Construction of non-human primate usher syndrome disease model having USH2a gene mutation

Abstract

The construction of a non-human primate Usher syndrome disease model having USH2A gene mutation, wherein a target sequence against the mRNA of the non-human primate USH2A gene is established and a corresponding sgRNA is synthesized, then a knockout vector is constructed, the sgRNA and a Cas9 mRNA are mixed and injected into a non-human primate embryo to obtain a non-human primate embryo having USH2A gene knockout, and then by means of embryo transfer, a non-human primate having USH2A gene knockout is obtained, which exhibits symptoms of Usher syndrome. Upon detection and identification of the knockout effect, the knockout of the USH2A gene can be effectively realized in a non-human primate cynomolgus monkey embryo and cynomolgus monkeys, which provides a new and effective disease model for the diagnosis and treatment of Usher syndrome in non-human primates.

Description

Construction of a non-human primate Usher syndrome model with USH2A gene mutation Technical Field

[0001] The present invention belongs to the field of genetic engineering technology, and more specifically, relates to the construction of a non-human primate Usher syndrome disease model with a USH2A gene mutation. Background Art

[0002] The USH2A gene is located on chromosome 1q41. The protein encoded by USH2A, Usherin, is expressed in both the human retina and cochlea, playing an important role in maintaining the structure and function of retinal photoreceptors and inner ear hair cells. Mutations in USH2A can cause nonsyndromic retinitis pigmentosa (nRP) and Usher syndrome type II (USH II). To date, the pathogenesis of USH2A-mutated RP / USH II remains unclear, and treatment options are limited. According to statistics, 50% to 75% of all Usher syndrome patients are caused by USH2A mutations, while 12% to 25% of RP patients are caused by USH2A mutations. Over 690 pathogenic USH2A mutations have been identified, including splicing, deletion, and missense mutations, but the vast majority of these mutations are compound heterozygous. Even within the same family, the same mutation can lead to significant variability in the course of clinical manifestations, significantly increasing the complexity of understanding the genetic makeup of the disease.

[0003] Mutations in USH2A are known to be associated with nonsyndromic retinitis pigmentosa (nRP) and Usher syndrome type II (USH II). nRP is characterized by a gradual decline in visual function in early adulthood, with the absence of rod and cone responses on electroretinography. It is a progressive disease characterized by night blindness as the initial symptom. Patients experience delayed dark adaptation and difficulty walking in dim light or at night. The visual field of both eyes gradually decreases concentrically, with early annular visual defects developing into tunnel vision or total blindness, with progressive visual loss. As the disease progresses, central vision is ultimately impaired, and half of patients become completely blind by middle age. USH II is characterized not only by the gradual decline in visual function in early adulthood, reflecting the retinal degeneration of nRP, but also by moderate to severe sensorineural hearing loss, which follows a curvilinear pattern, with mild to moderate deterioration in low-frequency hearing and severe deterioration in high-frequency hearing.

[0004] Currently, only zebrafish and mouse models have been reported as animal models for USH2A gene mutations. However, the retinal and sensorineural lesion characteristics and disease progression of zebrafish and mouse gene mutation models are inconsistent with those of humans, making it difficult to accurately simulate the pathogenesis and development of USH2A mutation retinal degeneration. However, there are no reports on primate models of USH2A gene editing. The use of non-human primates as models of retinal degeneration and sensorineural hearing loss for related research is more convincing than previous studies in zebrafish and rodents. There are no detailed reports on how the inner retinal neurons change at different ages after birth in mammals, and there are relatively few studies on the morphological structure and function of USH2A retinopathy. Technical issues

[0005] To address the deficiencies in existing animal models for non-human primate retinopathy and sensorineural hearing loss, the present invention first provides a sgRNA targeting the USH2A gene. USH2A gene knockout is then performed in relevant non-human primates to construct relevant models. This application provides new approaches for early diagnosis, intervention, prevention, and treatment of retinopathy and sensorineural hearing loss caused by USH2A mutations.

