Microalgae compositions and methods for treating disease

Abstract

In an aspect, the disclosure provides methods for making LC-PUFA and VLCFAs in a host organism. The LC-PUFA and VLCFAs can be new chemical entities, well-known LC-PUFA, and derivatives of LC-PUFA as well as VLCFAs. The host cells can be microalgae, fungi or other host cells. In a related aspect, the disclosure provides host cells engineered to have biochemical pathways for making LC-PUFA and VLCFAs.

Description

MICROALGAE COMPOSITIONS AND METHODS FOR TREATINGDISEASEBACKGROUND

[0001] Studies have clearly shown the importance of polyunsaturated fatty acids (as essential fatty acids) and their nutritional value for human health. Linoleic and linolenic acids are synthesized in large quantities in plants, while they are not produced in humans and other mammals, so these fatty acids should be provided from external sources. Although humans can synthesize long-chain, polyunsaturated fatty acids such as ARA, DHA, and EP A by a series of desaturase and elongase enzymes from the precursor LA and ALA, the conversion efficiency is low in humans, so direct uptake appears to be significantly more effective.

[0002] The American Heart Association Nutrition Committee (AHANC) guidelines suggest to consume fish at least two times per week or take supplements containing LCco3-PUFA 500 mg / day to prevent and reduce the risk of heart disease.The European Food Safety Authority (EFSA) panel recommends taking 250 mg n-3 LC-PUFA per day, in contrast to the Suggested Dietary Targets (SDT) in Australia for adult men and women that recommends 610 and 430 mg of eicosapentaenoic acid (EP A) and docosahexaenoic acid (DHA) per day necessary to reduce the risk of cardiovascular disease. Infant formulae should contain at least 0.2% of total fatty acids as docosahexaenoic acid (DHA) and 0.35% as arachidonic acid (ARA).SUMMARY

[0003] In an aspect, the disclosure describes methods for making fatty acids, especially essential long-chain fatty acids using microalgae. These fatty acids may be saturated or unsaturated fatty acids. Exemplary fatty acids made by the methods and compositions herein include, for example, gamma linolenic acid (C18:3y; GLA), dihomo-gamma linolenic acid (C20:3n6; DGLA), eicosenoic acid (C20: l), erucic acid (C22:l), and nervonic acid (C24: l).

[0004] In an aspect, the microalgae are engineered to express fatty acid desaturase-6 (FADdelta6 desaturase; Accession No: XP_002182901.1) and fatty acid delta-6 elongase [FADdelta6 elongase (ELO); Accession No: ABQ18315] genes.Microalgae engineered with these enzymes accumulate significant amounts of gamma linolenic (C18:3y; GLA) and dihomo-gamma linolenic (C20:3n6; DGLA) acids.

[0005] In an aspect, the microalgae are also engineered to express lysophosphatidyl-choline acyltransferase (LPCAT), phosphatidyl-choline:diacyl- glycerol-choline phosphotransferase (PDCT), and / or CDP-choline: l,2-sn- diacylglycerol choline phosphotransferase (CPT / DAG-CPT). Microalgae with some or all of these other enzymes further increases the production of GLA.

[0006] In an aspect, microalgae above can also be engineered with 3-ketoacyl- CoA synthase (KCS), 3-ketoacyl-CoA Reductase (KCR), enoyl-CoA Reductase (ECR), and 3-hydroxyacyl-CoA dehydratase (HACD). Microalgae engineered with these enzymes or combinations thereof produce very long chain fatty acids (VLCFA’s) including eicosenoic (C20: l), erucic (C22:l), and nervonic (C24: l) acids.

[0007] The microalgae can contain the nucleic acids and / or polypeptides described above and herein. The microalgae host cell can be an algae species and / or a photosynthetic, or non-photosynthetic, microorganism from Agmenellum, Amphora, Anabaena, Ankistrodesmus, Asterochloris, Asteromonas, Astephomene, Auxenochlorella, Basichlamys, Botryococcus, Botryokoryne, Boekelovia, Borodinella, Brachiomonas, Catena, Carteria, Chaetoceros, Chaetophora, Characiochloris, Characiosiphon, Chlainomonas, Chlamydomonas, Chlorella, Chlorochytrium, Chlorococcum, Chlorogonium, Chloromonas, Chrysosphaera, Closteriopsis, Cricosphaera, Cryptomonas, Cyclotella, Dictyochloropsis, Dunaliella, Ellipsoideus Eremosphaera, Eudorina, Euglena, Fragilaria, Floydiella, Friedmania, Haematococcus, Hafniomonas, Heterochlorella, Gleocapsa, Gloeothamnion, Gonium, Halosarcinochlamys, Hymenomonas, Isochrysis, Koliella, Lepocinclis, Lobocharacium, Lobochlamys, Lobomonas, Lobosphaera, Lobosphaeropsis, Marvania, Monoraphidium, Myrmecia, Nannochloris, Nannochloropsis, Navicula, Nephrochloris, Nitschia, Nitzschia, Ochromonas, Oocystis, Oogamochlamys, Oscillatoria, Pabia, Pandorina, Parietochloris, Pascheria, Phacotus, Phagus, Phormidium, Platydorina, Platymonas, Pleodorina, Pleurochrysis, Polulichloris, Polytoma, Polytomella, Prasiola, Prasiolopsis, Prasiococcus, Prototheca, Pseudochlorella, Pseudocarteria, Pseudotrebouxia, Pteromonas, Pyrobotrys, Rosenvingiella, Scenedesmus, Schizochytrium Spirogyra, Stephanosphaera,Tetrabaena, Tetraedron, Tetraselmis, Thraustochytrium, Trebouxia, Trochisciopsis, Ulkenia, Viridiella, Vitreochlamys, Volvox, Volvulina, Vulcanochloris, Watanabea, or Yamagishiella. The microalgae host cell can be Auxenochlorella protothecoides, Botryococcus braunii, Prototheca krugani, Prototheca moriformis, Prototheca portoricensis, Prototheca stagnora, Prototheca wickerhamii, Prototheca zopfii, or Schizochytrium sp. or Aurantiochy trium sp. The host cell can be a strain of the species Auxenochlorella protothecoides, Prototheca moriformis, Prototheca krugani, Prototheca stagnora or Prototheca zopfii, and in other embodiments the microalgae has a 16S rRNA sequence with at least 70, 75, 80, 85, 90, 95 or 99% sequence identity to that of Auxenochlorella protothecoides, Prototheca moriformis, Prototheca krugani, Prototheca stagnora or Prototheca zopfii (Ewing A, et al (2014) J. Phycol. 50: 765- 769).

[0008] In an aspect, oils obtained from microalgae host cells and methods of obtaining the oils are disclosed by the specification. For example, a method for producing an oil or oil-derived product involves cultivating the host cell and extracting the oil, optionally wherein the cultivation is heterotrophic growth on sugar. Fatty acids described herein can be produced from the oil. Optionally, the oil is produced in microalgae and can have desired ratios of different fatty acids.

[0009] In additional embodiments the invention include LC-PUFA oil compositions as well as cells containing LC-PUFA oil compositions comprising a lipid profile of a desired fatty acid(s) and one or more of the following attributes: 0.1-0.4 micrograms / ml total carotenoids, less than 0.4 micrograms / ml total carotenoids, less than 0.001 micrograms / ml lycopene; less than 0.02 micrograms / ml beta carotene, less than 0.02 milligrams of chlorophyll per kilogram of oil; 0.40-0.60 milligrams of gamma tocopherol per 100 grams of oil; 0.2-0.5 milligrams of total tocotrienols per gram of oil, less than 0.4 milligrams of total tocotrienols per gram of oil, 4-8 mg per 100 grams of oil of campesterol, and 40-60 mg per 100 grams of oil of stigmasterol.

[0010] In an aspect, fatty acid(s) enzymatically produced in microalgae, can be further modified by chemical or environmental factors such as exposure to heat, light, air, pressure etc. In this aspect, fatty acids (acidic forms) generated in microalgae enzymatically can be converted to corresponding neutral forms through decarboxylation reactions.BRIEF DESCRIPTION OF THE DRAWINGS

[0011] FIG. 1 illustrates the alignment of Pi-CPTl, Pi-CPT2, and the 3 hits from the PB75 genome.

[0012] FIG. 2 illustrates the % identity between Pi-CPTl, Pi-CPT2, and the 3 hits from the PB75 genome.

[0013] FIG. 3 illustrates the alignment of At-PDCT and the look alike PDCT from PB75.

[0014] FIG. 4 illustrates the % identity between At-PDCT and the look alike PDCT from PB75.

[0015] FIG. 5 illustrates the alignment of FADdelta6 desaturase proteins from B. officinalis (Accession number: AAC49700.1), C. elegans (Accession number: AF031477), M. alpina (Accession number: AAF08685, ADE06661, AIG59045, and CAE53093), P. tricornutum (Accession number: ABP49078, ADI49410, and XP_002182901) and Synechocystis Sp. (Accession number: WP_010873125).

[0016] FIG. 6 illustrates the % identity between FADdelta6 desaturase proteins from B. officinalis (Accession number: AAC49700.1), C. elegans (Accession number: AF031477), M. alpina (Accession number: AAF08685, ADE06661, AIG59045, and CAE53093), P. tricornutum (Accession number: ABP49078, ADI49410, and XP_002182901) and Synechocystis Sp. (Accession number: WP_010873125).

[0017] FIG. 7 illustrates the alignment of FADdelta6 ELO proteins from P. tricornutum (Accession number: XP 002180428, ADI49411, ABQ18315, and AAW70157), Mortierella antarctica (KAF9982696), and M. alpina (ACD31685, ADE06662, and KAF9943255).

[0018] FIG. 8 illustrates the % identity between FADdelta6 ELO proteins from P. tricornutum (Accession number: XP 002180428, ADI49411, ABQ18315, and AAW70157), Mortierella antarctica (KAF9982696), and M. alpina (ACD31685, ADE06662, and KAF9943255).

[0019] FIG. 9 illustrates the alignment among KCS enzymes from Malania oleifera (Accession numbers: QDA34238, XP_057960190, and XP_057960186), Cardamine graeca (Accession number: ACJ61778), Crambe abysinnica (Accession number: AAX22298), Lunaria annua (Accession number: ACJ61777), Limnanthes douglasii (Accession number: AF247134 1), Alliaria petiolata, Brassica napus (Bn-KCS1 and Bn-KCS2, Accession numbers: AAA96054 and AAT65206), Arabidopsis lyrata (Accession number: ADN10815), Camelina hispida (Accession number: ADN10817), Arabidopsis thaliana (Accession number: NP_195178), Vitia vinifera (Accession number: RVW53968), Vitis riparia (Accession number: XP_034683607), Durio zibethinus (Accession number: XP 022729498), Prunus persica (Accession number: XP 007223150), Theobroma cacao (Accession number: EOY31420), and Syzygium oleosum (Accession number: XP_030467300) .

[0020] FIG. 10 illustrates the % identity among KCS enzymes from Malania oleifera (Accession number: QDA34238, XP_057960190, and XP_057960186), Accession number: ACJ61777), Limnanthes douglasii (Accession number: AF247134 1), Alliaria petiolata, Brassica napus (Bn-KCSl and Bn-KCS2, Accession numbers: AAA96054 and AAT65206), Arabidopsis lyrata (Accession number: ADN10815), Camelina hispida (Accession number: ADN10817), Arabidopsis thaliana (Accession number: NP_195178), Vitia vinifera (Accession number: RVW53968), Vitis riparia (Accession number: XP 034683607), Durio zibethinus (Accession number: XP_022729498), Prunus persica (Accession number: XP_007223150), Theobroma cacao (Accession number: EOY31420), and Syzygium oleosum (Accession number: XP_030467300) .

[0021] FIG. 11 illustrates the alignment among KCR enzymes from Malania oleifera (Accession number: QDA34240), Alliaria petiolata, Ziziphus jujuba (Accession number: XP_015894465), Vitis riparia (Accession number: XP_034696659), Manihot esculenta (Accession number: XP_021633644), Cucurbita argyrosperma subsp. sororia (Accession number: KAG6598255), Vitis vinifera (Accession number: RVW74316), Gossypium hirsutum (Accession number: XP_016740434), Morelia rubra (Accession number: KAB1201206), Arabidopsis thaliana (Accession number: NP_564905), Arabidopsis lyrata subsp. lyrata (Accession number: XP_002887140), Camelina sativa (Accession number: XP_010470694), Eutrema salsugineum (Accession number: XP 006391228), Brassica oleracea var. oleracea (Accession number: XP 013621534), Brassica napus (Accession number: NP_001302805), Hirschfeldia incana (Accession number: KAJ0256027), Brassica rapa (Accession number: XP_009127574), and Microthlaspi erraticum (Accession number: CAA7058321).

[0022] FIG. 12 illustrates the % identity among KCR enzymes from Malania oleifera (Accession number: QDA34240), Alliaria petiolata, Ziziphus jujuba (Accession number: XP_015894465), Vitis riparia (Accession number: XP_034696659), Manihot esculenta (Accession number: XP_021633644), Cucurbita argyrosperma subsp. sororia (Accession number: KAG6598255), Vitis vinifera (Accession number: RVW74316), Gossypium hirsutum (Accession number: XP_016740434), Morelia rubra (Accession number: KAB1201206), Arabidopsis thaliana (Accession number: NP_564905), Arabidopsis lyrata subsp. lyrata (Accession number: XP_002887140), Camelina sativa (Accession number: XP_010470694), Eutrema salsugineum (Accession number: XP 006391228), Brassica oleracea var. oleracea (Accession number: XP 013621534), Brassica napus (Accession number: NP_001302805), Hirschfeldia incana (Accession number: KAJ0256027), Brassica rapa (Accession number: XP_009127574), and Microthlaspi erraticum (Accession number: CAA7058321).

[0023] FIG. 13 illustrates the alignment among HACD enzymes from Malania oleifera (Accession number: XP 057967704), Alliaria petiolata, Brassica rapa (Accession number: XP 009131162), Brassica napus (Accession number: XP_013701928), Eutrema salsugineum (Accession number: XP_006399546), Magnolia sinica (Accession number: XP 058081763), Nicotiana tomentosiformis (Accession number: XP_033508788), Nymphaea colorata (Accession number: XP_031478963), Punica granatum (XP_031376559), and Citrus sinensis (Accession number: XP_006466304), Cornus florida (Accession number: XP_059624145), Amaranthus tricolor (XP_057541506), Carya illinoinensis (Accession number: XP_042990950), and Morus notabilis (Accession number: XP_024028577), Ziziphus jujuba (XP 015890567), and Camellia lanceoleosa (KAI8030338).

[0024] FIG. 14 illustrates the % identity among HACD enzymes Malania oleifera (Accession number: XP 057967704), Alliaria petiolata, Brassica rapa (Accession number: XP 009131162), Brassica napus (Accession number: XP_013701928), Eutrema salsugineum (Accession number: XP_006399546), Magnolia sinica (Accession number: XP 058081763), Nicotiana tomentosiformis (Accession number: XP_033508788), Nymphaea colorata (Accession number: XP_031478963), Punica granatum (XP_031376559), and Citrus sinensis (Accessionnumber: XP_006466304), Cornus florida (Accession number: XP_059624145), Amaranthus tricolor (XP_057541506), Carya illinoinensis (Accession number: XP_042990950), and Morus notabilis (Accession number: XP_024028577), Ziziphus jujuba (XP 015890567), and Camellia lanceoleosa (KAI8030338).

[0025] FIG. 15 illustrates the alignment among ECR enzymes from Malania oleifera (Accession number: XP 057979752), Alliaria petiolata, Brassica napus (Accession number: NP_001302896), Brassica rapa (Accession number: XP_009116229), Eutrema salsugineum (Accession number: XP_006403467), Vitis riparia (Accession number: XP_034705237), Pistacia vera (Accession number: XP_031259583), Vitis vinifera (XP_010658577), Mangifera indica (XP_044509682) Manihot esculenta (Accession number: XP_021618477), Citrus Clementina (Accession number: XP_006435990), Hevea brasiliensis (Accession number: XP_057989572), Jatropha curcas (Accession number: XP 012089325), Ricinus communis (Accession number: XP_002530850), Herrania umbratica (Accession number: XP_021295484), and Citrus sinensis (Accession number: KAH9767690).

[0026] FIG. 16 illustrates the % identity among ECR enzymes Malania oleifera (Accession number: XP_057979752), Alliaria petiolata, Brassica napus (Accession number: NP_001302896), Brassica rapa (Accession number: XP_009116229), Eutrema salsugineum (Accession number: XP_006403467), Vitis riparia (Accession number: XP_034705237), Pistacia vera (Accession number: XP_031259583), Vitis vinifera (XP_010658577), Mangifera indica (XP_044509682) Manihot esculenta (Accession number: XP_021618477), Citrus Clementina (Accession number: XP_006435990), Hevea brasiliensis (Accession number: XP_057989572), Jatropha curcas (Accession number: XP 012089325), Ricinus communis (Accession number: XP_002530850), Herrania umbratica (Accession number: XP_021295484), and Citrus sinensis (Accession number: KAH9767690).

[0027] FIG. 17A and FIG. 17B illustrate gas chromatograms in derivative lines PB5;378-2 and PB5;377-3 expressing Mole-KCSl (17A) and Apet-KCS (17B) respectively.DETAILED DESCRIPTION OF THE INVENTION

[0028] Before the various embodiments are described, it is to be understood that the teachings of this disclosure are not limited to the particular embodiments described, and as such can vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present teachings will be limited only by the appended claims.

[0029] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present teachings, some exemplary methods and materials are now described.

[0030] It must be noted that as used herein and in the appended claims, the singular forms “a”, “an”, and “the” include plural referents unless the context clearly dictates otherwise. It is further noted that the claims can be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as “solely,” “only” and the like in connection with the recitation of claim elements, or use of a “negative” limitation. Numerical limitations given with respect to concentrations or levels of a substance are intended to be approximate unless the context clearly dictates otherwise. Thus, where a concentration is indicated to be (for example) 10 pg, it is intended that the concentration be understood to be at least approximately or about 10 pg.

[0031] As will be apparent to those of skill in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has discrete components and features which can be readily separated from or combined with the features of any of the other several embodiments without departing from the scope or spirit of the present teachings. Any recited method can be carried out in the order of events recited or in any other order which is logically possible.Definitions

[0032] In reference to the present disclosure, the technical and scientific terms used in the descriptions herein will have the meanings commonly understood by one of ordinary skill in the art, unless specifically defined otherwise. Accordingly, the following terms are intended to have the following meanings.

[0033] As used herein, “codon optimized” refers to changes in the codons of the polynucleotide encoding a protein to those preferentially used in a particular organism such that the encoded protein is efficiently expressed in the organism of interest. Although the genetic code is degenerate in that most amino acids are represented by several codons, called “synonyms” or “synonymous” codons, it is well known that codon usage by particular organisms is nonrandom and biased towards particular codon triplets. This codon usage bias may be higher in reference to a given gene, genes of common function or ancestral origin, highly expressed proteins versus low copy number proteins, and the aggregate protein coding regions of an organism's genome.

[0034] As used herein, “consensus sequence” and “canonical sequence” refer to an archetypical amino acid sequence against which all variants of a particular protein or sequence of interest are compared. The terms also refer to a sequence that sets forth the nucleotides that are most often present in a DNA sequence of interest among members of related gene sequences. For each position of a gene, the consensus sequence gives the amino acid that is most abundant in that position in a multiple sequence alignment (MSA).

[0035] As used herein, “control sequence” refers to components, which are used for the expression of a polynucleotide and / or polypeptide. Each control sequence may be native or foreign to the nucleic acid sequence encoding the polypeptide. Such control sequences may include, but are not limited to, some or all of the following: a promoter, inducible or constitutive, an enhancer, an operator, an attenuator, a ribosome binding site (e.g., shine-dalgarno sequence), a leader, a polyadenylation sequence, a pro-peptide sequence, a signal peptide sequence which directs the protein to which they are attached to a particular location in or outside the cell, and a transcription terminator. At a minimum, the control sequences include a promoter and transcriptional signals, and where appropriate, translational start and stop signals.

[0036] As used herein, an “effective amount” refers to an amount of a compound, formulation, material, or composition, as described herein effective to achieve a particular biological result.

[0037] As used herein, “expression vector” or “expression construct” or “recombinant DNA construct” refer to a nucleic acid construct, that has been generatedrecombinantly or synthetically via human intervention, including by recombinant means or direct chemical synthesis, with a series of specified nucleic acid elements that permit transcription and / or translation of a particular nucleic acid in a host cell. The expression vector can be part of a plasmid, virus, or nucleic acid fragment. Typically, the expression vector includes a nucleic acid to be transcribed operably linked to a promoter. The expression vector can exist in a host cell as either an episomal or integrated vector / construct.

[0038] As used herein, “exogenous gene” refers to a nucleic acid that codes for the expression of an RNA and / or protein that has been introduced ("transformed") into a cell. A transformed cell may be referred to as a recombinant cell, into which additional exogenous gene(s) may be introduced. The exogenous gene may be from a different species (and so heterologous), or from the same species (and so homologous), relative to the cell being transformed. Thus, an exogenous gene can include a homologous gene that occupies a different location in the genome of the cell or is under different control, relative to the endogenous copy of the gene. An exogenous gene may be present in more than one copy in the cell. An exogenous gene may be maintained in a cell as an insertion into the genome or as an episomal molecule.

[0039] As used herein, “expeller pressing” is a mechanical method for extracting oil from raw materials such as soybeans and rapeseed. An expeller press is a screw type machine, which presses material through a caged barrel-like cavity. Raw materials enter one side of the press and spent cake exits the other side while oil seeps out between the bars in the cage and is collected. The machine uses friction and continuous pressure from the screw drives to move and compress the raw material. The oil seeps through small openings that do not allow solids to pass through. As the raw material is pressed, friction typically causes it to heat up.

[0040] As used herein, “heterologous” polynucleotide or polypeptide refers to any polynucleotide that is introduced into a host cell by laboratory techniques, or a polynucleotide that is foreign to a host cell. As such, the term includes polynucleotides that are removed from a host cell, subjected to laboratory manipulation, and then reintroduced into a host cell. The introduced polynucleotide can express a heterologous polypeptide. Heterologous polypeptides are those polypeptides that are foreign to the host cell being utilized.

[0041] As used herein, “isolated polypeptide” refers to a polypeptide which is substantially separated from other components that naturally accompany it, e.g., protein, lipids, and polynucleotides. The term embraces polypeptides which have been removed or purified from their naturally-occurring environment or expression system (e.g., host cell or in vitro synthesis). The polypeptides may be present within a cell, present in the cellular medium, or prepared in various forms, such as lysates or isolated preparations.

[0042] As used herein, “lipids” are a class of molecules that are soluble in nonpolar solvents (such as ether and chloroform) and are relatively or completely insoluble in water. Lipid molecules have these properties, because they consist largely of long hydrocarbon tails which are hydrophobic in nature. Examples of lipids include fatty acids (saturated and unsaturated); glycerides or glycerolipids (such as monoglycerides, diglycerides, triglycerides or neutral fats, and phosphoglycerides or glycerophospholipids); nonglycerides (sphingolipids, sterol lipids including cholesterol and steroid hormones, prenol lipids including terpenoids, fatty alcohols, waxes, and polyketides), composite prenol lipids (terpenophenol); and complex lipid derivatives (sugar-linked lipids, or glycolipids, and protein-linked lipids).

[0043] As used herein, the terms “natural oil” or “natural fat” are used interchangeably and are defined to mean a total lipid predominantly composed of hydrocarbon oils of tryglyceride and / or terpenoid nature, where the oil has not undergone blending with another natural or synthetic oil, or fractionation so as to substantially alter the composition or the structure of hydrocarbons.

[0044] As used herein, “microalgae” refers to a eukaryotic microbial organism that contains a chloroplast or plastid, and optionally that is capable of performing photosynthesis, or a prokaryotic microbial organism capable of performing photosynthesis. Microalgae include obligate photoautotrophs, which cannot metabolize a fixed carbon source as energy, as well as heterotrophs, which can live solely off of a fixed carbon source. Microalgae include unicellular organisms that separate from sister cells shortly after cell division, such as Chlamydomonas, as well as microbes such as, for example, Volvox, which is a simple multicellular photosynthetic microbe of two distinct cell types. Microalgae include cells such as Chlorella, Dunaliella, and Prototheca. Microalgae also include other microbialphotosynthetic organisms that exhibit cell-cell adhesion, such as Agmenellum, Anabaena, and Pyrobotrys. Microalgae also include obligate heterotrophic microorganisms that have lost the ability to perform photosynthesis, such as certain dinoflagellate algae species, thraustochytrids such as Schizochytrium, Thraustochytrium and Aurantiochy trium and species of the genus Prototheca.

[0045] As used herein, “microorganism” and “microbe” are used interchangeably and refer to microscopic, unicellular organisms.

[0046] As used herein, “naturally-occurring” or “wild-type” refers to the form found in nature. For example, a naturally occurring or wild-type polypeptide or polynucleotide sequence is a sequence present in an organism that can be isolated from a source in nature, and which has not been intentionally modified by human manipulation.

[0047] As used herein, “neurotransmitter” refers to molecules that interact with receptors found on neurons. Neurotransmitters may be agonists or antagonists of a receptor. Neurotransmitters may inhibit re-uptake of other neurotransmitters by neurons or cause a cell to have less neurotransmitter (make less or reduce the half-life). Neurotransmitters may be naturally occurring, recombinantly made, or otherwise manufactured.

[0048] As used herein, “operably linked” and “operable linkage” refer to a configuration in which a control sequence or other nucleic acid is appropriately placed (z.e., in a functional relationship) at a position relative to a polynucleotide of interest such that the control sequence or other nucleic acid can interact with the polynucleotide of interest. In the case of a control sequence, operable linkage means the control sequence directs or regulates the expression of the polynucleotide and / or polypeptide of interest. In the case of polypeptides, operably linked refers to a configuration in which a polypeptide is appropriately placed at a position relative to a polypeptide of interest such that the polypeptide can interact as desired with the polypeptide of interest.

[0049] As used herein, “percentage of sequence identity” and “percentage homology” are used interchangeably herein to define to comparisons among polynucleotides or polypeptides, and are determined by comparing two optimally aligned sequences over a comparison window, where the portion of the polynucleotide or polypeptide sequence in the comparison window may comprise additions ordeletions (z.e., gaps) as compared to the reference sequence for optimal alignment of the two sequences. The percentage may be calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity. Alternatively, the percentage may be calculated by determining the number of positions at which either the identical nucleic acid base or amino acid residue occurs in both sequences or a nucleic acid base or amino acid residue is aligned with a gap to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity. Those of skill in the art appreciate that there are many established algorithms available to align two sequences. Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith and Waterman, Adv Appl Math. 2:482, 1981; by the homology alignment algorithm of Needleman and Wunsch, J Mol Biol. 48:443, 1970; by the search for similarity method of Pearson and Lipman, Proc Natl Acad Sci. USA 85:2444, 1988; by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the GCG Wisconsin Software Package), or by visual inspection (see generally, Current Protocols in Molecular Biology, F. M. Ausubel et al., eds., Greene Publishing Associates, Inc. and John Wiley & Sons, Inc., (1995 Supplement). Examples of algorithms that are suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al., J. Mol. Biol. 215:403-410, 1990; and Altschul et al., Nucleic Acids Res. 25(17):3389-3402, 1977; respectively. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information website. BLAST for nucleotide sequences can use the BLASTN program with default parameters, e.g., a word length (W) of 11, an expectation (E) of 10, M=5, N=-4, and a comparison of both strands. BLAST for amino acid sequences can use the BLASTP program with default parameters, e.g., a word length (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff and Henikoff, Proc Natl Acad Sci. USA 89: 10915, 1989). Exemplary determination of sequence alignment and %sequence identity can also employ the BESTFIT or GAP programs in the GCG Wisconsin Software package (Accelrys, Madison WI), using default parameters provided.

[0050] As used herein, “recombinant” or “engineered” or “non-naturally occurring” refers to a cell, nucleic acid, protein or vector that has been modified due to the introduction of an exogenous nucleic acid or the alteration of a native nucleic acid. Thus, e.g., recombinant cells express genes that are not found within the native (nonrecombinant) form of the cell or express native genes differently than those genes are expressed by a non-recombinant cell. A “recombinant nucleic acid” is a nucleic acid made, in general, by the manipulation of nucleic acid, e.g., using polymerases and endonucleases, or otherwise into a form not normally found in nature. Recombinant nucleic acids may be produced, for example, to place two or more nucleic acids in operable linkage. Thus, an isolated nucleic acid or an expression vector formed in vitro by ligating DNA molecules that are not normally joined in nature, are both considered recombinant for the purposes of this invention. Once a recombinant nucleic acid is made and introduced into a host cell or organism, it may replicate using the in vivo cellular machinery of the host cell; however, such nucleic acids, once produced recombinantly, although subsequently replicated intracellularly, are still considered recombinant for purposes of this invention. Similarly, a “recombinant protein” is a protein made using recombinant techniques, i.e., through the expression of a recombinant nucleic acid.

[0051] As used herein, "recombinant variant" refers to any polypeptide differing from naturally occurring polypeptides by amino acid insertions, deletions, and substitutions, created using recombinant DNA techniques. Guidance in determining which amino acid residues may be replaced, added, or deleted without abolishing activities of interest, such as enzymatic or binding activities, may be found by comparing the sequence of the particular polypeptide with that of homologous peptides and minimizing the number of amino acid sequence changes made in regions of high homology. Amino acid "substitutions" are the result of replacing one amino acid with another amino acid having similar structural and / or chemical properties, i.e., conservative amino acid replacements. Amino acid substitutions may be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and / orthe amphipathic nature of the residues involved. For example, nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and methionine; polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine; positively charged (basic) amino acids include arginine, lysine, and histidine; and negatively charged (acidic) amino acids include aspartic acid and glutamic acid.

[0052] As used herein, “reference sequence” refers to a defined sequence used as a basis for a sequence comparison. A reference sequence may be a subset of a larger sequence, for example, a segment of a full-length gene or polypeptide sequence. Generally, a reference sequence is at least 20 nucleotide or amino acid residues in length, at least 25 residues in length, at least 50 residues in length, or the full length of the nucleic acid or polypeptide. Since two polynucleotides or polypeptides may each (1) comprise a sequence (ie., a portion of the complete sequence) that is similar between the two sequences, and (2) may further comprise a sequence that is divergent between the two sequences, sequence comparisons between two (or more) polynucleotides or polypeptide are typically performed by comparing sequences of the two polynucleotides or polypeptides over a “comparison window” to identify and compare local regions of sequence similarity. In some embodiments, a “reference sequence” can be based on a primary amino acid sequence, where the reference sequence is a sequence that can have one or more changes to the primary sequence.

[0053] As used herein, “reporter” or “reporter molecule” refers to a moiety capable of being detected indirectly or directly. Reporters include, without limitation, a chromophore, a fluorophore, a fluorescent protein, a receptor, a hapten, an enzyme, and a radioisotope.

[0054] As used herein, “reporter gene” refers to a polynucleotide that encodes a reporter molecule that can be detected, either directly or indirectly. Exemplary reporter genes encode, among others, enzymes, fluorescent proteins, bioluminescent proteins, receptors, antigenic epitopes, and transporters.

[0055] As used herein, “reporter probe” refers to a molecule that contains a detectable label and is used to detect the presence (e.g., expression) of a reporter molecule. The detectable label on the reporter probe can be any detectable moiety, including, without limitation, an isotope (e.g., detectable by PET, SPECT, etc.),chromophore, and fluorophore. The reporter probe can be any detectable molecule or composition that binds to or is acted upon by the reporter to permit detection of the reporter molecule.

