the length of the “b” domain by less than 5, preferably less than 3, more preferably less than 1 , yet more preferably 0 nucleotides.

[0229] The d domain of the second aptamer sequence may consist of a nucleotide sequence that is not self-complementary, preferably wherein it does not have more than 10,

[0230] 9, 8, 7, 6, 5, 4, 3, or 2 consecutive nucleotides which are complementary with the same number of consecutive nucleotides elsewhere in the “d” domain. Optionally, the d domain of the second aptamer sequence consists of a nucleotide sequence that is not self- complementary, preferably wherein it does not have more than 6, preferably not more than 4, yet more preferably not more than 2 consecutive nucleotides which are complementary with the same number of consecutive nucleotides elsewhere in the “d” domain.

[0231] The d domain of the second aptamer sequence may consist of a nucleotide sequence that differs from the length of the “d*” domain by less than 10, less than 9, less than 8, less than 7, less than 6, less than 5, less than 4, less than 3, less than 2, less than 1 , or by 0 nucleotides. Optionally, the d domain of the second aptamer sequence consists of a nucleotide sequence that differs from the length of the “d*” domain by less than 5, preferably less than 3, more preferably less than 1 , yet more preferably 0 nucleotides.

[0232] The b* domain of the second aptamer sequence may consist of a nucleotide sequence that is about 6 bases to about 8 bases in length, preferably wherein the one or more non-complementary loop structures are about 6 bases or about 8 bases in length.

[0233] The b* domain of the second aptamer sequence may consist of a nucleotide sequence that is not self-complementary, preferably wherein it does not have more than 10, 9, 8, 7, 6, 5, 4, 3, or 2 consecutive nucleotides which are complementary with the same number of consecutive nucleotides elsewhere in the “b*” domain. Optionally, the b* domain of the second aptamer sequence may consist of a nucleotide sequence that is not self- complementary, preferably wherein it does not have more than 6, preferably not more than 4, yet more preferably not more than 2 consecutive nucleotides which are complementary with the same number of consecutive nucleotides elsewhere in the “b*” domain.

[0234] The b* domain of the second aptamer sequence may consist of a nucleotide sequence that differs from the length of the “b” domain by less than 10, less than 9, less than 8, less than 7, less than 6, less than 5, less than 4, less than 3, less than 2, less than 1, or by 0 nucleotides. Optionally, the b* domain of the second aptamer sequence consists of a nucleotide sequence that differs from the length of the “b” domain by less than 5, preferably less than 3, more preferably less than 1 , yet more preferably 0 nucleotides.

[0235] The b* domain of the second aptamer sequence may consist of a nucleotide sequence that is located adjacent to the “c*” domain of the third aptamer sequence with no intervening nucleotides.

[0236] The “b” domain of the third aptamer sequence may consist of a nucleotide sequence that has less than 40%, less than 35%, less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, or less than 5% G- and / or C-containing nucleotides. Optionally, the “b” domain of the second aptamer sequence may consist of a nucleotide sequence that has less than 40% G- and / or C-containing nucleotides.

[0237] The ensemble defined herein is provided wherein the first, second, and third aptamer sequences comprise ribonucleosides (i.e. be an RNA oligonucleotide), deoxyribonucleosides (i.e. be a DNA oligonucleotide), or a combination thereof. Alternatively or in addition, an aptamer of the invention may comprise one or more nucleic acid analogue. Preferably, the ensemble defined herein is provided wherein the first, second, and third aptamer sequences are nucleic acid aptamer sequences, e.g. DNA aptamer sequences.

[0238] The invention also provides the sentry nanite, the stabiliser nanite, and / or the signaller nanite as defined herein.

[0239] Mismatches

[0240] As described herein, the first and / or second and / or third aptamer sequences may comprise one or more nucleotide base mismatches. The number of mismatches in each of the first and / or second and / or third aptamer sequences may be selected independently. Advantageously, the incorporation of one or more nucleotide base mismatches enables fine tuning of the properties of the aptamer sequences. For example, the incorporation of one or more nucleotide base mismatches within the first and / or second and / or third aptamer sequences results in decreased self-binding. Depending on the context, i.e. the specific target biomarker of interest, it may be desirable to reduce self-binding (intramolecular interactions) between the first and / or second and / or third aptamer sequences, and therefore increase the relative strength of intermolecular interactions e.g. those between the first aptamer sequence and the target biomarker. Incorporation of one or more nucleotide base mismatches may also reduce the strength of intermolecular interactions between e.g. the stabiliser second aptamer sequence and the signaller third aptamer sequence. This can be particularly useful in reducing the ability of the stabiliser and signaller to concatenate.

[0241] In some embodiments, the one or more nucleotide base mismatches are intramolecular mismatches. In other embodiments, the one or more nucleotide base mismatches are intermolecular mismatches e.g. mismatches between otherwise complementary domains of the stabiliser and signaller.

[0242] It is particularly advantageous for the one or more nucleotide base mismatches to be located in the one or more complementary stem structures of the first and / or second and / or third aptamer sequences. For example, the one or more complementary stem structures of the first and / or second and / or third aptamer sequences may comprise from about 1 , about 2, about 3, about 4, or about 5 nucleotide base mismatches. Preferably, the one or more nucleotide base mismatches are present within 5, within 4, within 3, within 2, within 1 nucleotide of the 5’ and / or 3’ end of one or more non-complementary loop structures.

[0243] The ensemble defined herein may be provided wherein the one or more complementary stem structures of the first and / or second and / or third aptamer sequences comprise one or more nucleotide base mismatches, optionally wherein:

[0244] A) the one or more complementary stem structures of the first and / or second and / or third aptamer sequences comprises from about 1 to about 5 nucleotide base mismatches;

[0245] B) the one or more nucleotide base mismatches are present within 5, preferably within 3, more preferably within 1 nucleotide of the 5’ and / or 3’ end of one or more non- complementary loop structures.

[0246] The sentry support

[0247] Advantageously, the sentry nanites of the invention comprise a support in particle form. The support performs several beneficial functions. First, the support provides a surface to which the plurality of first aptamer sequences may be attached. Second, the support, by virtue of its mass (alternatively or in addition, its magnetic properties), enables a straightforward separation of the conjugates formed after the ensemble is contacted with a target biomarker from e.g. excess stabiliser and signaller nanite, and any other impurities in the sample e.g. other biomarkers that are not of interest.

[0248] The particle form of the support is particularly beneficial because this enables the concentration of sentry nanites to be easily varied depending on the application. This is a clear advantage over e.g. a plurality of first aptamer sequences attached to a planar surface. The support in particle form may be substantially spherical or spherical. A spherical support results in optimal distribution of the plurality of first aptamer sequences on the surface of the sentry nanite, resulting in increased homogeneity within the sentry nanite in isolation, and also within the ensemble in combination with a target biomarker, i.e. the conjugate described herein.

[0249] The support may comprise silica, e.g. it may consist of silica. Silica is conveniently used in the support as it is biocompatible and readily available. Further, silica is commercially available with a range of different properties e.g. size. As a person of ordinary skill in the art will appreciate, a wide range of different materials may be used as alternatives to silica.

[0250] The support may comprise or consist of one or more ferromagnetic metals, compounds thereof, or alloys thereof. Advantageously, the incorporation of ferromagnetic metals, compounds thereof, or alloys thereof within the structure of the sentry nanites results in the sentry nanites (and therefore any conjugate that forms from their contact as part of the ensemble with a target biomarker) having magnetic properties. As described herein, a magnetic support enables a straightforward separation of the conjugates formed after the ensemble is contacted with a target biomarker from e.g. excess stabiliser and signaller nanite, and any other impurities in the sample e.g. other biomarkers that are not of interest. The one or more ferromagnetic metals, compounds thereof, or alloys thereof, may be selected from iron, cobalt, nickel, steel, stainless steel, hematite, and magnetite (FesC ), preferably magnetite. Alternatively or additionally, the one or more ferromagnetic metals, compounds thereof, or alloys thereof, may be encapsulated by the support material. Alternatively or additionally, the one or more ferromagnetic metals, compounds thereof, or alloys thereof, may be present as a dispersion throughout the support, preferably as a microcrystalline dispersion, more preferably as a microcrystalline magnetite dispersion, most preferably as about a 20% microcrystalline magnetite dispersion.

[0251] The support may be in the form of microparticles. Alternatively, the support may be in the form of nanoparticles.

[0252] The z-average mean diameter of the support may be from 1 to 1000 nm, from 1 to 900 nm, from 5 to 800 nm, from 10 to 700 nm, from 20 to 600 nm, from 30 to 500 nm, from 40 to 400 nm, from 60 to 300 nm, from 80 to 250 nm, from 100 to 200 nm, as measured by dynamic light scattering.

[0253] The support may comprise a polymer coating. The polymer coating is advantageously biocompatible. The polymer coating may be a functionalised polymer coating. Preferentially, the polymer coating is functionalised such that attachment to the plurality of first aptamer sequences is possible by covalent means. The functionalisation could be with a number of different groups, or protected versions thereof as will be known to those of ordinary skill in the art. Preferably, the polymer coating is functionalised with free carboxylic acid groups. The polymer coating may be a synthetic polymer. The polymer maybe linear or branched. The polymer coating may comprise or consist of one or more of (poly)methacrylic acid (PMAA), carboxylated polyvinyl alcohol, polylactic acid, polyaspartate, polyglutamate, and polyacrylic acid. Preferably the polymer coating is (poly)methacrylic acid (PMAA). In some embodiments, the polymer coating is a continuous film around the support. In alternative embodiments, the polymer coating is not a continuous film around the support, but is a "mesh" or "cloud" of extended polymer chains attached to and surrounding the support.

[0254] The plurality of first aptamer sequences may be bound to the support via the polymer coating, e.g., via a plurality of amide groups, preferably wherein the polymer coating is a surface polymer coating comprising carboxylic acid functional groups, e.g., (poly)methacrylic acid (PMAA).

[0255] Labels

[0256] As described herein, the third aptamer sequence comprises a first label. Alternatively or in addition, the stabiliser nanite may comprise a second label. Alternatively or in addition, the sentry nanite may comprise a third label and / or a fourth label. The use of labels in the aptamer sequences of the invention is beneficial because the labels allow the identification (and quantification) of ensemble-biomarker complexes. The presence (and amount) of a target biomarker may therefore be determined using the ensembles of the invention. In particular, due to the aptamer chains extending from the sentry nanite (formed by hybridisation between copies of stabiliser and signaller nanites), the signal resulting from any label(s) present within the structure of the complex will be increased. This is particularly useful because it increases the sensitivity of the method.

[0257] It is within the routine practice of one of ordinary skill in the art to select a suitable label for use with an aptamer sequence or sentry nanite of the invention. Non-limiting examples are described herein. The labels may be selected from a fluorescent label (a fluorophore), an enzyme, a chemiluminescent label, a bioluminescent label, a redox active label, a luminescence label, a radioactivity label, and a dye.

[0258] Preferably, the first label, second label (if present), and third label (if present), are fluorophores. Non-limiting examples of fluorophores include: 5-(and 6)-carboxyfluorescein, 5-or 6-carboxyfluorescein, 6-(fluorescein)-5- (and 6)-carboxamido hexanoic acid, fluorescein isothiocyanate (FITC), rhodamine, tetramethylrhodamine, dyes such as Cy2, Cy3, and Cy5, optionally substituted coumarin including AMCA, PerCP, Texas Red, phycobiliproteins including R-phycoerythrin (RPE) and allophycoerythrin (APC), Princeton Red, Green fluorescent protein (GFP) and analogues thereof, and conjugates of R-phycoerythrin or allophycoerythrin and e. g. Cy5 or Texas Red, and inorganic fluorophores based on semiconductor nanocrystals (like quantum dot and nanocrystals), and time-resolved fluorophores based on lanthanides like Eu3+and Sm3+, haptens such as DNP, biotin, and digoxiginin, enzymatic labels such as horseradish peroxidase (HRP), alkaline phosphatase (AP), beta-galactosidase (GAL), glucose-6-phosphate dehydrogenase, beta-N- acetylglucosaminidase, R-glucuronidase, invertase, Xanthine Oxidase, firefly luciferase and glucose oxidase (GO).

[0259] The fluorophore may be a simple fluorophore selected from: 4',6-diamidino-2- phenylindole (DAPI), Fluor dyes, Pacific Blue™, Pacific Orange™, Cascade Yellow™, AlexaFluor®(AF), AF405, AF488, AF500, AF514, AF532, AF546, AF555, AF568, AF594, AF610, AF633, AF635, AF647, AF680, AF700, AF710, AF750, AF800, Quantum Dot based dyes, QDot® Nanocrystals, Qdot®525, Qdot®565, Qdot®585, Qdot®605, Qdot®655, Qdot®705, Qdot®800, DyLight™ Dyes (Pierce) (DL), DL549, DL649, DL680, DL800, fluorescein (Flu) or a derivate thereof, Cy-Dyes, Cy2, Cy3, Cy3.5, Cy5, Cy5.5, Cy7, 5,6,7- trimethyl-1 ,8-naphthyridin-2-amine (ATMND), thiazole orange, fluorescent proteins, RPE, PerCp, APC, green fluorescent proteins, GFP and GFP derived mutant proteins, BFP, CFP, YFP, DsRed, T1 , Dimer2, mRFP1 , MBanana, mOrange, dTomato, tdTomato, mTangerine, mStrawberry, mCherry, tandem dyes, RPE-Cy5, RPE-Cy5.5, RPE-Cy7, RPE-AlexaFluor® tandem conjugates; RPE-Alexa610, RPE-TxRed, APC-Aleca600, APC-Alexa610, APC- Alexa750, APC-Cy5, APC-Cy5.5, multi fluorochrome assemblies, multiple fluorochromes attached to a polymer molecule, such as a peptide / protein, Dextran, polysaccharide.

[0260] Preferably, the fluorophore is independently selected from Cy3, 6-FAM (fluorescein), Cy5, 4',6-diamidino-2-phenylindole (DAPI), and a lanthanide or lanthanide complex e.g., Eu3+or a complex thereof.

[0261] The label may be a luminescence label. Non-limiting examples of luminescence labels include: luminol, isoluminol, acridinium esters, 1 ,2-dioxetanes, and pyridopyridazines.

[0262] The label may be a radiolabel. Non-limiting examples of radiolabels include: bromine77, carbon14, cobalt57, fluorine8, gallium67, gallium68, hydrogen3(tritium), indium111, indiurn113m, iodine123m, iodine125, iodine126, iodine131, iodine133, mercury107, mercury203, phosphorous32, rhenium99m, rhenium101, rhenium105, ruthenium95, ruthenium97, ruthenium103, ruthenium105, scandium47, selenium75, sulphur35, technetium99, technetium99m, tellurium121™ tellurium122™ tellurium125™, thulium165, thulium167, thulium168and yttrium199

[0263] The label may be a chemiluminescent label, for example a biochemiluminescent label.