[0006] The second object of the present invention is to provide the use of the above-mentioned sgRNA targeting the USH2A gene.

[0007] The third object of the present invention is to provide a method for constructing a non-human primate model targeting USH2A gene knockout using the above-mentioned sgRNA targeting the USH2A gene. Technical Solutions

[0008] The purpose of the present invention is achieved through the following technical solutions:

[0009] First, the present invention provides an sgRNA combination for targeted knockout of the USH2A gene, wherein the sgRNA combination is USH-1, USH-2, USH-3, and USH-4, wherein USH-1 is composed of sgRNA1-1 and sgRNA1-10, USH-2 is composed of sgRNA1-1 and sgRNA1-2, USH-3 is composed of sgRNA1-1 and sgRNA1-7, and USH-4 is composed of sgRNA1-2 and sgRNA1-7; wherein the sequences of sgRNA1-1, sgRNA1-2, sgRNA1-7, and sgRNA1-10 are shown in SEQ ID NOs: 1 to 4, respectively.

[0010] The present invention targets the USH2A gene editing exon, designs and screens a sgRNA combination that specifically knocks out the USH2A gene, obtains mutant embryos through embryo injection, and sequences the mutant embryos. The results show that the editing efficiency of the combined sgRNA is 100%.

[0011] As a specific embodiment, the non-human primate of the present invention is a cynomolgus monkey.

[0012] Embryos injected with the aforementioned sgRNA combinations were cultured to blastocysts and then transplanted into the uterus of surrogate females. After birth, offspring were collected for genotyping of the USH2A gene target site fragment, characterization of retinal pathology, and otoacoustic emission (OAE) testing. Results showed that USH2A gene expression in the knockout non-human primate (M5) was significantly lower than that in the control group. Otoacoustic emission (DPOAE) testing in 3-month-old M5 animals revealed a significantly lower signal-to-noise ratio (SNR) in the 3-12 kHz range compared to the control group, suggesting abnormal cochlear outer hair cell function in both ears of the USH2A-edited non-human primate. Retinal electrophysiological testing in 5-month-old M5 animals revealed significantly lower a-wave amplitudes in both eyes compared to the control group, indicating significant retinal impairment in these animals. Therefore, preferably, the above-mentioned sgRNA combination for targeting and knocking out the USH2A gene is USH-1.

[0013] By using a combination of sgRNAs to target and knock out the USH2A gene, non-human primates exhibiting retinal disease and hearing abnormalities can be obtained. Therefore, the present invention also provides applications of the sgRNA combination for targeting and knocking out the USH2A gene, wherein the application includes at least any one of the following:

[0014] (1) Used for knockout of USH2A gene;

[0015] (2) Used to construct an animal model of Usher (hereditary deafness-retinitis pigmentosa) syndrome;

[0016] (3) Used to construct animal models of hereditary retinitis pigmentosa or degenerative retinal degeneration;

[0017] (4) Used to construct an animal model of sensorineural hearing loss;

[0018] (5) Used to screen animal models of Usher (hereditary deafness-retinitis pigmentosa) syndrome;

[0019] (6) Used to screen animal models of hereditary retinitis pigmentosa or degenerative retinal degeneration;

[0020] (7) Used to screen animal models of hereditary sensorineural hearing loss.

[0021] Preferably, for the above-mentioned application (2), application (3) and application (4), the operation method is: using embryo micromanipulation technology to mix the sgRNA combination and Cas9mRNA respectively to obtain a gene editing vector mixture, and then injecting them into non-human primate embryos respectively, and then culturing the embryos and transplanting the embryos into the uterus of a surrogate female animal. The obtained offspring animals are screened to show Usher (hereditary deafness-retinitis pigmentosa) syndrome, which can be used as an animal model of Usher (hereditary deafness-retinitis pigmentosa) syndrome, or hereditary retinitis pigmentosa or degenerative retinal degeneration, or sensorineural hearing loss.