[0056] As used herein, a “ribosome binding site” refers to a sequence of nucleotides upstream of the start codon of an mRNA transcript that is responsible for the recruitment of a ribosome during the initiation of protein translation.

[0057] As used herein, a “selection marker” refers to a gene introduced into a host cell that confers upon the host cell a trait suitable for artificial selection.

[0058] As used herein, “stringent hybridization conditions” refers to hybridizing in 50% formamide at 5XSSC at a temperature of 42 °C and washing the filters in 0.2XSSC at 60 °C. (1XSSC is 0.15MNaCl, 0.015M sodium citrate.) Stringent hybridization conditions also encompasses low ionic strength and high temperature for washing, for example 0.015 M sodium chloride / 0.0015 M sodium citrate / 0.1% sodium dodecyl sulfate at 50 °C; hybridization with a denaturing agent, such as formamide, for example, 50% (v / v) formamide with 0.1% bovine serum albumin / 0.1% Ficoll / 0.1% polyvinylpyrrolidone / 50 mM sodium phosphate buffer at pH 6.5 with 750 mM sodium chloride, 75 mM sodium citrate at 42 °C; or 50% formamide, 5XSSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5X Denhardt's solution, sonicated salmon sperm DNA (50 pg / ml), 0.1% SDS, and 10% dextran sulfate at 42 °C, with washes at 42 °C in 0.2XSSC (sodium chloride / sodium citrate) and 50% formamide at 55 °C, followed by a high-stringency wash consisting of 0.1XSSC containing EDTA at 55 °C.

[0059] As used herein, “substantial identity” refers to a polynucleotide or polypeptide sequence that has at least 80 percent sequence identity, at least 85 percent identity and 89 to 95 percent sequence identity. Substantial identity also encompasses at least 99 percent sequence identity as compared to a reference sequence over a comparison window of at least 20 residue positions or a window of at least 30-50 residues, wherein the percentage of sequence identity is calculated by comparing the reference sequence to a sequence that includes deletions or additions or substitutions over the window of comparison. In specific embodiments applied to polypeptides, the term “substantial identity” means that two polypeptide sequences, when optimally aligned, such as by the programs GAP or BESTFIT using standard parameters, ie.,default parameters, share at least 80 percent sequence identity, preferably at least 89 percent sequence identity, at least 95 percent sequence identity or more (e.g., 99 percent sequence identity).Enzymes

[0060] Microalgae (e.g., Auxenochlorella protothecoides) are used herein to produce high value omega-3 (carbon-carbon double bond in the third bond from methyl end of the fatty acid) and omega-6 lipids (carbon-carbon double bond in the sixth bond from methyl end of the fatty acid), other fatty acids, carotenoids, terpenoids, and other compounds.

[0061] Enzymes capable of enhancing and / or modifying fatty acid production in Microalgae (e.g., A. protothecoides) include, for example, fatty acid desaturase-6 (FADdelta6 desaturase), fatty acid delta-6 elongase [FADdelta6 elongase (ELO)], lysophosphatidyl-choline acyltransferase (LPCAT), phosphatidyl-choline:diacyl- glycerol-choline phosphotransferase (PDCT), CDP-choline: l,2-sn-diacylglycerol choline phosphotransferase (CPT / DAG-CPT), 3 -ketoacyl -Co A synthase (KCS), Ketoacyl-CoA reductase (KCR), Hydroxyacyl-CoA Hydratase (HACD), and / or Enoyl- CoA Reductase (ECR).

[0062] FADdelta6 desaturase from Phaeodactylum tricornutum (Accession No: XP 002182901.1) can be used. Alternatively, FADdelta6 desaturase proteins from Borage officinalis (Accession number: AAC49700.1), Caenorhabditis elegans (Accession number: AF031477), Mortierella alpina (Accession number: AAF08685, ADE06661, AIG59045, and CAE53093), Phaeodactylum tricornutum (Accession number: ABP49078, ADI49410, and XP_002182901) and Synechocystis Sp. (Accession number: WP 010873125) can be used. Additional enzymes that can be used include, for example, Accession number XP 002180428, ADI49411, ABQ18315, AAW70157, KAF9982696, KAF9943255, ADE06662, and / or ACD31685.

[0063] FADdelta6 elongase (ELO) from Phaeodactylum tricornutum (Accession No: ABQ18315) can be used. Alternatively, FADdelta6 ELO proteins from Phaeodactylum tricornutum (Accession number: XP 002180428, ADI49411, ABQ18315, AAW70157), Mortierella antarctica (KAF9982696), or Mortierella alpina (ACD31685, ADE06662, and KAF9943255) can be used.

[0064] Lysophosphatidyl-choline acyltransferase (LPCAT) enzymes belong to a group of membrane bound O-acyl transferase (MBOAT) family of proteins. MB OAT s function in enzymatic acylation of substrates at the membrane. MBOATs are implicated in diverse cellular pathways across species including membrane biogenesis, metabolism, and development and are further categorized into three subgroups based on their biochemical reactions: lipid biosynthesis, sterol acylation and acylation of secreted proteins / peptides (Masumoto et al., 2015). MBOAT family members from various plants including the A. thaliana LPCAT1 (At-LPCATl, NP 172724), also known as lysophospholipid acyltransferase 1 (LPLAT1), show very high conservation.

[0065] LPCAT from Arabidopsis thaliana or Oblongichytrium sp. PB75 can be used. Alternatively, LPCAT Accension numbers NP_172724 (MBOAT (membrane bound O-acyl transferase) family protein from Arabidopsis thaliana), XP 006307436(lysophospholipid acyltransferase 1 from Capsella rubella), AGM15931 (lysophosphatidylcholine acyltransferase 1 from Physaria fendleri), KAG2268038 (hypothetical protein Bca52824_062593 from Brassica carinata), XP_010476235 (lysophospholipid acyltransferase 1 from Camelina sativa), XP_010458693(lysophospholipid acyltransferase 1 from Camelina sativa), XP_010494443(lysophospholipid acyltransferase 1-like isoform XI from Camelina sativa),VVA91 121 (lysophospholipid acyltransferase from Arabis nemorensis), KAF8050459(lysophospholipid acyltransferase from Sinapis alba), XP_018480723(lysophospholipid acyltransferase 1 from Raphanus sativus), KAF3610746(lysophospholipid acyltransferase from Brassica cretica), VDD42258(lysophospholipid acyltransferase from Brassica oleracea), XP 048613976(lysophospholipid acyltransferase 1 from Brassica napus), XP 013637732(lysophospholipid acyltransferase 1 from Brassica oleracea var. oleracea),XP_013742603 (lysophospholipid acyltransferase 1 from Brassica napus),XP 009148576 (lysophospholipid acyltransferase 1 from Brassica rapa), RID57473 (lysophospholipid acyltransferase from Brassica rapa), CAF2082801(lysophospholipid acyltransferase from Brassica napus), CAH8321976(lysophospholipid acyltransferase from Eruca vesicaria subsp. sativa), XP 009113025(lysophospholipid acyltransferase 2 from Brassica rapa), CAG7861229(lysophospholipid acyltransferase 2 from Brassica rapa), and / or KAG2302728 (lysophospholipid acyltransferase from Brassica carinata) can be used.

[0066] Phosphatidyl-choline:diacyl-glycerol-choline phosphotransferase (PDCT) from Arabidopsis thaliana or Oblongichytrium sp. PB75 can be used. Alternatively, PDCT can be used having Accession numbers NP 566527, QJD09136, XP_006298254, CAH2053596, XP_006406915, KAJ0264196, KAG2305941, CAH8361340, XP_018492472, XP_013695400, KAG2271844, KAF3604882, UZS99691, XP_018493296, XP_013587626, XP_013700801, CAF2101166, XP_056842520, XP_009146195, KAJ0249247, CAG7877449, XP_013736317, XP_048635755, XP_013702685, and / or XP_009135457. These Accession numbers correspond to the following species: Arabidopsis thaliana (NP 566527), Camelina sativa (QJD09136), Capsella rubella (XP 006298254), Thlaspi arvense (CAH2053596), Eutrema salsugineum (XP 006406915), Hirschfeldia incana (KAJ0264196; KAJ0249247), Brassica carinata (KAG2305941; KAG2271844), Eruca vesicaria subsp. sativa (CAH8361340), Raphanus sativus (XP_018492472; XP_018493296; XP_056842520), Brassica napus (XP_013695400; XP_013700801; CAF2101166; XP_013736317’ XP_048635755; XP_013702685), Brassica cretica (KAF3604882), Lepidium campestre (UZS99691), Brassica oleracea var. oleracea (XP_013587626), Brassica rapa (XP_009146195; CAG7877449; XP_009135457 ).

[0067] In yeast and mammals, Choline-phosphotransf erase CPT and ethanolamine-phosphotransferase (EPT) are distinct enzymes. In plants, however, amino-alcohol-phosphotransferases (AAPT) play a dual role for CPT and EPT and are able to catalyze both phosphatidylcholine and phosphatidylethanolamine biosynthesis from CDP-choline and CDP-ethanolamine. Arabidopsis thaliana CPTZEPT protein AAPT1 has a higher choline-phosphotransferase activity than ethanolaminephosphotransferase activity.

[0068] CDP-choline: 1,2-sn-diacylglycerol choline phosphotransferase(CPT / DAG-CPT) from Arabidopsis thaliana or Oblongichytrium sp. PB75 can be used. Other CPTZEPT / DAG-CPT proteins can be used, such as Accession number NP_172813, XP_020866963, XP_023645150, XP_010458803, XP_018435175, KAF8066115, CAH2037916, XP_009148643, XP_006417116, KAJ0256924, XP_013671790, XP_048613998, KAG2268162, KAF2548457, XP_018433429,KAF8104583, CAH8391535, KAG2297839, CDY30028, XP_009117989,VDD58957, KAJ0253359, XP_013601995, RID48554, and / or KAF3493050. These Accession numbers correspond to plants: Arabidopsis thaliana (NP 172813), Arabidopsis lyrata subsp. lyrata (XP_020866963), Capsella rubella (XP_023645150), Camelina sativa (XP_010458803), Raphanus sativus (XP_018435175; XP_018433429), Sinapis alba (KAF8066115; KAF8104583), Thlaspi arvense (CAH2037916), Brassica rapa (XP 009148643; XP 009117989; RID48554), Eutrema salsugineum (XP 006417116), Hirschfeldia incana (KAJ0256924), Brassica napus (XP_013671790; XP_048613998; CDY30028; CAF1925318), Brassica carinata (KAG2268162; KAG2297839), Brassica cretica (KAF2548460; KAF2548457; KAF3493050), Eruca vesicaria subsp. sativa (CAH8391535), Brassica oleracea (VDD58957), Hirschfeldia incana (KAJ0253359), Brassica oleracea var. oleracea (XP 013601995). Alternatively, CPT / DAG-CPT / ethanolamine phosphotransferase (EPT) PB75 005318-T1 (PB75-DAG-CPT), CPT / DAG-CPT / ethanolamine phosphotransferase (EPT) PB75 006534-T1 (PB75-CPT1), CPT / DAG- CPT / ethanolamine phosphotransferase (EPT) PB75 009271-T1 (PB75-CPT2), and a PDCT look-alike PB75 012102-T1 (PB75-PDCT) can be used. Additional enzymes that can be used include, for example, Phytophthora infestans cholinephosphotransferase CPT1 (Accession number: XM 002900684) and CPT2 (Accession number: XM_002997893) and At-PDCT (Accession No: NP_566527 described below).

[0069] 3-ketoacyl-CoA synthase (KCS) from Malania oleifera (Accession number: QDA34238, XP 057960190, and XP 057960186), or Alliaria petiolata can be used. Alternatively, KCS enzymes from Cardamine graeca (Accession number: ACJ61778), Crambe abysinnica (Accession number: AAX22298), Lunaria annua (Acession number: ACJ61777), Limnanthes douglasii (Accession number: AF247134 1), Brassica napus (Bn-KCSl and Bn-KCS2, Accession numbers: AAA96054 and AAT65206) can be used. Additional enzymes that can be used include, for example, KCS enzymes from Arabidopsis lyrata (ADN10815), Camelina hispida (ADN10817), Arabidopsis thaliana (NP_195178), Vitia vinifera (RVW53968), Vitis riparia (XP 034683607), Durio zibethinus (XP 022729498), Prunus persica(XP_007223150), Theobroma cacao (EOY31420), and Syzygium oleosum (XP_030467300).

[0070] Extension of fatty acids beyond Cl 8: 1, in higher plants and microalgae, requires the coordinated action of four key ER enzymes - a Ketoacyl Co-A synthase (KCS aka fatty acid elongase, FAE), a Ketoacyl-CoA reductase (KCR), a Hydroxyacyl- CoA Hydratase (HACD) and an Enoyl-CoA Reductase (ECR). Each elongation reaction condenses two carbons at a time from malonyl-CoA to an acyl group, followed by reduction, dehydration, and a final reduction reaction. KCS (or FAE) catalyzes the condensation of malonyl-CoA with an acyl primer. Malonyl-CoA itself is generated through irreversible carboxylation of cytosolic acetyl-CoA by the action of multidomain cytosolic homomeric acetyl-coenzyme A carboxylase (ACCase). For efficient and sustained fatty acid elongation, the unavailability of ample malonyl-CoA can potentially become a bottleneck. Besides Malonyl-CoA is also used to produce flavonoids, anthocyanins, malonate D-amino-acids, and malonyl-amino cyclopropanecarboxylic acid, which may further decrease its availability for elongation. We have previously described the identification and upregulation of A. protothecoides homomeric ACCase genes via the “promoter hijack” methodology (PCT application Serial Number PCT / IB2022 / 062048). The “promoter hijack”, as described in our earlier applications, was accomplished by inserting various heterologous gene cassettes together with a stronger promoter between the endogenous ApACCase-2 promoter and the initiation codon of the ApACCase-2 gene.

[0071] Ketoacyl-CoA reductase (KCR) from Malania oleifera (Accession number: QDA34240) or Alliaria petiolata can be used. Alternatively, the following KCRs can be used: XP_015894465, XP_034696659, XP_021633644, KAG6598255, RVW74316, XP_016740434, KAB1201206. These Accession numbers correspond to plants Ziziphus jujuba (XP_015894465), Vitis riparia (XP 034696659), Manihot esculenta (XP_021633644), Cucurbita argyrosperma subsp. sororia (KAG6598255), Vitis vinifera (RVW74316), Gossypium hirsutum (XP_016740434), Morelia rubra (KAB1201206). Additional enzymes that can be used include, for example, KCR enzymes from Arabidopsis thaliana (NP_564905), Arabidopsis lyrata subsp. lyrata (XP_002887140), Camelina sativa (XP_010470694), Eutrema salsugineum (XP 006391228), Brassica oleracea var. oleracea (XP 013621534), Brassica napus(NP_OO 1302805), Hirschfeldia incana (KAJ0256027), Brassica rapa (XP_009127574), Microthlaspi erraticum (CAA7058321).

[0072] Hydroxyacyl-CoA Hydratase (HACD) from Malania oleifera (Accession number: XP_057967704) or Alliaria petiolata can be used. Alternatively, the following HACDs can be used: XP_009131162, XP_013701928, XP_006399546, XP_058081763, XP_033508788, XP_031478963, XP_031376559, XP_006466304. These Accession numbers correspond to plants Brassica rapa (XP 009131162), Brassica napus (XP 013701928), Eutrema salsugineum (XP 006399546), Magnolia sinica (XP_058081763), Nicotiana tomentosiformis (XP_033508788), Nymphaea colorata (XP 031478963), Punica granatum (XP 031376559), and Citrus sinensis (XP 006466304). Additional enzymes that can be used include, for example, HACD enzymes from Cornus florida (XP_059624145), Amaranthus tricolor (XP_057541506), Carya illinoinensis (XP_042990950), Morus notabilis (XP_024028577), Ziziphus jujuba (XP 015890567), and Camellia lanceoleosa (KAI8030338).

[0073] Enoyl-CoA Reductase (ECR) from Malania oleifera (Accession number: XP_057979752) or Alliaria petiolata can be used. Alternatively, the following ECRs can be used: NP_001302896, XP_009116229, XP_006403467, XP_034705237, XP_031259583, XP_010658577, XP_044509682, XP_021618477, XP_006435990. These Accession numbers correspond to plants Brassica napus (NP 001302896), Brassica rapa (XP_009116229), Eutrema salsugineum (XP_006403467), Vitis riparia (XP_034705237), Pistacia vera (XP_031259583), Vitis vinifera (XP_010658577), Mangifera indica (XP_044509682) Manihot esculenta (XP_021618477), and Citrus Clementina (XP 006435990). Additional enzymes that can be used include, for example, ECR enzymes from Hevea brasiliensis (XP 057989572), Jatropha curcas (XP 012089325), Ricinus communis (XP 002530850), Herrania umbratica (XP_021295484), and Citrus sinensis (KAH9767690).Fatty Acids

[0074] Long-chain polyunsaturated fatty acids (LC-PUFAs) are fatty acids with 18-20 carbons or more, which can be categorized into two main families — co6 (n-6) and co3 (n-3) — depending on the position of the first double bond from the methyl end group of the fatty acid, n-3 LC-PUFA in food sources are a-linolenic acid (ALA) (18:3 A9, 12, 15), docosahexaenoic acid (DHA) (22:6 A4, 7, 10, 13, 16, 19), eicosapentaenoicacid (EP A) (20:5 A5, 8, 11, 14, 17), and docosapentaenoic acid (DPA) (22:5 A7, 10, 13, 16, 19), and n-6 LC-PUFA include linoleic acid (LA) (18:2 A9, 12) and arachidonic acid (ARA) (20:4 A5, 8, 11, 14). Some intermediate products such as di-homo-y- linolenic acid (DGLA; 20:3 A8,l l,14) and y-linolenic acid (GLA; 18:3 A6,9,12) (for n- 6 production), and stearidonic acid (SDA; 18:4 A6,9,12,15) and eicosatetraenoic acid(ETA; 20:4 A8, 11,14,17) (for n-3 production) are created during LC-PUFA production.

[0075] Mammals cannot make linoleic acid (LA) (18:2 A9, 12) and a-linolenic acid (ALA) (18:3 A9, 12, 15) from the precursor oleic acid, and the conversion efficiency of LA to arachidonic acid (ARA) (20:4 A5, 8, 11, 14), docosahexaenoic acid (DHA) (22:6 A4, 7, 10, 13, 16, 19), eicosapentaenoic acid (EP A) (20:5 A5, 8, 11, 14, 17) are low, hence these fatty acids are obtained from diet.

[0076] The structure of these fatty acids is shown below:

[0077] Besides the amount of polyunsaturated fatty acid in the diet, the ratio of co6 / co3 is known to be of nutritional importance as it is the key index for balanced synthesis of eicosanoids in the body. For optimal infant nutrition, the ratio of n-6 / n-3 must be not higher than 10. High consumption of plant oils rich in n-6 PUFA and consumption of relatively low marine foods (as source of n-3 PUFA) increases the n- 6 / n-3 ratio. When one has a diet rich in ALA and lower LA consumption levels, EPA and DHA in muscle tissue increases due to reduced competition for A6 desaturase. An ideal ratio of n-6 / n-3 is 1 / 5-10 to protect human health. An even more ideal ratio of n- 6 / n-3 is 1 / 2-4. Many people consume large amounts of co6 (n6) and much less co3 (n3) such that in the amount of co6 is 10-30 times more than that of co3.

[0078] GLA is an important unsaturated fatty acid. It is the precursor for ARA biosynthesis which is a precursor for prostaglandin formation. GLA can provide health benefits in the prevention and treatment of cardiovascular disorders.Nucleic Acids

[0079] Nucleic acids encode one or more of the enzymes described above. These nucleic acids are used to engineer into suitable host cells the biochemical pathways for making desired LC-PUFA.

[0080] In some embodiments, the nucleic acids are expression constructs, such as plasmids, or viral vectors, or linear vectors, or vectors that integrate into chromosomal DNA. Expression constructs can contain a nucleic acid sequence that enables the construct to replicate in one or more selected host cells (e.g., an origin of replication). Such sequences are well known for a variety of cells. E.g., the origin of replication from the plasmid pBR322 is suitable for most Gram-negative bacteria. In eukaryotic host cells, e.g., mammalian cells, the expression construct can be integrated into the host cell chromosome and then the construct replicates with the host chromosome. Similarly, constructs can be integrated into the chromosome of prokaryotic cells.

[0081] In general, expression constructs containing replication and control sequences that are derived from species compatible with the host cell are used in connection with a suitable host cell. The expression construct ordinarily carries a replication site, as well as marking sequences that are capable of providing phenotypic selection of the construct in transformed cells. For example, E. coli is typically transformed using pBR322, a plasmid derived from an E. coli species (see, e.g., Bolivar et al., (1977) Gene, 2: 95). pBR322 contains genes for ampicillin and tetracycline resistance and thus provides easy means for identifying transformed cells.

[0082] In some embodiments, the constructs used can be stimulated to increase (or decrease) copy number in a suitable host cell. This copy control can be used to change the window of detection / selection for the biosensors that are cloned in the constructs, e.g., fosmid clones. For example, the CopyControl Cloning System vectors which are sold by Epicentre can be used in the invention to make fosmid clones whose copy number can be inducibly changed (using arabinose). These copy number controllable constructs may be used in conjunction with the EPI300 E. coli strain whichis also sold by Epicentre. In some embodiments, the CopyControl Cloning System is used to induce a high copy number for fosmid clones in the Metagenomic library.

[0083] Expression constructs also generally contain a selection gene, also termed a selectable marker. Selectable markers are well-known in the art for prokaryotic and eukaryotic cells, including host cells of the invention. Generally, the selection gene encodes a protein necessary for the survival or growth of transformed host cells grown in a selective culture medium. Host cells not transformed with the construct containing the selection gene will not survive in the culture medium. Typical selection genes encode proteins that (a) confer resistance to antibiotics or other toxins, e.g., ampicillin, neomycin, methotrexate, spectinomycin, chloramphenicol, kanamycin, or tetracycline, (b) complement auxotrophic deficiencies, e.g., the gene encoding D- alanine racemase for Bacilli unable to make D-alanine because of a mutant D-alanine racemase. In some embodiments, an exemplary selection scheme utilizes a drug to arrest growth of a host cell. Those cells that are successfully transformed with a heterologous gene produce a protein conferring drug resistance and thus survive the selection regimen. Other selectable markers for use in bacterial or eukaryotic (including mammalian) systems are well-known in the art.

[0084] The expression construct for producing the polypeptides of the invention contain a suitable control region that is recognized by the host organism and is operably linked to the nucleic acid encoding the polypeptide of interest. Promoters used in the constructs of the invention include cis-acting transcriptional control elements and regulatory sequences that are involved in regulating or modulating the timing and / or rate of transcription of a gene. For example, a promoter can be a cis-acting transcriptional control element, including an enhancer, a promoter, a transcription terminator, an origin of replication, a chromosomal integration sequence, 5' and 3' untranslated regions, or an intronic sequence, which are involved in transcriptional regulation. These cis-acting sequences can interact with proteins or other biomolecules to carry out (turn on / off, regulate, modulate, etc.) transcription. "Constitutive" promoters are those that drive expression continuously under most environmental conditions and states of development or cell differentiation. "Inducible" or "regulatable" promoters direct expression of the nucleic acid of the invention under the influence of environmental conditions or developmental conditions. Examples ofenvironmental conditions that may affect transcription by inducible promoters include anaerobic conditions, elevated temperature, drought, changes in nutrient concentration, or the presence of light.

[0085] Expression constructs of the invention typically have promoter elements, e.g., enhancers, to regulate the frequency of transcriptional initiation. Typically, these are located in the region 30-110 base pairs upstream of the start site, although a number of promoters have been shown to contain functional elements downstream of the start site as well. The spacing between promoter elements frequently is flexible, so that promoter function is preserved when elements are inverted or moved relative to one another. In the thymidine kinase (tk) promoter, the spacing between promoter elements can be increased to 50 base pairs apart before activity begins to decline. Depending on the promoter it appears that individual elements can function either cooperatively or independently to activate transcription.

[0086] Promoters suitable for use in microalgae include, for example, P-tubulin from Chlamydomonas reinhardtii, viral promoters from cauliflower mosaic virus (CMV) and chlorella virus, which are active in multiple species of microalgae (see for example Plant Cell Rep. 2005 March; 23(10-11):727-35; J Microbiol. 2005 August; 43(4):361-5; Mar Biotechnol (NY). 2002 January; 4(l):63-73). Another promoter that is suitable for use in Prototheca is the Chlorella sorokiniana glutamate dehydrogenase promoter / 5'UTR, the promoter for the Chlorella HUP1 gene, and the promoter for the Chlorella ellipsoidea nitrate reductase. The foregoing promoters and more promoters useful for expressing polypeptides in microalgae are disclosed in U.S. Patent No. 8,222,010, 9,279,136 and 9,290,749, such as amino acid (AAT), ammonium (AMT), sugar (SUT) transporters (SEQ ID NOs: 55-66 of U.S. Pat. No. 9,279,136), and which are incorporated by reference in their entirety for all purposes. Chlorella virus promoters can also be used to express genes in Prototheca, such as SEQ ID NOs: 1-7 of U.S. Pat. No. 6,395,965, which is incorporated by reference in its entirety for all purposes. Still other promoters active in Prototheca can be found, for example, in Biochem Biophys Res Commun. 1994 Oct. 14; 204(1): 187-94; Plant Mol. Biol. 1994 October; 26(l):85-93; Virology. 2004 Aug. 15; 326(1): 150-9; and Virology. 2004 Jan. 5; 318(l):214-23, all of which are incorporated by reference in their entirety for all purposes.

[0087] Exemplary mammalian promoters include CMV immediate early, HSV thymidine kinase, early and late SV40, LTRs from retrovirus, and mouse metallothionein I. The nucleotide sequences of these and many other promoters have been published, thereby enabling a skilled worker to operably join them to DNA encoding the polypeptide of interest (Siebenlist et al, (1980) Cell, 20: 269) using linkers, adaptors or "scarless", to supply any required restriction sites. See also, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989); and Current Protocols in Molecular Biology, Ausubel et al., eds, Green Publishers Inc. and Wiley and Sons, N.Y (1994), both of which are incorporated by reference in their entirety for all purposes.

[0088] Nucleic acids that encode polypeptides are also described herein. The nucleic acid encoding a polypeptide can be easily prepared from an amino acid sequence of the polypeptide of interest using the genetic code. The nucleic acid encoding a polypeptide can be prepared using a standard molecular biological and / or chemical procedure. For example, based on the base sequence, a nucleic acid can be synthesized, and the nucleic acid of the present invention can be prepared by combining DNA fragments which are obtained from a cell or other nucleic acid using a polymerase chain reaction (PCR).

[0089] For recombinant expression of a polypeptide in a host cell, it can be beneficial to employ coding sequences in recombinant nucleic acids that produce mRNA with codons preferentially used by the host cell. Thus, proper expression of transgenes can require that the codon usage of the transgene matches the specific codon bias of the organism in which the transgene is being expressed. Codon optimization for microalgae is described in U.S. Patent Nos. 8,222,010 and 9,290,749, both of which are incorporated by reference in their entirety for all purposes. Table 1 shows codon usage for mRNAs from Prototheca strains.

[0090] The nucleic acids may also encode fragments and / or variants of a polypeptide having one or more deletions, additions and substitutions to the sequence. The fragments and / or variants can have 1, 2, 3 or more deletions, additions and / or substitutions to the sequence. The additions and deletions can be in the internal sequence, carboxy, and / or amino terminus of the polypeptide sequence, where the variant retains the desired enzymatic activity. The term “conservative variation” denotes the replacement of an amino acid residue by another biologically similar residue, or the replacement of a nucleotide in a nucleic acid sequence such that the encoded amino acid residue does not change or is changed to another structurally, chemically or otherwise functionally similar residue. In this regard, some substitutions will generally be conservative in nature, z.e., those substitutions that take place withina family of amino acids. For example, amino acids are generally divided into four families: (1) acidic— aspartate and glutamate; (2) basic— lysine, arginine, histidine; (3) non-polar— alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan; and (4) uncharged polar— glycine, asparagine, glutamine, cysteine, serine, threonine, and tyrosine. Phenylalanine, tryptophan, and tyrosine are sometimes classified as aromatic amino acids. Examples of conservative variations include the substitution of one hydrophobic residue such as isoleucine, valine, leucine or methionine for another hydrophobic residue, or the substitution of one polar residue for another polar residue, such as the substitution of arginine for lysine, glutamic acid for aspartic acid, or glutamine for asparagine, and the like; or a similar conservative replacement of an amino acid with a structurally related amino acid that will not have a major effect on the biological activity. Polypeptides having substantially the same amino acid sequence as the reference molecule but possessing minor amino acid substitutions that do not substantially affect the activity of the polypeptide are, therefore, within the definition of the reference polypeptide. All of the polypeptides produced by these modifications are included herein. The term “conservative variation” also includes the use of a substituted amino acid in place of an unsubstituted parent amino acid provided that antibodies raised to the substituted polypeptide also immunoreact with the unsubstituted polypeptide.

[0091] Homologs of the enzymes used herein are also disclosed. As used herein, the term “homologs” includes analogs and paralogs. The term “anologs” refers to two polynucleotides or polypeptides that have the same or similar function, but that have evolved separately in unrelated host organisms. The term “paralogs” refers to two polynucleotides or polypeptides that are related by duplication within a genome. Paralogs usually have different functions, but these functions may be related. Analogs and paralogs of an enzyme can differ from the wild-type enzyme by post-translational modifications, by amino acid sequence differences, or by both. In particular, homologs will generally exhibit at least 80-85%, 85-90%, 90-95%, or 95%, 96%, 97%, 98%, or 99% sequence identity, with all or part of the wild-type enzyme sequence and will exhibit a similar function. Variants include allelic variants. The term “allelic variant” refers to a polynucleotide or a polypeptide containing polymorphisms that lead to changes in the amino acid sequences of a protein and that exist within a naturalpopulation (e.g., a virus species or variety). Such natural allelic variations can typically result in 1-5% variance in a polynucleotide or a polypeptide. Any and all such nucleic acid variations and resulting amino acid polymorphisms or variations that are the result of natural allelic variation and that do not alter the functional activity of the gene of interest, are intended to be within the scope of the disclosure.

[0092] As used herein, “derivative” or “variant” refers to an enzyme, or a nucleic acid encoding an enzyme, that has one or more conservative amino acid variations or other minor modifications such that the corresponding polypeptide has substantially equivalent function when compared to the wild type polypeptide. These variants or derivatives include polypeptides having minor modifications of the enzyme primary amino acid sequences that may result in peptides which have substantially equivalent activity as compared to the unmodified counterpart enzyme. Such modifications may be deliberate, as by site-directed mutagenesis, or may be spontaneous. The term “variant” further contemplates deletions, additions and substitutions to the sequence, so long as the enzyme functions. The term “variant” also includes the modification of a polypeptide where the native signal peptide is replaced with a heterologous signal peptide to facilitate the expression or secretion of the polypeptide from a host species.

[0093] The nucleic acid of the present invention can be linked to another nucleic acid so as to be expressed under control of a suitable promoter. The nucleic acid of the present invention can be also linked to, in order to attain efficient transcription of the nucleic acid, other regulatory elements that cooperate with a promoter or a transcription initiation site, for example, a nucleic acid comprising an enhancer sequence, or a terminator sequence. In addition to the nucleic acid of the present invention, a gene that can be a marker for confirming expression of the nucleic acid (e.g. a drug resistance gene, a gene encoding a reporter enzyme, or a gene encoding a fluorescent protein) may be incorporated.