[0264] The label may be a redox active label, for example ferrocene, ferricyanide, nicotinamide adenine dinucleotide (phosphate), diamines, phenanthroline, ruthenium (II), osmium (II), anthraquinone, quinone, phenothiazine, phenazine, phenoxazine, dichlorophenolindophenol tetrazolium dyes, phenylimino-benzophenoxazine, and derivatives thereof.

[0265] Other non-limiting examples of labels include particles, such as latex or carbon particles, metal sol, crystallite, liposomes, cells, etc., which may be further labelled with a dye, catalyst or other detectable group; molecules such as biotin, digoxygenin or 5- bromodeoxyuridine; toxin moieties, such as for example a toxin moiety selected from a group of Pseudomonas exotoxin (PE or a cytotoxic fragment or mutant thereof), Diptheria toxin or a cytotoxic fragment or mutant thereof, a Botulinum toxin A, B, C, D, E or F, ricin or a cytotoxic fragment thereof e.g. ricin A, abrin or a cytotoxic fragment thereof, saporin or a cytotoxic fragment thereof, pokeweed antiviral toxin or a cytotoxic fragment thereof and bryodin 1 or a cytotoxic fragment thereof.

[0266] Accordingly, the invention provides a binding member selected from an aptamer, an antibody or fragment thereof, a molecularly imprinted polymer (MIP), a small molecule, a peptide and a peptidomimetic; wherein said binding member is labelled, wherein optionally said label may be selected from a fluorescent label, an enzyme, a chemiluminescent label, a bioluminescent label, a redox active label and a dye.

[0267] Alternatively, any one or more of the first and / or second and / or third aptamer sequence and / or sentry nanite are not labelled. In such embodiments, a non-covalently bound dye may be employed, for example ThT, Cy5, Cy7, 5,6,7-trimethyl-1,8-naphthyridin-2- amine (ATMND), thiazole orange, SYBR green I, SYBR green II or SYBR gold.

[0268] The fourth label (if present), may be a dye, preferably wherein the dye is a fluorescent dye (i.e. a fluorophore), more preferably wherein the fluorescent dye is selected from (i) 4',6-diamidino-2-phenylindole (DAPI) or (ii) a lanthanide or lanthanide complex e.g., Eu3+or a complex thereof.

[0269] Optionally, the ensemble defined herein is provided wherein:

[0270] A) the first label is a fluorophore, preferably wherein the fluorophore is Cy3 or more preferably 6-FAM (fluorescein), e.g., 3’ 6-FAM; and / or

[0271] B) the stabiliser nanite comprises a second label, optionally wherein the label is a fluorophore, preferably wherein the fluorophore is Cy3, more preferably wherein the second fluorophore is 6-FAM (fluorescein), e.g., 5’ 6-FAM; and / or

[0272] C) the sentry nanite comprises a third label, optionally wherein the label is a fluorophore, preferably wherein the fluorophore is Cy5, e.g., 5’ Cy5; and / or

[0273] D) the sentry nanite comprises fourth label, optionally wherein the label is a dye, preferably wherein the dye is a fluorescent dye, more preferably wherein the fluorescent dye is selected from (i) 4',6-diamidino-2-phenylindole (DAPI) or (ii) a lanthanide or lanthanide complex e.g., Eu3+or a complex thereof. Advantageously, more than one type of label may be used in the ensemble, i.e. one or more of the first label, and / or second label (if present), and / or third label (if present), and / or fourth label (if present) may be different. The use of different types of label is beneficial because in addition to providing a means of quality control (e.g. if the first label is different to the fourth label), different samples may be analysed more accurately using certain labels (each of which has their own unique method of detection e.g. in the case of a fluorescent label, characteristic absorption wavelength(s)). Alternatively, or in addition, one or more of the labels in the ensemble may be the same.

[0274] Accordingly, the ensemble defined herein is provided wherein:

[0275] A) the third label is different to the first label and the second label; and / or

[0276] B) the first label and the second label are the same.

[0277] Advantageously, the sentry, stabiliser, and signaller nanites of the invention do not require the use of quenchers. Accordingly, the ensemble defined herein may be provided wherein the sentry nanite, stabiliser nanite, and / or the signaller nanite do not comprise a quencher. This is advantageous because it (i) simplifies the synthesis of the components of the ensemble; (ii) reduces costs; (iii) is more sustainable; and (iv) increases the flexibility of the system since specific labels do not need to be paired with appropriate quenchers. Alternatively, the ensemble defined herein may be provided wherein the sentry nanite, stabiliser nanite, and / or the signaller nanite do comprise a quencher.

[0278] The target biomarker

[0279] Similarly to the way in which the first, second, and third aptamer sequences may be conceptually divided into different regions or “domains”, the target biomarker may also be divided into different domains. The target biomarker which may be detected by the ensemble of the invention comprises domains a*, b*, and c*.

[0280] The a* domain of the target biomarker may consist of a nucleotide sequence that is greater than or equal to 30, greater than or equal to 32, greater than or equal to 34, greater than or equal to 36, greater than or equal to 38, greater than or equal to 40, greater than or equal to 42, greater than or equal to 44, greater than or equal to 46, greater than or equal to 48, or greater than or equal to 50 nucleotides in length. Optionally, the a* domain of the target biomarker consists of a nucleotide sequence that is greater than or equal to 30 nucleotides in length.

[0281] The a* domain of the target biomarker may consist of a nucleotide sequence that does not comprise one or more palindromic structures of 10 or more, of 9 or more, of 8 or more, of 7 or more, of 6 or more, or of 5 or more nucleotides. Optionally, the a* domain of the target biomarker consists of a nucleotide sequence that does not comprise one or more palindromic structures of 5 or more nucleotides. The a* domain of the target biomarker may consist of a nucleotide sequence that does not comprise one or more consecutive sequences of more than ten, of more than nine, of more than eight, of more than seven, of more than six, of more than five, or of more than four identical nucleotides.

[0282] The a* domain of the target biomarker may consist of a nucleotide sequence that is located at the 5’ end of the target biomarker and / or closer to the 5’ end of the target biomarker than the “b*” and “c*” domains, preferably wherein the “a*” domain is located no more than 10, no more than 9, no more than 8, no more than 7, no more than 6, no more than 5, no more than 4, or no more than 3 nucleotides from the 5’ end of the target biomarker. Optionally, the a* domain of the target biomarker consists of a nucleotide sequence that is located at the 5’ end of the target biomarker and / or closer to the 5’ end of the target biomarker than the “b*” and “c*” domains, preferably wherein the “a*” domain is located no more than 10, more preferably no more than 5, yet more preferably no more than 3 nucleotides from the 5’ end of the target biomarker.

[0283] The a* domain of the target biomarker may consist of a nucleotide sequence that has a 3’ end located at least 10, at least 11 , at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 nucleic acids from the 5’ end of the “c*” domain of the target biomarker. Optionally, the a* domain of the target biomarker may consist of a nucleotide sequence that has a 3’ end located at least 10 nucleic acids, preferably at least 20 nucleic acids from the 5’ end of the “c*” domain of the target biomarker.

[0284] The c* domain of the target biomarker may consist of a nucleotide sequence that is greater than or equal to 17, greater than or equal to 18, greater than or equal to 19, greater than or equal to 20, greater than or equal to 22, greater than or equal to 23, greater than or equal to 24, greater than or equal to 25, greater than or equal to 26, greater than or equal to 27, greater than or equal to 28, greater than or equal to 29, or greater than or equal to 30 nucleotides in length. Optionally, the c* domain of the target biomarker consists of a nucleotide sequence that is greater than or equal to 17 nucleotides in length.

[0285] The c* domain of the target biomarker may consist of a nucleotide sequence that differs to the a* domain of the target biomarker by at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11 , or at least 12 nucleotides. Optionally, the c* domain of the target biomarker consists of a nucleotide sequence that differs to the a* domain of the target biomarker by at least 4, preferably at least 6, more preferably at least 8, yet more preferably at least 10 nucleotides.

[0286] The a* domain of the target biomarker may consist of a nucleotide sequence that is located closer to the 3’ end of the target biomarker than the “a*” and “b*” domains, preferably wherein the “c*” domain is located no more than 10, no more than 9, no more than 8, no more than 7, no more than 6, no more than 5, no more than 4, or no more than 3 nucleotides from the 3’ end of the target biomarker. Optionally, the a* domain of the target biomarker consists of a nucleotide sequence that is located closer to the 3’ end of the target biomarker than the “a*” and “b*” domains, preferably wherein the “c*” domain is located no more than 10, more preferably no more than 5, yet more preferably no more than 3 nucleotides from the 3’ end of the target biomarker.

[0287] The b* domain of the target biomarker may consist of a nucleotide sequence that is greater than or equal to 8, greater than or equal to 9, greater than or equal to 10, greater than or equal to 11 , greater than or equal to 12, greater than or equal to 13, greater than or equal to 14, greater than or equal to 15, greater than or equal to 16, greater than or equal to 17, greater than or equal to 18, greater than or equal to 19, or greater than or equal to 20 nucleotides in length. Optionally, the b* domain of the target biomarker consists of a nucleotide sequence that is greater than or equal to 8 nucleotides in length.

[0288] The b* domain of the target biomarker may consist of a nucleotide sequence that has less than a certain proportion (which may be expressed as a percentage) of G- and / or C- containing nucleotides. By this it is meant that there is less than a certain percentage of guanine- and / or cytoside-containing nucleotides. The b* domain of the target biomarker may consist of a nucleotide sequence that has less than 40%, less than 35%, less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, or less than 5% G- and / or C- containing nucleotides. Optionally, the b* domain of the target biomarker may consist of a nucleotide sequence that has less than 40% G- and / or C-containing nucleotides. Optionally, the b* domain of the target biomarker may consist of a nucleotide sequence that has less than any of the above proportions of G- and / or C- containing nucleotides and / or modified forms or derivatives thereof. Non-limiting examples of modified G / C nucleotides include 5- methylcytosine, G-clamp and 8-methylguanine, 5-hydroxymethyl cytosine, 6-N- methylguanine, 2-thiocytosine, 5-halocytosine, 7-methylguanine, 7-deazaguanine, 3- deazaguanine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, and 5-methyl 4-N- benzoylcytosine.

[0289] The b* domain of the target biomarker may consist of a nucleotide sequence that differs to the c* domain of the target biomarker by at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11 , or at least 12 nucleotides. Optionally, the b* domain of the target biomarker consists of a nucleotide sequence that differs to the c* domain of the target biomarker by at least 1, preferably at least 3, more preferably at least 5, yet more preferably at least 10 nucleotides.

[0290] The b* domain of the target biomarker may consist of a nucleotide sequence that is located further from the 5’ end of the target biomarker than the “a*” domain and is located further from the 3’ end of the target biomarker than the “c*” domain. Alternatively or in addition, the b* domain of the target biomarker may consist of a nucleotide sequence that is located adjacent to the “c*” domain of the target biomarker with no intervening nucleotides.

[0291] The “a*”, “b*”, and “c*” domains of the target biomarker may be arranged in this order, preferably arranged in this order from the 5’ to the 3’ end. Optionally, the “b*” and “c*” domains of the target biomarker do not overlap, preferably wherein the “a*”, “b*”, and “c*” domains of the target biomarker do not overlap.

[0292] Optionally, the ensemble defined herein is provided wherein the target biomarker is a polynucleotide, e.g., an oligonucleotide.

[0293] The polynucleotide may be greater than or equal to 55, greater than or equal to 60, greater than or equal to 65, greater than or equal to 70, greater than or equal to 75, greater than or equal to 80, greater than or equal to 85, greater than or equal to 90, greater than or equal to 95, greater than or equal to 100, greater than or equal to 120, greater than or equal to 140, greater than or equal to 160, greater than or equal to 180, greater than or equal to 200, greater than or equal to 250, greater than or equal to 300, greater than or equal to 400, greater than or equal to 500, greater than or equal to 600, greater than or equal to 700, greater than or equal to 800, greater than or equal to 900, or greater than or equal to 1000 nucleotides in length. Optionally, the polynucleotide is greater than or equal to 55 nucleotides in length.

[0294] Conjugates

[0295] As described herein, the invention provides an ensemble for detecting a target biomarker, the ensemble comprising a sentry nanite, at least one stabiliser nanite, and at least one signaller nanite. When the ensemble contacts a target biomarker, a conjugate may form that comprises a sentry nanite, at least one stabiliser nanite, at least one signaller nanite, and at least one target biomarker. The formation of the conjugate is crucial to the detection (and quantification) of the target biomarker because due to the growing aptamer chains extending from the sentry nanite (formed by hybridisation between copies of stabiliser and signaller nanites), the signal resulting from any label(s) present within the structure of the complex will be increased. This is particularly useful because it increases the sensitivity of the method. Preferably, the conjugate includes no more than one sentry nanite.

[0296] Accordingly, the invention also provides a conjugate comprising:

[0297] A) a sentry nanite;

[0298] B) at least one stabiliser nanite;

[0299] C) at least one signaller nanite; and

[0300] D) at least one target biomarker; wherein the sentry nanite, stabiliser nanite, signaller nanite, and target biomarker are as defined herein. The conjugate may be branched. Preferably, the conjugate is linear. The conjugate may comprise both branched and linear portions.

[0301] An illustrative example of a conjugate of the invention is shown in FIG. 4vi. In this illustrative example:

[0302] A) domain “a” of the first aptamer sequence is hybridised to domain “a*” of the at least one target biomarker;

[0303] B) the first toehold domain “b” of a first stabiliser nanite is hybridised to domain “b*” of the at least one target biomarker;

[0304] C) domain “c” of the first stabiliser nanite is hybridised to domain “c*” of the at least one target biomarker;

[0305] D) the first non-complementary loop structure “d” of the first stabiliser nanite is hybridised to the second toehold domain “d*” of a first signaller nanite; and

[0306] E) domain “c*” of the first stabiliser nanite is hybridised to domain “c” of the first signaller nanite.

[0307] A person of ordinary skill in the art will readily appreciate that the above-described conjugate is simply illustrative and that many different variations are possible and are within the scope of the invention.