[0022] Specifically, when the sgRNA combination is USH-1, the USH-1 application can also include at least any of the following:

[0023] (1) Used for knockout of the Ush2a gene;

[0024] (2) Used to construct an animal model of Usher (hereditary deafness-retinitis pigmentosa) syndrome;

[0025] (3) Used to construct animal models of hereditary retinitis pigmentosa or degenerative retinal degeneration;

[0026] (4) Used to construct an animal model of sensorineural hearing loss;

[0027] (5) Used to screen animal models of Usher (hereditary deafness-retinitis pigmentosa) syndrome;

[0028] (6) Used to screen animal models of hereditary retinitis pigmentosa or degenerative retinal degeneration;

[0029] (7) Used to screen animal models of hereditary sensorineural hearing loss.

[0030] The present invention also provides a method for a non-human primate model for targeted USH2A gene knockout, which comprises synthesizing the sgRNA combination in vitro and using gene editing technology to knock out the non-human primate USH2A gene sequence.

[0031] Preferably, the gene editing technology includes at least one of CRISPR / Cas9 technology and Cre‑loxp gene knockout technology.

[0032] More preferably, the method for preparing the above-mentioned animal model is to mix a donor vector containing a sgRNA combination targeting the USH2A gene and Cas9 mRNA, transform it into a fertilized egg of a non-human primate, and transplant the embryo into the uterus of a surrogate non-human primate to obtain a non-human primate model with targeted USH2A gene knockout in the offspring.

[0033] As a specific embodiment, the method for preparing the above-mentioned animal model, the steps of synthesizing in vitro the sgRNA combination for targeted knockout of the USH2A gene are as follows:

[0034] (1) Based on the sgRNA combination for targeted knockout of the USH2A gene, primers were designed and synthesized, and then PCR amplification was performed using the px459 vector as a template to obtain a transcription DNA template;

[0035] (2) Transcribe the transcription DNA template prepared in step (1) to obtain sgRNA.

[0036] More preferably, the nucleotide sequence of the primer in step (1) is as follows:

[0037] Ush2a sgRNA 1-1 F:

[0038] 5'-TAATACGACTCACTATAGATTGACAAAAGAGAGAGGATGGGTTTTAGAGCTAGAAATAGC-3';

[0039] gRNA PCR R: 5'-AGCACCGACTCGGTGCCACTT-3';

[0040] Ush2a sgRNA 1-2 F:

[0041] 5'-TAATACGACTCACTATAGCAGCTGATAATAGAGTGTCACGGGTTTTAGAGCTAGAAATAGC-3';

[0042] gRNA PCR R: 5'-AGCACCGACTCGGTGCCACTT-3';

[0043] Ush2a sgRNA 1-7 F:

[0044] 5'-TAATACGACTCACTATAGGGGTCCACCCTTTGGCACAGCGGTTTTAGAGCTAGAAATAGC-3';

[0045] gRNA PCR R: 5'-AGCACCGACTCGGTGCCACTT-3';

[0046] Ush2a sgRNA 1-10 F:

[0047] 5'-TAATACGACTCACTATAGTTATCATTGACAAAAGAGAGAGGTTTTAGAGCTAGAAATAGC-3';

[0048] gRNA PCR R: 5'-AGCACCGACTCGGTGCCACTT-3'.