[0094] When the nucleic acid of the present invention is introduced into a host cell, the nucleic acid of the present invention may be combined with a substance that promotes transference of a nucleic acid into a cell, for example, a reagent for introducing a nucleic acid such as a liposome or a cationic lipid, in addition to theaforementioned excipients. Alternatively, a construct carrying the nucleic acid of the present invention is also useful.Host Cells

[0095] In the present invention, various host cells can be used with the polynucleotides and polypeptides of the invention. The host cell may be any of the host cells familiar to those skilled in the art, including prokaryotic cells and eukaryotic cells, such as bacterial cells, fungal cells, yeast cells, mammalian cells, insect cells, or plant cells.

[0096] In other embodiments, the host cells are algal and / or photosynthetic, or non-photosynthetic, including but not limited to algae or photosynthetic cells of the genera Agmenellum, Amphora, Anabaena, Ankistrodesmus, Asterochloris, Asteromonas, Astephomene, Basichlamys, Botryococcus, Botryokoryne, Boekelovia, Borodinella, Brachiomonas, Catena, Carteria, Chaetoceros, Chaetophora, Characiochloris, Characiosiphon, Chlainomonas, Chlamydomonas, Chlorella, Chlorochytrium, Chlorococcum, Chlorogonium, Chloromonas, Chrysosphaera, Closteriopsis, Cricosphaera, Cryptomonas, Cyclotella, Dictyochloropsis, Dunaliella, Ellipsoideus, Eremosphaera, Eudorina, Euglena, Fragilaria, Floydiella, Friedmania, Haematococcus, Hafniomonas, Heterochlorella, Gleocapsa, Gloeothamnion, Gonium, Halosarcinochlamys, Hymenomonas, Isochrysis, Koliella, Lepocinclis, Lobocharacium, Lobochlamys, Lobomonas, Lobosphaera, Lobosphaeropsis, Marvania, Monoraphidium, Myrmecia, Nannochloris, Nannochloropsis, Navicula, Nephrochloris, Nitschia, Nitzschia, Ochromonas, Oocystis, Oogamochlamys, Oscillatoria, Pabia, Pandorina, Pari etochl oris, Pascheria, Phacotus, Phagus, Phormidium, Platydorina, Platymonas, Pleodorina, Pleurochrysis, Polulichloris, Polytoma, Polytomella, Prasiola, Prasiolopsis, Prasiococcus, Prototheca, Pseudochlorella, Pseudocarteria, Pseudotrebouxia, Pteromonas, Pyrobotrys, Rosenvingiella, Scenedesmus, Schizotrichium, Spirogyra, Stephanosphaera, Tetrabaena, Tetraedron, Tetraselmis, Thraustochytrium, Trebouxia, Trochisciopsis, Ulkenia, Viridiella, Vitreochlamys, Volvox, Volvulina, Vulcanochloris, Watanabea, or Yamagishiella. The host cell can be Auxenochlorella protothecoides, Auxenochlorella pyrenoidosa. Botryococcus braunii. Prototheca krugani, Prototheca moriformis.Prototheca portoricensis, Prototheca stagnora, Prototheca wicker hamir Prototheca zopfii, Schizochytrium sp. and the like.

[0097] Microalgae are eukaryotic microbial organisms that contain a chloroplast or plastid, and optionally are capable of performing photosynthesis, or a prokaryotic microbial organism capable of performing photosynthesis. Microalgae include obligate photoautotrophs, which cannot metabolize a fixed carbon source as energy, as well as heterotrophs, which can live solely off of a fixed carbon source. Microalgae include unicellular organisms that separate from sister cells shortly after cell division, such as Chlamydomonas, as well as microbes such as, for example, Volvox, which is a simple multicellular photosynthetic microbe of two distinct cell types. Microalgae include cells such as Auxenochlorella, Chlorella, Dunaliella, and Prototheca. Microalgae also include other microbial photosynthetic organisms that exhibit cell-cell adhesion, such as Agmenellum, Anabaena, and Pyrobotrys. Microalgae also include obligate heterotrophic microorganisms that have lost the ability to perform photosynthesis, such as certain dinoflagellate algae species, thraustochytrids such as Schizochytrium, Thraustochytrium and Aurantiochytrium and species of the genus Prototheca. Examples of microalgae are provided in PCT Patent Applications W02008 / 151149, W02010 / 06032, WO2011 / 150410, andWO201 1 / 150411, all of which are incorporated by reference in their entirety for all purposes.

[0098] Host cells can be Auxenochlorella strains, particularly recombinant Auxenochlorella strains, for the production of lipids. Species of Auxenochlorella for use herein can be identified by amplification of certain target regions of the genome. Host cells can be Prototheca strains, particularly recombinant Prototheca strains, for the production of lipids. Species of Prototheca for use in the invention can be identified by amplification of certain target regions of the genome. Well established methods of phylogenetic analysis, such as amplification and sequencing of ribosomal internal transcribed spacer (ITS1 and ITS2 rDNA), 23 S rRNA, 18S rRNA, and other conserved genomic regions can be used by those skilled in the art to identify species of not only Prototheca, but other hydrocarbon and lipid producing organisms with similar lipid production capability. For examples of methods of identification and classification of algae also see for example Genetics, 2005 August; 170(4): 1601-10 and RNA, 2005April; 11 (4) : 361 -4. Microalgae for use in the present invention typically have genomic DNA sequences encoding for 16S rRNA that have at least 99%, at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, or at least 70% sequence identity described in Ewing A, et al (2014) J. Phycol. 50: 765-769, which is incorporated by reference in its entirety for all purposes.