[0308] As described herein, the sentry nanite comprises a plurality of first aptamer sequences. It is therefore possible for more than one target biomarker to hybridise with the plurality of first aptamer sequences i.e. more than one first aptamer sequence of the sentry nanite is independently hybridised with a copy of the target biomarker. For the avoidance of any doubt, a single copy of the target biomarker is not hybridised with more than one first aptamer sequence. Accordingly, the conjugate may comprise one or more polymer chains extending from the plurality of first aptamer sequences bound to the support of the sentry nanite; wherein the one or more polymer chains comprise the first aptamer sequence, at least one target biomarker, two or more copies of the stabiliser nanite, and two or more copies of the signaller nanite.

[0309] The conjugate may also comprise one or more polymer chains each comprising two or more copies of the stabiliser nanite and two or more copies of the signaller nanite; wherein each of the one or more polymer chains comprise hybridisation between:

[0310] A) the second non-complementary loop structure “b*” of the two or more copies of the signaller nanite and the first toehold domain “b” of the two or more copies of the stabiliser nanite;

[0311] B) domain “c*” of the two or more copies of the signaller nanite and domain “c” of the two or more copies of the stabiliser nanite; C) the first non-complementary loop structure “d” of the two or more copies of the stabiliser nanite and the second toehold domain “d*” of the two or more copies of the signaller nanite; and

[0312] D) domain “c*” of the two or more copies of the stabiliser nanite and domain “c” of the two or more copies of the signaller nanite; optionally wherein the polymer is a linear polymer.

[0313] As a person of ordinary skill in the art will appreciate, the diameter (size) of the sentry nanite support, and therefore the diameter of the sentry nanite and hence the diameter of the resulting conjugate (when the ensemble is contacted with a target biomarker), can be varied depending on the intended application. The size of the chambers into which the conjugate is dispensed in the methods of the invention may be selected depending on the diameter of the conjugate. Advantageously, the conjugate may have a diameter such that a single conjugate may be contained within a single chamber of an array. Preferably, the chambers form an array, e.g. an array of microchambers.

[0314] The conjugate may have a diameter of less than about 20 pm, less than about 18 pm, less than about 16 pm, less than about 14 pm, less than about 12 pm, less than about 10 pm, less than about 9 pm, less than about 8 pm, less than about 7 pm, less than about 6 pm, less than about 5 pm, less than about 4 pm, less than about 3 pm, less than about 2 pm, or less than about 1 pm. Preferably the conjugate has a diameter of less than about 10 pm.

[0315] The conjugate may have a diameter of between about 1 pm and about 10 pm, between about 1 pm and about 9 pm, between about 1 pm and about 8 pm, between about 1 pm and about 7 pm, between about 1 pm and about 6 pm, between about 1 pm and about 5 pm, between about 2 pm and about 4 pm, or between about 2.7 pm and about 4 pm, e.g. about 3 pm. Optionally, the conjugate has a diameter of less than about 10 pm, preferably between about 2.7 pm and about 4 pm, more preferably about 3 pm.

[0316] Target biomarker release

[0317] Advantageously, the conjugate defined herein (which comprises the at least one target biomarker) may be subjected to certain methods resulting in the release of the at least one target biomarker. The method of release of the at least one target biomarker is not a photochemical method. The released target biomarker may be isolated e.g., as a conjugate with one or more of the sentry, stabiliser, and / or signaller nanites, or in isolation. It is often desirable for the target biomarker to be isolated in isolation.

[0318] Given the very high sensitivity of the methods defined herein, the ability to release the at least one target biomarker from the conjugate is particularly advantageous because this can be used as a method of isolating (and purifying) samples comprising biomarkers at very low concentrations. The target biomarker is returned to its native state by the method of release, i.e. without modification (when isolated in isolation).

[0319] Accordingly, the invention provides a method for releasing the hybridised at least one target biomarker from the conjugate defined herein, wherein the method is not a photochemical process; optionally wherein the released target biomarker is isolated e.g., as a conjugate with one or more of the sentry, stabiliser, and / or signaller nanites, or in isolation.

[0320] Kits

[0321] The invention provides a kit for detecting the presence of a target biomarker in a sample fluid. The kit comprises a sentry nanite, at least one stabiliser nanite, and at least one signaller nanite as defined herein.

[0322] A kit of the invention may optionally comprise one or more additional component useful for performing a method of the invention. By way of non-limiting example, a kit may comprise a buffer, one or more labels, e.g. wherein the label is a dye, a reagent for obtaining a sample from a subject, a control sample, one or more sample compartments, a microchamber array microfluidic chip e.g. a femtolitre array, an instructional material which describes performance of a method of the invention, and sample specific controls / standards, or any combination thereof.

[0323] The reagents for isolating a sample from a subject can comprise one or more reagents that can be used to obtain a fluid or tissue from a subject, such as means for obtaining a blood, plasma, saliva, serum, sputum, urine, joint fluid, cerebral spinal fluid, synovial fluid, cells, a cellular extract, a tissue sample, a tissue biopsy, lymph, milk, pleural effusion, tissue infiltration, and stool sample and the like.

[0324] The kit may comprise a buffer. The buffer may be a salt prepared from an organic acid or base. The buffer may be selected from organic acid salts such as salts of citric acid, ascorbic acid, gluconic acid, carbonic acid, tartaric acid, succinic acid, acetic acid, or phthalic acid, tris, trimethamine hydrochloride, and phosphate buffers e.g. PBS, or combinations thereof. In some embodiments, the buffer may be a sodium salt.

[0325] The kit may be used in conjunction with (or comprises) a device capable of producing a magnetic field and / or a device capable of visualising an array, e.g. a device for monitoring fluorescence.

[0326] In embodiments in which the sentry nanite support comprises or consists of one or more ferromagnetic metals, compounds thereof, or alloys thereof, the kit may preferably used in conjunction with (or comprises) a device capable of producing a magnetic field.

[0327] In embodiments in which the first label, the second label, and / or the third label is a fluorophore, and / or the fourth label is a fluorescent dye, the kit may preferably used in conjunction with (or comprises) a device capable of visualising an array, e.g. a device for monitoring fluorescence.

[0328] The kit may further comprise instructions for use. The instructions may be printed instructions.

[0329] In some preferred embodiments, the kit may be designed for use when the subject is human.

[0330] Accordingly, the invention provides a kit for detecting the presence of a target biomarker in a sample fluid comprising:

[0331] A) a sentry nanite;

[0332] B) at least one stabiliser nanite;

[0333] C) at least one signaller nanite; and

[0334] D) instructions for use; wherein the sentry nanite, stabiliser nanite, and signaller nanite are as defined herein.

[0335] Methods of use

[0336] The invention also provides a method for detecting the presence of a target biomarker in a sample fluid, the method comprising the use of an ensemble as defined herein, the sentry nanite, the stabiliser nanite, and / or the signaller nanite as defined herein, the conjugate as defined herein, or the kit as defined herein.

[0337] The method may comprise the formation of one or more aptamer chains extending from the sentry nanite (formed by hybridisation between copies of stabiliser and signaller nanites); wherein each of the one or more aptamer chains comprise the first aptamer sequence, at least one target biomarker, two or more copies of the stabiliser nanite, and two or more copies of the signaller nanite; preferably wherein each of the polymer comprises: a) two or more first labels; b) two or more second labels; c) a third label; and / or d) a fourth label; wherein the two or more first labels, two or more second labels, third label, and / or fourth label are as defined herein.

[0338] The method may comprise the use of a sentry nanite; wherein the method additionally comprises the following steps:

[0339] A) contacting the sample fluid with an ensemble as defined herein or components A) to C) of the kit as defined herein, in a vessel; and

[0340] B) visualising the one or more labels defined herein.

[0341] In the method, the sentry nanite support preferably comprises or consists of one or more ferromagnetic metals, compounds thereof, or alloys thereof. The method may comprise the use of multiple ensembles or multiple kits or components thereof as defined herein. Advantageously, the use of multiple ensembles or multiple kits or components thereof as defined herein enables the detection of multiple target biomarkers simultaneously. Labels may be carefully selected such that e.g. different detection wavelengths are used for different conjugates formed from the ensembles hybridising with different target biomarkers. Orthogonal detection methods may be used in the case of different types of labels, e.g. fluorophores and radiolabels.

[0342] The method may comprise the use of a sentry nanite comprising a support comprising or consisting of one or more ferromagnetic metals, compounds thereof, or alloys thereof; wherein the method additionally comprises the following steps:

[0343] A) contacting the sample fluid with an ensemble as defined herein or components A) to C) of the kit as defined herein, in a vessel, preferably wherein the sample fluid is diluted with a liquid medium, e.g., an aqueous buffer solution;

[0344] B) agitating the mixture in the vessel;

[0345] C) exposing the vessel to a magnetic field;

[0346] D) decanting the liquid from the vessel while retaining the exposure to the magnetic field;

[0347] E) rinsing the contents of the vessel while retaining the exposure to the magnetic field;

[0348] F) removing the magnetic field;

[0349] G) resuspending the mixture;

[0350] H) dispensing the resuspended mixture on to a microchamber array microfluidic chip; and

[0351] I) visualising the array, e.g., by monitoring fluorescence.

[0352] A person of ordinary skill in the art will appreciate that by visualising the array, it is the one or more labels defined herein that are being visualised by an appropriate method.

[0353] Steps C) to E) of the method described herein are particularly advantageous because the magnetic support (of the sentry nanite) enables the straightforward separation of the conjugates formed after the ensemble is contacted with the target biomarker from e.g. excess stabiliser and signaller nanite, and any other impurities in the sample e.g. other biomarkers that are not of interest. As one of ordinary skill in the art will appreciate, the exposure of the vessel to a magnetic field results in attractive forces between the external magnetic source and the sentry nanites. This is particularly advantageous because it means that the conjugates remain in the vessel during the decanting step D and rinsing step E). As will be appreciated, step C) of the method is not necessary when the sentry nanite support is not magnetic. Effective decanting in step D) and rinsing in step E) may also be achieved using non-magnetic supports (the attractive force in this instance is that of gravity, acting to anchor the sentry nanites in the vessel). However, the method is particularly effective, quick, and easy to perform when the sentry nanite support is magnetic.

[0354] A variety of microchamber array microfluidic chips may be used in the method of the invention, but the array is preferably a femtolitre array. As described herein, a particular advantage of the method is that the diameter (size) of the sentry nanite support, and therefore the diameter of the sentry nanite and hence the diameter of the resulting conjugate (when the ensemble is contacted with a target biomarker), can be varied depending on the intended application. The size of the chambers into which the conjugate is dispensed in the methods of the invention (see step H), above) may be selected depending on the diameter of the conjugate. Advantageously, the conjugate may have a diameter such that a single conjugate may be contained within a single chamber of an array. The ability to dispense a single conjugate (or sentry nanite if it is not bound to a target biomarker), into a single chamber of an array is particularly beneficial because this enables each chamber to function as a pixel in a giant array. This greatly increases the sensitivity of the method of the invention.

[0355] As will be appreciated by those of ordinary skill in the art, the concentrations of the sentry nanite, stabiliser nanite, and signaller nanite may all be varied depending on the intended application and the amount of sample available.

[0356] The concentration of the sentry nanite may be about 10 pM, about 9 pM, about 8 pM, about 7 pM, about 6 pM, about 5 pM, about 4 pM, about 3 pM, about 2 pM, about 1 pM, about 0.9 pM, about 0.8 pM, about 0.7 pM, about 0.6 pM, about 0.5 pM, about 0.4 pM, about 0.3 pM, about 0.2 pM, about 0.1 pM, about 0.09 pM, about 0.08 pM , about 0.07 pM, about 0.06 pM about 0.05 pM, about 0.04 pM, about 0.03 pM, about 0.02 pM, or about 0.01 pM. Optionally, the concentration of the sentry nanite is about 1 pM.

[0357] The concentration of each of the stabiliser nanite and signaller nanite may be between about 0.1 nM and about 10 pM, between about 0.2 nM and about 9 pM, between about 0.3 nM and about 8 pM, between about 0.4 nM and about 7 pM, between about 0.5 nM and about 6 pM, between about 0.6 nM and about 5 pM, between about 0.7 nM and about 4 pM, between about 0.8 nM and about 3 pM, between about 0.9 nM and about 2 pM, or between about 1 nM and about 1 pM. Optionally, the concentration of each of the stabiliser nanite and signaller nanite is between about 1 nM and about 1 pM.

[0358] The concentration of the stabiliser nanite and signaller nanite may be about the same, preferably where it is the same, for example about 10 pM, about 9 pM, about 8 pM, about 7 pM, about 6 pM, about 5 pM, about 4 pM, about 3 pM, about 2 pM, about 1 pM, about 0.9 pM, about 0.8 pM, about 0.7 pM, about 0.6 pM, about 0.5 pM, about 0.4 pM, about 0.3 pM, about 0.2 pM, about 0.1 pM, about 0.09 pM, about 0.08 pM , about 0.07 pM, about 0.06 pM about 0.05 pM, about 0.04 pM, about 0.03 pM, about 0.02 pM, or about 0.01 pM. Optionally, the concentration of the stabiliser nanite and signaller nanite is about the same, preferably where it is the same, for example about 1 pM.

[0359] The concentration of the stabiliser nanite and / or signaller nanite may be greater than the concentration of the sentry nanite, e.g. about 1.1 times greater, about 1.5 times greater, about 2 times greater, about 3 times greater, about 4 times greater, about 5 times greater, about 6 times greater, about 7 times greater, about 8 times greater, about 9 times greater, or about 10 times greater than the concentration of the sentry nanite. Optionally, the concentration of the stabiliser nanite and / or signaller nanite is greater than the concentration of the sentry nanite, preferably about 2 times greater, more preferably about 5 times greater than the concentration of the sentry nanite.

[0360] Each of the concentrations of the sentry nanite, stabiliser nanite, and signaller nanite may be greater than the concentration of the target, e.g., in excess. For example, about 1.1 times, about 1.5 times, about 2 times, about 3 times, about 4 times, about 5 times, about 6 times, about 7 times, about 8 times, about 9 times, or about 10 times greater.

[0361] The temperature of the method may be greater than or equal to 20 °C, and / or less than or equal to 85 °C, e.g. 20 °C, 25 °C, 30 °C, 35 °C, 40 °C, 45 °C, 50 °C, 55 °C, 60 °C, 65 °C, 70 °C, 75 °C, 80 °C, or 85 °C. Optionally, the temperature is greater than or equal to 20 °C, and / or less than or equal to 85 °C.

[0362] The salt concentration may be greater than or equal to 0.05 M Na+, e.g. 0.06 M Na+, 0.07 M Na+, 0.08 M Na+, 0.09 M Na+, 0.1 M Na+, 0.2 M Na+, 0.3 M Na+, 0.4 M Na+, 0.5 M Na+, 0.6 M Na+, 0.7 M Na+, 0.8 M Na+, 0.9 M Na+, or 1.0 M Na+. Optionally, the salt concentration is greater than or equal to 0.05 M Na+.