[0049] The present invention also provides the use of the non-human primate model obtained above as a disease model, wherein the use includes at least any one of the following:

[0050] (1) Used for knockout of USH2A gene;

[0051] (2) Used to construct an animal model of Usher (hereditary deafness-retinitis pigmentosa) syndrome;

[0052] (3) Used to construct animal models of hereditary retinitis pigmentosa or degenerative retinal degeneration;

[0053] (4) Used to construct an animal model of sensorineural hearing loss;

[0054] (5) Used to screen animal models of Usher (hereditary deafness-retinitis pigmentosa) syndrome;

[0055] (6) Used to screen animal models of hereditary retinitis pigmentosa or degenerative retinal degeneration;

[0056] (7) Used to screen animal models of hereditary sensorineural hearing loss. Beneficial effects

[0057] Compared with the prior art, the present invention has the following beneficial effects:

[0058] (1) The present invention provides four highly efficient knockout targets for the USH2A gene in non-human primates.

[0059] (2) The present invention has been tested and identified to be effective in knocking out the USH2A gene in non-human primate cynomolgus macaque embryos and cynomolgus macaques, and can obtain offspring cynomolgus macaques that exhibit retinal lesions and hearing abnormalities, laying a solid foundation for establishing animal models of non-human primate retinal degeneration and sensorineural hearing loss. BRIEF DESCRIPTION OF THE DRAWINGS

[0060] Figure 1 shows the results of knockout of non-human primate cynomolgus macaque embryos by sgRNA combinations; USH-1: sgRNA1-1 and sgRNA1-10; USH2: sgRNA1-1 and sgRNA1-2; USH-3: sgRNA1-1 and sgRNA1-7; USH-4: sgRNA1-2 and sgRNA1-7; 1-18 are non-human primate cynomolgus macaque embryos;

[0061] Figure 2 is a peak graph of sequencing of USH-1 combination sgRNA mutant embryos;

[0062] Figure 3 is a peak graph of sequencing of USH-2 combination sgRNA mutant embryos;

[0063] Figure 4 is a peak graph of sequencing of USH-3 combination sgRNA mutant embryos;

[0064] Figure 5 is a peak graph of sequencing of USH-4 combination sgRNA mutant embryos;

[0065] FIG6 is a bar graph showing the embryo editing efficiency of non-human primate cynomolgus macaques using a combination of two sgRNAs (USH-1) and a single sgRNA (sgRNA1);

[0066] Figure 7 is a peak diagram of USH2A gene sequencing in the peripheral blood of non-human primate offspring cynomolgus monkeys edited with sgRNA of combination USH-1;

[0067] Figure 8 shows the expression level of the USH2A gene (Figure 8B), electroretinogram (Figure 8C), and otoacoustic emission detection graph (Figure 8D) of the offspring non-human primate cynomolgus macaques born using sgRNA editing with the combination of USH-1 (Figure 8A). Best Mode for Carrying Out the Invention

[0068] To better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below with reference to the accompanying drawings and examples. In the examples, the experimental methods used are conventional methods unless otherwise specified, and the materials and reagents used are all commercially available unless otherwise specified.

[0069] Example 1 Knockout of the USH2A gene in non-human primate cynomolgus monkey embryos

[0070] 1. The nucleotide sequence of the edited exon of the USH2A gene is as follows:

[0071] AGAGATTCTGGAAGTTTTTTCATTGACAAAAGAGAGGATGGGTGGTGGAGATCTCTCCAGATTGCATGCCCAATCACATTGCCGTTGCCCTGGCAGCCACCCGCGGGTCCACCCTTTGGCACAGCGGTACTGCATTCCTAACGATGCAGGAGACACAGC TGATAATAGAGTGTCACGGTTGAATCCTGAAGCCCATCCTCTCTCTTTTGTCAATGATAATGATGTTGGGACTTCATGGGTTTCAAATGTGTTTACAAACGTTACACAACTTAATCAAGGAGTGACTATTTCAGTTGACTTGGAAAATGGACAGTATCAG.

[0072] 2. Design sgRNA

[0073] Based on the above-mentioned USH2A gene editing exon nucleotide sequence, the following single sgRNAs were designed and screened using software, namely sgRNA 1-1, sgRNA 1-2, sgRNA 1-7, and sgRNA 1-10.