[0099] In some embodiments, the eukaryotic cells are fungi cells, including, but not limited to, fungi of the genera Aciculoconidium, Ambrosiozyma, Arthroascus, Arxiozyma, Ashbya, Aspergillus, Babjevia, Bensingtonia, Botryoascus, Botryozyma, Brettanomyces, Bullera, Bulleromyces, Candida, Chlamydomonas, Chrysosporium, Citeromyces, Clavispora, Cryptococcus, Cystofilobasidium, Debaryomyces, Dekkara, Dipodascopsis, Dipodascus, Eeniella, Endomycopsella, Eremascus, Eremothecium, Erythrobasidium, Fellomyces, Filobasidium, Fusarium, Galactomyces, Geotrichum, Guilliermondella, Hanseniaspora, Hansenula, Holtermannia, Hormoascus, Hyphopichia, Issatchenkia, Kloeckera, Kloeckeraspora, Kluyveromyces, Kondoa, Kuraishia, Kurtzmanomyces, Leucosporidium, Lipomyces, Lodderomyces, Malassezia, Metschnikowia, Mrakia, Myxozyma, Nadsonia, Nakazawaea, Nematospora, Neotyphodium, Neurospora, Ogataea, Oosporidium, Pachysolen, Penicillium, Phachytichospora, Phaffia, Pichia, Rhodosporidium, Rhodotorula, Saccharomyces, Saccharomycodes, Saccharomycopsis, Saitoella, Sakaguchia, Saturnospora, Schizoblastosporion, Schizosaccharomyces, Schwanniomyces,Sporidiobolus, Sporobolomyces, Sporopachydermia, Stephanoascus,Sterigmatomyces, Sterigmatosporidium, Symbiotaphrina, Sympodiomyces,Sympodiomycopsis, Torulaspora, Trichoderma, Trichosporiella, Trichosporon, Trigonopsis, Tsuchiyaea, Udeniomyces, Waltomyces, Wickerhamia, Wickerhamiella, Williopsis, Xanthophyllomyces, Yamadazyma, Yarrowia, Zygoascus, Zygosaccharomyces, Zygowilliopsis, and Zygozyma, among others. In some embodiments, the fungi is Candida albicans, Chrysosporium lucknowense, Fusarium graminearum, Fusarium venenatum, Hansenula polymorpha, Kluyveromyces lactis, Neurospora crassa, Pichia angusta, Pichia fmlandica, Pichia kodamae, Pichia membranaefaciens, Pichia methanolica, Pichia opuntiae, Pichia pastoris, Pichia pijperi, Pichia quercuum, Pichia salictaria, Pichia thermotolerans, Pichia trehalophila, Pichia stipitis, Streptomyces ambofaciens, Streptomyces aureofaciens,Streptomyces aureus, Saccaromyces bayanus, Saccaromyces boulardi, Saccharomyces cerevisiae, Schizosaccharomyces pompe, Streptomyces fungicidicus, Streptomyces griseochromogenes, Streptomyces griseus, Streptomyces lividans, Streptomyces olivogriseus, Streptomyces rameus, Streptomyces tanashiensis, Streptomyces vinaceus, Trichoderma reesei and Xanthophyllomyces dendrorhous (formerly Phaffia rhodozyma), or a filamentous fungi, e.g. Trichoderma, Aspergillus sp., including Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Aspergillus phoenicis, Aspergillus carbonarius, and the like.[000100] In some embodiments the host cells are plant cells. In some embodiments the plant cells are cells of monocotyledonous or dicotyledonous plants, including, but not limited to, alfalfa, almonds, asparagus, avocado, banana, barley, bean, blackberry, brassicas, broccoli, cabbage, canola, carrot, cauliflower, celery, cherry, chicory, citrus, coffee, cotton, cucumber, eucalyptus, hemp, lettuce, lentil, maize, mango, melon, oat, papaya, pea, peanut, pineapple, plum, potato (including sweet potatoes), pumpkin, radish, rapeseed, raspberry, rice, rye, sorghum, soybean, spinach, strawberry, sugar beet, sugarcane, sunflower, tobacco, tomato, turnip, wheat, zucchini, and other fruiting vegetables (e.g. tomatoes, pepper, chili, eggplant, cucumber, squash etc.), other bulb vegetables (e.g., garlic, onion, leek etc.), other pome fruit (e.g. apples, pears etc.), other stone fruit (e.g., peach, nectarine, apricot, pears, plums etc.), Arabidopsis, woody plants such as coniferous and deciduous trees, an ornamental plant, a perennial grass, a forage crop, flowers, other vegetables, other fruits, other agricultural crops, herbs, grass, or perennial plant parts (e.g., bulbs; tubers; roots; crowns; stems; stolons; tillers; shoots; cuttings, including un-rooted cuttings, rooted cuttings, and callus cuttings or callus-generated plantlets; apical meristems etc.). The term “plants” refers to all physical parts of a plant, including seeds, seedlings, saplings, roots, tubers, stems, stalks, foliage and fruits.Introduction of Polynucleotides to Host Cells[000101] In some embodiments, the nucleic acid(s) of the invention is / are introduced to the eukaryotic cell by transfection (e.g., Gorman, et al. Proc. Natl. Acad. Sci. 79.22 (1982): 6777-6781, which is incorporated by reference in its entirety for all purposes), transduction (e.g., Cepko and Pear (2001) Current Protocols in Molecular Biology unit 9.9; DOI: 10.1002 / 0471142727. mb0909s36, which is incorporated byreference in its entirety for all purposes), calcium phosphate transformation (e.g., Kingston, Chen and Okayama (2001) Current Protocols in Molecular Biology Appendix 1C; DOI: 10.1002 / 0471142301. nsaOlcsOl, which is incorporated by reference in its entirety for all purposes), calcium chloride and polyethylene glycol (PEG) to introduce recombinant DNA into microalgal cells (see Kim et al., (2002) Mar. Biotechnol. 4:63-73, which reports the use of this method to transform Chlorella ellipsoidea protoplasts, and which is incorporated by reference in its entirety for ail purposes), cell-penetrating peptides (e.g., Copolovici, Langel, Eriste, and Langel (2014) ACS Nano 2014 8 (3), 1972-1994; DOI: 10.1021 / nn4057269, which is incorporated by reference in its entirety for all purposes), electroporation (e.g. Potter (2001) Current Protocols in Molecular Biology unit 10.15; DOI: 10.1002 / 0471142735. iml015s03 and Kim et al (2014) Genome 1012-19. doi: 10.1101 / gr.171322.113, Kim et al. 2014 describe the Amaza Nucleofector, an optimized electroporation system, both of these references are incorporated by reference in their entirety for all purposes), microinjection(e.g., McNeil (2001) Current Protocols in Cell Biology unit 20.1; DOI: 10.1002 / 0471143030. cb2001sl8, which is incorporated by reference in its entirety for all purposes), liposome or cell fusion (e.g. Hawley-Nelson and Ciccarone (2001) Current Protocols in Neuroscience Appendix IF; DOI: 10.1002 / 0471142301.nsaOlfslO, which is incorporated by reference in its entirety for all purposes), mechanical manipulation (e.g. Sharon et al. (2013) PNAS 2013 110(6); DOI: 10.1073 / pnas.1218705110, which is incorporated by reference in its entirety for all purposes), biolistic methods (see, for example, Sanford, Trends in Biotech. (1988) 6: 299302, U.S. Pat. No. 4,945,050, which is incorporated by reference in its entirety for all purposes), Lithium Acetate / PEG transformation (Gietz and Woods (2006) Methods Mol. Biol. 313, 107-120) and its modifications, which is incorporated by reference in its entirety for all purposes, or other well-known techniques for delivery of nucleic acids to host cells. Once introduced, the nucleic acids of the invention can be expressed episomally or can be integrated into the genome of the host cell using well known techniques such as recombination (e.g., Lisby and Rothstein (2015) Cold Spring Harb PerspectBiol. Mar 2;7(3). pii: a016535. doi: 10.1101 / cshperspect.a016535, which is incorporated by reference in its entirety for all purposes), non-homologous integration (e.g., Deyle and Russell (2009) Curr Opin Mol Ther. 2009 Aug;l 1(4):442-7, which is incorporated by reference in its entirety for all purposes) or transposition (as described above for mobile genetic elements). The efficiency of homologous and non-homologous recombination can be facilitated by genome editing technologies that introduce targeted single or double-stranded breaks (DSB). Examples of DSB- generating technologies are CRISPR / Cas9, TALEN, Zinc-Finger Nuclease, or equivalent systems (e.g., Cong et al. Science 339.6121 (2013): 819-823, Li et al. Nucl. Acids Res (2011): gkrl88, Gajet al. Trends in Biotechnology 31.7 (2013 ): 397-405, all of which are incorporated by reference in their entirety for all purposes), transposons such as Sleeping Beauty (e.g., Singh et al (2014) Immunol Rev. 2014 Jan;257(l): 181- 90. doi: 10.1111 / imr.l2137, which is incorporated by reference in its entirety for all purposes), targeted recombination using, for example, FLP recombinase (e.g., O’Gorman, Fox and Wahl Science (1991) 15 :251 (4999): 1351 - 1355, which is incorporated by reference in its entirety for all purposes), CRE-LOX (e.g., Sauer and Henderson PNAS (1988): 85; 5166-5170), or equivalent systems, or other techniques known in the art for integrating the nucleic acids of the invention into the eukaryotic cell genome.[000102] Chemical means for introducing a polynucleotide into a host cell include colloidal dispersion systems, such as macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. An exemplary colloidal system for use as a delivery vehicle in vitro and in vivo is a liposome (e.g., an artificial membrane vesicle). Other methods of state-of-the-art targeted delivery of nucleic acids are available, such as delivery of polynucleotides with targeted nanoparticles or other suitable sub-micron sized delivery system.[000103] Techniques for transforming a wide variety of higher plant species are well known and described in the technical and scientific literature. See, e.g. Weising (1988) Ann. Rev. Genet. 22:421-477; U.S. Pat. No. 5,750,870, which are both incorporated by reference in their entirety for all purposes.Methods of Making Fatty Acids[000104] Microalgae can be engineered with the above-described enzymes so as to create biosynthetic pathways in the microalgae that can produce fatty acids including, long chain fatty acids and very long chain fatty acids. Micro algae can be engineeredwith nucleic acids encoding polypeptides of fatty acid desaturase-6 (FADdelta6 desaturase) and fatty acid delta-6 elongase [FADdelta6 elongase (ELO)], and / or nucleic acids encoding enzymes lysophosphatidyl-choline acyltransferase (LPCAT), phosphatidyl-choline:diacyl-glycerol-choline phosphotransferase (PDCT), CDP- choline: l,2-sn-diacylglycerol choline phosphotransferase (CPT / DAG-CPT), and / or 3- ketoacyl-CoA synthase (KCS), 3-ketoacyl-CoA Reductase (KCR), enoyl-CoA Reductase (ECR), and 3-hydroxyacyl-CoA dehydratase (HACD). Nucleic acids encoding the foregoing enzyme(s) are engineered into appropriate constructs, and these constructs are placed into microalgae using appropriate methods described above.[000105] In some embodiments, Auxenochlorella is engineered with nucleic acids that have Auxenochlorella control regions (promoters) operably linked to nucleic acids that are codon optimized for Auxenochlorella and encode combinations of FADdelta6 desaturase, FADdelta6 elongase, LPCAT, PDCT, CPT / DAG-CPT, and / or KCS, KCR, ECR, and HACD. These engineered Auxenochlorella are grown under suitable nutrient conditions to make LC-PUFA and / or VLCFA.[000106] In an aspect, LC-PUFA are extracted, and / or purified. Gamma linolenic (C18:3y; GLA) and / or dihomo-gamma linolenic (C20:3n6; DGLA) acids can be extracted and / or purified. Eicosenoic (C20: l), erucic (C22:l), and nervonic (C24: l) acids also can be extracted and / or purified.Growth of Microalgae[000107] The microalgae can be grown at any scale suitable for a particular purpose. For example, for large scale production of neurotransmitters, cultures can be grown on a large scale (e.g., 10,000 L, 40,000 L, 100,000 L or larger bioreactors) in a bioreactor. Microalgae (e.g., Auxenochlorella and Prototheca) and other host cells (e.g., fungi, mammalian cells, or prokaryotic cells) are typically cultured in liquid media. The bioreactor or fermenter is used to culture microalgae cells through the various phases of their physiological cycle. Microalgae can be fermented in large quantities in liquid, such as in suspension cultures as an example. Bioreactors such as steel fermenters can accommodate very large culture volumes (40,000 liter and greater capacity bioreactors can be used). Bioreactors also typically allow for the control of culture conditions such as temperature, pH, oxygen tension, and carbon dioxide levels. For example, bioreactors are typically configurable, for example, using ports attachedto tubing, to allow gaseous components, like oxygen or nitrogen, to be bubbled through a liquid culture. Other culture parameters, such as the pH of the culture media, the identity and concentration of trace elements, and other media constituents can also be more readily manipulated using a bioreactor.[000108] Bioreactors can be configured to flow culture media though the bioreactor throughout the time period during which the microalgae grow and increase in number. In some embodiments, for example, media can be infused into the bioreactor after inoculation but before the cells reach a desired density. In other instances, a bioreactor is filled with culture media at the beginning of a culture, and no more culture media is infused after the culture is inoculated. In other words, the microalgae biomass is cultured in an aqueous medium for a period of time during which the microalgae reproduce and increase in number; however, quantities of aqueous culture medium are not flowed through the bioreactor throughout the time period. Thus in some embodiments, aqueous culture medium is not flowed through the bioreactor after inoculation.[000109] Bioreactors equipped with devices such as spinning blades and impellers, rocking mechanisms, stir bars, means for pressurized gas infusion can be used to subject microalgae cultures to mixing. Mixing may be continuous or intermittent. For example, in some embodiments, a turbulent flow regime of gas entry and media entry is not maintained for reproduction of microalgae until a desired increase in number of said microalgae has been achieved.[000110] Microalgae culture media typically contains components such as a fixed nitrogen source, a fixed carbon source, trace elements, optionally a buffer for pH maintenance, and phosphate (typically provided as a phosphate salt). Other components can include salts such as sodium chloride, particularly for seawater microalgae. Nitrogen sources include organic and inorganic nitrogen sources, including, for example, without limitation, molecular nitrogen, nitrate, nitrate salts, ammonia (pure or in salt form, such as, (NH4)2SO4 and NH4OH), protein, soybean meal, cornsteep liquor, and yeast extract. Examples of trace elements include zinc, boron, cobalt, copper, manganese, and molybdenum in, for example, the respective forms of ZnCh, H3BO3, COC16H2O, CuCh 2H2O, MnCl24H2O and (NH4)6Mo7O244H2O.Oils and Related Products, Lipid Production and Extraction[000111] The host cells described herein include one or more exogenous genes encoding fatty acid desaturase-6 (FADdelta6 desaturase), fatty acid delta-6 elongase [FADdelta6 elongase (ELO)], lysophosphatidyl-choline acyltransferase (LPCAT), phosphatidyl-choline:diacyl-glycerol-choline phosphotransferase (PDCT), CDP- choline: l,2-sn-diacylglycerol choline phosphotransferase (CPT / DAG-CPT), 3- ketoacyl-CoA synthase (KCS), Ketoacyl-CoA reductase (KCR), Hydroxyacyl-CoA Hydratase (HACD), and / or Enoyl-CoA Reductase (ECR). Some host cells, e.g., microalgae, produce n-3 and / or n-6 LC-PUFA and / or VLCFA in desired amounts and / or proportions and / or ratios.[000112] The microalgae host cells can produce a LC-PUFA and / or VLCFA, which can include other hydrocarbons such as triacyl glyceride that may be stored in storage bodies of the host cell as well as related products that can include, without limitation, phospholipids, tocopherols, tocotrienols, carotenoids (e.g., alpha-carotene, beta-carotene, lycopene, etc.), xanthophylls (e.g., lutein, zeaxanthin, alphacryptoxanthin and beta-cryptoxanthin), isoprenoids and various organic or inorganic compounds. A raw oil may be obtained from the cells by disrupting the cells and isolating the oil. See W02008 / 151149, W02010 / 06032, WO2011 / 150410, and WO201 1 / 1504 which disclose heterotrophic cultivation and oil isolation techniques, and all of which are incorporated by reference in their entirety for all purposes. For example, oil may be obtained by cultivating, drying and pressing the cells. The oils produced may also be refined, bleached and deodorized (RBD) to remove phospholipids, free fatty acids and odors as known in the art or as described in W02010 / 120939, which is incorporated by reference in its entirety for all purposes. The raw or RBD oils may be used in a variety of food, chemical, pharmaceutical, nutraceutical and industrial products or processes. After recovery of the oil, a valuable residual biomass remains. Uses for the residual biomass can include the production of paper, plastics, absorbents, adsorbents, as animal feed, for human nutrition, or for fertilizer.[000113] The stable carbon isotope value 513C is an expression of the ratio of 13C / 12C relative to a standard (e.g. PDB, carbonite of fossil skeleton of Belemnite americana from Peedee formation of South Carolina). The stable carbon isotope value 513C (0 / 00) of the oils can be related to the 513C value of the feedstock used. The oilscan be derived from oleaginous organisms heterotrophically grown on sugar derived from a C4 plant such as corn or sugarcane. The 513C (0 / 00) of the oil can be from -10 to -17 0 / 00 or from -13 to -16 0 / 00.[000114] The oils disclosed herein can be made by methods using a microalgal host cell. As described above, the microalga can be, without limitation, Auxenochlorella, Chlorophyta, Trebouxiophyceae, Chlorellales, Chlorellaceae, or Chlorophyceae. It has been found that oils from microalgae of Trebouxiophyceae can be distinguished from vegetable oils based on their sterol profiles. Oil produced by Auxenochlorella protothecoides can include sterols such as brassicasterol, ergosterol, campesterol, stigmasterol, and P-sitosterol. Sterols produced by Auxenochlorella can have C24P stereochemistry. Microalgae oils can also include, for example, campesterol, stigmasterol, P-sitosterol, 22,23 -dihydrobrassicasterol, proferasterol and clionasterol. Oils produced by the microalgae may be distinguished from plant oils by the presence of sterols with C24P stereochemistry and the absence of C24a stereochemistry in the sterols present. For example, the oils produced may contain 22,23 -dihydrobrassicasterol while lacking campesterol; contain clionasterol, while lacking in P-sitosterol, and / or contain poriferasterol while lacking stigmasterol. Alternately, or in addition, the oils may contain significant amounts of A7- poriferasterol.[000115] Oleaginous host cells expressing fatty acid desaturase-6 (FADdelta6 desaturase), fatty acid delta-6 elongase [FADdelta6 elongase (ELO)], lysophosphatidyl-choline acyltransferase (LPCAT), phosphatidyl-choline:diacyl- glycerol-choline phosphotransferase (PDCT), CDP-choline: l,2-sn-diacylglycerol choline phosphotransferase (CPT / DAG-CPT), 3 -ketoacyl -Co A synthase (KCS), Ketoacyl-CoA reductase (KCR), Hydroxyacyl-CoA Hydratase (HACD), and / or Enoyl- CoA Reductase (ECR) can produce an oil with a desired percent amount of a LC-PUFA and / or VLCFA. The oleaginous host cell (e.g., microalgae) can produce an oil, LC- PUFA or VLCFA, triglyceride, isoprenoid or derivative of any of these. These host cells can be made by transforming a cell with the nucleic acids encoding any of the enzymes discussed herein. The transformed cell can be cultivated to produce an oil and, optionally, the oil can be extracted. Oil extracted can be used to produce food, oleochemicals, nutraceuticals, pharmaceuticals or other products.[000116] The LC-PUFA and VLCFA discussed above alone or in combination can be useful in the production of foods, pharmaceuticals, nutraceuticals, and chemicals. The oils, LC-PUFA and VLCFA, isoprenoids, triglycerides can be subjected to decarboxylation, oxidation, light exposure, hydroamino methylation, methoxycarbonation, ozonolysis, enzymatic transformations, epoxidation, methylation, dimerization, thiolation, metathesis, hydro-alkylation, lactonization, or other chemical processes. After extracting the oil, a residual biomass may be left, which may have use as a fuel, as an animal feed, or as an ingredient in paper, plastic, or other product.[000117] The various LC-PUFA and VLCFA can be tailored in for a mixture of specific LC-PUFA and VLCFA or their derivatives in order to adjust parameters such as biological and therapeutical efficacy, therapeutic index, potency, safety, bioavailability, permeability, as well as polarity and solvency of the oils or chemicals made from the oils. For the production of LC-PUFA and VLCFA total lipids produced by cells can be harvested, or otherwise collected, by any convenient means. Lipids can be isolated by whole cell extraction. The cells can be first disrupted, and then intracellular and cell membrane / cell wall-associated lipids as well as extracellular hydrocarbons can be separated from the cell mass, such as by use of centrifugation. Intracellular lipids produced in microorganisms can be extracted after lysing the cells of the microorganism. Extracellular lipids can be isolated by separation from cell biomass, drying or directly extracted. Once extracted, lipids can be refined to produce oils, pharmaceuticals, nutraceuticals, or oleochemicals.[000118] After completion of culturing, the host cells can be separated from the fermentation broth. Optionally, the separation is effected by centrifugation to generate a concentrated paste. The biomass can then optionally be washed with a washing solution (e.g., deionized water) to get rid of the fermentation broth and debris. Optionally, the washed microbial biomass may also be dried (oven dried, lyophilized, etc.) prior to cell disruption. Alternatively, cells can be lysed without separation from some or all of the fermentation broth when the fermentation is complete. For example, the cells can be at a ratio of less than 1 : 1 v:v cells to extracellular liquid when the cells are lysed.[000119] Host cells containing a lipid can be lysed to produce a lysate. The step of lysing a host cell (also referred to as cell lysis) can be achieved by any convenientmeans, including heat-induced lysis, adding a base, adding an acid, using enzymes such as proteases and polysaccharide degradation enzymes such as amylases, using ultrasound, mechanical lysis, using osmotic shock, infection with a lytic virus, and / or expression of one or more lytic genes. Lysis is performed to release intracellular molecules which have been produced by the host cell. Each of these methods for lysing a host cell can be used as a single method or in combination simultaneously or sequentially. The extent of host cell disruption can be observed by microscopic analysis. Typically more than 70% cell breakage is observed. Cell breakage can be more than 80%, more than 90%, or about 100%.[000120] The host cells can be lysed after growth, for example to increase the exposure of cellular lipid for extraction or further processing. The timing of lipase expression (e.g., via an inducible promoter) or cell lysis can be adjusted to optimize the yield of lipids. Below are described a number of lysis techniques. These techniques can be used individually or in combination.[000121] The step of lysing a host cell can comprises heating of a cellular suspension containing the host cell. The fermentation broth containing the host cell (or a suspension of host cells isolated from the fermentation broth) is heated until the host cells, i.e., the cell walls and membranes of host cells degrade or breakdown. Typically, temperatures applied are at least 50° C. Other temperatures, such as, at least 30° C. at least 60° C., at least 70° C., at least 80° C., at least 90° C., at least 100° C., at least 110° C., at least 120° C., at least 130° C. or higher can be used for more efficient cell lysis. Lysing cells by heat treatment can be performed by boiling the host cell. Alternatively, heat treatment (without boiling) can be performed in an autoclave. The heat-treated lysate may be cooled for further treatment. Cell disruption can also be performed by steam treatment, i.e., through addition of pressurized steam. Steam treatment of microalgae for cell disruption is described, for example, in U.S. Pat. No. 6,750,048, which is incorporated by reference in its entirety for all purposes. Steam treatment may be achieved by sparging steam into the fermentor and maintaining the broth at a desired temperature for less than about 90 minutes, less than about 60 minutes, or less than about 30 minutes.[000122] The step of lysing a host cell can also be done by adding a base to a cellular suspension containing the host cell. The base should be strong enough tohydrolyze at least a portion of the proteinaceous compounds of the host cell. Bases that are useful for solubilizing proteins are known in the art of chemistry. Exemplary bases include, but are not limited to, hydroxides, carbonates, and bicarbonates of lithium, sodium, potassium, calcium, and mixtures thereof. One base that can be used is KOH. Base treatment of microalgae for cell disruption is described, for example, in U.S. Pat. No. 6,750,048, which is incorporated by reference for all purposes.[000123] The step of lysing a host cell can include adding an acid to a cellular suspension containing the host cell. Acid lysis can be effected using an acid at a concentration of 10-500 mN or preferably 40-160 nM. Acid lysis can be performed at above room temperature (e.g., at 40-160°, and preferably a temperature of 30-180°. For moderate temperatures (e.g., room temperature to 100° C. and particularly room temperature to 65°, acid treatment can usefully be combined with sonication or other cell disruption methods.[000124] The step of lysing a host cell can also involve lysing the host cell by using an enzyme. Enzymes for lysing a microorganism can be proteases and polysaccharide-degrading enzymes such as hemicellulase (e.g., hemicellulase from Aspergillus niger; Sigma Aldrich, St. Louis, Mo.; #H2125), pectinase (e.g., pectinase from Rhizopus sp.; Sigma Aldrich, St. Louis, Mo.; #P2401), Mannaway 4.0 L (Novozymes), cellulase (e.g., cellulose from Trichoderma viride; Sigma Aldrich, St. Louis, Mo.; #C9422), and driselase (e.g., driselase from Basidiomycetes sp.; Sigma Aldrich, St. Louis, Mo.; #D9515).[000125] Lysis can also be accomplished using an enzyme such as, for example, a cellulase such as a polysaccharide-degrading enzyme, optionally from Auxenochlorella or a Chlorella virus, or a protease, such as Streptomyces griseus protease, chymotrypsin, proteinase K, proteases listed in Degradation of Polylactide by Commercial Proteases, Oda Y et al., Journal of Polymers and the Environment, Volume 8, Number 1, January 2000, pp. 29-32(4), Alcalase 2.4 FG (Novozymes), and Flavourzyme 100 L (Novozymes). Any combination of a protease and a polysaccharide-degrading enzyme can also be used, including any combination of the preceding proteases and polysaccharide-degrading enzymes.[000126] The step of lysing a host can be performed using ultrasound, i.e., sonication. Thus, host cells can also be lysed with high-frequency sound. The soundcan be produced electronically and transported through a metallic tip to an appropriately concentrated cellular suspension. This sonication (or ultrasonication) disrupts cellular integrity based on the creation of cavities in cell suspension.[000127] Lysis can be performed using an expeller press. In this process, biomass is forced through a screw-type device at high pressure, lysing the cells and causing the intracellular lipid to be released and separated from the protein and fiber (and other components) in the cell.[000128] The step of lysing a host cell can be performed by mechanical lysis. Cells can be lysed mechanically and optionally homogenized to facilitate hydrocarbon (e.g., lipid) collection. For example, a pressure disrupter can be used to pump a cell containing slurry through a restricted orifice valve. High pressure (up to 1500 bar) can be applied, followed by an instant expansion through an exiting nozzle. Cell disruption can be accomplished by three different mechanisms: impingement on the valve, high liquid shear in the orifice, and sudden pressure drop upon discharge, causing an explosion of the cell. The method releases intracellular molecules. Alternatively, a ball mill can be used. In a ball mill, cells are agitated in suspension with small abrasive particles, such as beads. Cells break because of shear forces, grinding between beads, and collisions with beads. The beads disrupt the cells to release cellular contents. Cells can also be disrupted by shear forces, such as with the use of blending (such as with a high speed or Waring blender as examples), the french press, or even centrifugation in case of weak cell walls, to disrupt cells.[000129] The step of lysing a host cell can also be performed by applying an osmotic shock.[000130] The step of lysing a host cell can be accomplished with an infection of the host cell with a lytic virus. A wide variety of viruses are known to lyse host cells, and the selection and use of a particular lytic virus for a particular host cell is known. For example, Paramecium bursaria chlorella virus (PBCV-1) is the prototype of a group (family Phycodnaviridae, genus Chlorovirus) of large, icosahedral, plaque-forming, double-stranded DNA viruses that replicate in, and lyse, certain unicellular, eukaryotic chlorella-like green algae. Accordingly, any susceptible microalgae can be lysed by infecting the culture with a suitable chlorella virus. Methods of infecting species of Chlorella with a chlorella virus are known. See for example Adv. Virus Res. 2006;66:293-336; Virology, 1999 Apr. 25; 257(1): 15-23; Virology, 2004 Jan. 5; 318(1):214- 23; Nucleic Acids Symp. Ser. 2000; (44): 161-2; J. Virol. 