[0363] The invention also provides a method as defined herein, wherein the sample fluid is selected from: blood, plasma, saliva, serum, sputum, urine, joint fluid, cerebral spinal fluid, synovial fluid, cells, a cellular extract, a tissue sample, a tissue biopsy, lymph, milk, pleural effusion, tissue infiltration, and stool sample and the like.

[0364] Advantageously, the methods of the invention are highly sensitive and capable of detecting very low concentrations of target biomarker. This is a significant advantage over existing methods of biomarker detection, for example nucleic acid detection, which are by default only qualitative. This is also particularly advantageous in the context of biological samples because in any case, the concentration is often too low for conventional techniques to detect. The methods of the invention are significantly more sensitive than standard PCR techniques and isothermal DNA / RNA amplification methods using e.g. the OptiGene Genie® III machine. Using the methods of the present invention, very low concentrations of particular biomarkers may be detected. As exemplified herein, the method additionally determines the concentration of the target biomarker, wherein the limit of detection of the method is about 1 x 10’18M, about 1 x 1O’17M, about 1 x 1 o16M, about 1 x 1 o15M, about 1 x 1014M, about 1 X 10-13M, about 1 x 10-12M, about 1 x 10’11M, about 1 x 1O'10M, about 1 x 1 o9M, about 1 x 10'8M, about 1 x 10'7M, about 1 x 10'6M, about 1 x 10'5M, about 1 x 10'4M, or about 1 x 10'3M. Optionally, the method additionally determines the concentration of the target biomarker, wherein the limit of detection of the method is 1 x 10'18M.

[0365] The methods of the invention are significantly easier (and quicker) to perform than existing PCR methods. As a person of ordinary skill in the art will appreciate, PCR requires clean (purified) samples. As much as 30-70% of the target DNA may be lost during the preliminary steps of DNA extraction before PCR is performed. Not only does this further decrease the utility of the method when applied to very low concentration samples, but it significantly limits the utility of any quantitative data obtained (in the case of qPCR). In contrast, the methods of the invention do not require purification prior to analysis.

[0366] Applications and uses

[0367] Given the advantageous properties of the ensembles, there are numerous applications and uses of the sentry, stabiliser, and signaller nanites, ensembles, conjugates, kits, and methods of the invention described herein.

[0368] Applications and uses of the invention include:

[0369] • detecting one or more target biomarkers, e.g. when the one or more target biomarkers is present at low concentration;

[0370] • simultaneous detection of two or more target biomarkers;

[0371] • detecting one or more target biomarkers directly using an unpurified (e.g. native) sample. The method is particularly advantageous over existing methods because existing PCR processes cannot be used with substances such as heme in blook, or humic acid in soil since they inhibit the PCR process. The current method is not inhibited by these substances;

[0372] • purification of samples to afford isolated biomarker(s);

[0373] • quality control e.g. re-testing a sample that has already been subjected to the method of biomarker detection (this is not possible with existing endpoint PCR, qPCR, ddPCR, or LAMP methods);

[0374] • environmental analysis / sampling;

[0375] • food testing;

[0376] • clinical diagnostics;

[0377] • therapeutic applications;

[0378] • forensics;

[0379] • academic and industrial research;

[0380] • environmental monitoring e.g. monitoring wastewater;

[0381] • agro-industry, e.g. monitoring of animal health, plant health, and growth; Advantageously, the method permits also permits real time analysis, so it is particularly useful for detecting biomarkers in dynamic systems e.g. biological systems.

[0382] Generating aptamer sequences

[0383] The sentry, stabiliser, and signaller nanites of the present invention may be adapted or custom made to suit a particular application, e.g. to detect the presence and / or concentration of a particular target biomarker. A computer algorithm may be used in the methods of the present invention to determine (or suggest options for) the structures of the first, second, and / or third aptamer sequences. Advantageously, the use of the computer algorithm increases the efficiency of the method and enables a vast range of alternative nanite structures to be tested in silico to determine the optimum structures of the first, second, and / or third aptamer sequences. In some embodiments, the sequence of the target biomarker is input into the computer algorithm.

[0384] When the optimum structures of the first, second, and / or third aptamer sequences have been determined, the sequences may be synthesised using any of a number of methods commonly known to those of ordinary skill in the art. The aptamer synthesis method may be an automated method.

[0385] Accordingly, the invention provides a method for determining one or more of the first, second, and third aptamer sequences as defined herein, the method comprising the selection of a target biomarker and the use of a computer algorithm.

[0386] Methods of generating nanites

[0387] The present invention provides processes for making the sentry, stabiliser, and signaller nanites as defined herein.

[0388] As described above, the sentry nanite comprises a support. In the processes for making a sentry nanite of the invention, the support may be any of those defined herein. The support may be a ferrite (FesC ) support. The ferrite support may be prepared by adding FeC and FeCh solutions to an alkali solution which is optionally preheated e.g. to at least about 80 °C, at least about 85 °C, at least about 90 °C, at least about 95 °C, or at least about 100 °C. The alkali solution is preferably preheated to 80 °C. In some embodiments, FeCh and FeCh solutions are added in a molar ratio in which FeCh is present in excess, e.g. a molar ratio of 1 :2. The process for making the ferrite support may comprise a washing step, e.g. using deionised water.

[0389] In the processes for making a sentry nanite of the invention, the support is coated with a polymer coating. The polymer coating may be any of those defined herein. The polymer coating is preferably a surface polymer coating, e.g. a surface polymer coating comprising carboxylic acid functional groups. Preferably, the process comprises a polymer coating step in which methacrylic acid is added to the sentry nanite support, e.g. to the solution comprising the ferrite support to afford a surface polymer coated ((poly)methacrylic acid coated) support. The polymer coating process may proceed through a free radical retrograde precipitation polymerisation reaction.

[0390] The polymer coated support may be contacted with a plurality of first aptamer sequences. A person of ordinary skill in the art will appreciate that there are a vast number of chemical methods by which the plurality of first aptamer sequences may be affixed to the polymer coated support. A particularly convenient method (when the polymer coating is (poly)methacrylic acid) is a coupling reaction between the carboxylic acid coating and a nucleophilic functional group within the structure of the plurality of first aptamer sequences, e.g. an amine group. Accordingly, the first aptamer sequences preferably comprise a free amine group e.g., an amino modifier modification such as 3’AmMO. A number of different coupling reagents and conditions may be used to effect the coupling reaction as will be known to those of ordinary skill in the art. Preferably, the coupling agent is EDC.

[0391] Accordingly, the invention also provides a process for making a sentry nanite, the process comprising the steps of:

[0392] A) providing a support, optionally wherein a) the support comprises or consists of one or more ferromagnetic metals, compounds thereof, or alloys thereof; or b) the support comprises silica and a microcrystalline dispersion of one or more ferromagnetic metals, compounds thereof, or alloys thereof, for example a microcrystalline magnetite dispersion;

[0393] B) coating the support with a polymer coating, preferably a surface polymer coating comprising carboxylic acid functional groups, e.g., (poly)methacrylic acid (PMAA); and

[0394] C) contacting the coated support with a plurality of first aptamer sequences and a coupling agent, preferably wherein the first aptamer sequences comprise a free amine group e.g., an amino modifier modification such as 3’AmMO.

[0395] The processes for making the sentry nanite defined herein may optionally comprise a step resulting in the incorporation of a fourth label. This incorporation step may occur between steps B) and C) of the method defined herein. The fourth label is preferably embedded within or affixed to the surface of, the sentry nanite support e.g. embedded within a polymethacrylate coating on the sentry nanite support. The fourth label may be any one or more of the labels defined herein. As will be appreciated, the fourth label may be embedded within or affixed to the surface of, the sentry nanite support, using methods known to those of ordinary skill in the art.

[0396] The label may be any one of the dyes and fluorescent dyes defined herein. The dye is preferably a fluorescent dye, more preferably wherein the fluorescent dye is selected from (i) 4',6-diamidino-2-phenylindole (DAPI) or (ii) a lanthanide or lanthanide complex e.g., Eu3+ or a complex thereof.

[0397] Additional description of the invention

[0398] Further disclosure relating to the present invention is provided below.

[0399] Nucleic acid detection is critical in various fields, including life sciences research and clinical diagnostics. Existing methods often suffer from limitations related to sensitivity, specificity, and signal amplification, all of which are at-least partly constrained by prior requirement for involved extraction and purifications. Furthermore, traditional molecular probes, primarily used as primers in PCR or attached to magnetic beads for extractions, offer only a static response to target sequences. The present invention advances this field, introducing a dynamic, reconfigurable, and highly sensitive detection mechanism. The present invention aims to address these issues by introducing nanites, programmable DNA nanostructures capable of highly specific and sensitive target molecule detection.

[0400] The present invention pertains to the field of nanotechnology, molecular diagnostics, and DNA origami, particularly focusing on the design and functionality of programmable, computationally and rationally designed polymer Aptameric composite structures named "Nanites" for dynamic molecular interactions and amplified target detection.

[0401] The invention describes ‘Nanites’, sophisticated polymer Aptameric composites characterized by hybrid silicon / iron structures embedded with programmed DNA aptamers. Designed for dynamic behaviour, these Nanites can self-fold in the absence of a target and activate upon target detection, triggering a unique hybridization chain reaction, resulting in an amplified fluorescent signal. The nanites1surfaces are adorned with aptamer "arms" that remain self-folded, akin but not identical to hairpin structures, in the absence of the target molecule of interest. However, in the presence of the target molecule, the aptamer arms unwind, allowing the nanite to capture the target molecule through sequence-specific hybridization controlled by thermodynamics. These Nanites are uniquely programmed for dynamic behaviour in response to specific environmental triggers. The Nanites1distinguishing feature is their ability to self-fold, remain inactive in the absence of a target, and activate upon target presence, initiating a chain reaction yielding a detectable fluorescent signal. This targeted capture initiates a chain reaction recognition event involving multiple nanites, setting off a highly efficient hybridization cascade. The cascade results in exponential signal amplification, making the detection of the target nucleic acid rapid and sensitive.

[0402] The present invention pertains to Nanites, advanced programmable DNA nanostructures, and the method for their production. Nanites, defined as smart, programmable DNA nanostructures, are composed of aptameric polymer composites tailored for next-generation detection. These Nanites offer a new approach to molecular detection without the reliance on enzymes. Given their advanced design, Nanites can detect and bind to specific target molecules in complex samples, distinguishing them from surrounding molecules. Their programmability ensures adaptability, making them an essential tool for various molecular diagnostics scenarios.

[0403] Disclosed herein are methods and systems for producing and utilizing Nanites. Nanites are rationally engineered nanostructures, designed to fold into specific configurations based on situational requirements & exhibit situational ‘behavioural’ changes in response to particular stimuli - such as the presence of a particular sequence target molecule. Each Nanite encompasses polymeric composites, produced through a proprietary in-house process. The nanites consist of iron oxide crystals dispersed in a polymer matrix, with a functional polymer overcoating for the encapsulation of magnetite and the introduction of reactive groups. The core structure of nanites is primarily composed of short, programmed DNA aptamers designed to form the Nanite framework and contain complementary sequences for particular target recognition. Preferably, at least three separate programmed aptamers are encompassed within one Nanite. These are the Sentry(N1) or primary Nanite, the Stabiliser(N2) or Auxiliary nanite 1, and the Signaller, (N3) or Auxiliary Nanite 2. Nanites, at their core, are exemplary models of DNA Origami, where DNA fragments are controlled to assume specific shapes. The entirety of this spherical structure, encapsulating foldable aptamer complexes of DNA with embedded iron and silica, is termed a single Nanite.

[0404] The surfaces of the Primary Nanites are adorned with aptamer "arms" , while resembling a hairpin structure with a long unpaired toehold, they are designed to remain self-folded in the absence of a target molecule, with only the exposed toe-hold region unpaired. Primary Nanite aptamer arms can in some instances possess a fluorophore molecule which differs from those of the auxiliary nanites which preferentially possess a single fluorophore molecule each and no quencher molecules. Primary Nanites are preferably magnetic, so that they may be manipulated and confined using magnetic fields, especially within microfluidic arrays.

[0405] Upon encountering the target nucleic acid, these N1 aptamer arms demonstrate high sensitivity and specificity, recognizing and binding the target through sequence-specific hybridization by way of toe-hold mediated strand displacement, a process governed by thermodynamic shifts in the free-energy of folding. Upon capturing the target molecule, the N1 Primary Nanite which anchors the target DNA strand to its surface, facilitates a landing pad for the smaller auxiliary nanites N2 and N3 to begin the cascade. N2, which is also selffolded save for its own small toe-hold region, hybridises with a particular portion of the target sequence, unwinding from its self-folded state through toehold mediated strand displacement. At least one portion of the Auxiliary Nanite(N1) is complementary to the Auxiliary Nanite(N2) itself self-folded until the specific sequence interaction domain of N1 is exposed through its unwinding to the target, which facilitates the unwinding of N2 to preferentially bind the complementary portion of N1. Through the unwinding and sequencespecific hybridisation of N1 to N2, at least one other portion of N2 unwinds to provide a complementary landing pad for a further N1 Auxiliary Nanite to hybridise to. As each Auxiliary nanite possesses at least one single fluorophore molecule each, concomitant linear hybridisation chains of N1 & N2 nanites occur originating from and anchored to the primary Nanite through the captured, anchored target molecule. The nanites initiate a chain reaction known as a hybridization cascade. Hybridisation Cascading involves multiple nanites and results in the formation of a signal amplification cascade. This cascade culminates in a rapid, pronounced fluorescent signal, ensuring a robust and easily detectable signal, marking the presence of the target molecule.

[0406] The Nanite-capture complex can be manipulated using a magnet in combination with custom large number, low-volume microchamber, microfluidic chip arrays to confine each Nanite in femtoliter-sized reaction array wells, courtesy of their magnetic properties. Their uniqueness lies in their engineered capability to change configurations; self-folding, unfolding, bridging, re-orienting, based on the presented stimuli. Upon successful target capture, Nanites are programmed to exhibit colour-changes - from at least one colour to another wavelength, offering a distinct detection signal when housed within specialized wells.

[0407] Unlike conventional methods, Nanites offer enzyme-free amplification capabilities. When paired with a specific reader instrument, a separate invention, they enable singlemolecule detection. The Nanites can bind to specific target molecules, making them ideal probes for a broad range of applications. Their programmable nature allows for adaptability in various detection scenarios, revolutionizing the field of molecular diagnostics

[0408] Further description of Apparatus, System, and Method for anites Production and Utilization

[0409] The present invention provides an ensemble of Nanite formations specifically designed for precise molecular detection. Detailed aspects of the invention include:

[0410] (a) A Sentry Module (N1): This module is specifically engineered to recognize and bind to certain target molecules, acting as the primary interface.