[0074] 3. In vitro synthesis of sgRNA

[0075] (1) Select sgRNA 1-1, sgRNA 1-2, sgRNA 1-7, and sgRNA 1-10 to design synthetic primers, where the nucleotide sequences of the primers are as follows:

[0076] Ush2a sgRNA 1-1 F:

[0077] 5'-TAATACGACTCACTATAGATTGACAAAAGAGAGAGGATGGGTTTTAGAGCTAGAAATAGC-3';

[0078] gRNA PCR R: 5'-AGCACCGACTCGGTGCCACTT-3';

[0079] Ush2a sgRNA 1-2 F:

[0080] 5'-TAATACGACTCACTATAGCAGCTGATAATAGAGTGTCACGGGTTTTAGAGCTAGAAATAGC-3';

[0081] gRNA PCR R: 5'-AGCACCGACTCGGTGCCACTT-3';

[0082] Ush2a sgRNA 1-7 F:

[0083] 5'-TAATACGACTCACTATAGGGGTCCACCCTTTGGCACAGCGGTTTTAGAGCTAGAAATAGC-3';

[0084] gRNA PCR R: 5'-AGCACCGACTCGGTGCCACTT-3'.

[0085] Ush2a sgRNA 1-10 F:

[0086] 5'-TAATACGACTCACTATAGTTATCATTGACAAAAGAGAGAGGTTTTAGAGCTAGAAATAGC-3';

[0087] gRNA PCR R: 5'-AGCACCGACTCGGTGCCACTT-3'.

[0088] PCR amplification was performed using the px459 vector as a template and T7-gRNA-F and gRNA-PCR-R as amplification primers to obtain a transcription DNA template. The PCR amplification system is shown in Table 1.

[0089]

[0090] (2) The transcription DNA template prepared in step (1) is transcribed using a transcription kit and purified to obtain sgRNA, wherein the transcription system is shown in Table 2.

[0091]

[0092] (3) Embryo development after vector injection

[0093] To improve the efficiency of embryonic gene editing, sgRNAs were injected into embryos in combination, with combinations of sgRNA1-1, sgRNA1-2, sgRNA1-7, and sgRNA1-10 used as injection vectors. The combinations are shown in Table 3.

[0094]

[0095] Using embryonic micromanipulation technology, sgRNA 1-1, sgRNA 1-2, sgRNA 1-7, and sgRNA 1-10 (the final concentration of each sgRNA after mixing was 50 ng / μL) and Cas9 mRNA (commercially purchased) 100 ng / μL (final concentration after mixing) were mixed to obtain a gene editing vector mixture, which was then injected into 18 crab-eating macaque embryos to observe the embryonic development after injection.

[0096] The specific steps for embryo micromanipulation are as follows: (a) Single sperm injection: Transfer MII-stage oocytes from the IVM immature oocyte culture medium to the manipulation medium and wash the sperm again with sperm washing solution. A single sperm is aspirated with a microinjection needle, while the oocyte is secured with an egg holder. The sperm is then injected into the oocyte's cytoplasm. Following injection, the oocyte is incubated in a 37°C, 5% CO2, saturated humidity incubator for 8 hours. (b) Mixed vector injection: Select a fertilized oocyte and place it under a microscope. A small amount of the gene editing vector mixture is aspirated with an injection needle. The zygote is secured with an egg holder and the editing vector mixture is injected into the oocyte's cytoplasm. The oocyte is then incubated in a 37°C, 5% CO2, saturated humidity incubator.

[0097] (4) Verification of embryonic target site knockout

[0098] Collect potential edited embryos, add 10 μL of proteinase K lysis buffer to the embryos, mix well, centrifuge briefly, and react in a PCR instrument according to the program in Table 4 (top cover temperature is 70°C).