2006 March; 80(5):2437-44; and Annu. Rev. Microbiol. 1999; 53:447-94, all of which are incorporated by reference in their entirety for all purposes.[000131] The step of lysing a host cell can use autolysis. Host cells can be genetically engineered to produce a lytic protein at a desired time so that the host cell lyses after expression of the lytic protein. The lytic gene can be expressed using an inducible promoter so that the cells can first be grown to a desirable density in a fermentor, followed by induction of the promoter to express the lytic gene to lyse the cells. The lytic gene can encode a polysaccharide-degrading enzyme, or a lytic gene from a lytic virus. For example, a lytic gene from a Chlorella virus can be expressed in an algal cell; see Virology 260, 308-315 (1999); FEMS Microbiology Letters 180 (1999) 45-53; Virology 263, 376-387 (1999); and Virology 230, 361-368 (1997), all of which are incorporated by reference in their entirety for all purposes. Expression of lytic genes can be done using an inducible promoter, such as a promoter active in microalgae that is induced by a stimulus such as the presence of a small molecule, light, heat, and other stimuli.[000132] Various methods are available for separating lipids from cellular lysates produced by the above methods. For example, lipids and lipid derivatives such as aldehydes, alcohols, and hydrocarbons such as isoprenoids can be extracted with a hydrophobic solvent such as hexane (see Frenz et al. 1989, Enzyme Microb. Technol., 11 :717, which is incorporated by reference in its entirety for all purposes), heptane or butane. Lipids and lipid derivatives can also be extracted using liquefaction (see for example Sawayama et al. 1999, Biomass and Bioenergy 17:33-39 and Inoue et al. 1993, Biomass Bioenergy 6(4):269-274, which are each incorporated by reference in their entirety for all purposes); oil liquefaction (see for example Minowa et al. 1995, Fuel 74(12): 1735-1738, which is incorporated by reference in its entirety for all purposes); and supercritical CO2 extraction (see for example Mendes et al. 2003, Inorganica Chimica Acta 356:328-334, which is incorporated by reference in its entirety for all purposes). Miao and Wu describe a protocol of the recovery of microalgal lipid from a culture of A. prototheocoides in which the cells were harvested by centrifugation, washed with distilled water and dried by freeze drying. The resulting cell powder waspulverized in a mortar and then extracted with n-hexane (Miao and Wu, Biosource Technology (2006) 97:841-846, which is incorporated by reference in its entirety for all purposes).[000133] Lipids, lipid derivatives and hydrocarbons generated by the host cells can be recovered by extraction with an organic solvent. The organic solvent can be hexane or heptane. The organic solvent can be added directly to the lysate without prior separation of the lysate components or to the whole cell broth. The lysate generated by one or more of the methods described above can be contacted with an organic solvent for a period of time sufficient to allow the lipid and / or hydrocarbon components to form a solution with the organic solvent. The solution can then be further refined to recover specific desired lipid or hydrocarbon components. Hexane or heptane extraction methods can be used.[000134] Lipids and lipid derivatives, alcohols, and hydrocarbons such as isoprenoids can be produced by host cells after modification of the host cells by the use of one or more enzymes. When LC-PUFA and VLCFA are in the extracellular environment of the cells, the one or more enzymes can be added to that environment under conditions in which the enzyme modifies the LC-PUFA and VLCFA or completes its synthesis from a precursor. Alternatively, LC-PUFA and VLCFA can be partially, or completely, isolated from the cellular material before addition of one or more catalysts such as enzymes. Such catalysts are exogenously added, and their activity occurs outside the cell or in vitro.[000135] LC-PUFA and VLCFA, hydrocarbons and other lipid produced by cells in vivo, or enzymatically modified in vitro, as described herein can be optionally further processed by conventional means. The processing can include “cracking” to reduce the size of the molecules through decarboxylation, and thus increase the hydrogemcarbon ratio, of hydrocarbon molecules. Catalytic and thermal cracking methods are routinely used in hydrocarbon and triglyceride oil processing. Catalytic methods may involve the use of a catalyst, such as a solid acid catalyst, cofactor, solvent, oxygen or light, which could lead to the heterolytic, or asymmetric, breakage of a carbon-carbon bond and / or result in oxidation. Hydrocarbons can also be processed to reduce, optionally to zero, the number of carbon-carbon double, or triple, bonds therein. Hydrocarbons can also be processed to remove or eliminate or add a ring or cyclic structure therein.Hydrocarbons can also be processed to increase the hydrogen:carbon ratio. This can include the addition of hydrogen (“hydrogenation”) and / or the “cracking” of hydrocarbons into smaller hydrocarbons.Uses of Fatty Acids[000136] The fatty acids made above can be used to treat inflammation (antiinflammatory and antioxidant), demyelinating conditions, neurodegenerative disorders, neurological diseases, cancers, diabetes, and obesity. Gamma linolenic acid (C18:3y; GLA) and / or dihomo-gamma linolenic acid (C20:3n6; DGLA) are functional fatty acids with roles in mitigating inflammation, rendering them potent components for addressing skin conditions like Eczema, Acne, and Psoriasis. GLA is also effective in controlling diabetic neuropathy, ADHD, breast cancer and menopause. VLCFA such as eicosenoic, erucic, and nervonic acids have multiple applications in skin and overall health. Eicosenoic acid is readily absorbed by the skin and balances oil in the skin. It also has emollient properties and deeply nourishes the skin and is non-comedogenic. Erucic acid transforms into nervonic acid, a crucial element of myelin. Erucic acid may have remyelinating effects and could be crucial for treating different demyelinating conditions. Also, erucic acid exerts antioxidant and anti-inflammatory effects, providing a therapeutic role in different neurodegenerative disorders. Nervonic acid supplementation is beneficial to human health and can improve many medical conditions such as neurological diseases, cancers, diabetes, obesity, and their complications.[000137] Long-chain, polyunsaturated fatty acids (LC-PUFA) of the co6 (n-6) and co3 (n-3) families often oppose each others action in inflammation. LC-PUFAs can influence inflammation by (1) acting on fatty acid receptors, (2) acting as precursors to eicosanoids (e.g., prostaglandins), and (3) incorporation into the phospholipids of inflammatory cell membranes, where the fatty acids play important roles assuring the correct environment for membrane protein function, maintaining membrane order (fluidity), influencing lipid raft formation and modifying membrane-generated intracellular signaling cascades.[000138] n-3 LC-PUFA EPA (eicosapentaenoic acid) and DHA (docosahexanoic acid) can inhibit LPS-induced production of COX-2, inducible NO synthase, TNFa, IL-1, IL-6, IL-8 and IL-12 in endothelial cells, monocytes, macrophages and dendriticcells. The effects of n-3 LC-PUFA have been shown to involve inhibition of LPS- induced activation of NF-KB associated with decreased IKB phosphorylation. This proinflammatory activation through NF-KB can be inhibited by LC-PUFAs such as EP A, DHA, arachidonic, linoleic and oleic acids.[000139] Saturated fatty acids (SFA) such as lauric acid, for example, can enhance NF-KB activation in macrophages and dendritic cells, promoting pro-inflammatory gene expression.[000140] LC-PUFA and their derivatives can be endogenous ligands for PPARy. The n-3 PUFA DHA induced PPARy in dendritic cells and this was associated with reduced production of the pro-inflammatory cytokines TNFa and IL-6 following endotoxin stimulation. PPARy is a transcription factor that can act in an antiinflammatory manner. It can directly regulate inflammatory gene expression, but it can also interfere with the activation of the prototypical pro-inflammatory transcription NF- KB.[000141] Omega-3 (n3) LC-PUFA can improve chronic neuroinflammatory diseases in the peripheral and central nervous systems. Docosahexaenoic acid (DHA) protects nerve cells from noxious stimuli in vitro and in vivo. The metabolites involved in oxidative stress and glutathione production shift significantly to a more antiinflammatory state post supplementation with n3 LC-PUFA. Omega-3 LC-PUFA can reduce the adverse effects of chronic neuroinflammatory diseases in both the peripheral and central nervous systems. Omega-3 LC-PUFA can reduce chronic pain from spinal cord injuries, and oral administration can stimulate nerve regeneration and protect peripheral nerves from injury.[000142] PUFA can be important constituents of the phospholipid membranes of immune cells. Typically, immune cell membranes contain a relatively high proportion of the n-6 PUFA, arachidonic acid. Increased oral supply of the n-3 PUFA EPA and DHA results in an increase in the amount of those fatty acids in inflammatory cells.[000143] Eicosanoids, which include PG, thromboxanes and leukotrienes, are mediators and regulators of inflammation. They are formed from C20 LC-PUFA, typically arachidonic acid, by the COX and lipoxygenase enzymes. In general, arachidonic acid-derived eicosanoids act in a pro-inflammatory way, although this is an over-simplification since it is now recognized that PGE2, for example, has both pro-and anti-inflammatory effects, and that another eicosanoid derived from arachidonic acid, lipoxin A4, is anti-inflammatory.[000144] The decrease in arachidonic acid content of inflammatory cell membranes that occurs with incorporation of the n-3 LC-PUFA reduces the availability of the usual eicosanoid substrate and so the production of the major 2-series PG and 4- series leukotrienes is decreased.[000145] The n-3 LC-PUFA EPA and DHA act through multiple interconnected mechanisms to reduce production of inflammatory eicosanoids and cytokines and to enhance production of anti-inflammatory and inflammation resolving resolvins and protectins. In these ways, n-3 LC-PUFA act to oppose the pro-inflammatory actions of SFA and of n-6 LC-PUFA. The roles of n-3 LC-PUFA in shaping and regulating inflammatory processes and responses suggest that the level of exposure to these fatty acids might be important in determining the development and severity of inflammatory diseases.[000146] Omega-3 PUFA can upregulate protective cellular pathways in patients with type 2 diabetes and improve symptoms from diabetic neuropathy. Further, omega- 3 LC-PUFA supplementation can promote nerve regeneration in patients with type 1 diabetes.[000147] LC-PUFA are regulators of brain neurotransmission, neurogenesis, and neuroinflammation, all having an important role in the prevention and treatment of psychological and behavioral dysfunction disorders. Eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) are highly concentrated in the brain, exhibiting anti oxi dative, anti-inflammatory, and antiapoptotic effects, with these contributing to neuron protection. The omega-6 fatty acid gamma linolenic acid (GLA) is also important in the generation of arachidonic acid (ARA) which is abundantly present in in the brain. Combinations of omega-3 and omega-6 fatty acids (EPA and GLA) can improve symptoms of inattention in children with ADHD. Brain lipids within cell membranes also act as signalling mediums, supporting neurotransmitter function with omega-3 fatty acids and may help in the prevention of anxiety disorders. Omega-3 LC- PUFA can act in a similar way to antipsychotics by acting on brain receptors and helping to restore oxidative balance. The ratio of fatty acids (omega-6 : omega-3) which complete for the same enzyme pathways can influence neurotransmission andprostaglandin formation, both of which are crucial in the maintenance of normal brain function.[000148] Dietary n-3 LC-PUFA are inversely associated with breast cancer risk. Higher intake of dietary ALA (Alpha-linolenic acid), n-3 LC-PUFA, and total n-3 LC- PUFA was associated with lower risk of breast cancer.[000149] After demyelinating injury of the nervous system, n-3 LC-PUFA enhance lesion recovery and provide the basis for pro-regenerative medicines of demyelinating diseases in the nervous system. Resolution of the acute inflammatory response that occurs after demyelinating injury is crucial for tissue repair and for return to host tissue homeostasis. Increased n-3 LC-PUFA improved phagocyte resolution and enhanced generation of mature oligodendrocytes.[000150] The Mfsd2a receptor can be used to shuttle LPC-coupled LC-PUFA into the brain. Using this approach to enhance lipid delivery into the CNS, LPC-DHA can promote resolution of the phagocytic infiltrate, and enhanced regeneration in aged mice. DHA serves as a substrate for the biosynthesis of anti-inflammatory and proresolving mediators such as protectins, resolvins, and maresins.[000151] Upon treatment with a composition of the present invention after a single dose administration or multiple dose administration, for example over a period of about 1 to about 12 weeks, about 1 to about 8 weeks, or about 1 to about 4 weeks, the subject or subject group exhibits a desired therapeutic effect.[000152] Upon treatment of a subject or subject group (fed or fasted) with a composition comprising about 200 mg of fatty acid herein to about 8000 mg fatty acid herein (administered as one or more dosage units, for example as 500 mg or 1 g dosage units equating to total daily fatty acid doses of about 500 mg, about 1000 mg, about 2000 mg, about 3000 mg, about 4000 mg, about 5000 mg, about 6000 mg, about 7000 mg or about 8000 mg) and after single dose administration or after multiple dose administration, the subject or subject group exhibits one or more of the following outcomes:[000153] A free fatty acid Cmax (or mean or median Cmax) of about 400 ng / ml to about 4500 ng / ml, about 500 ng / ml to about 3400 ng / ml, about 600 ng / ml to about 3300 ng / ml, about 700 ng / ml to about 3200 ng / ml, for example about 900 ng / ml, about 1000 ng / ml, about 1100 ng / ml, about 1200 ng / ml, about 1300 ng / ml, about 1400 ng / ml, about1500 ng / ml, about 1600 ng / ml, about 1700 ng / ml, about 1800 ng / ml, about 1900 ng / ml, about 2000 ng / ml, about 2100 ng / ml, about 2200 ng / ml, about 2300 ng / ml, about 2400 ng / ml, about 2500 ng / ml, about 2600 ng / ml, about 2700 ng / ml, about 2800 ng / ml, about 2900 ng / ml, about 3000 ng / ml, about 3100 ng / ml, about 3200 ng / ml, about 3300 ng / ml, about 3400 ng / ml, about 3500 ng / ml, about 3600 ng / ml, about 3700 ng / ml, about 3800 ng / ml, about 3900 ng / ml, about 4000 ng / ml, about 4100 ng / ml, about 4200 ng / ml, about 4300 ng / ml about 4400 ng / ml or about 4500 ng / ml;[000154] A free fatty acid Cmax / dose (or mean or median Cmax / dose) of about 0.5 (1 / kL) to about 3 (1 / kL), about 0.6 (1 / kL) to about 2.5 (1 / kL) or about 0.7 (1 / kL) to about 2 (1 / kL), for example about 0.7 (1 / kL), about 0.8 (1 / kL), about 0.9 (1 / kL), about 1 (1 / kL), about 1.5 (1 / kL), about 1.6 (1 / kL), about 1.7 (1 / kL) or about 1.8 (1 / kL);[000155] A free fatty acid AUCo-24 (or mean or median AUC0-24) of about 1500 ng h / ml to about 12000 ng h / ml, about 2000 ng h / ml to about 11000 ng h / ml or about2500 ng h / ml to about 10000 ng h / ml, for example about 1000 ng h / ml, about 1500 ng h / ml, about 2000 ng h / ml, about 2500 ng h / ml, about 3000 ng h / ml, about 3500 ng h / ml, about 4000 ng h / ml, about 4500 ng h / ml, about 5000 ng h / ml, about 5500 ng h / ml, about 6000 ng h / ml, about 6500 ng h / ml, about 7000 ng h / ml, about 7500 ng h / ml, about 8000 ng h / ml, about 8500 ng h / ml, about 9000 ng h / ml, about 9500 ng h / ml, about 10000 ng h / ml, about 10500 ng h / ml, about 11000 ng h / ml, about 11500 ng h / ml or about 12000 ng h / ml;[000156] A free DGLA AUCo-24 / dose (or mean or median AUCo-24 / dose) of about1.5 to about 10 h / kL, about 1.7 to about 8 h / kL or about 2 to about 6 h / kL, for example about 2 h / kL, about 2.5 h / kL, about 3 h / kL, about 3.5 h / kL, about 4 h / kL, about 4.5 h / kL, about 5 h / kL or about 5.5 h / kL.[000157] A free DGLA tmax (h) of about 2 to about 10 hours, about 3 to about 8 hours, for example about 3 hours, about 4 hours, about 5 hours, about 6 hours, about 7 hours or about 8 hours.[000158] A steady state free DGLA plasma level (Cavg) or mean or median steady state free DGLA plasma level (Cavg), after 1 to about 30, 1 to about 28, 1 to about 14 or 1 to about 10 consecutive days of daily administration, of up to about 2000 ng / ml, up to about 750 ng / ml, or up to about 700 ng / ml, for example about 385 ng / ml or about 675 ng / ml.Pharmaceutical Compositions and Administration[000159] The fatty acids herein or a pharmaceutically acceptable salts thereof, may be formulated for administration in a variety of ways. The fatty acid or a pharmaceutically acceptable salt thereof can be formulated with a biologically acceptable medium, such as water, buffered saline, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol and the like), triglyceride oil, or suitable mixtures thereof. The fatty acid or a pharmaceutically acceptable salt thereof, may be formulated as solid pharmaceutical preparations in a usual dosage form, typically, in the dosage form of powders, granules, surface-coated granules, capsules, tablets or surface-coated tablets. A granulation step can be used in which a humectant can be added as a stabilizer and optionally, an auxiliary agent for manufacturing a pharmaceutical preparation is added to bulk powders and the resulting mixture is granulated by means of a granulator, the encapsulation step in which the resulting granular powders are encapsulated under compression by means of a capsule filler or the tableting step in which the resulting granular powders are compressed by means of a tablet machine and, if desired, the coating step in which the granular powders, tablets or granules obtained in the preceding steps are surface-coated.[000160] As used herein, “biologically acceptable medium” includes any and all solvents, dispersion media, and the like which may be appropriate for the desired route of administration of the pharmaceutical preparation. Suitable vehicles and their formulation are described, for example, in the book Remington's Pharmaceutical Sciences (Remington's Pharmaceutical Sciences. Mack Publishing Company, Easton, Pa., USA 1985), which is incorporated by reference in its entirety for all purposes.[000161] The compositions described herein may comprise one or more surfactants. Examples of suitable surfactants include those having a hydrophilic- lipophilic balance (HLB) value of from 4 to 16. Non-limiting examples of suitable surfactants include: tocopherol polyethylene glycol succinate surfactants (e.g., D-a- tocopherol polyethylene glycol 1000 succinate, also known as Vitamin E TPGS and tocophersolan); polyoxyethylene castor oil surfactants (e.g., polyoxyethylene 35 castor oil, also known as PEG-35 castor oil and macrogolglycerol ricinoleate, such as KOLLIPHOR® EL and KOLLIPHOR® ELP); polyoxyl hydrogenated castor oil surfactants (e.g., polyoxyl 40 hydrogenated castor oil, also known as macrogolglycerolhydroxystearate, such as KOLLIPHOR® RH40); polyoxyl hydroxy stearate surfactants (e.g., polyoxyl 15 hydroxy stearate, also known as macrogol (15)-hydroxy stearate, polyethylene glycol (15)-hydroxystearate, and polyoxyethylated 12-hydroxy stearic acid, such as KOLLIPHOR® HS 15); lauroyl polyoxylglyceride and lauroyl macrogoglyceride surfactants (e.g., GELUCIRE® 44 / 14 and ACCONON® C-44); stearoyl polyoxylglyceride and stearoyl macrogoglyceride surfactants (e.g., GELUCIRE® 50 / 13 and ACCONON® C-50); polyoxyl stearate surfactants (e.g., polyoxyl stearate Type I such as GELUCIRE® 48 / 16); oleoyl poly oxy 1-6-glyceride surfactants (e.g., LABRAFIL® M 1944 CS); linoleoyl macrogolglyceride and linoleoyl polyoxylglyceride surfactants (e.g., LABRAFIL® M 2125 CS); glycerol monocaprylocaprate Type I (e.g., CAPMUL® MCM) surfactants; propylene glycol monocaprylate Type II (e.g., CAPMUL® PG-8) surfactants; and propylene glycol monolaurate Type II surfactants (e.g., CAPMUL® PG-12) and lauroyl macrogolglyceride and lauroyl polyoxylglyceride surfactants (e.g., LABRAFIL® M 2130 CS).[000162] When present, the surfactant(s) can be present in a composition as described herein in any suitable amount. For example, a composition as described herein may include one or more of these surfactants in a total amount of from about 5% w / w to about 65% w / w, including about 5% w / w, about 5.5% w / w, about 6% w / w, about 6.5% w / w, about 7% w / w, about 10% w / w, about 12% w / w, about 15% w / w, about 17% w / w, about 20% w / w, about 22% w / w, about 25% w / w, about 30% w / w, about 35% w / w, about 40% w / w, about 45% w / w, about 50% w / w, about 55% w / w, about 60% w / w, or about 65% w / w, or any value therebetween. When combinations of surfactants are used, they each may be present in any suitable amount. For example, a composition as described herein may comprise a relatively large amount of one surfactant and a relatively small amount of the other(s), or may comprise relatively equal amounts.[000163] A composition as described herein optionally may comprise a precipitation inhibitor. Non-limiting examples of suitable precipitation inhibitors include one or more of polyvinyl caprolactam-polyvinyl acetate-polyethylene glycol graft copolymer solubilizers, (e.g., SOLUPLUS®), polyoxyethylene poly oxypropylene glycol solubilizers (e.g., KOLLIPHOR® PI 88 or P407), polyvinylpyrrolidonesolubilizers (e.g., KOLLIDON® K-30), vinylpyrrolidone-vinyl acetate copolymer solubilizers (e.g., KOLLIDON® VA-64), polyvinyl alcohol / poly ethylene glycol graft copolymer solubilizers (e.g., KOLLICOAT® IR), hydroxypropyl methylcellulose solubilizers (also known as HMPC and hypromellose), and hypromellose acetate succinate solubilizers (e.g., AQOAT®). A precipitation inhibitor may be used in any suitable amount. For example, a composition may comprise one or more precipitation inhibitors in a total amount of from about 0.5% w / w to about 5% w / w or from about 0.5% w / w to about 1 % w / w, including about 0.5% w / w, about 0.75% w / w, about 1% w / w, about 1.5% w / w, about 2% w / w, about 2.5% w / w, about 3% w / w, about 3.5% w / w, about 4% w / w, about 4.5% w / w, about 5% w / w, and any value therebetween. For example, a composition as described herein may comprise a polyvinyl caprolactampolyvinyl acetate-poly ethylene glycol graft copolymer solubilizer (e.g., SOLUPLUS®) in an amount from about 0.5% w / w to about 5% w / w, including about 0.5% w / w, or about 0.65% w / w, or about 0.75% w / w.[000164] The compositions described herein may comprise one or more solubilizers. Non-limiting examples of suitable solubilizers include those having an HLB value of from 11 to 15, such as polyethylene glycol caprylic / capric glycerides solubilizers, such as polyethylene glycol caprylocaproyl polyoxylglyceride and capryl ocaproyl macrogoglyceride solubilizers (e.g., ACCONON® MC8-2), polyglyceryl oleate solubilizers (e.g., polyglyceryl- 10-oleate such as CAPROL® PGE 860), polyoxyethylene sorbitan monooleate solubilizers (e.g., polyoxyethylene (20) sorbitan monooleate or polysorbate 80). In some embodiments, the composition does not include a caprylocaproyl polyoxyl-8 glyceride solubilizer / surf actant (e.g., does not include LABRASOL® and does not include LABRASOL® ALF). Embodiments excluding caprylocaproyl polyoxyl-8 glyceride solubilizers / surf actants still may (optionally) comprise polyethylene glycol caprylocaproyl polyoxylglyceride / caprylocaproyl macrogoglyceride solubilizers (e.g., ACCONON® MC8 2, a polyethylene glycol caprylic / capric glycerides solubilizer).[000165] When present, the solubilizer may be present in any suitable amount. For example, a composition as described herein may comprise a total amount of one or more solubilizers of from about 10% w / w to about 65% w / w, such as about 15% w / w, about 20% w / w, about 25% w / w, about 27% w / w, about 30% w / w, about 35% w / w,about 40% w / w, about 45% w / w, about 50% w / w, about 55% w / w, about 60% w / w, about 65% w / w, or any value therebetween. When combinations of solubilizers are used, they each may be present in any suitable amount.[000166] The compositions described herein can comprise one or more antioxidants. Non-limiting examples of suitable antioxidants include DL-methionine, butylated hydroxy anisole (BHA), butylated hydroxy toluene (BHT), arginine, cysteine, ascorbic palmitate, sodium metabisulfite, sodium thiosulfate, propyl gallate, gamma linoleic acid, ascorbic acid, ethylenediaminetetraacetic acid (EDTA), and alpha tocopherol. Thus, in accordance with any of the foregoing embodiments, a composition as described herein may comprise an antioxidant. For example, a composition as described herein may comprise one or more selected from DL-methionine, BHA, and BHT. In some embodiments, a composition may comprise one or more of DL- methionine, arginine and cysteine. In some embodiments, a composition may comprise DL-methionine. The anti oxi dant(s) may be present in any suitable amount. For example, a composition as described herein may comprise one or more antioxidants in a total amount of from about 0.01% to about 1.0% w / w, including from about 0.05% to about 1.0% w / w, including any value therebetween.[000167] The compositions herein can be contained in acceptable excipients and / or carriers for oral consumption. The carrier may be a liquid, gel, gelcap, capsule, powder, solid tablet (coated or non-coated), tea, or the like. The fatty acid composition may be in the form of dry powders, granules, pills, tablets, capsules, lozenges, dry products for reconstitution with water or other suitable carrier, aqueous or oily solutions or suspensions, gels, pastes, emulsions or syrups.[000168] The fatty acids herein can be formulated into a capsule shell. The capsule shell can comprise gelatin, for example, Gelatin RXL or lime bone gelatin with a lower molecular weight. The capsule shell can comprise Gelatin RXL that has been treated by proteolytic enzymes to cut the gelatin pattern and effectively decrease its molecular weight. The pharmaceutical composition can comprise fatty acid esters of D-Sorbitol and 1,4-sorbitan. The capsule shell can comprise (a) gelatin and (b) plasticizers selected from one or more of d-sorbitol and 1,4-sorbitans. The gelatin can be as described in U.S. Pat. No. 7,485,323, hereby incorporated by reference herein in its entirety for all purposes.[000169] The composition can be in the form of a tablet or capsule or a soft gelatin capsule. Suitable excipient and / or carriers include maltodextrin, calcium carbonate, dicalcium phosphate, tricalcium phosphate, microcrystalline cellulose, dextrose, rice flour, magnesium stearate, stearic acid, croscarmellose sodium, sodium starch glycolate, crospovidone, sucrose, vegetable gums, lactose, methylcellulose, povidone, carboxymethylcellulose, corn starch, and the like (including mixtures thereof). The various ingredients and the excipient and / or carrier are mixed and formed into the desired form using conventional techniques. The tablet or capsule as disclosed may be coated with an enteric coating that dissolves at a pH of about 6.0 to 7.0. A suitable enteric coating that dissolves in the small intestine but not in the stomach is cellulose acetate phthalate. Further details on techniques for formulation for and administration may be found in the latest edition of Remington's Pharmaceutical Sciences (Mack Publishing Co., Easton, PA), which is incorporated by reference in its entirety for all purposes.