[0411] (b) A Stabilizer Module (N2): This module's primary function is to establish a stable environment that reinforces molecular capture. It inhibits the potential release or degradation of the target and sets the groundwork for the Signaler, amplifying detection through fluorescence arising from simultaneous hybridizations.

[0412] (c) A Signaler Module (N3): Upon assimilating information from the Sentry and Stabilizer modules, the Signaler produces an identifiable output signal. This is achieved through sequence-specific hybridization. The module interacts with presented complementary domains and further exposes its own domains, enhancing subsequent interactions with the N2 molecule. This design guarantees effective communication of the detection process.

[0413] In virtue of the structured sequence of these Nanite modules, which delineate a detection pathway, the system exhibits exceptional precision and regulatory control. The integrated operation of the Sentry, Stabilizer, and Signaler modules culminates in heightened molecular detection sensitivity.

[0414] In a preferred embodiment, a minimum of two Nanite modules are anchored to a common structure, ideally the Primary Nanite. This ensures streamlined interactions and effective signal propagation among modules. It is particularly advantageous for the Stabilizer and Signaler modules to be affixed to the aforementioned Primary Nanite structure. The linkage can be achieved via specialized tethering techniques or direct attachment. This configuration guarantees close proximity and efficient inter-module communication, enhancing their combined efficiency.

[0415] In terms of adaptability and precision in design, the universal structure for the Nanites could adopt a DNA-based formation. For user interface efficiency and cohesive design, this structure might manifest as a nanoparticle. To broaden its compatibility with various systems or apparatuses, the structure might also be conceived as a substrate.

[0416] For synchronized module interactions, it's advantageous for at least two Nanite modules to be anchored to the universal structure in a predetermined configuration. An example would be the strategic placement of the Stabilizer module between the Sentry and Signaler modules.

[0417] The Sentry module is adept at detecting specific target molecules, spanning from DNA to RNA to proteins. Upon successful target identification, the module triggers the subsequent Nanite system modules. This recognition proficiency heightens the Nanites' selective detection capability, refining its specificity.

[0418] Sentry Module

[0419] For optimal sensitivity, the Sentry module is configured to recognize multiple target molecules, thereby expanding its detection range. This multifaceted interaction capability can be attributed to specialized Nanite arms that are present on its surface. Each arm is designed to match specific target sequences, allowing for selective and broad-spectrum detection. For enhanced precision, the Sentry module might be designed to interact with multiple target molecules, thus broadening its detection spectrum. It may do this through different, specific Nanite arms adorning its surface, tailored to particular target sequences. The Sentry module can comprise distinct DNA sequences. These sequences might be fixed to a shared architecture, preferably a DNA formation. Their arrangement is ideally predetermined, potentially utilizing a tethering technique for efficient anchorage. Upon successful interaction with a target molecule, the Sentry module can undergo structural alterations. This allows it to effectively engage subsequent modules. A secondary sequence within the Sentry can further solidify this recognition, ensuring a durable and amplified initial detection. Mechanisms, such as competitive hybridization, might be integrated into the design. Strategies like toe-hold-mediated strand displacement or toe-hold exchange can be leveraged to facilitate this process.

[0420] Stabilizer Module

[0421] The Stabilizer module plays a pivotal role in upholding the integrity of the signal instigated by the Sentry module. It acts as a shield, ensuring that the initial detection is unaffected by external influences or disruptions. It ensures that the initial detection is preserved and not degraded by external factors or interferences. This protective function underscores the reliability of the entire Nanite system. In a preferred embodiment, the Stabilizer module consists of multiple subunits. Each subunit is crafted to specifically support the signal initiated by the Sentry module. When these subunits operate in concert, they guarantee that the signal remains unaffected, even in the face of potential interferences or varying environmental conditions. Several versions of the Stabilizer subunits can be integrated, with each variant performing nuanced roles, yet collectively ascertaining signal consistency.

[0422] Signaller Module

[0423] Upon assimilation of inputs from both the Sentry and Stabilizer modules, the Signaller module generates a discernible output. This output can manifest in various forms, tailored to the specific application — be it visual, electronic, or other relevant modalities. A fluorescent output is especially favoured due to its clear visibility and ease of detection. The module's design might incorporate principles akin to competitive hybridization, ensuring potent signaling.

[0424] The Signaller module can possess distinct DNA sequences that, upon activation by the Sentry and Stabilizer modules, yield a detectable output. These sequences might be affixed to a unified structure, preferably a DNA formation, in a predetermined layout, possibly utilizing a tethering strategy for secure attachment.

[0425] Enhancements and Considerations

[0426] To augment the accuracy of detection and minimize potential false positives, the Nanite system may integrate mechanisms to neutralize interfering molecules. This ensures that only the designated target molecules activate the Nanite system, thus preserving detection fidelity.

[0427] To mitigate potential false positives and enhance the accuracy of detection, Nanites might incorporate mechanisms to counter interfering molecules. Such mechanisms would ensure that only the intended target molecules trigger the Nanite system, thus maintaining high fidelity in detection.

[0428] Ideally, the Stabiliser module encompasses multiple subunits, each one specifically tailored to sustain the integrity of the signal initiated by the Sentry module. These subunits work in unison, ensuring the signal remains consistent and doesn't degrade amidst potential interferences or environmental factors. Multiple iterations of the Stabiliser subunits might be present, each performing slightly varied functions but collectively ensuring signal stability.

[0429] The Sentry module may comprise multiple instances of specific DNA sequences (potentially anchored to a shared structure, optimally a DNA formation, ideally in a predefined arrangement, possibly using a tethering mechanism) designed to recognize and bind to target molecules. Alongside, the Signaller module may have specific DNA sequences (also potentially anchored to a common structure, optimally a DNA formation, in a predefined arrangement, and possibly tethered) that produce a detectable output upon activation by the Sentry and Stabiliser modules.

[0430] Upon recognition of the target molecule, the Sentry module might undergo conformational changes, enabling it to activate the subsequent modules. A secondary sequence within the Sentry could further stabilize or amplify this recognition, ensuring a robust initial detection. The design might include mechanisms such as competitive hybridization, facilitated by strategies like toe-hold-mediated strand displacement or toe-hold exchange.

[0431] The Signaller module, equipped with its specific DNA sequences, gets activated in response to the cues from the Sentry and Stabiliser. The Signaller sequences might be prehybridized, and upon activation, produce a detectable output. This output generation might involve mechanisms similar to competitive hybridization or other conformational changes, ensuring effective signaling and clear detection.

[0432] For enhanced accuracy and to mitigate potential false positives, the Stabiliser module might consist of multiple pathways tailored to sustain various signals initialized by the Sentry module. Multiple iterations of the Stabiliser subunits might be incorporated, each fine-tuned to maintain specific signals. To achieve optimal amplification, these pathways could be designed to mutually enhance each other's functions.

[0433] Preferably, the Signaller module includes a DNA capture mechanism, adept at securely holding a reporter molecule in an initial state and releasing it in a subsequent state, ensuring a clear transition from non-detection to detection.

[0434] The DNA capture mechanism in the Signaller could be designed to transition between its states upon interaction with specific sequences relayed by the Sentry and Stabiliser modules. Such interactions could be based on competitive hybridization strategies, potentially employing techniques like toe-hold-mediated strand displacement or toe-hold exchange.

[0435] In another aspect of the Nanites system, there's a method for detecting specific target molecules by introducing the ensemble of Nanite modules to a sample, ideally conducted in vitro.

[0436] Another aspect details the detection process using Nanites: The Sentry module recognizes and binds to the target molecule, initiating a landing pad signal for the stabilizer, signal. This signal is then acted upon by the Stabiliser module, through the form of sequence-specific hybridisation, providing capture reinforcement and ensuring the integrity of the target molecule. Subsequently, the Signaller module, upon receiving cues from the preceding stabilizer module, produces a detectable output, ideally changing its internal DNA structure to embody, deliver and facilitate a specific reporting signal, which in tandem with other signallers exponentially renders the detection evident.

[0437] The Stabilizer module may include several instances of particular sequences, each specifically engineered to safeguard the integrity of signals initiated by the Sentry module. Concurrently, the Signaller module may encompass sequences tailored to yield a detectable outcome upon being activated. The aforesaid Sentry, Stabilizer, and Signaller modules may be constituents of a more expansive Nanite formation ensemble. Each module might be methodically positioned upon a shared foundation, ideally leveraging a DNA-centric structure, to foster efficient inter-module communication.

[0438] Potential applications of Nanites involve introducing the aforementioned DNA structures to diverse sample types, with a preference for in vitro procedures. In another embodiment, a computer program product can be devised to emulate the interactions and functionalities of the Nanite ensemble. Such a digital model assists in predicting, understanding, and refining the operational dynamics of Nanites in practical settings.

[0439] Moreover, an approach may encompass digitally simulating the Nanite ensemble's behaviour prior to its physical assembly. Post-simulation, distinct DNA sequences for each module are identified, followed by the physical construction of the Nanite ensemble based on these sequences.

[0440] For the sake of clarity:

[0441] "DNA sequence" or "DNA strand" within this context typically alludes to specific DNA configurations with predetermined sequences.

[0442] "Stabilization" primarily refers to the process where the initial signal from the Sentry is maintained and shielded from potential disturbances through sequence-specific hybridisation to favourable free-energy and increased stability of the bound duplex.

[0443] "Ensemble of Nanite formations" signifies an aggregated system of Nanite modules, potentially in a solution, affixed to a substrate, or anchored to a common foundation. "Nanite formation" generally denotes a designated DNA configuration fashioned for a specific role within the Nanite architecture.

[0444] The design of the Nanites can manifest in varied configurations, contingent upon distinct module activations and their interactions.

[0445] A distinct embodiment entails a computer program product equipped with specific software code to simulate and analyse interactions of the Nanite modules. Furthermore, a non-transitory computer-readable medium is provided, storing instructions tailored for the simulation and optimization of the Nanite system. Another facet of the Nanite invention includes a digital signal depiction outlining the operational schematic of Nanites. Such a representation is transmittable and can be integrated into computer systems with operating systems conducive to Nanite simulations and analytics. Furthermore, another approach entails the creation of the Nanite ensemble by first simulating its behaviour. Post-simulation, specific DNA sequences for each module are determined. The Nanite ensemble is then physically assembled based on these identified sequences.

[0446] Features described for any given Nanite module can potentially be repurposed as a methodological procedure, and vice versa. The features across various Nanite modules are malleable and can be executed in a multitude of combinations, bestowing the system with adaptability. Distinct combinations of features across Nanite modules can be independently conceptualized, implemented, and utilized to suit specific applications. Considering the diverse applications of Nanites, it's conceivable that features described as software implementations might also be translated to hardware forms and vice versa. All references to software and hardware functionalities should be interpreted in this light.

[0447] Nanites are preferably designed for digital counting rather than bulk intensity measurements, therefore Nanites offer enhanced sensitivity and specificity, however in some instantiations they may be tailored for intensity measurements.

[0448] Features and functionalities across the different Nanite modules are interchangeable and can be applied in diverse combinations, ensuring flexibility and adaptability. Specifically, methodologies pertaining to one module can be adapted to functionalities of another, enhancing the holistic efficiency of the Nanite system.

[0449] It's essential to acknowledge that unique combinations of features across the Nanite modules can be designed, deployed, and utilized independently, catering to specific applications and requirements.

[0450] As used herein, means plus function features of Nanites may be expressed alternatively in terms of their corresponding structure, such as a suitably programmed molecular matrix and associated memory within the nanite's core.

[0451] Applications and Advantages: Beyond mere target detection, Nanites facilitate extraction, purification, and concentration seamlessly integrated into the detection process, eliminating the need for cumbersome pre-processing steps .

[0452] Nanites are tailored for microfluidic microchamber containment arrays, emphasizing isolated detection over bulk ensemble reactions, as seen with traditional HCR hairpins, CHA, PCR and other systems of detection, enabling the potential for unprecedented sensitivity and specificity at high-speed through employment of Digital Counting and Bioassay principles. Simulations and experimental data, as elaborated later, showcase the superior sensitivity and functionality of Nanites compared to conventional methods.

[0453] In the illustrations DNA strands are depicted as lines, with the 5’ and 3’ ends indicated. Subsections of nucleotides as indicated by their bases(ATCG) are grouped into domains and given designations based on groups of corresponding lower-case letters - l.e. - (a) represents a domain and (a*) represents a region complementary. Domains are included as a means of illustrating modular, discrete regions which hybridise with one- another and is used as an aid to understanding the molecular interplay.

[0454] These and other aspects of the present invention will become apparent from the following exemplary embodiments that are described with reference to the following figures in which:

[0455] Figure 1B: Overview of Nanite components

[0456] A schematic representation showcasing the entire Nanite ensemble, including the Sentry, Stabilizer, and Signaller modules alongside representative target DNA. Corresponding domains are marked. The Nanite is designed to allow unparalleled molecular detection capabilities when paired with microchamber compartmentalisation and scanned with our reader instrument. The Nanite is precise enough to distinguish between molecular compositions with minute differences, akin to discerning between different DNA or RNA fragments. When a target molecule is detected, the Nanite causes a signal that is observable to a user (e.g., a fluorescent signal), facilitating instant feedback, preferably for research purposes. Because the Nanite identifies specific molecular structures, it can provide insight into the molecular composition and potential anomalies. The Nanite is formed of aptameric polymer composites through a custom laboratory protocol involving a selfassembly process, as is cutting-edge in the field. The target molecule to be detected is broken into domains a*, c* and b* respectively. Note, the target molecule is usually selffolded to varying degrees dependent upon the particular sequence composition of each individual target. For clarity, it is depicted unfolded in this illustration for ease of understanding. Domain a of the Sentry hybridises sequence specifically with the domain denoted a* on the target sequence to be detected. The aptameric arm of the Sentry begins self-folded with a small toehold region unpaired in the absence of the target molecule. The Stabilizer nanite possesses a single fluorophore molecule (F) and no quencher moieties and is organised to self-fold into a hairpin like structure (c* and c, with d as the unpaired loop region in between) in the absence of the target-molecule, with a long, exposed, singlestranded toehold region denoted b. The Signaller module comprises a single fluorophore molecule(F) and a long, unpaired single-stranded toehold region (d*), followed by a hairpin( c and c* with b* as the unpaired loop region in between.)