[0099]

[0100] The lysate obtained from the above reaction was used as a template for PCR amplification (see Table 5 for the amplification system). The nucleotide sequences of the primers used are as follows:

[0101] Ush2a-F3:5'-CATGAAAGCACTAAACGAGTGACA-3';

[0102] Ush2a-R3: 5' - ACACCTTATCGTTTCTCATTACCTG -3'.

[0103]

[0104] Sequencing of the final PCR product clearly demonstrated that the sgRNA combination of USH-1, USH-2, USH-3, and USH-4 worked in the embryos, knocking out the target gene (Figures 1 to 5). Figure 6 shows that the editing efficiency of the combined sgRNAs was 100%, while the embryo editing efficiency of the individual sgRNAs was 73%, significantly higher than that of the individual sgRNAs.

[0105] Example 2 Knockout of the USH2A gene in non-human primate cynomolgus monkeys

[0106] To obtain a USH2A gene knockout non-human primate cynomolgus macaque model, embryos injected with any of the above sgRNA combinations were cultured to blastocysts and then transplanted into the uterus of a surrogate female monkey. After the offspring were born, blood was collected for genotyping of the USH2A gene target site fragment, characterization of retinopathy in the offspring, and otoacoustic emission testing. The specific procedures are as follows:

[0107] 1. Embryo culture to blastocyst, then transplanted into the uterus of a surrogate female monkey

[0108] (1) Embryo culture: Fresh culture medium should be replaced every 48 hours, and the embryonic development status should be recorded each time the medium is replaced. When the edited embryos develop to the morula stage, they can be collected for embryo testing or embryo transfer. If there are no suitable recipients or the number of recipients is insufficient, the embryos can be frozen and awaited for subsequent transfer.

[0109] (2) Embryo transplantation: (a) Embryo selection: Select well-grown and well-developed gene-edited morulae or blastocysts for embryo transplantation; (b) Selection of surrogate mother monkeys (recipient monkeys): Perform B-ultrasound examination of the uterus and ovaries of female crab-eating macaques that have reached physical maturity, are in good health, and are in good nutritional status. Select female crab-eating macaques with regular uterine shape, abundant blood flow, and in the ovulation stage as recipients for embryo transplantation; (c) Laparoscopic embryo transplantation: After the recipient monkey is anesthetized and immobilized, the abdominal skin is thoroughly disinfected with iodine; a scalpel is used to make small holes in the midline and ventral side of the abdomen, and a pneumoperitoneum needle, laparoscope, and surgical forceps are inserted in sequence. Sterile CO2 gas is filled into the abdominal cavity to expose the surgical field of view. Under the guidance of the laparoscope, the embryo transfer tube is inserted into the fallopian tube, and the edited embryo is inserted to complete the embryo transplantation; (d) Pregnancy monitoring: The recipient monkeys are anesthetized on the 25th day after transplantation, and the pregnancy status is checked by B-ultrasound. If the pregnancy is successful, the fetal body length, head diameter, heart rate and other developmental data are measured and recorded in a timely manner.

[0110] 2. Genotypic analysis of USH2A gene target site fragments in offspring monkey blood

[0111] (1) Sampling: 0.5 mL of venous blood was drawn from the small saphenous vein of the newborn monkey using a disposable syringe; (2) After the genomic DNA of the newborn monkey was extracted, the DNA fragment of the target gene USH2A was amplified: the genomic DNA of the newborn monkey extracted in the previous step was used as a template for PCR amplification. The amplification sequence of the target DNA fragment was shown in Table 6, the amplification system was shown in Table 7, and the amplification procedure was the same as that in Table 8; (3) Sequencing: The PCR amplification product was subjected to high-throughput sequencing: The PCR amplification product obtained in step (2) was subjected to high-throughput sequencing (NGS).