[000170] The compositions herein may comprise at least one food flavoring such as acetaldehyde (ethanal), acetoin (acetyl methylcarbinol), anethole (parapropenyl anisole), benzaldehyde (benzoic aldehyde), N-butyric acid (butanoic acid), d- or 1- carvone (carvol), cinnamaldehyde (cinnamic aldehyde), citral (2,6-dimethyloctadien- 2,6-al-8, gera-nial, neral), decanal (N-decylaldehyde, capraldehyde, capric aldehyde, caprinaldehyde, aldehyde C-IO), ethyl acetate, ethyl butyrate, 3 -methyl-3 -phenyl glycidic acid ethyl ester (ethyl-methyl-phenyl-gly cidate, strawberry aldehyde, C-16 aldehyde), ethyl vanillin, geraniol (3,7-dimethyl-2,6 and 3,6-octadien-l-ol), geranyl acetate (geraniol acetate), limonene (d-, 1-, and dl-), linalool (linalol, 3,7-dimethyl-l,6- octadien-3-ol), linalyl acetate (bergamol), methyl anthranilate (methyl-2- aminobenzoate), piperonal (3, 4-methylenedi oxy -benzaldehyde, heliotropin), vanillin, alfalfa (Medicago sativa L.), allspice (Pimenta officinalis), ambrette seed (Hibiscus abelmoschus), angelic (Angelica archangelica), Angostura (Galipea officinalis), anise (Pimpinella anisum), star anise (Illicium verum), balm (Melissa officinalis), basil (Ocimum basilicum), bay (Laurus nobilis), calendula (Calendula officinalis), (Anthemis nobilis), capsicum (Capsicum frutescens), caraway (Carum carvi), cardamom (Elettaria cardamomum), cassia, (Cinnamomum cassia), cayenne pepper (Capsicum frutescens), Celery seed (Apium graveolens), chervil (Anthriscuscerefolium), chives (Allium schoenoprasum), coriander (Coriandrum sativum), cumin (Cuminum cyminum), elder flowers (Sambucus canadensis), fennel (Foeniculum vulgare), fenugreek (Trigonella foenum-graecum), ginger (Zingiber officinale), horehound (Marrubium vulgare), horseradish (Armoracia lapathifolia), hyssop (Hyssopus officinalis), lavender (Lavandula officinalis), mace (Myristica fragrans), marjoram (Major ana hortensis), mustard (Brassica nigra, Brassica juncea, Brassica hirta), nutmeg (Myristica fragrans), paprika (Capsicum annuum), black pepper (Piper nigrum), peppermint (Mentha piperita), poppy seed (Papayer somniferum), rosemary (Rosmarinus officinalis), saffron (Crocus sativus), sage (Salvia officinalis), savory (Satureia hortensis, Satureia montana), sesame (Sesamum indicum), spearmint (Mentha spicata), tarragon (Artemisia dracunculus), thyme (Thymus vulgaris, Thymus serpyllum), turmeric (Curcuma longa), vanilla (Vanilla planifolia), zedoary (Curcuma zedoaria), sucrose, glucose, saccharin, sorbitol, mannitol, aspartame. Other suitable flavoring are disclosed in such references as Remington's Pharmaceutical Sciences, 18th Edition, Mack Publishing, p. 1288-1300 (1990), and Furia and Pellanca, Fenaroli's Handbook of Flavor Ingredients, The Chemical Rubber Company, Cleveland, Ohio, (1971), known to those skilled in the art.[000171] The compositions herein may comprise at least one synthetic or natural food coloring (e.g., annatto extract, astaxanthin, beet powder, ultramarine blue, canthaxanthin, caramel, carotenal, beta carotene, carmine, toasted cottonseed flour, ferrous gluconate, ferrous lactate, grape color extract, grape skin extract, iron oxide, fruit juice, vegetable juice, dried algae meal, tagetes meal, carrot oil, corn endosperm oil, paprika, paprika oleoresin, riboflavin, saffron, and turmeric).[000172] The compositions herein may comprise at least one phytonutrient (e.g., soy isoflavonoids, oligomeric proanthocyanidins, indol-3 -carbinol, sulforaphone, fibrous ligands, plant phytosterols, ferulic acid, anthocyanocides, triterpenes, conjugated fatty acids such as conjugated linoleic acid and conjugated linolenic acid, polyacetylene, quinones, terpenes, catechins, gallates, and quercitin). Sources of plant phytonutrients include, but are not limited to, soy lecithin, soy isoflavones, brown rice germ, royal jelly, bee propolis, acerola berry juice powder, Japanese green tea, grape seed extract, grape skin extract, carrot juice, bilberry, flaxseed meal, bee pollen, ginkgo biloba, red clover, burdock root, dandelion, parsley, rose hips, milk thistle, ginger,Siberian ginseng, rosemary, curcumin, garlic, lycopene, grapefruit seed extract, spinach, and broccoli.[000173] The compositions herein may comprise at least one vitamin (e.g., vitamin A, thiamin (Bl), riboflavin (B2), pyridoxine (B6), cyanocobalamin (B 12), biotin, ascorbic acid (vitamin C), retinoic acid (vitamin D), vitamin E, folic acid and other folates, vitamin K, niacin, and pantothenic acid). As disclosed herein, the particles may comprise at least one mineral (e.g., sodium, potassium, magnesium, calcium, phosphorus, chlorine, iron, zinc, manganese, fluorine, copper, molybdenum, chromium, selenium, and iodine). As disclosed herein, a dosage of a plurality of particles may include vitamins or minerals in the range of the recommended daily allowance (RDA) as specified by the United States Department of Agriculture. As disclosed herein, the particles may comprise an amino acid supplement formula in which at least one amino acid is included (e.g., 1-camitine or tryptophan).[000174] The fatty acids as described herein may also be formulated with a number of other compounds. These compounds and substances can add to the palatability or sensory perception of the particles (e.g., flavorings and colorings) or can improve the nutritional value of the particles (e.g., minerals, vitamins, phytonutrients, antioxidants, etc.).[000175] The dietary supplement may comprise one or more inert ingredients, especially if it is desirable to limit the number of calories added to the diet by the dietary supplement. For example, the dietary supplement according to the description may also contain optional ingredients including, for example, herbs, vitamins, minerals, enhancers, colorants, sweeteners, flavorants, inert ingredients, and the like. For example, the dietary supplement according to the present description may contain one or more of the following: ascorbates (ascorbic acid, mineral ascorbate salts, rose hips, acerola, and the like), dehydroepiandrosterone (DHEA), Fo-Ti or Ho Shu Wu (herb common to traditional Asian treatments), Cat's Claw (ancient herbal ingredient), green tea (polyphenols), inositol, kelp, dulse, bioflavonoids, maltodextrin, nettles, niacin, niacinamide, rosemary, selenium, silica (silicon dioxide, silica gel, horsetail, shavegrass, and the like), spirulina, zinc, and the like. Such optional ingredients may be either naturally occurring or concentrated forms.[000176] The dietary supplements may further comprise vitamins and minerals including, but not limited to, calcium phosphate or acetate, tribasic; potassium phosphate, dibasic; magnesium sulfate or oxide; salt (sodium chloride); potassium chloride or acetate; ascorbic acid; ferric orthophosphate; niacinamide; zinc sulfate or oxide; calcium pantothenate; copper gluconate; riboflavin; beta-carotene; pyridoxine hydrochloride; thiamin mononitrate; folic acid; biotin; chromium chloride or picolonate; potassium iodide; sodium selenate; sodium molybdate; phylloquinone; vitamin D3; cyanocobalamin; sodium selenite; copper sulfate; vitamin A; vitamin C; inositol; potassium iodide. Suitable dosages for vitamins and minerals may be obtained, for example, by consulting the U.S. RDA guidelines.[000177] Fatty acids herein or a derivative thereof can be present in a composition herein in an amount of about 50 mg to about 5000 mg, about 75 mg to about 2500 mg, or about 100 mg to about 1000 mg, for example about 75 mg, about 100 mg, about 125 mg, about 150 mg, about 175 mg, about 200 mg, about 225 mg, about 250 mg, about 275 mg, about 300 mg, about 325 mg, about 350 mg, about 375 mg, about 400 mg, about 425 mg, about 450 mg, about 475 mg, about 500 mg, about 525 mg, about 550 mg, about 575 mg, about 600 mg, about 625 mg, about 650 mg, about 675 mg, about 700 mg, about 725 mg, about 750 mg, about 775 mg, about 800 mg, about 825 mg, about 850 mg, about 875 mg, about 900 mg, about 925 mg, about 950 mg, about 975 mg, about 1000 mg, about 1025 mg, about 1050 mg, about 1075 mg, about 1100 mg, about 1025 mg, about 1050 mg, about 1075 mg, about 1200 mg, about 1225 mg, about 1250 mg, about 1275 mg, about 1300 mg, about 1325 mg, about 1350 mg, about 1375 mg, about 1400 mg, about 1425 mg, about 1450 mg, about 1475 mg, about 1500 mg, about 1525 mg, about 1550 mg, about 1575 mg, about 1600 mg, about 1625 mg, about 1650 mg, about 1675 mg, about 1700 mg, about 1725 mg, about 1750 mg, about 1775 mg, about 1800 mg, about 1825 mg, about 1850 mg, about 1875 mg, about 1900 mg, about 1925 mg, about 1950 mg, about 1975 mg, about 2000 mg, about 2025 mg, about 2050 mg, about 2075 mg, about 2100 mg, about 2125 mg, about 2150 mg, about 2175 mg, about 2200 mg, about 2225 mg, about 2250 mg, about 2275 mg, about 2300 mg, about 2325 mg, about 2350 mg, about 2375 mg, about 2400 mg, about 2425 mg, about 2450 mg, about 2475 mg, or about 2500 mg. Any of the foregoing can further comprise fatty acid esters of D-Sorbitol and / or 1,4-sorbitan.[000178] The compositions herein may be administered by any suitable delivery route, such as intradermal, mucosal (e.g. intranasal), oral, intramuscular, subcutaneous, intradural, intravenous, or pulmonary. Other delivery routes are well-known in the art. The route of administration may be dictated by the disease or condition to be treated. For example, if the disease or condition is, for example, a demyelinating condition, a neurodegenerative disorder, or a neurological disease the composition may be administered via inhalation. Alternatively, if the disease or condition is, for example, certain inflammatory conditions the composition may be administered via intraarticular administration. It is within the skill of one in the art, to determine the route of administration based on the disease or condition to be treated. In certain examples, a composition herein is administered orally to provide systemic administration to the patient, or to treat conditions or diseases of the gut.[000179] The inventions disclosed herein will be better understood from the experimental details which follow. However, one skilled in the art will readily appreciate that the specific methods and results discussed are merely illustrative of the inventions as described more fully in the claims which follow thereafter. Unless otherwise indicated, the disclosure is not limited to specific procedures, materials, or the like, as such may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.EXAMPLESExample 1. Biosynthesis of Gamma-Linolenic Acid (C18:3y; GLA)[000180] A DNA construct pPB0405 was made. This construct allowed targeted integration of transforming DNA via homologous recombination at the THI4 (Thiamine biosynthesis 4) locus within the Auxenochlorella protothecoides genome. The construct contained a heterologous fatty acid desaturase (FADdelta6, Pt- FADdelta6; Accession No: XP 002182901.1) codon optimized for expression in A. protothecoides. Construct pPB0405 introduced for expression in A. protothecoides was ApTHI4 : : Ap S AD2v 1 p-PtF ADdelta6desaturase- Ap S AD2v 13UTR: ApPGK 1 p-Neo- ApPGK3UTR:ApTHI4. The sequence of the transforming construct pPB0405 is provided below as SEQ ID NO: 1 :aagcttAGCATACTCCTATTCTGACAATGTCACAGTCGGTCTGCCAGGCGATAGTGGCTTTGCTGTCAGACTCGGCCCCGGACTCTCCCCTGAACTGCGACGCC GGGAATCTGTTGAGAGGAGGCGATCTGCGAGGGTTCGCCTCCATGGCCCG CATGTACACCATCGAGTATGCCATGAAGCGATGATGTCTGTGAAAATGAT GTTCAGAATTCATTATATACTCATGTTTTTGTGTAAATGCTGTGTCGACTT AAGTTACCGAGCTGGCTGACAGAGACAATCTTCAGGTCAAATGTTGGCAC CAATGATCGCGACGATCGTTCAGGGGTTATCAAGTCAGATCTGAACGAAA ACCAGAAATCAAATTTGCCAAAGCGCATGTTTGTATGTCGAGAATTATCA TGCGGGTGACTGGCTCGCTAATTCTGGCATGGAAGGATGCCACATCGAAT TGATCCGGGGAGACTAACACTTGTCAGAATTGCAATGTGCCATATTCCAG ATATCCCAGCCGGCCCTTCTATAAACCACCTGCGGGCTCAGATACCTACG AAGAGGCTCAGATAACTCAAGGACGTGCATTCGAATTATCCCTGCCGCGC GGAAACATCAGACCAGGTGCGGATGCTGAGCGTCGAGTTGGGTGCTTGAT AGACCTTCACCTTGATCTGAGGTTCCCGTCCCCAGAGCACTCGAATCTCCG GCATCTTACAGGCAAACCGCAAACAGTAAATAATGGCGAGCACCATCACC ATGtctaga|ctgcagtgccccaaaaactggctaccacctaacaattctcacgcagttttatcctctgcacttgatgtcag ctttttgattcgtctgcgtacattacagcgttgagtggccagcaggaaggagaccgcggtccgagacgagtctgagggcg cgctctcgcaacttggattccggattctaccctgcatcgacctcggcctggagtcgatcagaaatgtcatgccagattgc ctggcgaggacgggtgatatactcaaggcgttgcatcgcccacaaaacacacacttatctgcaagggagttactgcatcag gctctgctcaacagctcgtgacatcgatcgttcagctccccagcaggtgcgtgtccgcatggagcacccctcccgagaca cctgcgtgggtgtcggaggagctcacatgccagggaggtgcccacattgcaccacgcgaccgcgaaataggcagactt cgggcatcctgtcatcgcatgtccgctggccgggaatcatggcctccccaccaggcgtcacgcgctgcccacctccctcc ccttgctgcgcagggcaccgcgttcctgtggagagccgaccac[4ZGggcaagggcggcgacgcccgcgccfccaa gggctccaccgccgcccgcaagatctcctggcaggaggtgaagacccacgcctcccccgaggacgcctggatcatc cactccaacaaggtgtacgacgtgtccaactggcacgagcaccccggcggcgccgtgatcttcacccacgccggcg acgacatgaccgacatcttcgccgccttccacgcccccggctcccagtccctgatgaagaagttctacatcggcgagct gctgcccgagaccaccggcaaggagccccagcagatcgccttcgagaagggctaccgcgacctgcgctccaagct gatcatgatgggcatgttcaagtccaacaagtggttctacgtgtacaagtgcctgtccaacatggccatctgggccgcc gcctgcgccctggtgttctactccgaccgcttctgggtgcacctggcctccgccgtgatgctgggcaccttcttccagcag tccggctggctggcccacgacttcctgcaccaccaggtgttcaccaagcgcaagcacggcgacctgggcggcctgttc tggggcaacctgatgcagggctactccgtgcagtggtggaagaacaagcacaacggccaccacgccgtgcccaac ctgcactgctcctccgccgtggcccaggacggcgaccccgacatcgacaccatgcccctgctggcctggtccgtgcagcaggcccagtcctaccgcgagctgcaggccgacggcaaggactccggcctggtgaagttcatgatccgcaaccagtc ctacttctacttccccatcctgctgctggcccgcctgtcctggctgaacgagtccttcaagtgcgccttcggcctgggcgcc gcctccgagaacgccgccctggagctgaaggccaagggcctgcagtaccccctgctggagaaggccggcatcctgc tgcactacgcctggatgctgaccgtgtcctccggcttcggccgcttctccttcgcctacaccgccttctacttcctgaccgc caccgcctcctgcggcttcctgctggccatcgtgttcggcctgggccacaacggcatggccacctacaacgccgacgc ccgccccgacttctggaagctgcaggtgaccaccacccgcaacgtgaccggcggccacggcttcccccaggccttcg tggactggttctgcggcggcctgcagtaccaggtggaccaccacctgttcccctccctgccccgccacaacctggccaa gacccacgccctggtggagtccttctgcaaggagtggggcgtgcagtaccacgaggccgacctggtggacggcacc atggaggtgctgcaccacctgggctccgtggccggcgagttcgtggtggactcgtgcgcgacggccccgccatgTG ^GCGGAGGCCTTGGAAATATTCGCGTCACGCGAGGAGTAGGCTCTGCTGGTCGGCCCTGG ATACGCTGACTCTTCAAGCAGTGGGGCACCACACCCACCTTTTGCCAAGGGCAAGGAGTC GGAAGGGGGCGGGGCTGCCATGCACCCCTGACGGGCATGGCCGTTCCGCGAGGGCGCCA ACTGCGGCGGCCTGCCCGCTGGCTCGTGCCCCCCTACCCCCACCATTGCCTGGAGCGTTTC CATCCCCAAATCACATTCCATCCAAGTTGTATCACTATGCCCCTTTGGCTCTATACACTCA CGGCCTGAGGTCCCTTCTCGGCCGTGGCGGCACACGCCCAACCCCCCACCATACTCTTTCC ATACACTGCAATGCTTCGAGCCTGCCTGCCACCTGCTCTGCTTGTCTCCCCTCCCTTCCCTT GAGGTTTTCCAATGCAGTAAGAGAAGTCGACGTGCATGGACAGATGATTGAGAGATGAGa ctagtjccttcctgtcccacaatgcttggtgaatgcagtgggttgatcaccgcggaggagctgtggcttactcgttctgatcaa gggagcctctgcaccttaaccctgccaggatcgaaaccaaccttgtcagtcccgtggtgggcaacatcatcctcgtgaagc tgattgaccaggaaaacatgatgagtcggtatgaggacgagcatgagtggcccaacatcgatatgacacatcttggagtt acggcaaatgtatcacacttccatcctggcttgcaccacaatattagtggacccctccttgcagtggcacggtgagaagcta gtttgtagtaatcttcttaattgacgaaccagacgtgtgtaatggcctcctttgagtgatggaaggatggaacctacccccccc ctccccagtactctgcggtacatccgagtaacccttccatgatcagcccaaacgcaatatgcaacgactctacatacggcc accgagtgcttattccttcgctatcaccgcacaaaaatcccatccgcgaactcatccgaggtgatagattgcgatcggggtt attcgggttaaggtgcgactagggatccctgaatcttttggggattccccgggtctcgtcctgcatgcttatcatcagtctcgt gggttatttggatcgctgcgcatgccataacagagcgctcataatatttgctgcggcggtggtgctggcaaaatcccctgcg taccgggcgcctgtcaagccaaccccgccgtgcggcactcccctgcagatccatcacc^ZGateffaffcaffffacffffc ctccacgccggctcccccgccgcctgggtggagcgcctgttcggctacgactgggcccagcagaccatcggctgctcc gacgccgccgtgttccgcctgtccgcccagggccgccccgtgctgttcgtgaagaccgacctgtccggcgccctgaac gagctgcaggacgaggccgcccgcctgtcctggctggccaccaccggcgtgccctgcgccgccgtgctggacgtggt gaccgaggccggccgcgactggctgctgctgggcgaggtgcccggccaggacctgctgtcctcccacctggcccccg ccgagaaggtgtccatcatggccgacgccatgcgccgcctgcacaccctggaccccgccacctgccccttcgaccac caggccaagcaccgcatcgagcgcgcccgcacccgcatggaggccggcctggtggaccaggacgacctggacgaggagcaccagggcctggcccccgccgagctgttcgcccgcctgaaggcccgcatgcccgacggcgaggacctggtg gtgacccacggcgacgcctgcctgcccaacatcatggtggagaacggccgcttctccggcttcatcgactgcggccgc ctgggcgtggccgaccgctaccaggacatcgccctggccacccgcgacatcgccgaggagctgggcggcgagtgg gccgaccgcttcctggtgctgtacggcatcgccgcccccgactcccagcgcatcgccttctaccgcctgctggacgagtt C«C7UZ4GCTGTTCCTAGGAACGTGGAGGAGGTGCAAGGAGGGTGATCTCACCCTGGTGTG TCTCTTCATGGAGCTCAGATCTTGAAAACTGTGAGGTGCTTATCCGATACCTGCTTCGTGC ATGGCTTGTGCGATATGTACACGCATTTGCAGATTGGTGGGAGCAGCAGATTGGTGGGAG CAGCATAGAGCTTTAGAAGGGGCTTAGGAGCGGGAATGTGAAACTCAGGCGGTTGGGCCAGATGAGAGCGCAAAGtacgtaCAACGCTACGCAACTCCCTTCGATGGCTTCAAG TACGGAGATGTGGGCATCCAGGATTCGCATGTGCTGCTTCAGCCCTCCTCA TGCCACTAGCACTCATTTTTCGACTCCCGGATTGCCAGGTTCAAGGGCATC AAGGAGTCGGAGATCAGCCGCGCCATGACCTCCCGCTACTTCGAGGACCT AAACGTCAATGCCGAGGTGCTTTTGCATATATTTACAGCTAATTATGATGG GTGTGGTGCGCGATATGCTTGCAAGGTCTCCGGTGAGCTAATGATCGGCA CATCCCTTCCGCGCATCCGCAGGTCGATGTCGTCATTGTTGGGGCTGGGTC TGCGGGCCTCTCGTGCGCCTATGAGCTGAGCAAGCACCCGGATGTCAAGGTATGGGCTGAGCAGGGCACATCCTCAGATGATGTTGCTGTAATTGCAATT GAAACTTGCGGTTGTTCCCAGCACAGCCTCAATCAATCATGTGTGCTGCGT TGGAAACGCTATGATACCCCAGCCTTCAACATGGGGCAGGGATATCGTTT ACACCTGCTTGAACCCCCCGCAACAGGTGGCCATCATCGAGCAGGGCGTC GCCCCTGGGGGTGGAGCGTGGCTGGGGGGTCAGCTCTTCTCGGCTATGTG TGTGAGTCTAGGCACGGGGACGGGTGGACTGAAGCAAGGGTTGGGCGCA GGGTGTTGATATCCATGTGTTGGACATTCTCGTTGGGAAAACAAGATGTG TGTATTTAGTGCTATCTCGGTGGCTGCATTCCaagctt(SEQ ID NO: 1)[000181] Relevant restriction sites in the construct are indicated in lowercase bold text and are from 5’ to 3’ Hindlll, Xbal, Spel, SnaBI, and Hindlll, respectively. Hindlll restriction endonuclease site used to generate linear DNA is indicated in lowercase bold and delimits the 5’ and 3’ ends of the transforming DNA. Underlined uppercase text at the 5’ and 3’ flanks of the construct represent genomic DNA from A. protothecoides that enable targeted integration of the transforming DNA via homologous recombination at the Thi4 locus within the genome. Proceeding in the 5’ to 3’ direction, the A. protothecoides stearoyl ACP desaturase (ApSAD2vl) promoter, driving theexpression of codon-optimized Pt-FADdelta6, is indicated by the lowercase boxed text. The initiator ATG and terminator TGA for Pt-FADdelta6 are indicated in uppercase italics, while the coding region is indicated in lowercase italics. The terminator region of the A. protothecoides stearoyl ACP desaturase (ApSAD2vl terminator) gene is indicated by small capitals followed by the A. protothecoides phosphoglycerate kinase 1 (ApPGKl) promoter in lowercase, boxed text, driving expression of neomycin phosphotransferase II gene (Neo, codon-optimized for expression in A. protothecoides and encoding neomycin phosphotransferase II, thereby enabling the strain to grow on aminoglycoside antibiotic G418). The initiator ATG and terminator TGA for Neo are indicated in uppercase italics while the rest of the sequence is indicated in lowercase italics. The terminator region of the A. protothecoides phosphoglycerate kinase 1 (ApPGKl) terminator is indicated by small capitals followed by A. protothecoides PB5 THI4 genomic region indicated by the underlined uppercase text.[000182] pPB0405 was transformed into A. protothecoides and the resulting primary transformants were grown in media supplemented with G418. Transformed A protothecoides was grown under standard lipid production conditions. The lipid profiles from a set of representative transformed clones are shown in Table 1.Table 1. Lipid Profiles[000183] A. protothecoides transformants expressing Pt-FADdelta6 desaturase showed a new fatty acid peak in lipid profiles corresponding to GLA (C18:3y or C18:3n6) over the control (Table 1). The production of GLA was concomitant with the diminution of the substrate linoleic acid (C18:2n6), demonstrating that Pt-FADdelta6 specifically introduces a double bond at the C-6 position from the carboxylic group. As expected, no change occurred in alpha-linolenic acid (C18:3n3) levels. Transformant PB5;405-2 was banked as Phycoil engineered strain (PES) PES29 and used as a parent strain for relevant subsequent transformations.Example 2. Increasing the Production of GLA in Auxenochlorella protothecoides [000184] Starting from the transformant made in Example 1 (PES29), we introduced constructs overexpressing Arabidopsis thaliana LPCAT1 (Accession No: NP_172724) - encoding lyso-phosphatidylcholine acyltransferase (pPB0234), PDCT (Accession No: NP_566527) - encoding phosphatidyl-choline diacylglycerol cholinephosphotransferase (pPB0214) or a combination of both genes (pPB0222). Constructs pPB0214, pPB0234, and pPB0222, targeting At-LPCATl, At-PDCT, and a combination of At-PDCT and At-LPCATl along with selection marker ScSUC2 into D-aspartate oxidase 1 (DAO1) genomic locus, in PES29 can be written as: pPB0234 ( ApD AO 1 : : CrTUB2- Sc SUC2- ApPGH : Ap AMT2v 1 - At-LPC AT 1 - ApSAD2vl::ApDA01), pPB0214 (ApDA01::CrTUB2-ScSUC2-ApPGH:ApAMTlvl-At-PDCT-ApPGKl::ApDA01), pPB0222 (ApDAOl::CrTUB2- ScSUC2-ApPGH:ApAMTlvl-At-PDCT-ApPGKl:ApAMT2vl-At-LPCATl- ApSAD2vl::ApDA01). The sequences of pPB0214, pPB0234, and pPB0222 are shown below: pPB0234 gatatcCAAGGTCGCTAGGACAGGACCAGACTCGAGAATCAGTTTTCCGCAG AAATTGAAGCTTTACGTTGAGTGCTCAAGCTCTTCGGTTGCAAAATTGTGC TCGATGGAAGGCGGGACAAAATGCGCAATTACATGCAGGTGAAAGTTCA ATACGACGATCTGGGAGTGTGAGTGGGTCCACAATGCTCCCGAGTAGCAC ATGCAATTTTTAGCTCTTCACCTCCCCGTCAATTCTGTTTTCTTCCGCTTTT TCCAAATGGGATGCTGTTGGCAGTGAGAACAGCGTTATTGATGTTCGGTTT ATGGATCTTATTATCTGACACTGCTGTGCGTGCACTGCTGTATTGCAGCCA CCTGCGGCATTTGCATGCAGAATTCGATCAAACATTTCTTTCTATCGGGCC AGTAGAGAATGGTGGACCATTGCAAGCTTGGAATCTACAGCGCTCATCCT GGCCAAGCAGGTTTCTGTCTCGGCATCAGGCATCGAGCGCGGGTCGCCGA CAAGGGCCTCCGGAACCGGTCGAGATCAGGGCGTAATCAGGCAAAGCCA AACAACCCAACAGCTTGTATTTGTTGATTGGTTCTGTAGTCGGGAGGTTGC CCTTAGCTCGAGCCGCGGACCTCGCAATGGACCAGAGCACCCGGCGACGT GTCAGGCACTTGACGGAACTCCTCTCACCCGCATCTCATCCCCTGGGGTTC GATGAACCGGTGAGAGCCGTCAAGTGTTCATCCCGGCGAAGCTCCCGAGT CTGCGTGCTGGGAGCTGGCGTGGTGGGGCTGACCACGGCCCTCAGACTCCccggcgctgcatgcaacaccgatgatgcttcgaccccccgaagctccttcggggctgcatgggcgctccgatgccgctccagggcgagcgctgtttaaatagccaggcccccgattgcaaagacattatagcgagctaccaaagccatattcaaacacctaVaacccugaaa<M TGctgctgcaggccttcctgttcctgctggccggcttcgccgccaagalcagcgcclccalgacgaacgagacgtccgaccgccccctggtgcacttcacccccaacaagggctggatgaacgaccccaacggcctgtggtacgacgagaaggacgccaagtggcacctgtacttccagtacaacccgaacgacaccgtctgggggacgcccttgttctggggccacgccacgtccgacgacctgaccaactgggaggaccagcccatcgccatcgccccgaagcgcaacgactccggcgccttctccggctccatggtggtggactacaacaacacctccggcttcttcaacgacaccatcgacccgcgccagcgctgcgtggccatctggacctacaacaccccggagtccgaggagcagtacatctcctacagcctggacggcggctacaccttcaccgagtaccagaagaaccccgtgctggccgccaactccacccagttccgcgacccgaaggtcttctggtacgagccctcccagaagtggatcatgaccgcggccaagtcccaggactacaagatcgagatctactcctccgacgacctgaagtcctggaagctggagtccgcgttcgccaacgagggcttcctcggctaccagtacgagtgccccggcctgatcgaggtccccaccgagcaggaccccagcaagtcctactgggtgatgttcatctccatcaaccccggcgccccggccggcggctccttcaaccagtacttcgtcggcagcttcaacggcacccacttcgaggccttcgacaaccagtcccgcgtggtggacttcggcaaggactactacgccctgcagaccttcttcaacaccgacccgacctacgggagcgccctgggcatcgcgtgggcctccaactgggagtactccgccttcgtgcccaccaacccctggcgctcctccatgtccctcgtgcgcaagttctccctcaacaccgagtaccaggccaacccggagacggagctgatcaacctgaaggccgagccgatcctgaacatcagcaacgccggcccctggagccggttcgccaccaacaccacgttgacgaaggccaacagctacaacgtcgacctgtccaacagcaccggcaccctggagttcgagctggtgtacgccgtcaacaccacccagacgatctccaagtccgtgttcgcggacctctccctctggttcaagggcctggaggaccccgaggagtacctccgcatgggcttcgaggtgtccgcgtcctccttcttcctggaccgcgggaacagcaaggtgaagttcgtgaaggagaacccctacttcaccaaccgcatgagcgtgaacaaccagcccttcaagagcgagaacgacctgtcctactacaaggtgtacggcttgctggaccagaacatcctggagctgtacttcaacgacggcgacgtcgtgtccaccaacacctacttcatgaccaccgggaacgccctgggctccgtgaacatgacgacgggggtggacaacctgttctacatcgacaagttccaggtgcgcgaggtcaagTGA'V\ (i.\'V\ (i(i.\.\C'\ cACAAAGCGGCCCACGGCTTCGAACGTCCCGTGTCAATTGCGCGGGGTGTGCCAGAGTTTCTGCGCCACCGATGCTCACCCTAGGGGGGGATGCCCTTTGACATTCATGTGTGCCTGCATGCACGTTTGTATCAGTCTCACCACACCTTGAAGATTTTTGGGAGGGGGGGGGAAGTCGGAATGGAAACgCggCCgc|gaCggCtqgcttgtttgccgacgcccttgccgctcggatgggaaccatgactctccccctcgccaaggtcatccccattttggtggctgtggctgacgaggcgttctttcccggctcccaggcctcggcccacttgtcagagctggcggttgtgaaggagctggcagccatggtgtatgcgagcgggccgccccaggactgataatcctggaactgaacttggagacagtgctgccaaatacaacagggctctctggcaaacgatgagtgcgctgcaatactccttcacccgaacttagatgtactggactatgactctacacgtgggcacgagtcttttgtaggcagaaaatttggagactcccaccacgtccgggggtccatgtagtcgtgcaagtggtgggctagggttgt gcccctcgagttcttttgcgacgctgtttgcctctggtcatctgctgataccgatcataagtgtatggagtcatgtggcggcg attcaggggccctttccctgccatctgttccaatttcgtaaaattcccagtcgtccgcacaggtgtggccgccgtcgtaccga gtcatggcaccagcttccggccgacgaggagcggggtggctgcaaagccctagcgactgcgcgaattgaggtgtcagg gtcgaagcagcaggtggggggcctccgagcactctggagctgtggcgaccgaggccacatgagaatgccatggagg aaagtgggaccaagcccatcggcccggtgacctagggcaacactttggacaacttgcgccatccaagtggatccattgc attgttcctggatttaacactctgccatcggcattaacggaggctggacgcacctggggcgcacatcatcgccggtcggct caaccctaggtgcgcgcacaaaccccggcgcaacaccggcctcgcggtgttcgcgctgcgcatggccggtatgcctctt cagccgcaatgtgtccgattttgtcgccatgaacgccaccatcggctccgtctcatcctaaaccatctcgtttgtgcaaccc tagctgtgccgcgaatccaatctcctgtctcacttgccgtgtccgttggaaccattcgcgccggtctccagcctgcgcgttgc gccaattcttccaccaccatttcaaatgcatcattccttcacattgccgtgtctccatgagctggacgtacgagttttggagtcc caccggtccccccggccctgccgccatcgcagttcgaaggagcacctgtcacc^ZGgacaZgtecfcca / ggccggcZ ccatcggcgtgtccgtggccgtgctgcgcttcctgctgtgcttcgtggccaccatccccgtgtccttcgcctgccgcatcgt gccctcccgcctgggcaagcacctgtacgccgccgcctccggcgccttcctgtcctacctgtccttcggcttctcctccaa cctgcacttcctggtgcccatgaccatcggctacgcctccatggccatctaccgccccaagtgcggcatcatcaccttctt cctgggcttcgcctacctgatcggctgccacgtgttctacatgtccggcgacgcctggaaggagggcggcatcgactcc accggcgccctgatggtgctgaccctgaaggtgatctcctgctccatgaactacaacgacggcatgctgaaggagga gggcctgcgcgaggcccagaagaagaaccgcctgatccagatgccctccctgatcgagtacttcggctactgcctgtg ctgcggctcccacttcgccggccccgtgtacgagatgaaggactacctggagtggaccgagggcaagggcatctggg acaccaccgagaagcgcaagaagccctccccctacggcgccaccatccgcgccatcctgcaggccgccatctgcat ggccctgtacctgtacctggtgccccagtaccccctgacccgcttcaccgagcccgtgtaccaggagtggggcttcctg cgcaagttctcctaccagtacatggccggcttcaccgcccgctggaagtactacttcatctggtccatctccgaggcctcc atcatcatctccggcctgggcttctccggctggaccgacgacgcctcccccaagcccaagtgggaccgcgccaagaa cgtggacatcctgggcgtggagctggccaagtccgccgtgcagatccccctggtgtggaacatccaggtgtccacctg gctgcgccactacgtgtacgagcgcctggtgcagaacggcaagaaggccggcttcttccagctgctggccacccaga ccgtgtccgccgtgtggcacggcctgtaccccggctacatgatgttcttcgtgcagtccgccctgatgatcgccggctccc gcgtgatctaccgctggcagcaggccatctcccccaagatggccatgctgcgcaacatcatggtgttcatcaacttcctg tacaccgtgctggtgctgaactactccgccgtgggcttcatggtgctgtccctgcacgagaccctgaccgcctacggctc cgtgtactacatcggcaccatcatccccgtgggcctgatcctgctgtcctacgtggtgcccgccaagccctcccgcccca flgCCCCgcaaggaggflgZG^GCGGAGGCCTTGGAAATATTCGCGTCACGCGAGGAGTAGGCTCTGCTGGTCGGCCCTGGATACGCTGACTCTTCAAGCAGTGGGGCACCACACCCACCTTTTGCCAAGGGCAAG GAGTCGGAAGGGGGCGGGGCTGCCATGCACCCCTGACGGGCATGGCCGTTCCGCGAGGGCGCCAACTGCGGCGGCCTGCCCGCTGGCTCGTGCCCCCCTACCCCCACCATTGCCTGGAGCGTTTCCATCCCCAA ATCACATTCCATCCAAGTTGTATCACTATGCCCCTTTGGCTCTATACACTCACGGCCTGAGGTCCCTT CTCGGCCGTGGCGGCACACGCCCAACCCCCCACCATACTCTTTCCATACACTGCAATGCTTCGAGCCT GCCTGCCACCTGCTCTGCTTGTCTCCCCTCCCTTCCCTTGAGGTTTTCCAATGCAGTAAGAGAAGTCG ACGTGCATGGACAGATGATTGAAGATGAGCttaagTGGATCTGGTGGCCAAATGGGGAG CTGCCACATTTCAGCACTACATGGATCTGTATCGCACCAAGCACGCTGCCGACGCAGGCGAGCGGTCATGGGAGAAGGGACGGTGAGAAGCATTTACTT GCGAGGCGTACAAGCCGTCTTCTGCTAAATTTGCTGAGACTGAATGCCCA GATCCACATGAAGCACTCCATCTTCCTCCTGCCCCCTTCCACCCACTCCCT CAGGTGTCATGCTGACTGGTGGGTATGACCTCTCGTCGGTACCCCTCCCAG AGGAGAAGCCTTTCTGGGCCGACATCTTGCTTGCCTTCAGACGGCTGGAA AGCAGTGAGCTGGCCGCCTTCGATCCAAGCGGTACATCCGTCGATGGCTA CGGATTCACCACAATTGTGACGTGAGGCGGCCAATTATGGGAAAGGAAGC TCCACTTCAAGCGGCATGCCCTTGCAAGCTGAGGGGGAGTGCAGACCTCC TCATGCCTTGAATTTGCAGGGAGGCCAGCGACTCTGCCCCTTTCCACCGAG CAGGGAGGGGCGACTTTACCTGGTCTGGTTGATGAAGCAGATTGAGCAGC TGGGCGGCAGGCACGAGCGCCGTCATGTCAGCAGCTTGGATGAGCTGGCC GATTACGATGCCGTGGTCAACTGCACAGGTGCGCACGTGGTCGGGTTGCATGAGCCAGCACGGGGGGCGCAGCCCTCCCCTGCTCCCGGGACAGGCACGC CGACGCCGTTTTGCATCATCAGCCGAGAGCCTCTGTGAGGCAGGCCCACA TTCCTCACCCCATCcatatg(SEQ ID NO: 2)[000185] Relevant restriction sites in the construct are indicated in lowercase, bold, and are from 5’ to 3’ EcoRV, Spel, Notl, Aflll, EcoRV, respectively. EcoRV restriction endonuclease site used to generate linear DNA and for cloning is indicated in lowercase bold and delimits the 5’ and 3’ ends of the transforming DNA. Underlined, uppercase sequences represent genomic DNA from A. protothecoides that permit targeted integration of the transforming DNA at the D-aspartate oxidase 1 (DAO1) genomic locus via homologous recombination. Proceeding from 5’ to 3’, the selection cassette contains the C. reinhardtii beta tubulin 2 (CrTUB2) promoter in lowercase, boxed text, driving expression of Saccharomyces cerevisiae SUC2 gene (ScSUC2), codon-optimized for expression in A. protothecoides and encoding sucrose invertase, thereby enabling the strain to utilize exogenous sucrose. The initiator ATG andterminator TGA for ScSUC2 are indicated in uppercase italics while the rest of the sequence is indicated in lowercase italics. The terminator region of the A. protothecoides enolase gene (ApPGH) gene is indicated in small capitals followed by A. protothecoides ammonium transporter 2 (ApAMT2vl) promoter (indicated as small case boxed text) driving the expression of codon-optimized At-LPCATl. The initiator ATG and terminator TGA for At-LPCATl are indicated in uppercase italics, while the coding region is indicated in lowercase italics. The ApSAD2vl terminator region is indicated by small capitals followed by the A. protothecoides genomic region indicated by the underlined uppercase text. The final construct was sequenced to ensure correct reading frames and targeting sequences. pPB0214 gcggccgc|ggacatcatgggtctccagggctctaggcccttccccttcgctgcaagtaaacagttgcaggtcgcataagtc ccctggcatgcctctgctcatgcacttcaggtcagcaataatgataccgcatggcttggttatattcctttcttaatactgtacga catgcagctggaggtggcaacatgagcgatgaactgcacgatggacaagccggccctatggcgggagatgaagattgg gttcggaccacatccctctaccctcctggtacggaagggggcccaacgtcccttgatacggtcgattgatagctttgagata atgctacttcatgagaacgagatcgccagtggttgccgtgccttctcccacggcgggacccctgcgacactcttctgacctc cgagcgatgagcgactggacactatgcgacagtgccaaggacccttggtatagcagaccatgtatgcatggcatgacttc atggaacagggccctgtccgagtgtgacctctgggcgataggggatacgacgaagattagggttttcctgatgcgtgactt ggttctcgcgccactgtcaatggcagacatcgcaccacgccgtggagctatttatggtaactttgagtccactcgagggctc catgctgcattctgcccttcggtacgtcgggacatttctcagagaatcgcgtttggctcccggagatcaaccacagaaaagg aaagatcgaacacaagatcacggatcccgggtgtcatttgtgttgtcaacctagggtctctgcgccaacctagggtaaagg ctgtcacaccctggaagcgctttatttcaccccgggtttcactgtcacatctcaacattattcggtgtccactcgggcacccgg