[0457] Figure 2B: Detailed Anatomy of the Sentry -Target-Stabilizer interaction

[0458] A zoomed-in illustration of the Sentry-target bound complex aligning to a Stabilizer module which is expanded to detail its multiple subunits which encompass specific DNA sequences designed for target molecule recognition. Appropriate co-hybridising domains are marked with the corresponding letter. The 5’ portion of the target sequence is sequence- specifically hybridised to the 3’ portion of a nanite arm on the surface of a Sentry. Following this initial attachment, the Sentry provided sufficient contact and access points (c*, which becomes exposed through at least the partial anchoring by the Sentry, exposing the c* domain and the b* domain of the target. The b* domain serves as the landing pad for the Stabilizer module whose single-stranded toehold region(denoted b) finds, and sequence specifically hybridises initiating a hybridisation through strand displacement of any present secondary structure of the target. Portions b and c of the Stabilizer sequence-specifically hybridise with the corresponding b* and c* portions of the target.

[0459] Figure 3B: Signaller Module Subunits and association with Sentry -Target- Stabilizer complex

[0460] A zoomed-in illustration of the Sentry-target-stabilizer bound complex aligning to a Signaller module which is expanded to detail its multiple subunits. With the Stabilizer anchoring the target to the Sentry, the remaining unpaired portion of the Stabilizer d provides the landing pad for Signaller module to hybridise sequence-specifically through its toehold domain d* - resulting in a sequence-specific hybridisation and strand displacement of the Signallers c* and c domain in favour of the signaller c hybridising to the stabilizers own c* module. The result of this association is a bound signaller which remains anchored to the Sentry and its captured target by way of the stabilizer module. The bound signaller leaves exposed a b* and c* domain which serves as the anchoring point for a second Stabilizer module.

[0461] Figure 8B: Signal Production from the signaller module schematic

[0462] A detailed portrayal of the Signaller module, emphasizing the sequences responsible for producing a detectable output (e.g., fluorescent) upon activation. In scheme i the Sentry Nanite is inactive, with no target interaction occurring. Scheme ii denotes a target by itself with the corresponding sections of interest annotated as domains. In scheme iii the Sentry anchors the target to its surface by way of toehold mediated strand-displacement and / or sequence specific hybridisation of the a* domain of the target with the a domain of the Sentry aptameric arm. Anchoring of the target molecule to the Sentry through domain a-a* hybridisation facilitates interaction of the Stabilizer module’s b and c domains which hybridise preferentially with the target over hybridising with itself in its self-folded state owing to favourable thermodynamics which drive the unwinding of the Stabiliser which minimises its free energy through preferential hybridisation to the target. In doing so, the stabiliser leaves unpaired its d and c* domains which facilitate the sequence-specific hybridisation of a signaller module through its unpaired d* overhang and the correspondingly complementary c domain. Once a first signaller module is hybridised to a first stabilizer, the remaining unpaired portion of the first signaller with domains b* and c* provides the necessary anchoring point for a second Stabilizer module to hybridise to. In this fashion, a sequencespecific hybridisation cascade can occur which results in the anchoring of the target to the Sentry and in parallel the production of a pronounced fluorescence increase through sequential addition of alternating Stabilizer and signaller modules.

[0463] Figure 5: Nanite use process

[0464] An illustration detailing the main steps in Nanite use experimentally. Scheme 1 Denotes the starting point which begins with a sample containing both the target molecule of interest in addition to other non-specific components. Scheme 2 involves simply the addition of Nanites(given to mean Sentry, Stabilizer and Signaller modules). Scheme 3 denotes a zoomed out depiction of the reaction as illustrated in more detail in figures 4 and 3. Once the reaction has occurred, the sample can be manipulated as in scheme 4 whereby a magnet is applied to the reaction tube to sequester the sentry and by proxy any captured target molecule and associated bound Stabilizer and signaller. Scheme 5 illustrates the simple wash-steps which can be performed through utilisation of the magnet, followed by decanting supernatant and resuspension in wash buffer. Scheme

[0465] Figure 6: Compartmentalization of Nanites Mechanism

[0466] A focused illustration of Nanite compartmentalisation into Large arrays of Femtoliter reaction chambers to confine a single Nanite as illustrated in scheme 6 of figure 5. The Nanite is here depicted anchoring a single target molecule to which Auxiliary Nanites Stabilizer and Signaller have initiated a hybridisation cascade upon. The small volume of the Femtoliter Array serves to house at most one Nanite-capture complex (Sentry-Target-and n amount of stabilizer and signaller respectively. Confinement in this small volume enables a digital counting methodology to be applied rendering single-molecule sensitivity and specificity through Nanites achievable.

[0467] Figure 7: Digital Simulation Framework

[0468] A flowchart and schematic representing the computer program product designed to simulate Nanite interactions. The software simulates experimental conditions and takes specific user-entered inputs to produce a tailored nanite sequence composition to the given target of interest. Inputs include the target sequence, reaction conditions such as ion concentration or workable temperature range as well as specified sub-domains of interest on the target. The software simulations provide an outputted Nanite sequence composition which can then be experimentally verified, and feedback / validations fed back into the software.

[0469] Figure 8A and 8C : Alternative Sentry Nanite aptamer arm configuration

[0470] An alternate design for the Nanite aptamer arms which features a different length toehold region with respect to a varying length self-folded hairpin-like component. The mechanism itself of the Nanite with respect to Sentry, Stabilizer and Signaller interactions remains unchanged from figure 3 and 4.

[0471] Numbered embodiments

[0472] 1. A programmable Aptameric polymer composite termed "Nanite", characterized by its hybrid silica / iron structure with embedded folded, reconfigurable DNA aptamers.

[0473] 2. The Nanite as per embodiment 1, designed to remain self-folded and inert in the absence of a target molecule.

[0474] 3. The Nanite as per embodiment 1 or 2, wherein upon presence of a target molecule, it activates and binds to the target molecule in a 1:1 molecular ratio.

[0475] 4. The Nanite as per any preceding embodiment, wherein activation of the Nanite initiates a hybridization cascade with other Nanite modules, resulting in a pronounced fluorescent signal.

[0476] 5. The Nanite as per any of the preceding embodiments, characterized by its dynamic fluorescent signal, shifting from red only (inactive) to additionally green (active) upon target capture.

[0477] 6. The Nanite as per any preceding embodiment, showcasing magnetic properties, enabling precise manipulation and confinement within in femtoliter-sized microfluidic chamber arrays .

[0478] 7. A method for designing Nanites using custom-developed algorithm / software tools, optimizing sequence design, thermodynamic stability, and functional performance.

[0479] 8. The Nanite as per any preceding embodiment, designed to function in microfluidic arrays, emphasizing isolated target detection.

[0480] 9. The Nanite as per any preceding embodiment, facilitating target extraction, purification, and concentration, negating the need for external pre-processing.

[0481] 10. A system comprising the Nanite as per any of embodiments 1 to 6, paired with microfluidic microchamber arrays, enabling enhanced sensitivity and specificity in target detection. 11. The Nanite as per in any preceding embodiment, distinctly different in design, functionality, and application compared to conventional HCR hairpins.

[0482] 12. A programmable Nanite as per any of the preceding embodiments, wherein its DNA aptamers are specifically designed for dynamic behaviour in response to environmental stimuli.

[0483] 13. The Nanite as per any preceding embodiment, designed with specific sequence lengths and bonding setups to enhance specificity and minimize off-target bindings.

[0484] 14. The Nanite as per any preceding embodiment, wherein its activation and subsequent chain reaction begins in seconds upon target detection.

[0485] 15. The Nanite as per embodiment 3, wherein the hybridization involves three dynamic Nanite components, emphasizing an enzyme-free, thermodynamically driven mechanism.

[0486] 16. The Nanite as per any preceding embodiment, designed to change its three- dimensional structure upon interaction with specific target sequences, facilitating target capture.

[0487] 17. A method for detecting target molecules using the Nanite as per any of embodiments 1 to 10, wherein the Nanites' shift in fluorescence signal provides a clear indication of target presence.

[0488] 18. The Nanite as per any preceding embodiment, wherein its arms are self-folded, rearrangeable aptamer sequences capable of specific hybridization and dynamic reconfiguration.

[0489] 19. The Nanite as per any preceding embodiment, devoid of Fluorophore-Quencher pairing, focusing on single fluorophores and subsequent fluorescence additions for signal detection.

[0490] 20. The Nanite as per any preceding embodiment, designed for applications in microfluidic arrays, ensuring each Nanite is physically isolated from others for precise individual target detection.

[0491] 21. The Nanite as per any preceding embodiment, where the iron core serves a dual purpose of imparting magnetic properties and adding weight to the structure, facilitating its confinement in the microfluidic arrays when spread across the surface.

[0492] 22. A system comprising the Nanite as per any of embodiments 1 to 10, and a magnet, facilitating the precise positioning and confinement of the Nanites.

[0493] 23. The Nanite as per any preceding embodiment, wherein its design and function differ significantly from traditional standard ensemble amplification hairpins measured in bulk, showcasing enhanced sensitivity and specificity in molecular detection. 24. The Nanite as per any preceding embodiment, wherein the thermodynamic equilibrium shifts in the presence of the target molecule, ensuring specific and precise target capture.

[0494] 25. A method utilizing the Nanite as per any of embodiments 1 to 10, which avoids heavy extraction and purification steps, simplifying the process of target molecule detection.

[0495] 26. The Nanite as per any preceding embodiment, designed for digital counting methodologies, distinguishing it from traditional bulk intensity measurement techniques.

[0496] Conclusion:

[0497] The present invention provides a novel and efficient approach to nucleic acid detection through the use of nanites. These programmable DNA nanostructures offer highly specific and sensitive target molecule recognition, along with exponential signal amplification through a hybridization chain reaction. The applications of nanites extend to various fields, including life sciences research and clinical diagnostics.

[0498] EXAMPLES

[0499] The invention is now described with reference to the Examples below. These are not limiting on the scope of the invention, and a person skilled in the art would be appreciate that suitable equivalents could be used within the scope of the present invention. Thus, the Examples may be considered component parts of the invention, and the individual aspects described therein may be considered as disclosed independently, or in any combination.

[0500] Example 1A - Sentry nanite preparation

[0501] An exemplary sentry nanite was prepared using the process outlined in this Example. Materials:

[0502] 1. Iron(lll) chloride hexahydrate (FeCI3 6H2O)

[0503] 2. Iron(ll) chloride tetrahydrate (FeCI2 4H2O)

[0504] 3. Sodium hydroxide (NaOH)

[0505] 4. Methacrylic acid (MAA)

[0506] 5. Sodium dodecyl sulfate (SDS)

[0507] 6. Azobisisobutyronitrile (Al BN) - initiator for polymerization

[0508] 7. Deionized (DI) water

[0509] 8. Nitrogen gas

[0510] 9. Ethanol

[0511] 10. Toluene

[0512] 11. Magnetic stirrer 12. Ultrasonicator

[0513] 13. Heating plate

[0514] 14. Reaction vessel (500 mL beaker or similar)

[0515] 15. Vacuum oven

[0516] Equipment:

[0517] • Ultracentrifuge

[0518] • Magnetic stirrer

[0519] • Vacuum filtration setup

[0520] • pH meter

[0521] • Thermometer

[0522] • our optical microscope

[0523] Procedure:

[0524] 1. Paramagnetic Core Synthesis (Fe3O4 Nanoparticles)

[0525] 1. Iron salt solution preparation: o 5.4 g of FeCI3 6H2O and 2 g of FeCI2 4H2O were dissolved in 100 mL of deionized water and stirred until completely dissolved.

[0526] 2. Degassing of the solution: o Nitrogen gas was bubbled through the solution for 15-20 minutes to remove dissolved oxygen. This step was crucial to avoid oxidation of Fe(ll) ions.

[0527] 3. Alkali solution preheating: o In a separate beaker, 100 mL of 1 M NaOH solution was prepared and heated to 80°C while stirring.

[0528] 4. Fe3O4 precipitation: o The iron salt solution was slowly added to the preheated NaOH solution while being stirred vigorously. This resulted in the formation of a black precipitate (Fe3O4). o Maintain the temperature at 80°C for an additional 30 minutes to ensure complete reaction.

[0529] 5. Washing: o After the reaction, the Fe3O4 precipitate was collected using a strong magnet or centrifugation (10,000 rpm for 10 minutes). o The precipitate was washed with deionized water at least three times to remove excess sodium ions. o Two further washes were completed using ethanol. The washed Fe3O4 cores were set aside.

[0530] 2. Polymer Coating (Methacrylic Acid Polymerization) Preparation 1. Fe3O4 dispersion in SDS solution: o In a 250 mL beaker, 100 mg of Fe3O4 nanoparticles were added to 100 mL of deionized water containing 0.5% (w / v) sodium dodecyl sulfate (SDS) as a surfactant. o The mixture was ultrasonicated for 30 minutes to ensure a uniform dispersion of the Fe3O4 nanoparticles.

[0531] 2. Methacrylic acid (MAA) addition: o 10 mL of methacrylic acid (MAA) was added to the solution and stirred under a nitrogen atmosphere to prevent any unwanted oxidation.

[0532] 3. Polymerization initiation: o 50 mg of azobisisobutyronitrile (Al BN) was dissolved in 5 mL of ethanol, and slowly added this solution to the MAA / Fe3O4 mixture. N.B. Al BN is a free radical initiator for the polymerization process. o The solution was heated to 70°C and stirred for 4 hours under nitrogen gas to promote polymerization of MAA around the Fe3O4 nanoparticles.

[0533] 4. Cooling and purification: o After polymerization had completed, the reaction mixture was cooled to room temperature. o Centrifugation (10,000 rpm for 10 minutes) was used to collect the coated Fe3O4 particles. The particles were washed thoroughly with ethanol and deionized water to remove any unreacted monomers and SDS. urface Functionalization with Carboxyl Groups

[0534] 1. Carboxyl activation (optional): o If needed for specific applications, the carboxyl groups on the surface of the microspheres can be activated using 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) and N-hydroxysuccinimide (NHS) for further conjugation to biomolecules like proteins or aptamers. An example procedure is illustrated below. o A solution of 50 mM EDC and 50 mM NHS in a MES buffer (pH 6.0) was prepared and the microspheres were incubated in this solution for 30 minutes. After incubation, the particles were washed with PBS to remove excess reagents. ize Characterization

[0535] 1. Particle size analysis: o The size of the carboxyl-functionalized paramagnetic microspheres was confirmed using dynamic light scattering (DLS) or optical microscopy. Washing or sonication procedures were adjusted to remove any aggregated particles. rying and Storage

[0536] 1. Lyophilization: o For long-term storage, the microspheres were dried by lyophilization or placed in a vacuum oven at 60°C for 12 hours.