[0112]

[0113] 3. Characterization and analysis of retinopathy in offspring of non-human primates, cynomolgus monkeys

[0114] Electroretinography (ERG) Examination: This experiment used an electrophysiological diagnostic system (model: RETⅠ-Scan21) for ERG examination. Monkeys were pre-dilated with compound tropicamide eye drops and then placed in a darkened room for 0.5-1 hour of dark adaptation. Afterwards, they were transferred to a dim red light environment and anesthetized intramuscularly with 0.15-0.2 mL of Zota (1:1 diluted with saline). Once fully anesthetized, the monkeys were placed on the ERG table with their abdomen facing upwards. Pre-treatment was then performed: First, the central forehead and the temporal orbital skin were wiped and disinfected with an alcohol swab. Skin keratin and dirt were gently scraped off, and electrostain gel was applied to ensure good conductivity of the skin electrodes. Electrode placement: A ground electrode was inserted into the subcutaneous tissue in the central forehead and secured securely. A silver chloride reference electrode was inserted into the subcutaneous tissue in the temporal orbital tissue and secured securely. The eyelids were held open with a lid speculum, and a contact lens (serving as the recording electrode) was placed over the monkey's cornea. The experimental steps are as follows: (a) After the previous dark adaptation, in a dark field environment, use a single weak light stimulus with an intensity lower than the standard stimulus light (Standard Flash, SF) to record the response of rod cells in the dark field; (b) Continue to record the mixed response of cone cells and rod cells to a single standard flash stimulus (called the dark field maximum mixed response) and oscillatory potentials (OPs) in the dark field environment; (c) Turn on the light, adapt to light for 10 minutes, and record the response of cone cells in the bright field to a single standard flash stimulus; (d) In a bright field environment, use a 30 Hz standard flash stimulus to record the flicker light response.

[0115] 4. Otoacoustic emission testing of offspring cynomolgus monkeys

[0116] Distortion Product Otoacoustic Emission (DPOAE) detection: In this experiment, the GSI Corti otoacoustic emission instrument was used to perform DPOAE detection on USH2A-edited monkeys. The experimental site was selected to be a place with an ambient noise level lower than 40 dB. The monkeys were anesthetized by intramuscular injection of 0.15 mL of 1:1 saline diluted with Shutai to keep them in a quiet state, which was conducive to the test. The specific experimental steps are as follows: (1) Check whether the otoacoustic emission instrument has sufficient power and perform power-on calibration to ensure the accuracy of the test; (2) Keep the external auditory canal clean to avoid earwax blocking the external auditory canal and affecting the experimental results; (3) Select the frequency range to be tested and enter the experimental monkey number; (4) Select a probe of appropriate size so that the probe fits tightly against the ear canal to ensure the airtightness of the external auditory canal during the test. The probe should always be pointed deep into the ear canal and remain quiet during the test; (5) Repeat the test for more than 3 times on both ears; (6) After the test, import the data into the computer; (7) After the test, the monkeys are transferred to the observation area and wait for them to fully wake up. Ensure that they are transferred to the original cage in a healthy state.

[0117] The sequencing results (Figure 7) show that the USH2A knockout monkeys experienced a 5-base loss in the gene target fragment, indicating that the USH2A knockout cynomolgus monkey model was successfully established.

[0118] As shown in the qPCR results of Figure 8B, the expression level of the USH2A gene in the gene-knockout macaque (M5) was significantly lower than that in the control group (Control). At the same time, otoacoustic emission (DPOAE) test was performed on the 3-month-old gene-knockout macaque (M5). The results showed that the signal-to-noise ratio of M5 in the 3-12 kHz range was significantly lower than that of the control group, indicating that the outer hair cells of the cochlea in both ears of the USH2A gene-edited macaque were abnormal (Figure 8D). Retinal electrophysiological measurements were performed on the 5-month-old gene-knockout macaque (M5). The results (Figure 8C) showed that the a-wave amplitude of its retinas in both eyes was significantly lower than that in the control group, indicating that the retinal function of the USH2A gene-knockout macaque has been significantly damaged.