agtcgccggttacaactcccagcagcatctaatctcccaagccctagacctacagcaccggccgcacaggacgagcgcc gttgccccagccctccacaaa^TGfccgccgccgccgccgagaccgacgtgfccctgcgccgccgcfccaacfccct gaacggcaaccacaccaacggcgtggccatcgacggcaccctggacaacaacaaccgccgcgtgggcgacacca acacccacatggacatctccgccaagaagaccgacaacggctacgccaacggcgtgggcggcggcggctggcgct ccaaggcctccttcaccacctggaccgcccgcgacatcgtgtacgtggtgcgctaccactggatcccctgcatgttcgc cgccggcctgctgttcttcatgggcgtggagtacaccctgcagatgatccccgcccgctccgagcccttcgacctgggct tcgtggtgacccgctccctgaaccgcgtgctggcctcctcccccgacctgaacaccgtgctggccgccctgaacaccgt gttcgtgggcatgcagaccacctacatcgtgtggacctggctggtggagggccgcgcccgcgccaccatcgccgccct gttcatgttcacctgccgcggcatcctgggctactccacccagctgcccctgccccaggacttcctgggctccggcgtggacttccccgtgggcaacgtgtccttcttcctgttcttctccggccacgtggccggctccatgatcgcctccctggacatgcg ccgcatgcagcgcctgcgcctggccatggtgttcgacatcctgaacgtgctgcagtccatccgcctgctgggcacccgc ggccactacaccatcgacctggccgtgggcgtgggcgccggcatcctgttcgactccctggccggcaagtacgagga gatgatgtccaagcgccacctgggcaccggcttctccctgatctccaaggactccctggtgaacTGAGC'YGTYCC'Y AGGAACGTGGAGGAGGTGCAAGGAGGGTGATCTCACCCTGGTGTGTCTCTTCATGGAGCTCAGATCT TGAAAACTGTGAGGTGCTTATCCGATACCTGCTTCGTGCATGGCTTGTGCGATATGTACACGCATTTG CAGATTGGTGGGAGCAGCAGATTGGTGGGAGCAGCATAGAGCTTTAGAAGGGGCTTAGGAGCGGGA ATGTGAAACTCAGGCGGTTGGGCCAGATGAGAGCGCAAAGCttaag (SEQ ID NO: 3)[000186] pPB0214 has the same vector backbone and selectable marker cassette as pPB0234, differing only in the Lands cycle enzyme being tested and the promoter and 3’UTRbeing used to drive its expression. Relevant restriction sites in the construct are also the same as in pPB0234. In pPB0214, we tested the function of the At-PDCT gene driven by A. protothecoides ammonium transporter 1 (ApAMTlvl) promoter and A. protothecoides phosphoglycerate kinase 1 (ApPGKl terminator) as the terminator sequence. The sequence of the Ap AMT 1- At-PDCT- ApPGK cassette contained in pPB0214 is provided in SEQ ID NO: 3. A. protothecoides ammonium transporter 1 (ApAMTl) promoter is indicated in small case boxed text and drives the expression of codon-optimized At-PDCT. The initiator ATG and terminator TGA for At-PDCT are indicated in uppercase italics, while the coding region is indicated in lowercase italics. The terminator region of the ApPGKl is indicated by small capitals. Notl and Aflll restriction sites, at the beginning and end of the cassette, are depicted in lowercase bold. pPB0222 gcggccgc|ggacatcatgggtctccagggctctaggcccttccccttcgctgcaagtaaacagttgcaggtcgcataagtc ccctggcatgcctctgctcatgcacttcaggtcagcaataatgataccgcatggcttggttatattcctttcttaatactgtacga catgcagctggaggtggcaacatgagcgatgaactgcacgatggacaagccggccctatggcgggagatgaagattgg gttcggaccacatccctctaccctcctggtacggaagggggcccaacgtcccttgatacggtcgattgatagctttgagata atgctacttcatgagaacgagatcgccagtggttgccgtgccttctcccacggcgggacccctgcgacactcttctgacctc cgagcgatgagcgactggacactatgcgacagtgccaaggacccttggtatagcagaccatgtatgcatggcatgacttc atggaacagggccctgtccgagtgtgacctctgggcgataggggatacgacgaagattagggttttcctgatgcgtgactt ggttctcgcgccactgtcaatggcagacatcgcaccacgccgtggagctatttatggtaactttgagtccactcgagggctc catgctgcattctgcccttcggtacgtcgggacatttctcagagaatcgcgtttggctcccggagatcaaccacagaaaagg aaagatcgaacacaagatcacggatcccgggtgtcatttgtgttgtcaacctagggtctctgcgccaacctagggtaaaggctgtcacaccctggaagcgctttatttcaccccgggttcactgtcacatctcaacattattcggtgtccactcgggcacccgg agtcgccggttacaactcccagcagcatctaatctcccaagccctagacctacagcaccggccgcacaggacgagcgcc gttgccccagccctccacaaa^TGfccgccgccgccgccgagaccgacgZgfcccZgcgccgccgcfccaacfcccZ gaacggcaaccacaccaacggcgtggccatcgacggcaccctggacaacaacaaccgccgcgtgggcgacacca acacccacatggacatctccgccaagaagaccgacaacggctacgccaacggcgtgggcggcggcggctggcgct ccaaggcctccttcaccacctggaccgcccgcgacatcgtgtacgtggtgcgctaccactggatcccctgcatgttcgc cgccggcctgctgttcttcatgggcgtggagtacaccctgcagatgatccccgcccgctccgagcccttcgacctgggct tcgtggtgacccgctccctgaaccgcgtgctggcctcctcccccgacctgaacaccgtgctggccgccctgaacaccgt gttcgtgggcatgcagaccacctacatcgtgtggacctggctggtggagggccgcgcccgcgccaccatcgccgccct gttcatgttcacctgccgcggcatcctgggctactccacccagctgcccctgccccaggacttcctgggctccggcgtgg acttccccgtgggcaacgtgtccttcttcctgttcttctccggccacgtggccggctccatgatcgcctccctggacatgcg ccgcatgcagcgcctgcgcctggccatggtgttcgacatcctgaacgtgctgcagtccatccgcctgctgggcacccgc ggccactacaccatcgacctggccgtgggcgtgggcgccggcatcctgttcgactccctggccggcaagtacgagga gatgatgtccaagcgccacctgggcaccggcttctccctgatctccaaggactccctggtgaacTGAGC'YGTYCC'Y AGGAACGTGGAGGAGGTGCAAGGAGGGTGATCTCACCCTGGTGTGTCTCTTCATGGAGCTCAGATCT TGAAAACTGTGAGGTGCTTATCCGATACCTGCTTCGTGCATGGCTTGTGCGATATGTACACGCATTTG CAGATTGGTGGGAGCAGCAGATTGGTGGGAGCAGCATAGAGCTTTAGAAGGGGCTTAGGAGCGGGA ATGTGAAACTCAGGCGGTTGGGCCAGATGAGAGCGCAAAGCttaaggaCggCtCgCttgtttgCCgaCgCCC ttgccgctcggatgggaaccatgactctccccctcgccaaggtcatccccatttggtggctgtggctgacgaggcgttcttt cccggctcccaggcctcggcccacttgtcagagctggcggttgtgaaggagctggcagccatggtgtatgcgagcgggc cgccccaggactgataatcctggaactgaacttggagacagtgctgccaaatacaacagggctctctggcaaacgatgag tgcgctgcaatactccttcacccgaacttagatgtactggactatgactctacacgtgggcacgagtcttttgtaggcagaaa atttggagactcccaccacgtccgggggtccatgtagtcgtgcaagtggtgggctagggttgtgcccctcgagttctttgc gacgctgttgcctctggtcatcttgctgataccgatcataagtgtatggagtcatgtggcggcgattcaggggccctttccct gccatctgtccaatttcgtaaaattcccagtcgtccgcacaggtgtggccgccgtcgtaccgagtcatggcaccagcttcc ggccgacgaggagcggggtggctgcaaagccctagcgactgcgcgaattgaggtgtcagggtcgaagcagcaggtgg ggggccttccgagcactctggagctgtggcgaccgaggccacatgagaatgccatggaggaaagtgggaccaagccc atcggcccggtgacctagggcaacactttggacaacttgcgccatccaagtggatccattgcattgttcctggatttaacac tctgccatcggcattaacggaggctggacgcaccttggggcgcacatcatcgccggtcggctcaaccctaggtgcgcgc acaaaccccggcgcaacaccggcctcgcggtgttcgcgctgcgcatggccggtattgcctcttcagccgcaatgtgtccg atttttgtcgccatgaacgccaccatcggctccgtctcatcctaaaccatctcgttttgtgcaaccctagctgtgccgcgaatc caatctcctgtctcacttgccgtgtccgttggaaccattcgcgccggtctccagcctgcgcgttgcgccaattcttccaccaccatttcaaatgcatcattccttcacattgccgtgtctccatgagctggacgtacgagttttggagtcccaccggtccccccggc cctgccgccatcgcagttcgaaggagcacctgtcacc|471Ggaca / gtcctecatggccggctecatcggcgtgtecgtggcc gtgctgcgcttcctgctgtgcttcgtggccaccatccccgtgtccttcgcctgccgcatcgtgccctcccgcctgggcaagcacctgta cgccgccgcctccggcgccttcctgtcctacctgtccttcggcttctcctccaacctgcacttcctggtgcccatgaccatcggctacg cctccatggccatctaccgccccaagtgcggcatcatcaccttcttcctgggcttcgcctacctgatcggctgccacgtgttctacatgt ccggcgacgcctggaaggagggcggcatcgactccaccggcgccctgatggtgctgaccctgaaggtgatctcctgctccatga actacaacgacggcatgctgaaggaggagggcctgcgcgaggcccagaagaagaaccgcctgatccagatgccctccctgat cgagtacttcggctactgcctgtgctgcggctcccacttcgccggccccgtgtacgagatgaaggactacctggagtggaccgagg gcaagggcatctgggacaccaccgagaagcgcaagaagccctccccctacggcgccaccatccgcgccatcctgcaggccgc catctgcatggccctgtacctgtacctggtgccccagtaccccctgacccgcttcaccgagcccgtgtaccaggagtggggcttcct gcgcaagttctcctaccagtacatggccggcttcaccgcccgctggaagtactcicttccitctggtcccitctccgciggcctcccitccitc atctccggcctgggcttctccggctggaccgacgacgcctcccccacigccccicigtgggaccgcgcccicigcicicgtggciccitcctg ggcgtggagctggccaagtccgccgtgccigcitccccctggtgtggciaccitccciggtgtcccicctggctgcgcccictcicgtgtcicg agcgcctggtgcagaacggcaagaaggccggcttcttccagctgctggccacccagaccgtgtccgccgtgtggcacggcctgt accccggctacatgatgttcttcgtgcagtccgccctgatgatcgccggctcccgcgtgatctaccgctggcagcaggccatctccc ccaagatggccatgctgcgcaacatcatggtgttcatcaacttcctgtacaccgtgctggtgctgaactactccgccgtgggcttcat ggtgctgtccctgcacgagaccctgaccgcctacggctccgtgtactacatcggcaccatcatccccgtgggcctgatcctgctgtc ctacgtggtgcccgccaagccctcccgccccaagccccgcaaggaggagTGAGCGGAGGCCTTGGAAATATTCGC GTCACGCGAGGAGTAGGCTCTGCTGGTCGGCCCTGGATACGCTGACTCTTCAAGCAGTGGGGCACCA CACCCACCTTTTGCCAAGGGCAAGGAGTCGGAAGGGGGCGGGGCTGCCATGCACCCCTGACGGGCA TGGCCGTTCCGCGAGGGCGCCAACTGCGGCGGCCTGCCCGCTGGCTCGTGCCCCCCTACCCCCACCA TTGCCTGGAGCGTTTCCATCCCCAAATCACATTCCATCCAAGTTGTATCACTATGCCCCTTTGGCTCT ATACACTCACGGCCTGAGGTCCCTTCTCGGCCGTGGCGGCACACGCCCAACCCCCCACCATACTCTTT CCATACACTGCAATGCTTCGAGCCTGCCTGCCACCTGCTCTGCTTGTCTCCCCTCCCTTCCCTTGAGGT TTTCCAATGCAGTAAGAGAAGTCGACGTGCATGGACAGATGATTGAAGATGAGCttaag (SEQ IDNO: 4)[000187] pPB0222 has the same vector backbone, selectable marker cassette, and relevant restriction sites like pPB0234 and pPB0214 described above. However, it differs from both constructs in that we combined both At-PDCT and At-LPCATl cassettes from pPB0234 and pPB0214 into pPB0222. The sequence of ApAMTl-At- PDCT-ApPGKl :ApAMT2vl-At-LPCATl-ApSAD2vl contained in pPB0222 is provided in SEQ ID NO: 4. Notl and Aflll restriction sites, at the beginning, middle, and end of the cassette, are depicted in lowercase bold. A. protothecoides ammonium transporter 1 (ApAMTl) promoter is indicated as small case boxed text and drives the expression of codon-optimized At-PDCT. The initiator ATG and terminator TGA forAt-PDCT are indicated in uppercase italics, while the coding region is indicated with lowercase italics. The ApPGK terminator region is indicated by small capitals followed by A. protothecoides ammonium transporter 2 (ApAMT2vl) promoter (indicated as small case boxed text) driving the expression of codon-optimized At-LPCATl. The initiator ATG and terminator TGA for At-LPCATl are indicated in uppercase italics, while the coding region is indicated in lowercase italics. The ApSAD2vl terminator region is indicated by small capitals. The final construct was sequenced to ensure correct reading frames and targeting sequences.[000188] pPB0234, pPB0214, and pPB0222 were transformed into strain PES29(expressing Pt-FADdelta6 desaturase), and transformants were obtained. Transformants were grown under standard lipid production conditions. The fatty acid profiles of from the transformants with plasmids pPB0234, pPB0214, and pPB0222 are shown in Table 2.Table 2. Fatty Acid Profiles[000189] C18:2n6 (Linoleic acid) levels, being 4.16% in the PES29 parent, increased by 3- or more-folds in derivative transformants expressing At-LPCATl (PES29;234 lines). The highest Cl 8:2n6 (18.98%) level was observed in derivative line PES29;234-2(3) exhibiting more than 4.5-fold increase over the PES29 control, indicating that expression of At-LPCATl during lipid production significantly increases the channeling of C18:ln9 to phospholipid membranes where they becomeavailable for desaturation by endogenous FAD2 enzyme and are converted into C18:2n6. Since the PES29 also expresses Pt-FADdelta6 desaturase, a significant portion of the available C18:2n6 is desaturated to C18:3n6 (GLA) resulting in about 2- fold increase over the amount seen in PES29 (8.57% and 8.31% GLA in PES29;234- 3(2) and PES29;234-2(3) vs -4.69% in PES29). Combined C18:2n6 and C18:3n6 increased from around 8.85% in PES29 parent to more than 24% in the representative derivative lines demonstrating the positive effect of increased At-LPCAT activity in these strains.[000190] Endogenous choline-phosphotransf erase activity (encoded by CPT gene) modulates symmetrical interconversion of C18:2n6 (and C18:3n3) between phosphatidylcholine (PC) and diacylglycerol (DAG). Like CPT, At-PDCT modulates symmetrical interconversion of C18:2n6 (and C18:3n3) between phosphatidylcholine (PC) and diacylglycerol (DAG). DAGs are eventually converted into TAGs by Kennedy pathway acyltransferases. Increased PC to DAG channeling of C18:2n6 plausibly results in more available space on phospholipids and thus more channeling of C18: ln9 into phospholipids (driven by endogenous LPCAT activity in our organism). We have previously demonstrated that At-PDCT complements the endogenous CPT activity in 4. protothecoides and efficiently channels Cl 8:2n6 out of phospholipids into DAGs and eventually TAGs (PCT / IB2022 / 062048). Thus, not surprisingly, At-PDCT (pPB0214) expression in PES29 resulted in an around 4-fold increase in C18:2n6 levels compared to the parent PES29 (PES29;214 lines vs PES29 control in Table 2). Interestingly, however, At-PDCT also exhibited more affinity for GLA such that the levels increased from 4.69% in PES29 to 12.79% in PES29;214-2(2) and 15.75% in PES29;214-3(1) which were banked as PES31 and PES32 respectively. Combined C18:2n6 and C18:3n6 increased from around 8.85% in PES29 to 28.21% in PES31 and 30.18% in PES32. Increased C18:2n6 and C18:3n6 content in At-LPCATl or AT- PDCT expressing derivative lines were concomitant with a corresponding decrease in C18: ln9 levels (between 51-55% in derivative lines vs 72.11 % in PES29).Example 3. Modification of PES29 for the Production of GLA in Auxenochlorella protothecoides[000191] Starting from the transformant made in Example 1 (PES29), we introduced constructs overexpressing another copy Pt-FADdelta6 desaturase, with Arabidopsis thaliana LPCAT 1 (Accession No: NP_172724) encoding lyso-phosphatidylcholine acyltransferase (pPB0436), or PDCT (Accession No: NP_566527) encoding phosphatidyl-choline diacylglycerol cholinephosphotransferase (pPB0435) or a combination of both genes (pPB0437). Constructs pPB0435, pPB0436, and pPB0437, targeting Pt-FADdelta6 and At-LPCATl, PtFADdelta6 and At-PDCT, or Pt- FADdelta6, At-PDCT and At-LPCATl along with selection marker ScSUC2 into D- aspartate oxidase 1 (DA01) genomic locus can be represented by pPB0435 (ApDAOl : :CrTUB2-ScSUC2-ApPGHUTR:ApSAD2vl-PtFADd6 desat-ApSAD2vlUTR:ApAMTlvl-At-PDCT-ApPGKlUTR: ApDAOl), pPB0436 (ApDAOl : :CrTUB2-ScSUC2-ApPGHUTR:ApSAD2vl-PtFADd6 desat-Ap S AD2v 1 UTR: Ap AMT2vl-At-LPC AT l-ApHSP90UTR:: ApDAOl), and pPB0437 (ApDAOl : :CrTUB2-ScSUC2-ApPGHUTR:ApSAD2vl-PtFADd6 desat-ApSAD2vlUTR:ApAMTlvl-At-PDCT-ApPGKlUTR:ApAMT2vl-At-LPCATl- ApHSP90UTR: ApDAO l ).[000192] The sequences of pPB0435, pPB0436, and pPB0437 are shown below: pPB0435 gatatcCAAGGTCGCTAGGACAGGACCAGACTCGAGAATCAGTTTTCCGCAGAAATTGAAGCTTTACGTTGAGTGCTCAAGCTCTTCGGTTGCAAAATTGTGCTCGATGGAAGGCGGGACAAAATGCGCAATTACATGCAGGTGAAAGTTCA ATACGACGATCTGGGAGTGTGAGTGGGTCCACAATGCTCCCGAGTAGCACATGCAATTTTTAGCTCTTCACCTCCCCGTCAATTCTGTTTTCTTCCGCTTTT TCCAAATGGGATGCTGTTGGCAGTGAGAACAGCGTTATTGATGTTCGGTTTATGGATCTTATTATCTGACACTGCTGTGCGTGCACTGCTGTATTGCAGCCA CCTGCGGCATTTGCATGCAGAATTCGATCAAACATTTCTTTCTATCGGGCCAGTAGAGAATGGTGGACCATTGCAAGCTTGGAATCTACAGCGCTCATCCT GGCCAAGCAGGTTTCTGTCTCGGCATCAGGCATCGAGCGCGGGTCGCCGACAAGGGCCTCCGGAACCGGTCGAGATCAGGGCGTAATCAGGCAAAGCCAAACAACCCAACAGCTTGTATTTGTTGATTGGTTCTGTAGTCGGGAGGTTGC CCTTAGCTCGAGCCGCGGACCTCGCAATGGACCAGAGCACCCGGCGACGT GTCAGGCACTTGACGGAACTCCTCTCACCCGCATCTCATCCCCTGGGGTTC GATGAACCGGTGAGAGCCGTCAAGTGTTCATCCCGGCGAAGCTCCCGAGT CTGCGTGCTGGGAGCTGGCGTGGTGGGGCTGACCACGGCCCTCAGACTCCTCGAGCGATTCCactagt|ctttcttgcgctatgacacttccagcaaaaggtagggcgggctgcgagacggcttcccggcgctgcatgcaacaccgatgatgcttcgaccccccgaagctccttcggggctgcatgggcgctccgatgccgctcc agggcgagcgctgtttaaatagccaggcccccgattgcaaagacattatagcgagctaccaaagccatattcaaacaccta gatcactaccactctacacaggccactcgagctgtgatcgcactccgctaagggggcgcctcttcctcttcgttcagtca ca^ccc^&aacA TGclgclgcaggccllcclgllcclgclggccggcllcgccgccaagalcagcgcclccalgacg aacgagacgtccgaccgccccctggtgcacttcacccccaacaagggctggatgaacgaccccaacggcctgtggt acgacgagaaggacgccaagtggcacctgtacttccagtacaacccgaacgacaccgtctgggggacgcccttgttc tggggccacgccacgtccgacgacctgaccaactgggaggaccagcccatcgccatcgccccgaagcgcaacgac tccggcgccttctccggctccatggtggtggactacaacaacacctccggcttcttcaacgacaccatcgacccgcgcc agcgctgcgtggccatctggacctacaacaccccggagtccgaggagcagtacatctcctacagcctggacggcggc tacaccttcaccgagtaccagaagaaccccgtgctggccgccaactccacccagttccgcgacccgaaggtcttctgg tacgagccctcccagaagtggatcatgaccgcggccaagtcccaggactacaagatcgagatctactcctccgacga cctgaagtcctggaagctggagtccgcgttcgccaacgagggcttcctcggctaccagtacgagtgccccggcctgat cgaggtccccaccgagcaggaccccagcaagtcctactgggtgatgttcatctccatcaaccccggcgccccggccg gcggctccttcaaccagtacttcgtcggcagcttcaacggcacccacttcgaggccttcgacaaccagtcccgcgtggt ggacttcggcaaggactactacgccctgcagaccttcttcaacaccgacccgacctacgggagcgccctgggcatcg cgtgggcctccaactgggagtactccgccttcgtgcccaccaacccctggcgctcctccatgtccctcgtgcgcaagttc tccctcaacaccgagtaccaggccaacccggagacggagctgatcaacctgaaggccgagccgatcctgaacatca gcaacgccggcccctggagccggttcgccaccaacaccacgttgacgaaggccaacagctacaacgtcgacctgtc caacagcaccggcaccctggagttcgagctggtgtacgccgtcaacaccacccagacgatctccaagtccgtgttcgc ggacctctccctctggttcaagggcctggaggaccccgaggagtacctccgcatgggcttcgaggtgtccgcgtcctcc ttcttcctggaccgcgggaacagcaaggtgaagttcgtgaaggagaacccctacttcaccaaccgcatgagcgtgaa caaccagcccttcaagagcgagaacgacctgtcctactacaaggtgtacggcttgctggaccagaacatcctggagct gtacttcaacgacggcgacgtcgtgtccaccaacacctacttcatgaccaccgggaacgccctgggctccgtgaacat gacgacgggggtggacaacctgttctacatcgacaagttccaggtgcgcgaggtcaagTGAHGKVlGGkAC TCACAAAGCGGCCCACGGCTTCGAACGTCCCGTGTCAATTGCGCGGGGTGTGCCAGAGTT TCTGCGCCACCGATGCTCACCCTAGGGGGGGATGCCCTTTGACATTCATGTGTGCCTGCATGCACGTTTGTATCAGTCTCACCACACCTTGAAGATTTTTGGGAGGGGGGGGGAAGTCGGA ATGGAAACgcggccgc|cttgcagtgccccaaaaactggctaccacctaacaattctcacgcagttttatcctctgcactt tgatgtcagctttttgattcgtctgcgtacattacagcgttgagtggccagcaggaaggagaccgcggtccgagacgagtct gagggcgcgctctcgcaacttggattccggatttcttaccctgcatcgacctcggcctggagtcgatcagaaattgtcattgc cagattgcctggcgaggacgggtgatatactcaaggcgttgcatcgcccacaaaacacacacttatctgcaagggagttac tgcatcaggctctgctcaacagctcgtgacatcgatcgttcagctccccagcaggtgcgtgtccgcatggagcacccctcccgagacacctgcgttgggtgtcggaggagctcacatgccagggaggtgcccacattgcaccacgcgaccgcgaaatag gcagacttcgggcatcctgtcatcgcatgtccgctggccgggaatcatggcctccccaccaggcgtcacgcgctgcccac ctccctccccttgctgcgcagggcaccgcgttcctgtggagagccgaccac[4ZGggcaagggcggcgacgcccgcg cctccaagggctccaccgccgcccgcaagatctcctggcaggaggtgaagacccacgcctcccccgaggacgcctg gatcatccactccaacaaggtgtacgacgtgtccaactggcacgagcaccccggcggcgccgtgatcttcacccacg ccggcgacgacatgaccgacatcttcgccgccttccacgcccccggctcccagtccctgatgaagaagttctacatcg gcgagctgctgcccgagaccaccggcaaggagccccagcagatcgccttcgagaagggctaccgcgacctgcgct ccaagctgatcatgatgggcatgttcaagtccaacaagtggttctacgtgtacaagtgcctgtccaacatggccatctgg gccgccgcctgcgccctggtgttctactccgaccgcttctgggtgcacctggcctccgccgtgatgctgggcaccttcttc cagcagtccggctggctggcccacgacttcctgcaccaccaggtgttcaccaagcgcaagcacggcgacctgggcg gcctgttctggggcaacctgatgcagggctactccgtgcagtggtggaagaacaagcacaacggccaccacgccgtg cccaacctgcactgctcctccgccgtggcccaggacggcgaccccgacatcgacaccatgcccctgctggcctggtcc gtgcagcaggcccagtcctaccgcgagctgcaggccgacggcaaggactccggcctggtgaagttcatgatccgca accagtcctacttctacttccccatcctgctgctggcccgcctgtcctggctgaacgagtccttcaagtgcgccttcggcct gggcgccgcctccgagaacgccgccctggagctgaaggccaagggcctgcagtaccccctgctggagaaggccgg catcctgctgcactacgcctggatgctgaccgtgtcctccggcttcggccgcttctccttcgcctacaccgccttctacttcc tgaccgccaccgcctcctgcggcttcctgctggccatcgtgttcggcctgggccacaacggcatggccacctacaacgc cgacgcccgccccgacttctggaagctgcaggtgaccaccacccgcaacgtgaccggcggccacggcttcccccag gccttcgtggactggttctgcggcggcctgcagtaccaggtggaccaccacctgttcccctccctgccccgccacaacct ggccaagacccacgccctggtggagtccttctgcaaggagtggggcgtgcagtaccacgaggccgacctggtggac ggcaccatggaggtgctgcaccacctgggctccgtggccggcgagtcgtggtggactcgtgcgcgacggccccgc caZgKL4GCGGAGGCCTTGGAAATATTCGCGTCACGCGAGGAGTAGGCTCTGCTGGTCGGC CCTGGATACGCTGACTCTTCAAGCAGTGGGGCACCACACCCACCTTTTGCCAAGGGCAAG GAGTCGGAAGGGGGCGGGGCTGCCATGCACCCCTGACGGGCATGGCCGTTCCGCGAGGG CGCCAACTGCGGCGGCCTGCCCGCTGGCTCGTGCCCCCCTACCCCCACCATTGCCTGGAGC GTTTCCATCCCCAAATCACATTCCATCCAAGTTGTATCACTATGCCCCTTTGGCTCTATACA CTCACGGCCTGAGGTCCCTTCTCGGCCGTGGCGGCACACGCCCAACCCCCCACCATACTCT TTCCATACACTGCAATGCTTCGAGCCTGCCTGCCACCTGCTCTGCTTGTCTCCCCTCCCTTC CCTTGAGGTTTTCCAATGCAGTAAGAGAAGTCGACGTGCATGGACAGATGATTGAGAGAT GAGtctagalggacatcatgggtctccagggctctaggcccttcccctcgctgcaagtaaacagttgcaggtcgcataag tcccctggcatgcctctgctcatgcacttcaggtcagcaataatgataccgcatggcttggttatattcctttcttaatactgtac gacatgcagctggaggtggcaacatgagcgatgaactgcacgatggacaagccggccctatggcgggagatgaagatt gggttcggaccacatccctctaccctcctggtacggaagggggcccaacgtcccttgatacggtcgattgatagctttgagataatgctacttcatgagaacgagatcgccagtggtgccgtgccttctcccacggcgggacccctgcgacactcttctgac ctccgagcgatgagcgactggacactatgcgacagtgccaaggacccttggtatagcagaccatgtatgcatggcatgac ttcatggaacagggccctgtccgagtgtgacctctgggcgataggggatacgacgaagattagggttttcctgatgcgtga cttggttctcgcgccactgtcaatggcagacatcgcaccacgccgtggagctatttatggtaactttgagtccactcgaggg ctccatgctgcattctgcccttcggtacctcgggacattctcagagtctcgcgtttggctcccggagatcaaccacagaaaa ggaaagatcgaacacaagatcacggatcccgggtgtcattgtgttgtcaacctagggtctctgcgccaacctagggtaaa ggctgtcacaccctggaagcgctttatttcaccccgggttcactgtcacatctcaacattattcggtgtccactcgggcaccc ggagtcgccggttacaactcccagcagcatctaatctcccaagccctagacctacagcaccggccgcacaggacgagcg ccgttgccccagccctccacaaa^TGfccgccgccgccgccgagaccgacgZgfcccZgcgccgccgcfccaacfcc ctgaacggcaaccacaccaacggcgtggccatcgacggcaccctggacaacaacaaccgccgcgtgggcgacac caacacccacatggacatctccgccaagaagaccgacaacggctacgccaacggcgtgggcggcggcggctggc gctccaaggcctccttcaccacctggaccgcccgcgacatcgtgtacgtggtgcgctaccactggatcccctgcatgttc gccgccggcctgctgttcttcatgggcgtggagtacaccctgcagatgatccccgcccgctccgagcccttcgacctgg gcttcgtggtgacccgctccctgaaccgcgtgctggcctcctcccccgacctgaacaccgtgctggccgccctgaacac cgtgttcgtgggcatgcagaccacctacatcgtgtggacctggctggtggagggccgcgcccgcgccaccatcgccgc cctgttcatgttcacctgccgcggcatcctgggctactccacccagctgcccctgccccaggacttcctgggctccggcgt ggacttccccgtgggcaacgtgtccttcttcctgttcttctccggccacgtggccggctccatgatcgcctccctggacatg cgccgcatgcagcgcctgcgcctggccatggtgttcgacatcctgaacgtgctgcagtccatccgcctgctgggcaccc gcggccactacaccatcgacctggccgtgggcgtgggcgccggcatcctgttcgactccctggccggcaagtacgag gagatgatgtccaagcgccacctgggcaccggcttctccctgatctccaaggactccctggtgaacTGAGC^GTTC CTAGGAACGTGGAGGAGGTGCAAGGAGGGTGATCTCACCCTGGTGTGTCTCTTCATGGAG CTCAGATCTTGAAAACTGTGAGGTGCTTATCCGATACCTGCTTCGTGCATGGCTTGTGCGA TATGTACACGCATTTGCAGATTGGTGGGAGCAGCAGATTGGTGGGAGCAGCATAGAGCTT TAGAAGGGGCTTAGGAGCGGGAATGTGAAACTCAGGCGGTTGGGCCAGATGAGAGCGCA AAGcttaagTGGATCTGGTGGCCAAATGGGGAGCTGCCACATTTCAGCACTAC ATGGATCTGTATCGCACCAAGCACGCTGCCGACGCAGGCGAGCGGTCATG GGAGAAGGGACGGTGAGAAGCATTTACTTGCGAGGCGTACAAGCCGTCTT CTGCTAAATTTGCTGAGACTGAATGCCCAGATCCACATGAAGCACTCCAT CTTCCTCCTGCCCCCTTCCACCCACTCCCTCAGGTGTCATGCTGACTGGTG GGTATGACCTCTCGTCGGTACCCCTCCCAGAGGAGAAGCCTTTCTGGGCCGACATCTTGCTTGCCTTCAGACGGCTGGAAAGCAGTGAGCTGGCCGCCTT CGATCCAAGCGGTACATCCGTCGATGGCTACGGATTCACCACAATTGTGACGTGAGGCGGCCAATTATGGGAAAGGAAGCTCCACTTCAAGCGGCATGCC CTTGCAAGCTGAGGGGGAGTGCAGACCTCCTCATGCCTTGAATTTGCAGG GAGGCCAGCGACTCTGCCCCTTTCCACCGAGCAGGGAGGGGCGACTTTAC CTGGTCTGGTTGATGAAGCAGATTGAGCAGCTGGGCGGCAGGCACGAGCG CCGTCATGTCAGCAGCTTGGATGAGCTGGCCGATTACGATGCCGTGGTCA ACTGCACAGGTGCGCACGTGGTCGGGTTGCATGAGCCAGCACGGGGGGC GCAGCCCTCCCCTGCTCCCGGGACAGGCACGCCGACGCCGTTTTGCATCA TCAGCCGAGAGCCTCTGTGAGGCAGGCCCACATTCCTCACCCCATCgatatc (SEQ ID NO: 5)[000193] Relevant restriction sites in the construct are indicated in lowercase, bold, and are from 5’ to 3’ EcoRV, Spel, Notl, Xbal, Aflll, EcoRV, respectively. EcoRV restriction endonuclease site used to generate linear DNA delimits the 5’ and 3’ ends of the transforming DNA. Underlined, uppercase sequences represent genomic DNA from PB5 that permit targeted integration of the transforming DNA at the DAO1 locus via homologous recombination. Proceeding from 5’ to 3’, the selection cassette contains the C. reinhardtii beta tubulin 2 (CrTUB2) promoter in lowercase, boxed text, driving expression of Saccharomyces cerevisiae SUC2 gene (ScSUC2), codon- optimized for expression in A. protothecoides and encoding sucrose invertase, thereby enabling the strain to utilize exogenous sucrose. The initiator ATG and terminator TGA for ScSUC2 are indicated in uppercase italics while the rest of the sequence is indicated in lowercase italics. The terminator region of the A. protothecoides enolase gene (ApPGH) gene is indicated in small capitals followed by A. protothecoides stearoyl ACP desaturase (ApSAD2vl) promoter, driving the expression of codon-optimized Pt- FADdelta6 desaturase indicated by the lowercase boxed text. The initiator ATG and terminator TGA for Pt-FADdelta6 are indicated in uppercase italics, while the coding region is indicated in lowercase italics. The terminator region of the A. protothecoides stearoyl ACP desaturase (ApSAD2vl terminator) gene is indicated by small capitals followed by A. protothecoides ammonium transporter 1 (ApAMTlvl) promoter (indicated as small case boxed text) driving the expression of codon-optimized At- PDCT. The initiator ATG and terminator TGA for At-PDCT are indicated in uppercase italics, while the coding region is indicated in lowercase italics. The ApPGKl l terminator region is indicated by small capitals followed by the PB5 ApDAOl genomicregion indicated by the underlined uppercase text. The final construct was sequenced to ensure correct reading frames and targeting sequences. pPB0436 tctagalgacggctcgcttgtttgccgacgcccttgccgctcggatgggaaccatgactctccccctcgccaaggtcatccc cattttggtggctgtggctgacgaggcgttctttcccggctcccaggcctcggcccacttgtcagagctggcggttgtgaag gagctggcagccatggtgtatgcgagcgggccgccccaggactgataatcctggaactgaacttggagacagtgctgcc aaatacaacagggctctctggcaaacgatgagtgcgctgcaatactccttcacccgaacttagatgtactggactatgactct acacgtgggcacgagtcttttgtaggcagaaaatttggagactcccaccacgtccgggggtccatgtagtcgtgcaagtgg tgggctagggttgtgcccctcgagttcttttgcgacgctgtttgcctctggtcatcttgctgataccgatcataagtgtatggag tcatgtggcggcgattcaggggccctttccctgccatctgttccaatttcgtaaaattcccagtcgtccgcacaggtgtggcc gccgtcgtaccgagtcatggcaccagcttccggccgacgaggagcggggtggctgcaaagccctagcgactgcgcga attgaggtgtcagggtcgaagcagcaggtggggggccttccgagcactctggagctgtggcgaccgaggccacatgag aatgccatggaggaaagtgggaccaagcccatcggcccggtgacctagggcaacacttttggacaacttgcgccatcca agtggatccattgcattgttcctggatttaacactctgccatcggcattaacggaggctggacgcaccttggggcgcacatc atcgccggtcggctcaaccctaggtgcgcgcacaaaccccggcgcaacaccggcctcgcggtgttcgcgctgcgcatg gccggtattgcctcttcagccgcaatgtgtccgatttttgtcgccatgaacgccaccatcggctccgtctcatcctaaaccatc tcgttttgtgcaaccctagctgtgccgcgaatccaatctcctgtctcacttgccgtgtccgttggaaccattcgcgccggtctc cagcctgcgcgttgcgccaattcttccaccaccatttcaaatgcatcattccttcacattgccgtgtctccatgagctggacgt acgagttttggagtcccaccggtccccccggccctgccgccatcgcagttcgaaggagcacctgtcacc^ tcctccatggccggctccatcggcgtgtccgtggccgtgctgcgcttcctgctgtgcttcgtggccaccatccccgtgtcctt cgcctgccgcatcgtgccctcccgcctgggcaagcacctgtacgccgccgcctccggcgccttcctgtcctacctgtcctt cggcttctcctccaacctgcacttcctggtgcccatgaccatcggctacgcctccatggccatctaccgccccaagtgcg gcatcatcaccttcttcctgggcttcgcctacctgatcggctgccacgtgttctacatgtccggcgacgcctggaaggagg gcggcatcgactccaccggcgccctgatggtgctgaccctgaaggtgatctcctgctccatgaactacaacgacggca tgctgaaggaggagggcctgcgcgaggcccagaagaagaaccgcctgatccagatgccctccctgatcgagtacttc ggctactgcctgtgctgcggctcccacttcgccggccccgtgtacgagatgaaggactacctggagtggaccgagggc aagggcatctgggacaccaccgagaagcgcaagaagccctccccctacggcgccaccatccgcgccatcctgcag gccgccatctgcatggccctgtacctgtacctggtgccccagtaccccctgacccgcttcaccgagcccgtgtaccagg agtggggcttcctgcgcaagttctcctaccagtacatggccggcttcaccgcccgctggaagtactacttcatctggtcca tctccgaggcctccatcatcatctccggcctgggcttctccggctggaccgacgacgcctcccccaagcccaagtggga ccgcgccaagaacgtggacatcctgggcgtggagctggccaagtccgccgtgcagatccccctggtgtggaacatccaggtgtccacctggctgcgccactacgtgtacgagcgcctggtgcagaacggcaagaaggccggcttcttccagctgc tggccacccagaccgtgtccgccgtgtggcacggcctgtaccccggctacatgatgttcttcgtgcagtccgccctgatg atcgccggctcccgcgtgatctaccgctggcagcaggccatctcccccaagatggccatgctgcgcaacatcatggtgt tcatcaacttcctgtacaccgtgctggtgctgaactactccgccgtgggcttcatggtgctgtccctgcacgagaccctga ccgcctacggctccgtgtactacatcggcaccatcatccccgtgggcctgatcctgctgtcctacgtggtgcccgccaag ccctcccgccccaagccccgcaaggaggagTGAGTCCTGGCGACCCTGCTCCCCTGACCCCTGTTCCCCT GCGCTGCTTCTCCCCGGTGACATCCGACCTGCTGCAAAATTCCCGTTCCTGCACAACACTTGCCTGAC CGAGGGTCGGGTCGCGAAGTAAAAGCCACAATCAACACCCCAGGCACATTAAGAGTGCACAGCATG ACGCAGCATAGGGTTTGTGTCGGAGGAAGGGGGTCGAGTCGCGTTGGCGAGGGGGTGGTCACGATG ACCACATCTGCGGGATAATTGAATCCTCAGGGGAAAATACCAGTCTCTGCTTCCAGGTGCTCCGCtta ag (SEQ ID NO: 6)[000194] pPB0436 has the same vector backbone, selectable marker cassette, andPtFADdelta6 desaturase cassette as pPB0435, differing only in the Lands cycle enzyme being tested and the promoter and 3’UTR being used to drive its expression. Relevant restriction sites in the construct are also the same as in pPB0435. In pPB0436, we tested the function of the At-LPCATl gene driven by A. protothecoides ammonium transporter 2 (ApAMT2vl) promoter and A. protothecoides heat shock protein 90 (ApHSP90 terminator) as the terminator sequence. The sequence of the ApAMT2vl- At-LPCATl-ApHSP90 cassette contained in pPB436 is provided in SEQ ID NO: 6. A. protothecoides ammonium transporter 2 (ApAMT2vl) promoter is indicated in small case boxed text and drives the expression of codon-optimized At-LPCATl gene. The initiator ATG and terminator TGA for At-LPCATl are indicated in uppercase italics, while the coding region is indicated in lowercase italics. The terminator region of the ApHSP90 is indicated by small capitals. Xbal and Aflll restriction sites, at the beginning and end of the cassette, are depicted in lowercase bold. pPB0437 tctaga|ggacatcatgggtctccagggctctaggcccttccccttcgctgcaagtaaacagttgcaggtcgcataagtccc ctggcatgcctctgctcatgcacttcaggtcagcaataatgataccgcatggcttggttatattcctttcttaatactgtacgaca tgcagctggaggtggcaacatgagcgatgaactgcacgatggacaagccggccctatggcgggagatgaagattgggtt cggaccacatccctctaccctcctggtacggaagggggcccaacgtcccttgatacggtcgattgatagctttgagataatg ctacttcatgagaacgagatcgccagtggttgccgtgccttctcccacggcgggacccctgcgacactcttctgacctccg agcgatgagcgactggacactatgcgacagtgccaaggacccttggtatagcagaccatgtatgcatggcatgacttcatg gaacagggccctgtccgagtgtgacctctgggcgataggggatacgacgaagattagggttttcctgatgcgtgacttggttctcgcgccactgtcaatggcagacatcgcaccacgccgtggagctatttatggtaactttgagtccactcgagggctccat gctgcatctgcccttcggtacgtcgggacatttctcagagaatcgcgtttggctcccggagatcaaccacagaaaaggaa agatcgaacacaagatcacggatcccgggtgtcatttgtgttgtcaacctagggtctctgcgccaacctagggtaaaggct gtcacaccctggaagcgctttatttcaccccgggttcactgtcacatctcaacattattcggtgtccactcgggcacccgga gtcgccggtacaactcccagcagcatctaatctcccaagccctagacctacagcaccggccgcacaggacgagcgccg ttgccccagccctccacaaa^TGfccgccgccgccgccgagaccgacgZgfcccZgcgccgccgcfccaacfcccZg aacggcaaccacaccaacggcgtggccatcgacggcaccctggacaacaacaaccgccgcgtgggcgacaccaa cacccacatggacatctccgccaagaagaccgacaacggctacgccaacggcgtgggcggcggcggctggcgctc caaggcctccttcaccacctggaccgcccgcgacatcgtgtacgtggtgcgctaccactggatcccctgcatgttcgcc gccggcctgctgttcttcatgggcgtggagtacaccctgcagatgatccccgcccgctccgagcccttcgacctgggctt cgtggtgacccgctccctgaaccgcgtgctggcctcctcccccgacctgaacaccgtgctggccgccctgaacaccgt gttcgtgggcatgcagaccacctacatcgtgtggacctggctggtggagggccgcgcccgcgccaccatcgccgccct gttcatgttcacctgccgcggcatcctgggctactccacccagctgcccctgccccaggacttcctgggctccggcgtgg acttccccgtgggcaacgtgtccttcttcctgttcttctccggccacgtggccggctccatgatcgcctccctggacatgcg ccgcatgcagcgcctgcgcctggccatggtgttcgacatcctgaacgtgctgcagtccatccgcctgctgggcacccgc ggccactacaccatcgacctggccgtgggcgtgggcgccggcatcctgttcgactccctggccggcaagtacgagga gatgatgtccaagcgccacctgggcaccggcttctccctgatctccaaggactccctggtgaacTGAGC'YGTYCC'Y AGGAACGTGGAGGAGGTGCAAGGAGGGTGATCTCACCCTGGTGTGTCTCTTCATGGAGCTCAGATCT TGAAAACTGTGAGGTGCTTATCCGATACCTGCTTCGTGCATGGCTTGTGCGATATGTACACGCATTTG CAGATTGGTGGGAGCAGCAGATTGGTGGGAGCAGCATAGAGCTTTAGAAGGGGCTTAGGAGCGGGA ATGTGAAACTCAGGCGGTTGGGCCAGATGAGAGCGCAAAGgtttaaaCgaCggCtCgCttgttgCCgaCgC ccttgccgctcggatgggaaccatgactctccccctcgccaaggtcatccccattttggtggctgtggctgacgaggcgttc tttcccggctcccaggcctcggcccactgtcagagctggcggttgtgaaggagctggcagccatggtgtatgcgagcgg gccgccccaggactgataatcctggaactgaacttggagacagtgctgccaaatacaacagggctctctggcaaacgatg agtgcgctgcaatactcctcacccgaacttagatgtactggactatgactctacacgtgggcacgagtcttttgtaggcaga aaattggagactcccaccacgtccgggggtccatgtagtcgtgcaagtggtgggctagggttgtgcccctcgagttctttt gcgacgctgttgcctctggtcatcttgctgataccgatcataagtgtatggagtcatgtggcggcgattcaggggcccttc cctgccatctgttccaatttcgtaaaattcccagtcgtccgcacaggtgtggccgccgtcgtaccgagtcatggcaccagctt ccggccgacgaggagcggggtggctgcaaagccctagcgactgcgcgaattgaggtgtcagggtcgaagcagcaggt ggggggccttccgagcactctggagctgtggcgaccgaggccacatgagaatgccatggaggaaagtgggaccaagc ccatcggcccggtgacctagggcaacacttttggacaacttgcgccatccaagtggatccattgcattgttcctggatttaac actctgccatcggcattaacggaggctggacgcaccttggggcgcacatcatcgccggtcggctcaaccctaggtgcgcgcacaaaccccggcgcaacaccggcctcgcggtgttcgcgctgcgcatggccggtattgcctcttcagccgcaatgtgtc cgatttttgtcgccatgaacgccaccatcggctccgtctcatcctaaaccatctcgttttgtgcaaccctagctgtgccgcgaa tccaatctcctgtctcacttgccgtgtccgttggaaccatcgcgccggtctccagcctgcgcgttgcgccaattcttccacca ccattcaaatgcatcatccttcacattgccgtgtctccatgagctggacgtacgagtttggagtcccaccggtccccccgg ccctgccgccatcgcagttcgaaggagcacctgtcaccl^TGgacatgfccfccatggccggcfccafcggcgtgfccgt ggccgtgctgcgcttcctgctgtgcttcgtggccaccatccccgtgtccttcgcctgccgcatcgtgccctcccgcctgggc aagcacctgtacgccgccgcctccggcgccttcctgtcctacctgtccttcggcttctcctccaacctgcacttcctggtgc ccatgaccatcggctacgcctccatggccatctaccgccccaagtgcggcatcatcaccttcttcctgggcttcgcctacc tgatcggctgccacgtgttctacatgtccggcgacgcctggaaggagggcggcatcgactccaccggcgccctgatgg tgctgaccctgaaggtgatctcctgctccatgaactacaacgacggcatgctgaaggaggagggcctgcgcgaggcc cagaagaagaaccgcctgatccagatgccctccctgatcgagtacttcggctactgcctgtgctgcggctcccacttcg ccggccccgtgtacgagatgaaggactacctggagtggaccgagggcaagggcatctgggacaccaccgagaagc gcaagaagccctccccctacggcgccaccatccgcgccatcctgcaggccgccatctgcatggccctgtacctgtacc tggtgccccagtaccccctgacccgcttcaccgagcccgtgtaccaggagtggggcttcctgcgcaagttctcctacca gtacatggccggcttcaccgcccgctggaagtactacttcatctggtccatctccgaggcctccatcatcatctccggcct gggcttctccggctggaccgacgacgcctcccccaagcccaagtgggaccgcgccaagaacgtggacatcctgggc gtggagctggccaagtccgccgtgcagatccccctggtgtggaacatccaggtgtccacctggctgcgccactacgtgt acgagcgcctggtgcagaacggcaagaaggccggcttcttccagctgctggccacccagaccgtgtccgccgtgtgg cacggcctgtaccccggctacatgatgttcttcgtgcagtccgccctgatgatcgccggctcccgcgtgatctaccgctg gcagcaggccatctcccccaagatggccatgctgcgcaacatcatggtgttcatcaacttcctgtacaccgtgctggtgc tgaactactccgccgtgggcttcatggtgctgtccctgcacgagaccctgaccgcctacggctccgtgtactacatcggc accatcatccccgtgggcctgatcctgctgtcctacgtggtgcccgccaagccctcccgccccaagccccgcaaggag gag7tL4GTCCTGGCGACCCTGCTCCCCTGACCCCTGTTCCCCTGCGCTGCTTCTCCCCGGTGACATCC GACCTGCTGCAAAATTCCCGTTCCTGCACAACACTTGCCTGACCGAGGGTCGGGTCGCGAAGTAAAA GCCACAATCAACACCCCAGGCACATTAAGAGTGCACAGCATGACGCAGCATAGGGTTTGTGTCGGA GGAAGGGGGTCGAGTCGCGTTGGCGAGGGGGTGGTCACGATGACCACATCTGCGGGATAATTGAATCCTCAGGGGAAAATACCAGTCTCTGCTTCCAGGTGCTCCGCttaag (SEQ ID NO: 7)[000195] pPB0437 has the same vector backbone, selectable marker and PtFAD6 desaturase cassettes, and relevant restriction sites like pPB0435 and pPB0436 described above. However, it differs from both constructs in that we combined both At-PDCT and At-LPCATl cassettes from pPB0435 and pPB0436 into pPB0437.