[0537] 2. Storage: o The dried paramagnetic microspheres were stored in an airtight container under an inert atmosphere (such as nitrogen or argon) to prevent oxidation and maintain functionality. oating with plurality of first aptamer sequences

[0538] 1. Take out the Microsphere suspension. Perform a 30 second high vortex to glass bottle in order to disperse the microspheres evenly, they may have clumped while stationary in the fridge.

[0539] 2. To a single 2ml round bottom Eppendorf tube was added:

[0540] • The sentry nanite support prepared above (2.3e+9 microspheres per mL)

[0541] • 50 pL of 0.1 M MES pH 4.6

[0542] • 3 pL of aminated capture probe comprising a Cy5 label

[0543] • 3 pL of freshly prepared EDC aliquot (0.125 g in 2.5 ml of 0.1 MES, pH 4.6)

[0544] 3. The tube was covered in tinfoil immediately after addition of the reagents. The tube was keep out of the light for the entirety of the procedure.

[0545] 4. The mixture was vortexed for 30 seconds on a high speed setting.

[0546] 5. The tube, covered in tin-foil, was placed on the thermomixer at room temperature & stirred at 1550 rpm.

[0547] 6. After 30 minutes, a fresh further EDC aliquot (0.125 g in 2.5 mL of 0.1M MES, pH 4.6) was prepared and added to the reaction mixture.

[0548] 7. The reaction mixture was placed back on the thermomixer, covered, and stirred for a further 30 minutes at room temperature & 1550 rpm.

[0549] 8. After one hour, the tube was removed and placed on a custom 3D printed magnetic rack that ensured optimal magnet placement.

[0550] 9. 1 mL of PBS & 0.03% tween was added.

[0551] 10. The reaction mixture was vortexed on high speed for 30 seconds, then returned to the magnet rack.

[0552] 11. The supernatant was removed.

[0553] 12. 1 mL of prepared 0.1% SDS solution was added. 13. To form pellets, the reaction mixture was removed from the rack & vortexed on high speed for 30 seconds before being returned to the rack.14.

[0554] After the pellets had formed, the supernatant was removed and & replaced with 1 mL of 100 mM tris HCI, pH 7.4.

[0555] 15. The reaction mixture was vortexed on high speed for 30 seconds before being returned to the magnetic rack.

[0556] To facilitate pelleting, the method may further comprise:

[0557] 16. Replace the supernatant with 1 mL of PBS & 0.03% tween.

[0558] 17. Vortex on high for 30 seconds.

[0559] 18. Place back on magnetic rack

[0560] 19. Remove supernatant, replace with 100 pL of PBS & 0.03% tween.

[0561] 20. Vortex on high for 10 seconds.

[0562] Example 1 B - Sentry nanite imaging

[0563] The exemplary sentry nanite of Example 1A was imaged using fluorescent microscopy. The results are shown in FIG. 11. These results show that the sentry nanite supports have been successfully attached to the plurality of first aptamer sequences to afford the desired sentry nanites.

[0564] Example 2 - Detecting a target biomarker using an ensemble of the invention

[0565] In this Example an ensemble of the present invention was used to detect a 200bp segment ND5 NADH dehydrogenase subunit 5 of Sus Scrofa (Pig). This sequence is commonly targeted in assays for determining food adulteration, such as the presence of pork in beef.

[0566] Sequences (all 5’ to 3’):

[0567] • Sentry: Cy5 / TT TTA CGT AGT TAG GGT AAA GGT TAG TTT T / AmMO (SEQ ID NO: 1)

[0568] • Stabilizer: / 6-FAM / CA TCC CAA TTA TAA TAT TTG CCG ATA TTA TAA TTG GGA

[0569] TGT TGA GTT G (SEQ ID NO: 2)

[0570] • Signaller: CGG CAA ATA TTA TAA TTG GGA TGC AAC TCA ACA TCC CAA TTA TAA TAT / 6-FAM / (SEQ ID NO: 3)

[0571] • Target:

[0572] CATCCCAATTATAATATCCAACTCAAACATCTACAAAACTAACCTTTACCCTAACTA CGTAAAAACCACCGTATCCTACGCCTTCACTCTCAGCCTAGTCCCCTTACTAATAT TTATACACACAGGCCAAGAAATAATCATTTCAAACTGACATTGAATAACCCTACAG ACCGTAGAACTCTCTCTTAGCTTTAAAATAG (SEQ ID NO: 4) Reaction Setup

[0573] 1. Prepare Reaction Components: o Target: 5 pL of target DNA (1 pM, prepared from 100 pM stock) o Sentry: 5 pL of stabilizer (10 pM stock) o Stabilizer: 5 pL of stabilizer (10 pM stock) o Signaller: 5 pL of signaller (10 pM stock) o HCR Buffer: 10 pL of HCR buffer (0.5 M NaCI)

[0574] 2. Reaction Volume: The above components were combined in a PCR tube or a microcentrifuge tube.

[0575] Incubation Conditions

[0576] 3. Incubation: o The reaction mixture was placed on a thermomixer set to 37 °C with shaking at 1450 rpm. o The reaction mixture was incubated for 90 minutes to allow the hybridization chain reaction to proceed.

[0577] Buffer composition:

[0578] 0.5M NaCI, 50mM Na2HPO4, MilliQ H2O

[0579] The exemplified ensemble was capable of detecting the test target: 200bp segment ND5 NADH dehydrogenase subunit 5 of Sus Scrofa, demonstrating the functionality of the ensembles of the invention.

[0580] Example 3 - Ensembles of the invention detect targets with high sensitivity

[0581] In this Example the high sensitivity of the method was demonstrated.

[0582] The method has been applied using target biomarkers selected from: E.coli, Salmonella, Sus-Scrofa (sequences included above). Bos Taurus (N=33) experimental runs were performed on each on the various sequences for sensitivity & specificity evaluation, with an average obtained sensitivity of 12 molecules obtained at <12% Coefficient of Variance for sensitivity and <25% Coefficient of Variance for specificity respectively. A calibration curve was generated over 4 logs from 1 fM to 1 aM (r2 = 0.997). A Log-log plot of the average number of captured and tagged target molecules per nanite (A) as a function of the target concentration enzyme / direct target-free amplification down to 1 aM in 20 pL was achieved, equal to detection and absolute quantification of just 12 target molecules. This plot is shown in FIG. 12.

[0583] Example 4 - Confirmation of the mechanism by which the ensembles of the invention function

[0584] This Example demonstrates the mechanism by which the ensembles of the invention function.

[0585] The method of Example 2 was used with the following reaction conditions:

[0586] • 90 mins @ 37 degrees, 1450 rpm shaking

[0587] • 5 pl of target (1 pm made from 100 pM stock),

[0588] • 5 pl of stabilizer (10 pM stock),

[0589] • 5 pl of signaller (10 pM stock),

[0590] • 10 pl of HCR buffer (0.5M NaCI)

[0591] The results are shown in FIG. 13. FIG. 13 shows the correct functionality of the mechanism - Lane 2 shows target biomarker on its own as a single band, Lane 3 shows the stabilizer and signaller on their own, we see a small degree of self-activation as evidenced by the faint ‘ladder’ of bands but largely they are concentrated and unreacted at the 50bp approximate position. From lane 4 we see 1 micromolar of target is given the stabilizer and signaller which sets of a strong chain reaction of chain concatenation, as evidence by the deep, dark colour and tight, frequent ladders - which is indicative of various lengths of target-stabilizer-signaller as the chain increases in length - we see this exceed 1000 bases. We also see in lane 4 by comparison with lane 3 that there is no concentrated unreacted band (as there was in lane 3) because the stabilizer and signaller are now all being utilized in concatenation / cascading of hybridisation on the target. Lane 5 shows that increasing the target concentration above that of the given stabilizer and signaller reduces the average length of the chains by comparison with lane 4 - this is due to the target now exceeding the available stabiliser and signaller concentration. Lanes 6 and 7 show that both stabiliser and signaller are required in order to set off this reaction - as lane 6 is just target and stabilizer- and we see no concatenation, and similarly, with lane 7; target and signaller - no concatenation occurs - as evidenced by two discrete bands at target and unreacted stabiliser and signaller, respectively.

Claims

CLAIMS1. An ensemble for detecting a target biomarker, the ensemble comprising:A) a “sentry nanite” comprising a plurality of first aptamer sequences bound to a support in particle form, wherein the plurality of first aptamer sequences are adapted for hybridisation with a target biomarker;B) at least one “stabiliser nanite” comprising a second aptamer sequence adapted for hybridisation with the target biomarker and a third aptamer sequence; andC) at least one “signaller nanite” comprising a third aptamer sequence adapted for hybridisation with the second aptamer sequence, wherein the third aptamer sequence comprises a first label.

2. An ensemble according to claim 1 , wherein:A) the second aptamer sequence is capable of simultaneously hybridising with: (i) both the target biomarker and the third aptamer sequence; and (ii) two copies of the third aptamer sequence; and / orB) the third aptamer sequence is capable of simultaneously hybridising with two copies of the second aptamer sequence; and / orC) the first aptamer sequence is not capable of hybridising with the second aptamer sequence or the third aptamer sequence.

3. An ensemble according to claim 1 or 2, wherein:A) the second aptamer sequence comprises a first toehold domain which is capable of hybridising with the target biomarker and is capable of hybridising with the third aptamer sequence; and / orB) the third aptamer sequence comprises a second toehold domain which is capable of hybridising with the second aptamer sequence; and / orC) the first aptamer sequence comprises a third toehold domain which is capable of hybridising with the target biomarker.

4. An ensemble according to any one of the preceding claims, wherein:A) the second aptamer sequence is adapted to release a first trigger domain on hybridisation of the second aptamer sequence to the target biomarker or the third aptamer sequence, wherein the release is by competitive hybridisation; andB) the first trigger domain is capable of hybridising with the second toehold domain of the third aptamer sequence.

5. An ensemble according to any one of the preceding claims, wherein:A) the third aptamer sequence is adapted to release a second trigger domain on hybridisation of the third aptamer sequence to the second aptamer sequence, wherein the release is by competitive hybridisation; andB) the second trigger domain is capable of hybridising with a second copy of the second aptamer sequence.

6. An ensemble according to any one of the preceding claims, wherein:A) the first aptamer sequence comprises a domain “a” which is adapted for hybridisation to a domain “a*” of the target biomarker;B) the second aptamer sequence comprises: a) a first toehold domain “b” which is adapted for hybridisation to a domain “b*” of the target biomarker; b) a domain “c” which is adapted for hybridisation to a domain “c*” of the third aptamer sequence and a domain “c*” of the target biomarker; c) a domain “c*” which is adapted for hybridisation to a domain “c” of the third aptamer sequence; and d) a first non-complementary loop structure “d” which is adapted for hybridisation to a second toehold domain “d*” of the third aptamer sequence; whereby hybridisation of the first toehold domain “b” of the second aptamer sequence to domain “b*” of the target biomarker releases the first trigger domain; wherein the release is by competitive hybridisation and the first trigger domain comprises domain “c*” and preferably further comprises domain “d”; andC) the third aptamer sequence comprises: a) a second toehold domain “d*” which is which is adapted for hybridisation to a domain “d” of the second aptamer; b) a domain “c” which is adapted for hybridisation to domain “c*” of the second aptamer sequence and domain “c*” of the target biomarker; c) a domain “c*” which is adapted for hybridisation to domain “c” of the second aptamer sequence; and d) a second non-complementary loop structure “b*” which is adapted for hybridisation to a first toehold domain “b” of the second aptamer sequence; whereby hybridisation of domain “d*” of the third aptamer sequence to domain “d” of the second aptamer sequence releases the second trigger domain, wherein the release is by competitive hybridisation and the second trigger domain comprises domain “c” and preferably further comprises domain “b*”.

7. An ensemble according to any one of the preceding claims, wherein:A) the sentry nanite plurality of first aptamer sequences comprise one or more non- complementary loop structures and one or more complementary stem structures, preferably wherein the one or more non-complementary loop structures are from about 6 bases to about 8 bases in length, more preferably wherein the one or more non-complementary loop structures are about 6 bases or about 8 bases in length, optionally wherein the one or more complementary stem structures are shorter than the one or more non-complementary loop structures; and / orB) the stabiliser nanite second aptamer sequence comprises one or more non- complementary loop structures and one or more complementary stem structures, preferably wherein the one or more non-complementary loop structures are from about 6 bases to about 8 bases in length, more preferably wherein the one or more non-complementary loop structures are about 6 bases or about 8 bases in length, optionally wherein the one or more complementary stem structures are longer than the one or more non-complementary loop structures; and / orC) the signaller nanite third aptamer sequence comprises one or more non- complementary loop structures and one or more complementary stem structures, preferably wherein the one or more non-complementary loop structures are from about 6 bases to about 8 bases in length, more preferably wherein the one or more non-complementary loop structures are about 6 bases or about 8 bases in length, optionally wherein the one or more complementary stem structures are longer than the one or more non-complementary loop structures.

8. An ensemble according to claim 7, wherein the one or more complementary stem structures of the first and / or second and / or third aptamer sequences comprise one or more nucleotide base mismatches, optionally wherein:A) the one or more complementary stem structures of the first and / or second and / or third aptamer sequences comprises from about 1 to about 5 nucleotide base mismatches;B) the one or more nucleotide base mismatches are present within 5, preferably within 3, more preferably within 1 nucleotide of the 5’ and / or 3’ end of one or more non- complementary loop structures.

9. An ensemble according to any one of the preceding claims, wherein the support:A) is spherical; and / orB) comprises silica; and / orC) comprises or consists of one or more ferromagnetic metals, compounds thereof, or alloys thereof; and / orD) comprises a polymer coating.

10. An ensemble according to claim 9, wherein:A) the one or more ferromagnetic metals, compounds thereof, or alloys thereof, are selected from iron, cobalt, nickel, steel, stainless steel, hematite, and magnetite (FesC ), preferably magnetite; and / orB) the one or more ferromagnetic metals, compounds thereof, or alloys thereof, are encapsulated by the support material; and / orC) the one or more ferromagnetic metals, compounds thereof, or alloys thereof, are present as a dispersion throughout the support, preferably as a microcrystalline dispersion, more preferably as a microcrystalline magnetite dispersion, most preferably as about a 20% microcrystalline magnetite dispersion; and / orD) the plurality of first aptamer sequences are bound to the support via the polymer coating, e.g., via a plurality of amide groups, preferably wherein the polymer coating is a surface polymer coating comprising carboxylic acid functional groups, e.g., (poly)methacrylic acid (PMAA).