[0119] In summary, Example 2 shows that embryos edited with USH-1 combined with sgRNA can be used to obtain non-human primate cynomolgus monkeys with Usher disease syndrome and USH2A gene knockout through embryo transplantation.

[0120] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. A sgRNA combination for targeted knockout of USH2A gene, characterized in that: The sgRNA combination is USH-1, USH-2, USH-3, and USH-4, wherein USH-1 is composed of sgRNA1-1 and sgRNA1-10, USH-2 is composed of sgRNA1-1 and sgRNA1-2, USH-3 is composed of sgRNA1-1 and sgRNA1-7, and USH-4 is composed of sgRNA1-2 and sgRNA1-7; wherein the sequences of sgRNA1-1, sgRNA1-2, sgRNA1-7, and sgRNA1-10 are shown in SEQ ID NOs: 1 to 4, respectively.

2. The sgRNA combination according to claim 1, characterized in that The sgRNA combination is USH-1.

3. The use of the sgRNA combination for targeted knockout of the USH2A gene according to claim 1, characterized in that: The application includes at least one of the following: (1) Used for knockout of USH2A gene; (2) Used to construct an animal model of Usher (hereditary deafness-retinitis pigmentosa) syndrome; (3) Used to construct animal models of hereditary retinitis pigmentosa or degenerative retinal degeneration; (4) Used to construct an animal model of sensorineural hearing loss; (5) Used to screen animal models of Usher (hereditary deafness-retinitis pigmentosa) syndrome; (6) Used to screen animal models of hereditary retinitis pigmentosa or degenerative retinal degeneration; (7) Used to screen animal models of hereditary neurological deafness.

4. The use of the sgRNA combination for targeted knockout of the USH2A gene according to claim 2, characterized in that: The application includes at least one of the following: (1) Used for knockout of USH2A gene; (2) Used to construct an animal model of Usher (hereditary deafness-retinitis pigmentosa) syndrome; (3) Used to construct animal models of hereditary retinitis pigmentosa or degenerative retinal degeneration; (4) Used to construct an animal model of sensorineural hearing loss; (5) Used to screen animal models of Usher (hereditary deafness-retinitis pigmentosa) syndrome; (6) Used to screen animal models of hereditary retinitis pigmentosa or degenerative retinal degeneration; (7) Used to screen animal models of hereditary neurological deafness.

5. A method for targeting USH2A gene knockout in a non-human primate model, characterized in that: The sgRNA combination of claim 1 or 2 is synthesized in vitro, and the USH2A gene sequence of a non-human primate is knocked out using gene editing technology.

6. The method for the non-human primate model of targeted USH2A gene knockout according to claim 5, characterized in that: The gene editing technology includes at least one of CRISPR / Cas9 technology and Cre-loxp gene knockout technology.

7. The method for non-human primate animal model targeting USH2A gene knockout according to claim 6, characterized in that: It is an in vitro synthesized sgRNA combination for targeted knockout of the USH2A gene. The donor vector containing the sgRNA combination targeting the USH2A gene and Cas9 mRNA are mixed and transformed into the fertilized eggs of non-human primates. The embryos are then transplanted into the uterus of surrogate non-human primates to obtain a non-human primate model with targeted USH2A gene knockout in the offspring.

8. The method for non-human primate animal model targeting USH2A gene knockout according to claim 6, characterized in that: The steps for in vitro synthesis of sgRNA combinations for targeted knockout of the USH2A gene are as follows: (1) According to the sgRNA combination for targeted knockout of the USH2A gene according to claim 1, designing and synthesizing primers, and then using the px459 vector as a template, performing PCR amplification to obtain a transcription DNA template; (2) Transcribe the transcription DNA template prepared in step (1) to obtain sgRNA.

9. The method for non-human primate animal model targeting USH2A gene knockout according to claim 8, characterized in that: The nucleotide sequence of the primer is as follows:

Images