11. An ensemble according to any one of claims 6 to 10, wherein domain “a” of the first aptamer sequence consists of a nucleotide sequence that is greater than about 15 nucleotides in length, preferably wherein the nucleotide sequence is from about 20 to about 50 nucleotides in length, e.g., about 45 nucleotides in length.

12. An ensemble according to any one of the preceding claims, wherein the stabiliser second aptamer sequence consists of a nucleotide sequence that is greater than or equal to 12 nucleotides in length, preferably greater than or equal to 18 nucleotides in length, for example between 18 and 20 nucleotides in length.

13. An ensemble according to any one of claims 3 to 12, wherein:A) the first toehold domain consists of a nucleotide sequence that is greater than or equal to 6 nucleotides in length, for example between 6 and 8 nucleotides in length; and / orB) the second toehold domain consists of a nucleotide sequence that is greater than or equal to 6 nucleotides in length, for example between 6 and 8 nucleotides in length; and / orC) the third toehold domain consists of a nucleotide sequence that is greater than or equal to 6 nucleotides in length, for example between 6 and 8 nucleotides in length.

14. An ensemble according to any one of the preceding claims, wherein:A) the first label is a fluorophore, preferably wherein the fluorophore is Cy3 or more preferably 6-FAM (fluorescein), e.g., 3’ 6-FAM; and / orB) the stabiliser nanite comprises a second label, optionally wherein the label is a fluorophore, preferably wherein the fluorophore is Cy3, more preferably wherein the second fluorophore is 6-FAM (fluorescein), e.g., 5’ 6-FAM; and / orC) the sentry nanite comprises a third label, optionally wherein the label is a fluorophore, preferably wherein the fluorophore is Cy5, e.g., 5’ Cy5; and / orD) the sentry nanite comprises fourth label, optionally wherein the label is a dye, preferably wherein the dye is a fluorescent dye, more preferably wherein the fluorescent dye is selected from (i) 4',6-diamidino-2-phenylindole (DAPI) or (ii) a lanthanide or lanthanide complex e.g., Eu3+or a complex thereof.

15. An ensemble according to claim 14 wherein:A) the third label is different to the first label and the second label; and / orB) the first label and the second label are the same.

16. An ensemble according to any one of the preceding claims, wherein the sentry nanite, stabiliser nanite, and / or the signaller nanite do not comprise a quencher.

17. An ensemble according to any one of the preceding claims, wherein the first, second, and third aptamer sequences are nucleic acid aptamer sequences, e.g. DNA aptamer sequences.

18. An ensemble according to any one of the preceding claims, wherein the target biomarker is a polynucleotide, e.g., an oligonucleotide.

19. An ensemble according to any one of claims 6 to 18, wherein:A) the “a*” domain of the target biomarker consists of a nucleotide sequence that: a) is greater than or equal to 30 nucleotides in length; and / or b) does not comprise one or more palindromic structures of 5 or more nucleotides; and / or c) does not comprise one or more consecutive sequences of more than four identical nucleotides; and / or d) is located: i) at the 5’ end of the target biomarker; and / orii) closer to the 5’ end of the target biomarker than the “b*” and “c*” domains, preferably wherein the “a*” domain is located no more than 10, more preferably no more than 5, yet more preferably no more than 3 nucleotides from the 5’ end of the target biomarker; and / or e) has a 3’ end located at least 10 nucleic acids, preferably at least 20 nucleic acids from the 5’ end of the “c*” domain of the target biomarker; and / orB) the “c*” domain of the target biomarker consists of a nucleotide sequence that: f) is greater than or equal to 17 nucleotides in length; and / or g) differs to the “a*” domain of the target biomarker by at least 4, preferably at least 6, more preferably at least 8, yet more preferably at least 10 nucleotides; and / or h) is located: i) at the 3’ end of the target biomarker; and / or ii) closer to the 3’ end of the target biomarker than the “a*” and “b*” domains, preferably wherein the “c*” domain is located no more than 10, more preferably no more than 5, yet more preferably no more than 3 nucleotides from the 3’ end of the target biomarker; and / orC) the “b*” domain of the target biomarker consists of a nucleotide sequence that: i) is greater than or equal to 8 nucleotides in length; and / or j) has less than 40% G- and / or C-containing nucleotides; and / or k) differs to the “c*” domain of the target biomarker by at least 1 , preferably at least 3, more preferably at least 5, yet more preferably at least 10 nucleotides; and / or l) is located further from the 5’ end of the target biomarker than the “a*” domain and is located further from the 3’ end of the target biomarker than the “c*” domain; and / or m) is located adjacent to the “c*” domain of the target biomarker with no intervening nucleotides; and / orD) the “a*”, “b*”, and “c*” domains of the target biomarker are arranged in this order, preferably arranged in this order from the 5’ to the 3’ end; and / orE) the “b*” and “c*” domains of the target biomarker do not overlap, preferably wherein the “a*”, “b*”, and “c*” domains of the target biomarker do not overlap.

20. An ensemble according to claim 19 wherein the polynucleotide is greater than or equal to 55 nucleotides in length.

21. An ensemble according to any one of claims 6 to 20, wherein:A) the second aptamer sequence comprises domains “b”, “c”, “d”, and “c*” arranged in this order, preferably arranged in this order from the 5’ to the 3’ end; and / orB) the third aptamer sequence comprises domains “d*”, “c”, “b*”, and “c*” arranged in this order, preferably arranged in this order from the 3’ to the 5’ end.

22. An ensemble according to any one of claims 6 to 21 , wherein:A) the “b” domain of the second aptamer sequence consists of a nucleotide sequence that has less than 40% G- and / or C-containing nucleotides; and / orB) the “c” domain of the second aptamer sequence consists of a nucleotide sequence that: b) has less than 40% G- and / or C-containing nucleotides; and / or c) is at least 10 nucleotides in length, preferably between 12 and 30 nucleotides, for example 17 nucleotides; and / orC) the “d” domain of the second aptamer sequence consists of a nucleotide sequence that: d) is about 6 bases to about 8 bases in length, preferably wherein the one or more non-complementary loop structures are about 6 bases or about 8 bases in length; and / or e) differs from the length of the “b” domain by less than 5, preferably less than 3, more preferably less than 1 , yet more preferably 0 nucleotides; and / or f) is not self-complementary, preferably wherein it does not have more than 6, preferably not more than 4, yet more preferably not more than 2 consecutive nucleotides which are complementary with the same number of consecutive nucleotides elsewhere in the “d” domain; and / or g) differs from the length of the “d*” domain by less than 5, preferably less than 3, more preferably less than 1 , yet more preferably 0 nucleotides; and / orD) the “b*” domain of the third aptamer sequence consists of a nucleotide sequence that: h) is about 6 bases to about 8 bases in length, preferably wherein the one or more non-complementary loop structures are about 6 bases or about 8 bases in length; and / or i) is not self-complementary, preferably wherein it does not have more than 6, preferably not more than 4, yet more preferably not more than 2 consecutive nucleotides which are complementary with the same number of consecutive nucleotides elsewhere in the “b*” domain; and / or j) differs from the length of the “b” domain by less than 5, preferably less than 3, more preferably less than 1 , yet more preferably 0 nucleotides; and / or k) is located adjacent to the “c*” domain of the third aptamer sequence with no intervening nucleotides; and / orE) the “b” domain of the third aptamer sequence consists of a nucleotide sequence that has less than 40% G- and / or C-containing nucleotides; and / orF) the “a” domain of the first aptamer sequence consists of a nucleotide sequence that: l) does not have more than 4 consecutive nucleotides which are complementary with 4 consecutive nucleotides in the “b”, “c”, “d”, and / or “c*” domains of the second aptamer sequence and / or the “d*”, “c”, “b*”, and / or “c*” domains of the third aptamer sequence; and / or m) is linear, i.e. it is not self-complementary.

23. The sentry nanite, the stabiliser nanite, and / or the signaller nanite as defined by any of the preceding claims.

24. A conjugate comprising:A) a sentry nanite;B) at least one stabiliser nanite;C) at least one signaller nanite; andD) at least one target biomarker; wherein the sentry nanite, stabiliser nanite, signaller nanite, and target biomarker are as defined in any of the preceding claims.

25. A conjugate according to claim 24, wherein:A) domain “a” of the first aptamer sequence is hybridised to domain “a*” of the at least one target biomarker;B) the first toehold domain “b” of a first stabiliser nanite is hybridised to domain “b*” of the at least one target biomarker;C) domain “c” of the first stabiliser nanite is hybridised to domain “c*” of the at least one target biomarker;D) the first non-complementary loop structure “d” of the first stabiliser nanite is hybridised to the second toehold domain “d*” of a first signaller nanite; andE) domain “c*” of the first stabiliser nanite is hybridised to domain “c” of the first signaller nanite.

26. A conjugate according to claim 24 or 25, wherein the conjugate comprises one or more polymer chains extending from the plurality of first aptamer sequences bound to the support of the sentry nanite; wherein the one or more polymer chains comprise the first aptamer sequence, at least one target biomarker, two or more copies of the stabiliser nanite, and two or more copies of the signaller nanite.

27. A conjugate according to any one of claims 24 to 26, wherein the conjugate comprises one or more polymer chains each comprising two or more copies of the stabiliser nanite and two or more copies of the signaller nanite; wherein each of the one or more polymer chains comprise hybridisation between:A) the second non-complementary loop structure “b*” of the two or more copies of the signaller nanite and the first toehold domain “b” of the two or more copies of the stabiliser nanite;B) domain “c*” of the two or more copies of the signaller nanite and domain “c” of the two or more copies of the stabiliser nanite;C) the first non-complementary loop structure “d” of the two or more copies of the stabiliser nanite and the second toehold domain “d*” of the two or more copies of the signaller nanite; andD) domain “c*” of the two or more copies of the stabiliser nanite and domain “c” of the two or more copies of the signaller nanite; optionally wherein the polymer is a linear polymer.

28. A conjugate according to any one of claims 24 to 27, wherein the conjugate has a diameter of less than about 10 pm, preferably between about 2.7 pm and about 4 pm, more preferably about 3 pm.

29. A method for releasing the hybridised at least one target biomarker from the conjugate of any one of claims 24 to 28, wherein the method is not a photochemical process; optionally wherein the released target biomarker is isolated e.g., as a conjugate with one or more of the sentry, stabiliser, and / or signaller nanites, or in isolation.

30. A kit for detecting the presence of a target biomarker in a sample fluid comprising:A) a sentry nanite;B) at least one stabiliser nanite;C) at least one signaller nanite; andD) instructions for use; wherein the sentry nanite, stabiliser nanite, and signaller nanite are as defined in any of the preceding claims.

31. A method for detecting the presence of a target biomarker in a sample fluid, the method comprising the use of an ensemble according to any one of claims 1 to 22, thesentry nanite, the stabiliser nanite, and / or the signaller nanite according to claim 23, the conjugate according to any one of claims 24 to 28, or the kit according to claim 30.

32. The method according to claim 31 , wherein the method comprises the formation of one or more polymer chains extending from the plurality of first aptamer sequences bound to the support of the sentry nanite; wherein each of the one or more polymer chains comprise the first aptamer sequence, at least one target biomarker, two or more copies of the stabiliser nanite, and two or more copies of the signaller nanite; preferably wherein each of the polymer comprises: a) two or more first labels; b) two or more second labels; c) a third label; and / or d) a fourth label; wherein the two or more first labels, two or more second labels, third label, and / or fourth label are as defined in any of the preceding claims.

33. The method according to claim 31 or 32, wherein the method comprises the use of a sentry nanite comprising a support comprising or consisting of one or more ferromagnetic metals, compounds thereof, or alloys thereof; wherein the method additionally comprises the following steps:A) contacting the sample fluid with an ensemble according to any one of claims 1 to 22 or components A) to C) of the kit according to claim 30, in a vessel, preferably wherein the sample fluid is diluted with a liquid medium, e.g., an aqueous buffer solution;B) agitating the mixture in the vessel;C) exposing the vessel to a magnetic field;D) decanting the liquid from the vessel while retaining the exposure to the magnetic field;E) rinsing the contents of the vessel while retaining the exposure to the magnetic field;F) removing the magnetic field;G) resuspending the mixture;H) dispensing the resuspended mixture on to a microchamber array microfluidic chip; andI) visualising the array, e.g., by monitoring fluorescence.

34. The method according to claim 33 wherein the microchamber array microfluidic chip is a femtolitre array.

35. The method according to any one of claims 31 to 34, wherein:A) the concentration of the sentry nanite is about 1 pM; and / orB) the concentration of each of the stabiliser nanite and signaller nanite is between about 1 nM and about 1 pM; and / orC) the concentration of the stabiliser nanite and signaller nanite is about the same, preferably where it is the same, for example about 1 pM; and / orD) the concentration of the stabiliser nanite and / or signaller nanite is greater than the concentration of the sentry nanite, preferably about 2 times greater, more preferably about 5 times greater than the concentration of the sentry nanite; and / orE) each of the concentrations of the sentry nanite, stabiliser nanite, and signaller nanite are greater than the concentration of the target, e.g., in excess; and / orF) the temperature is greater than or equal to 20 °C, and / or less than or equal to 85 °C; and / orG) the salt concentration is greater than or equal to 0.05 M Na+.

36. A method according to any one of claims 31 to 35, wherein the sample fluid is selected from: blood, plasma, saliva, serum, sputum, urine, joint fluid, cerebral spinal fluid, synovial fluid, cells, a cellular extract, a tissue sample, a tissue biopsy, lymph, milk, pleural effusion, tissue infiltration, and stool sample and the like.

37. A method according to any one of claims 31 to 36, wherein the method additionally determines the concentration of the target biomarker, wherein the limit of detection of the method is 1 x io18M.

38. A method for determining one or more of the first, second, and third aptamer sequences of any one of the previous claims, the method comprising the selection of a target biomarker and the use of a computer algorithm.

39. A process for making a sentry nanite, the process comprising the steps of:A) providing a support, optionally wherein: a) the support comprises or consists of one or more ferromagnetic metals, compounds thereof, or alloys thereof; or b) the support comprises silica and a microcrystalline dispersion of one or more ferromagnetic metals, compounds thereof, or alloys thereof, for example a microcrystalline magnetite dispersion;B) coating the support with a polymer coating, preferably a surface polymer coating comprising carboxylic acid functional groups, e.g., (poly)methacrylic acid (PMAA); andC) contacting the coated support with a plurality of first aptamer sequences and a coupling agent, preferably wherein the first aptamer sequences comprise a free amine group e.g., an amino modifier modification such as 3’AmMO.

Images