[000196] The sequence of Ap AMT 1- At-PDCT- ApPGKl:ApAMT2v 1- At- LPCATl -ApSAD21 cassettes contained in pPB0437 is provided above in SEQ ID NO:7. Xbal, Pmel, and Aflll restriction sites, at the beginning, middle, and end of the cassette, are depicted in lowercase bold. A. protothecoides ammonium transporter 1 (ApAMTl) promoter is indicated as small case boxed text and drives the expression of codon-optimized At-PDCT. The initiator ATG and terminator TGA for At-PDCT are indicated in uppercase italics, while the coding region is indicated with lowercase italics. The ApPGKl terminator region is indicated by small capitals followed by A. protothecoides ammonium transporter 2 (ApAMT2vl) promoter (indicated as small case boxed text) driving the expression of codon-optimized At-LPCATl. The initiator ATG and terminator TGA for At-LPCATl are indicated in uppercase italics, while the coding region is indicated in lowercase italics. The ApHSP90 terminator region is indicated by small capitals. The final construct was sequenced to ensure correct reading frames and targeting sequences.[000197] pPB0435, pPB0436, and pPB0437 were transformed into strain PES29(already expressing a single copy of Pt-FADdelta6 desaturase). Transformants were grown under standard lipid production conditions. The fatty acid profiles of lipids of PES29 transformed with plasmids pPB0435, pPB0436, or pPB0437 are shown in Table 3.Table 3. Fatty Acid Profiles[000198] Expression of a second copy of Pt-FADdelta6 desaturase along with At- PDCT, AT-LPCAT1, or a combination of both in PES29 did not significantly boost the GLA levels in the derivative transformed lines. The average GLA levels remained thesame as seen earlier when only the Lands Cycle enzymes (pPB0234, pPB0214, and pPB0222) were expressed in PES29 (Table 2 above) suggesting that the Pt-FADdelta6 levels mightnotbe the limiting factor in the conversion C18:2n6 into GLA. PES29;435- 3(0) and PES29;437-1(3) were banked as PES40 and PES41 and used as parental strains in subsequent experiments.Example 4. Other CPTs and PDCTs[000199] We used Phytophthora infestans cholinephosphotransferase CPT1 (Accession number: XM_002900684) and CPT2 (Accession number: XM_002997893) and At-PDCT (Accession No: NP_566527 described above) as baits in a homology search and identified 3 CPT / DAG-CPT / ethanolamine phosphotransferase (EPT) candidates (PB75 005318-T1, PB75 006534-T1, and PB75 009271-T1) and a PDCT look-alike (PB75 012102-T1) from our in-house proprietary PB75 (Oblongichytrium sp.) genome. Pi-CPTl has been reported to be involved in LC-PUFA biosynthesis (Chen et al., 2013). Using either Pi-CPTl or Pi-CPT2 as baits resulted in the same 3 hits from the PB75 genome even though Pi-CPTl and Pi-CPT2 are quite divergent from each other in their protein sequences.[000200] FIG. 1 and 2 show the alignment between Pi-CPTl, Pi-CPT2, and the 3 hits from the PB75 genome and the % identity. FIG. 3 and 4 show the alignment and % identity of At-PDCT and the PDCT look-alike from PB75.[000201] A blast search on the CPT / DAG-CPTZEPT candidate proteins from PB75 identified them as having homology to Choline / ethanolamine phosphotransferase (for PB75 006534-T1 and PB75 009271-T1) and diacylglycerol cholinephosphotransferase (DAG-CPT for PB75 005318-T1) proteins. We named PB75 006534-T1, PB75 009271-T1, and PB75 005318-T1 as PB75-CPT1, PB75- CPT2, and PB75 DAG-CPT respectively, and tested their functionality in PES40.[000202] A blast search on PDCT look-alike candidate protein from PB75 identified it as having homology to Sphingomyelin synthases (also known as phosphatidylcholine:ceramide cholinephosphotransferases).[000203] Sphingomyelin synthase like CPT / DAG-CPT / EPT is a bidirectional lipid cholinephosphotransferase capable of converting phosphatidylcholine (PC) and ceramide to diacylglycerol (DAG) and sphingomyelin (SM) and vice versa. We named our PDCT-like protein from PB75 as PB75-PDCT (PB75 012102-T1)Example 5. Modification of PES40 for the Production of GLA in Auxenochlorella protothecoides[000204] PB75-CPT1, PB75-CPT2, PB75-DAG-CPT, and PB75-PDCT-like genes were codon optimized and synthesized to reflect the A. protothecoides codon usage. pPB0408, pPB0409, pPB0410, and pPB0411 harboring PB75-DAG-CPT, PB75-CPT1, PB75-CPT2, and PB75-PDCT genes can be written as: PPB0408 (ApDAO 1 : : ApHUP 1 -AtTHIC-ApHSP90:ApSAD2vl-PB75-DAG-CPT-ApSAD2vlUTR::ApDA01), pPB0409 (ApDAOl::ApHUPl-AtTHIC- ApHSP90:ApSAD2vl-PB75-CPT-l-ApSAD2vlUTR::ApDAOl), pPB0410(ApDAOl ::ApHUPl-AtTHIC-ApHSP90:ApSAD2vl-PB75-CPT-2-Ap SAD2vlUTR:: ApDAO 1), and pPB0411 (ApDAOl ::ApHUPl-AtTHIC-ApHSP90:ApSAD2vl-PB75-PDCT-ApSAD2vlUTR::ApDAOl).[000205] The sequences of pPB0435, pPB0436, and pPB0437 are shown below: pPB0408 gatatcCAAGGTCGCTAGGACAGGACCAGACTCGAGAATCAGTTTTCCGCAG AAATTGAAGCTTTACGTTGAGTGCTCAAGCTCTTCGGTTGCAAAATTGTGC TCGATGGAAGGCGGGACAAAATGCGCAATTACATGCAGGTGAAAGTTCA ATACGACGATCTGGGAGTGTGAGTGGGTCCACAATGCTCCCGAGTAGCAC ATGCAATTTTTAGCTCTTCACCTCCCCGTCAATTCTGTTTTCTTCCGCTTTT TCCAAATGGGATGCTGTTGGCAGTGAGAACAGCGTTATTGATGTTCGGTTT ATGGATCTTATTATCTGACACTGCTGTGCGTGCACTGCTGTATTGCAGCCA CCTGCGGCATTTGCATGCAGAATTCGATCAAACATTTCTTTCTATCGGGCC AGTAGAGAATGGTGGACCATTGCAAGCTTGGAATCTACAGCGCTCATCCT GGCCAAGCAGGTTTCTGTCTCGGCATCAGGCATCGAGCGCGGGTCGCCGA CAAGGGCCTCCGGAACCGGTCGAGATCAGGGCGTAATCAGGCAAAGCCA AACAACCCAACAGCTTGTATTTGTTGATTGGTTCTGTAGTCGGGAGGTTGC CCTTAGCTCGAGCCGCGGACCTCGCAATGGACCAGAGCACCCGGCGACGT GTCAGGCACTTGACGGAACTCCTCTCACCCGCATCTCATCCCCTGGGGTTC GATGAACCGGTGAGAGCCGTCAAGTGTTCATCCCGGCGAAGCTCCCGAGT CTGCGTGCTGGGAGCTGGCGTGGTGGGGCTGACCACGGCCCTCAGACTCC TCGAGCGATTCCactagtfccccgctttttaattgagcccctttcgtcgctgaatcagcgaaagcaccgcgaaaca atgcctgtcccgtccatgcatctcaacagcctcatgcaaggtttgcacaagcaagaccattctgatctgggaacttgtaggtgttgtatgggggaggttgtgctcttgaatcaagtggtatcacgtttccggaacaccccgaaacgtgcatgggctatgcgatg agagcatttcccaccgcgattgtctcacgcgcatttcggagaaggtttgcagaacactccaggacatgaaatgccttgtcac gtatgaaccatctcccacggccttgaaaagatcgctcgacttccattctagatggtgcaaaaccctacgactcaagaaggtg ccaccgactcaggcattgggcacggcgggcagggagaagagaggagttgatcaaaactgctcgatcacgttcccccatg gcgatccgagcagcacatgatgcatcgaggtggcgccgttgcaaaggagttgcgcatgggtcgaagcagggagaagg aaacggcgaggcgtgccgcgggggtgaattcagagtcaaatctgcgcctgccccggcgctcctgacggggattaaccc ccacgactgtatccatcgacactcgtctcgggggaataaaagcggcgacccagctccagaggcgcaatccttctcacaat ctgtttaactttcaacaaagtataagtcaattcaacttgacaca^4ZGgccgcgfccgfccacZgcacccZgaZgfccgZggZ ctgcaacaacaagaaccactccgcccgccccaagctgcccaactcctccctgctgcccggcttcgacgtggtggtcca ggccgcggccacccgcttcaagaaggagacgacgaccacccgcgccacgctgacgttcgacccccccacgaccaa ctccgagcgcgccaagcagcgcaagcacaccatcgacccctcctcccccgacttccagcccatcccctccttcgagg agtgcttccccaagtccacgaaggagcacaaggaggtggtgcacgaggagtccggccacgtcctgaaggtgcccttc cgccgcgtgcacctgtccggcggcgagcccgccttcgacaactacgacacgtccggcccccagaacgtcaacgccc acatcggcctggcgaagctgcgcaaggagtggatcgaccgccgcgagaagctgggcacgccccgctacacgcaga tgtactacgcgaagcagggcatcatcacggaggagatgctgtactgcgcgacgcgcgagaagctggaccccgagtt cgtccgctccgaggtcgcgcggggccgcgccatcatcccctccaacaagaagcacctggagctggagcccatgatc gtgggccgcaagttcctggtgaaggtgaacgcgaacatcggcaactccgccgtggcctcctccatcgaggaggaggt ctacaaggtgcagtgggccaccatgtggggcgccgacaccatcatggacctgtccacgggccgccacatccacgag acgcgcgagtggatcctgcgcaactccgcggtccccgtgggcaccgtccccatctaccaggcgctggagaaggtgga cggcatcgcggagaacctgaactgggaggtgttccgcgagacgctgatcgagcaggccgagcagggcgtggacta cttcacgatccacgcgggcgtgctgctgcgctacatccccctgaccgccaagcgcctgacgggcatcgtgtcccgcgg cggctccatccacgcgaagtggtgcctggcctaccacaaggagaacttcgcctacgagcactgggacgacatcctgg acatctgcaaccagtacgacgtcgccctgtccatcggcgacggcctgcgccccggctccatctacgacgccaacgac acggcccagtcgccgagctgctgacccagggcgagctgacgcgccgcgcgtgggagaaggacgtgcaggtgatg aacgagggccccggccacgtgcccatgcacaagatccccgagaacatgcagaagcagctggagtggtgcaacga ggcgcccttctacaccctgggccccctgacgaccgacatcgcgcccggctacgaccacatcacctccgccatcggcg cggccaacatcggcgccctgggcaccgccctgctgtgctacgtgacgcccaaggagcacctgggcctgcccaaccg cgacgacgtgaaggcgggcgtcatcgcctacaagatcgccgcccacgcggccgacctggccaagcagcaccccca cgcccaggcgtgggacgacgcgctgtccaaggcgcgcttcgagttccgctggatggaccagttcgcgctgtccctgga ccccatgacggcgatgtccttccacgacgagacgctgcccgcggacggcgcgaaggtcgcccacttctgctccatgtg cggccccaagttctgctccatgaagatcacggaggacatccgcaagtacgccgaggagaacggctacggctccgcc gaggaggccatccgccagggcatggacgccatgtccgaggagttcaacatcgccaagaagacgatctccggcgagcagcacggcgaggtcggcggcgagatctacctgcccgagtcctacgtcaaggccgcgcagaagTGAG'YCC'YGGCGACCCTGCTCCCCTGACCCCTGTTCCCCTGCGCTGCTTCTCCCCGGTGACATCCGACCTGCTGCAAA ATTCCCGTTCCTGCACAACACTTGCCTGACCGAGGGTCGGGTCGCGAAGTAAAAGCCACAATCAACA CCCCAGGCACATTAAGAGTGCACAGCATGACGCAGCATAGGGTTTGTGTCGGAGGAAGGGGGTCGA GTCGCGTTGGCGAGGGGGTGGTCACGATGACCACATCTGCGGGATAATTGAATCCTCAGGGGAAAATACCAGTCTCTGCTTCCAGGTGCTCCGcttaagcttgcagtgccccaaaaactggctaccacctaacaattctcacg cagttttatcctctgcactttgatgtcagctttttgattcgtctgcgtacattacagcgttgagtggccagcaggaaggagaccg cggtccgagacgagtctgagggcgcgctctcgcaacttggattccggatttcttaccctgcatcgacctcggcctggagtc gatcagaaattgtcattgccagattgcctggcgaggacgggtgatatactcaaggcgttgcatcgcccacaaaacacacac ttatctgcaagggagttactgcatcaggctctgctcaacagctcgtgacatcgatcgttcagctccccagcaggtgcgtgtc cgcatggagcacccctcccgagacacctgcgtgggtgtcggaggagctcacatgccagggaggtgcccacattgcacc acgcgaccgcgaaataggcagacttcgggcatcctgtcatcgcatgtccgctggccgggaatcatggcctccccaccag gcgtcacgcgctgcccacctccctccccttgctgcgcagggcaccgcgttcctgtggagagccgaccaq47'Gggcg / g tccaagcagttccgcaaggccgtgctgggctacaagtactcctcccccaacctgtccctgctggagtccctgttcctgaa ccagtggtgggagttcgtgaccacctggtaccccaagtggctggcccccaacctgatcaccctgtccggcttcgcctgc atcctgatggcctccgccatctcctggtccctgtcccccgacggccgcggcaccctgccccaggagtactacgccgtga tcggcttcctgaccttctcctaccagaccctggacggctccgacggcaagcaggcccgccgcaccaagtccggctccg ccctgggcgagctgatggaccacggcgtggacgccctgaccacctccatctgcctgctgttcgtgctggactgcctggg cttcggcatcaactccgtgctgccctggaccctggtgttcctggcccagatcggcttctacctgtccaacctgaccctgctg cacatcggcaagcaggtgttcaacaccatcgacgtgatggaggcccagaccaccatgatctccgcctgcgtgaccac cggcttcctgggcgtggccttctggcgcaccaagatcccctacaacgactacctgcccgaggagtggcagttcaacgt gaagaccgacctgatgggcctgctggacgcctaccccggcgacgtgaacaacgactacgtggacttcaccaacggc ttcgagctgcgctacttcatcatcttcggcgccgtgttcggctgcgtgaccaacatctcctcctacctgctgaagtgcctgg ccgtgtacctggcccccaccgtgaaccagccccagcacgtgcaggacggcgccgtgggcaccggcatctccgccct gttccaccaggtgtcccagatcgccctgttcaccgtgctgcaggccatggcctggtaccagatccgcaccggcctggac ggccgctcctaccagtcccaggtgtacatggccctgctgttctgctccaccttctccttcgccgacgccatggaccgcatc ctggtgctgcgcgtggcccgcgagcagtaccccctgatcgtgcccggcaacctgttcatggcctccttcctggtggccgt gaccttcttcgacaagatcgccatcaagctgcccacctccgagtccttccccgtgcccttctactggttccccgtgatcac cgccgtgctgggccacctgttctacttcatcacccgcggcggcgccatcgccaacgccctgaacatccaccccttcaag g7gCgCgac7ggcagaagc7gaag7fcgacZGz4GCGGAGGCCTTGGAAATATTCGCGTCACGCGAGGAGT AGGCTCTGCTGGTCGGCCCTGGATACGCTGACTCTTCAAGCAGTGGGGCACCACACCCACCTTTTGC CAAGGGCAAGGAGTCGGAAGGGGGCGGGGCTGCCATGCACCCCTGACGGGCATGGCCGTTCCGCGA GGGCGCCAACTGCGGCGGCCTGCCCGCTGGCTCGTGCCCCCCTACCCCCACCATTGCCTGGAGCGTT TCCATCCCCAAATCACATTCCATCCAAGTTGTATCACTATGCCCCTTTGGCTCTATACACTCACGGCCTGAGGTCCCTTCTCGGCCGTGGCGGCACACGCCCAACCCCCCACCATACTCTTTCCATACACTGCAAT GCTTCGAGCCTGCCTGCCACCTGCTCTGCTTGTCTCCCCTCCCTTCCCTTGAGGTTTTCCAATGCAGTA AGAGAAGTCGACGTGCATGGACAGATGATTGAGAGATGAGggCgCgCcTGGATCTGGTGGCC AAATGGGGAGCTGCCACATTTCAGCACTACATGGATCTGTATCGCACCAA GCACGCTGCCGACGCAGGCGAGCGGTCATGGGAGAAGGGACGGTGAGAA GCATTTACTTGCGAGGCGTACAAGCCGTCTTCTGCTAAATTTGCTGAGACT GAATGCCCAGATCCACATGAAGCACTCCATCTTCCTCCTGCCCCCTTCCAC CCACTCCCTCAGGTGTCATGCTGACTGGTGGGTATGACCTCTCGTCGGTAC CCCTCCCAGAGGAGAAGCCTTTCTGGGCCGACATCTTGCTTGCCTTCAGAC GGCTGGAAAGCAGTGAGCTGGCCGCCTTCGATCCAAGCGGTACATCCGTC GATGGCTACGGATTCACCACAATTGTGACGTGAGGCGGCCAATTATGGGA AAGGAAGCTCCACTTCAAGCGGCATGCCCTTGCAAGCTGAGGGGGAGTGC AGACCTCCTCATGCCTTGAATTTGCAGGGAGGCCAGCGACTCTGCCCCTTT CCACCGAGCAGGGAGGGGCGACTTTACCTGGTCTGGTTGATGAAGCAGAT TGAGCAGCTGGGCGGCAGGCACGAGCGCCGTCATGTCAGCAGCTTGGATG AGCTGGCCGATTACGATGCCGTGGTCAACTGCACAGGTGCGCACGTGGTC GGGTTGCATGAGCCAGCACGGGGGGCGCAGCCCTCCCCTGCTCCCGGGAC AGGCACGCCGACGCCGTTTTGCATCATCAGCCGAGAGCCTCTGTGAGGCAGGCCCACATTCCTCACCCCATCgatatc (SEQ ID NO: 8)[000206] Relevant restriction sites in the construct are indicated in lowercase bold text and are from 5’ to 3’ EcoRV, Spel, Aflll, Asci, and EcoRV, respectively. EcoRV restriction endonuclease site used to generate linear DNA and for cloning is indicated in lowercase bold and delimits the 5’ and 3’ ends of the transforming DNA. Underlined uppercase text at the 5’ and 3’ flanks of the construct represent genomic DNA from A. protothecoides PB5 that enable targeted integration of the transforming DNA via homologous recombination at the DAO1 locus. Proceeding in the 5’ to 3’ direction, the A. protothecoides HUP1 (hexose / H+ symporter) promoter (Ap-HUPl) driving the expression of the A. thaliana thiaminC gene (At-THIC), codon-optimized for expression in A. protothecoides and encoding 4-amino-5-hydroxymethyl-2- methylpyrimidine synthase activity, thereby permitting the strain to grow in the absence of exogenous thiamine, is indicated in lowercase, boxed text. The initiator ATG and terminator TGA for At-THIC are indicated in uppercase italics, while the coding region is indicated with lowercase italics. The terminator region of the A. protothecoides heatshock protein 90 (Ap-HSP90) gene is indicated by small capitals followed by an endogenous A. protothecoides stearoyl ACP desaturase (Ap-SAD2vl) promoter indicated by the lowercase boxed text. The Initiator ATG and terminator TGA codons of the PB75 DAG-CPT (PB75 005318-T1) are indicated in uppercase italics, while the remainder of the gene is indicated in lowercase italics. The endogenous A. protothecoides stearoyl ACP desaturase terminator region Ap-SAD2vl is indicated in small capitals followed by A. protothecoides DAO1 genomic region indicated by the underlined uppercase text. The final construct was sequenced to ensure correct reading frames and targeting sequences.[000207] pPB0409 (SEQ ID NO: 9), pPB0410 (SEQ ID NO: 10), and pPB0411(SEQ ID NO: 11) have the same vector backbone; selectable marker, promoters, and 3’ untranslated region (UTR) as pPB0408 (SEQ ID NO: 8), differing only in the respective PB75 genes. Relevant restriction sites in these constructs are also the same as in pPB0408. SEQ ID NO: 9, SEQ ID NO: 10, and SEQ ID NO: 11 indicate the sequence of PB75-CPT1, PB75-CPT2, and PB75-PDCT sequences in lowercase with the initiator ATG and terminator TGA codons in uppercase italics. pPB0409ATGaccaagcagaacgacaagaacaccaagcgcaagtccaagtacttcgcccgctacatctccgagcagggcgc ccaggccctgcccgagtaccagtactccggcgccgaccactccctgctgctgaagtacgtgaccaaccccatctacaa cctgatggccgagcgcatgcccctgtggctggcccccaacgtgatcaccctgatcggcttcgtggccaccctgtccgtg cacgtgctgatcatgctggagtcccccgacctgaagtccacccccgccgactggctgtacatctcccacgccatcgcca ccgtgttctacgtggccatggacgccatcgacggcaagcaggcccgccgcaccggctcctcctcccccctgggcctgc tgttcgaccacggctgcgactccgtgaacaccaacgtgatcgtgctgtcccagatcgccctgctgcagctgggcacctc ctggtggtccgtggccatgtggctgtcctccgtggtggtgttcttcgcctccacctgggaggagtacttcaccggcatcctg ttcctgcccatcgtgaacggccccaacgagggcaccatgaccaccgccatcatcaacgtgctgaccgtggtgcgcctg accccctccttctgggtgacccccgtgctggacgtgcccgagcccttcaacacccccctgctgggcctgaacgagacc ctggcccccaaccagatcttcgtgttcctgatgtgcgtgatcgccttcgtgaccgtgctgggctccttctacaacgtgtcct gcgccctggtggccaagcaccgctgcggcaagtcccagcactccatcatcatcgaccacctgatcgccatcacccgc ggcgtgcccgccttctgcatcttcctgttcttcttctactgggtggccaactccccctccggcgtgttccagcgctaccccat cgcctgctactggctgctggccctgctgcaggccaagtccgtgatcggcatcatggtggcccacctgtgcgacgagga gtaccaccccgtgacccgcacccacatgggcgtgctggccctgctggtgtaccacaacacccgcctgtgcctgaagcc cgagtccgtgtccaagttcgacgaggagatcctgctggccggcctgctgtgcttctccgccttcatgatcctgcacaaggccgtgtccctggtgtgggaggtgtccggcgtgctgggcatcaagcccttcaagatcgactaccccggctccgacaaga agaactccTGA (SEQ ID NO: 9) pPB0410ATGaacatcctgaagaacaccaagtacatcccccccgagggcctgaaggccctggacaactacgcctacaagtcc ggcacctactccatcctggacaacctgctgaaccccttctggatctggtgcgccaacctgctgcccctgtgggtggcccc caacctggtgaccttcaccggcaccctgtgcctgtccctgatcttcgtgtccaccctgtggtacgacccccagctgtccgc catggccccctcctgggtgtacatgatgaacggcctgtgcgtgtggctgtaccagaccctggacgccatggacggcaa gcaggcccgccgcaccggcacctcctcccccctgggccagctgttcgaccacggctgcgacgccctgggcaccatga tgctgtccgtgggcctggccggcgccacctcccagggccccggcgtgatgcccctgaccatcctggtggtgatccaggt ggccttcttcttcgcccagtgggaggagtaccacgtgcacaccatgcgcacccagttcgccaacttcggcgtgaccga gggccagtacctggagtccctggtgatggtgttcaccggcctgttcggccgcgagttctggctgttcgacctgctgaccct ggtgcccgactccatgaaggagatcatcggcacccagatcaccctgcccctggccatcgagctgcgccacgccctga tgctggccgccgccctgttccccaccatgatgatgctggcctccgtgatcggcgtgctgtcccgcaccgagaccatgtcc cagaagttcctggccgtgcagcagctggtgcccctggtgctgctggagatctccctgttcgtggtgatcgcctccgacaa ctacatccccttcaacgagaagtaccccatcgccctgctgttcgtgttcggcgtgctgttcacccacatcaccaactgcat catcatcgccaacgtgtgccgcaccaagtacgccaccctgcacaaggtgatgctgcccctgcccttcgtggtgttcgcc ctgacccaggtgcacgacgagcgcgtgctggcctgcgtgctgctgtcctacggcgtgatcgtggtggtgcagtacttcc acttcatcctggtggtgaactcccagatctgcaactacctgggcatccacaccctgcgcatcaacccctccaacaagtc cgagTGA (SEQ ID NO: 10) pPB0411ATGgccatgtgggacaccttcaaggagcgctacttctgcctgcccggccgccagaccatcttcgccatgtgcttcttca tgggctgcgtgtacttcaactccatcatgcaggtgatcgtgcagcaggccgagcccctgctgtccggcgacctgcccga cgtgggccacgacgtgctggagtccctgttccccggcaacgaggccgccggccgcaacgacatcttcaccaccgtgt ccgtggcctccgccttcatcgtgaccgtgaccaacgaccgcgaccgcgtggtgtcccgccgcgccctgttcatgaacgc catcctgttcctgatgcgcgccatctccatctacgtgacccgcgtgcccaaccccaaccaggcctgctcctcctccgtgtc cggccacttcatcctggaggccgtggtggtggccttccgcctgaagaagacctgccaggacctgatcttctccggccac acctgcgccatcgtgctggcctccctggtgttctgcacctacttccccaagtaccacctggagcgctacatgtccatgtac aaggccaacatcttctccttcgtggtgaagggcctgaacatctcctgctccgcctacgccctgctgaccatcatctccacc aagttccactacaccgtggacgtgtacatcgccgtgctgctgaccttcaccgtgtggggctactaccacgccaagctgg acaccatccgcctggtgtcctccctgcgctaccagccccgcggccagacccagcgcttcctgatgtggttcgagaacatccagcccgaggccaagtccctgaagggctgcgactcctccgagtccatctccgacgacaccgacgtgaccaccggc gactccgactccgacggcgtggaggtgcgcatcgaggccgtgtcctccaaggactccgagatctccaacggcggcgt gctggaggtgtgcTGA (SEQ ID NO: 11) [000208] pPB0408 (SEQ ID NO: 8), pPB0409 (SEQ ID NO: 9), pPB0410 (SEQID NO: 10), and pPB0411 (SEQ ID NO: 11) were transformed into PES40. Transformants with pPB0408 (SEQ ID NO: 8), pPB0409 (SEQ ID NO: 9), pPB0410 (SEQ ID NO: 10), and pPB0411 (SEQ ID NO: 11) were grown under lipid production conditions, and the fatty acid profiles from the transformants are shown in Table 4. Table 4. Fatty Acid Profiles[000209] PES40 transformants with pPB0408, pPB0409, pPB0410, or pPB0411 showed improved GLA (C18:3n6) levels compared to the parent PES40. The greatest increases were seen in PES40 transformed with pPB0409 and pPB0410 expressing PB75-CPT1 and PB75-CPT2 proteins. Lines PES40;410-3, PES40;409-2, and PES40;410-8 showed C18:3n6 levels of 18.61%, 16.95%, and 16.40% respectively compared to 13.35% seen in parent PES40 thus demonstrating between 22% to 39% increase in GLA over the parent.[000210] Derivative line PES40;410-3 was run again to confirm the lipid profile (Table 5) and banked as PES51.Table 5. Fatty Acid ProfileExample 6. Combinatorial expression of FADdelta6 Elongase and FADdelta 6 Desaturase[000211] A construct was made that expressed both P. tricornutum fatty acid delta6 elongase (Pt-FADdelta6 ELO; Accession number ABQ18315) and fatty acid delta 6 desaturase (Pt-FADdelta6 desaturase; Accession No: XP_002182901.1). These genes were codon optimized for A. protothecoides and the construct was named pPB0406 ( ApTHI4 : : Ap S AD2v 1 p-PtF AD-delta6 desaturase- Ap SAD2v 13UTR: Ap AMT2v 1 -PtFAD-delta6 ELO-ApPGH3UTR-ApPGKlp-Neo-ApPGK3UTR:ApTHI4). The sequence of pPB0406 is shown below: aascttAGCATACTCCTATTCTGACAATGTCACAGTCGGTCTGCCAGGCGATA GTGGCTTTGCTGTCAGACTCGGCCCCGGACTCTCCCCTGAACTGCGACGCC GGGAATCTGTTGAGAGGAGGCGATCTGCGAGGGTTCGCCTCCATGGCCCG CATGTACACCATCGAGTATGCCATGAAGCGATGATGTCTGTGAAAATGAT GTTCAGAATTCATTATATACTCATGTTTTTGTGTAAATGCTGTGTCGACTT AAGTTACCGAGCTGGCTGACAGAGACAATCTTCAGGTCAAATGTTGGCAC CAATGATCGCGACGATCGTTCAGGGGTTATCAAGTCAGATCTGAACGAAA ACCAGAAATCAAATTTGCCAAAGCGCATGTTTGTATGTCGAGAATTATCA TGCGGGTGACTGGCTCGCTAATTCTGGCATGGAAGGATGCCACATCGAAT TGATCCGGGGAGACTAACACTTGTCAGAATTGCAATGTGCCATATTCCAG ATATCCCAGCCGGCCCTTCTATAAACCACCTGCGGGCTCAGATACCTACG AAGAGGCTCAGATAACTCAAGGACGTGCATTCGAATTATCCCTGCCGCGC GGAAACATCAGACCAGGTGCGGATGCTGAGCGTCGAGTTGGGTGCTTGAT AGACCTTCACCTTGATCTGAGGTTCCCGTCCCCAGAGCACTCGAATCTCCG GCATCTTACAGGCAAACCGCAAACAGTAAATAATGGCGAGCACCATCACC ATGtctaga|cttgcagtgccccaaaaactggctaccacctaacaattctcacgcagttttatcctctgcactttgatgtcag ctttttgattcgtctgcgtacattacagcgttgagtggccagcaggaaggagaccgcggtccgagacgagtctgagggcg cgctctcgcaacttggattccggatttcttaccctgcatcgacctcggcctggagtcgatcagaaattgtcattgccagattgc ctggcgaggacgggtgatatactcaaggcgttgcatcgcccacaaaacacacacttatctgcaagggagttactgcatcagcctgcgtgggtgtcggaggagctcacatgccagggaggtgcccacattgcaccacgcgaccgcgaaataggcagactt cgggcatcctgtcatcgcatgtccgctggccgggaatcatggcctccccaccaggcgtcacgcgctgcccacctccctcc ccttgctgcgcagggcaccgcgttcctgtggagagccgaccac[4ZGggcaagggcggcgacgcccgcgccfccaa gggctccaccgccgcccgcaagatctcctggcaggaggtgaagacccacgcctcccccgaggacgcctggatcatc cactccaacaaggtgtacgacgtgtccaactggcacgagcaccccggcggcgccgtgatcttcacccacgccggcg acgacatgaccgacatcttcgccgccttccacgcccccggctcccagtccctgatgaagaagttctacatcggcgagct gctgcccgagaccaccggcaaggagccccagcagatcgccttcgagaagggctaccgcgacctgcgctccaagct gatcatgatgggcatgttcaagtccaacaagtggttctacgtgtacaagtgcctgtccaacatggccatctgggccgcc gcctgcgccctggtgttctactccgaccgcttctgggtgcacctggcctccgccgtgatgctgggcaccttcttccagcag tccggctggctggcccacgacttcctgcaccaccaggtgttcaccaagcgcaagcacggcgacctgggcggcctgttc tggggcaacctgatgcagggctactccgtgcagtggtggaagaacaagcacaacggccaccacgccgtgcccaac ctgcactgctcctccgccgtggcccaggacggcgaccccgacatcgacaccatgcccctgctggcctggtccgtgcag caggcccagtcctaccgcgagctgcaggccgacggcaaggactccggcctggtgaagttcatgatccgcaaccagtc ctacttctacttccccatcctgctgctggcccgcctgtcctggctgaacgagtccttcaagtgcgccttcggcctgggcgcc gcctccgagaacgccgccctggagctgaaggccaagggcctgcagtaccccctgctggagaaggccggcatcctgc tgcactacgcctggatgctgaccgtgtcctccggcttcggccgcttctccttcgcctacaccgccttctacttcctgaccgc caccgcctcctgcggcttcctgctggccatcgtgttcggcctgggccacaacggcatggccacctacaacgccgacgc ccgccccgacttctggaagctgcaggtgaccaccacccgcaacgtgaccggcggccacggcttcccccaggccttcg tggactggttctgcggcggcctgcagtaccaggtggaccaccacctgttcccctccctgccccgccacaacctggccaa gacccacgccctggtggagtccttctgcaaggagtggggcgtgcagtaccacgaggccgacctggtggacggcacc atggaggtgctgcaccacctgggctccgtggccggcgagttcgtggtggacttcgtgcgcgacggccccgccatgTG ^4GCGGAGGCCTTGGAAATATTCGCGTCACGCGAGGAGTAGGCTCTGCTGGTCGGCCCTGGATACGCT GACTCTTCAAGCAGTGGGGCACCACACCCACCTTTTGCCAAGGGCAAGGAGTCGGAAGGGGGCGGG GCTGCCATGCACCCCTGACGGGCATGGCCGTTCCGCGAGGGCGCCAACTGCGGCGGCCTGCCCGCTG GCTCGTGCCCCCCTACCCCCACCATTGCCTGGAGCGTTTCCATCCCCAAATCACATTCCATCCAAGTT GTATCACTATGCCCCTTTGGCTCTATACACTCACGGCCTGAGGTCCCTTCTCGGCCGTGGCGGCACAC GCCCAACCCCCCACCATACTCTTTCCATACACTGCAATGCTTCGAGCCTGCCTGCCACCTGCTCTGCT TGTCTCCCCTCCCTTCCCTTGAGGTTTTCCAATGCAGTAAGAGAAGTCGACGTGCATGGACAGATGAT TGAGAGATGAGactagtlgacggctcgcttgttgccgacgcccttgccgctcggatgggaaccatgactctccccctc gccaaggtcatccccattttggtggctgtggctgacgaggcgttctttcccggctcccaggcctcggcccactgtcagagc tggcggttgtgaaggagctggcagccatggtgtatgcgagcgggccgccccaggactgataatcctggaactgaacttg gagacagtgctgccaaatacaacagggctctctggcaaacgatgagtgcgctgcaatactccttcacccgaacttagatgtgtagtcgtgcaagtggtgggctagggttgtgcccctcgagttcttttgcgacgctgttgcctctggtcatcttgctgataccg atcataagtgtatggagtcatgtggcggcgattcaggggccctttccctgccatctgttccaatttcgtaaaattcccagtcgt ccgcacaggtgtggccgccgtcgtaccgagtcatggcaccagcttccggccgacgaggagcggggtggctgcaaagc cctagcgactgcgcgaattgaggtgtcagggtcgaagcagcaggtggggggccttccgagcactctggagctgtggcg accgaggccacatgagaatgccatggaggaaagtgggaccaagcccatcggcccggtgacctagggcaacacttttgg acaacttgcgccatccaagtggatccattgcattgttcctggatttaacactctgccatcggcattaacggaggctggacgca ccttggggcgcacatcatcgccggtcggctcaaccctaggtgcgcgcacaaaccccggcgcaacaccggcctcgcggt gttcgcgctgcgcatggccggtattgcctcttcagccgcaatgtgtccgattttgtcgccatgaacgccaccatcggctccg tctcatcctaaaccatctcgttttgtgcaaccctagctgtgccgcgaatccaatctcctgtctcacttgccgtgtccgttggaac cattcgcgccggtctccagcctgcgcgttgcgccaattcttccaccaccatttcaaatgcatcattccttcacattgccgtgtct ccatgagctggacgtacgagtttggagtcccaccggtccccccggccctgccgccatcgcagttcgaaggagcacctgt caco / lTGatggtgccctcctcctacgacgagtacgtggtgatggtgaacgacctgggcgactccatcctgtcctgggc cgaccccgaccactaccgcggccacaccgagggctgggagttcaccgacttctcccccgccttctccatcgccgtggc ctacctgctgttcgtgttcgtgggctccctgatcatgtccatgggcgtgcccgccatcgacccctaccccctgaagttcgtg tacaacgtgtcccagatcatgctgtgcgcctacatgaccatcgaggcctccctgctggcctaccgcaacggctacacctt ctggccctgcaacgactgggacttcgagaagccccccatcgccaagctgctgtggctgttctacgtgtccaagatctgg gacttctgggacaccatcttcatcgtgctgggcaagaagtggcgccagctgtccttcctgcacgtgtaccaccacacca ccatcttcctgttctactggctgaacgcccacgtgaacttcgacggcgacatcttcctgaccatcgtgctgaacggcttcat ccacaccgtgatgtacacctactacttcatctgcatgcacaccaaggtgcccgagaccggcaagtccctgcccatctgg tggaagtcctccctgacctccatgcagctggtgcagttcatcaccatgatgacccaggccatcatgatcctgtacaagg gctgcgccgccccccactcccgcgtggtgacctcctacctggtgtacatcctgtccctgttcatcctgttcgcccagttcttc gtgtcctcctacctgaagcccaagaagaagaagaccgccTGATTGATTGGAACTCACAAAGCGGCCCACGGCTTCGAACGTCCCGTGTCAATTGCGCGGGGTGTGCCAGAGTTTCTGCGCCACCGATGCTCACCCTAGGGGGGGATGCCCTTTGACATTCATGTGTGCCTGCATGCACGTTTGTATCAGTCTCACCACACCTTGAAGATTTTTGGGAGGGGGGGGGAAGTCGGAATGGAAACgCtagc|ccttCCtgtCCCacaatgCttggtgaatgCa gtgggttgatcaccgcggaggagctgtggcttactcgttctgatcaagggagcctctgcaccttaaccctgccaggatcga aaccaacctgtcagtcccgtggtgggcaacatcatcctcgtgaagctgattgaccaggaaaacatgatgagtcggtatga ggacgagcatgagtggcccaacatcgatatgacacatctggagtttacggcaaatgtatcacacttccatcctggcttgca ccacaatattagtggacccctccttgcagtggcacggtgagaagctagttgtagtaatcttcttaattgacgaaccagacgt gtgtaatggcctcctttgagtgatggaaggatggaacctaccccccccctccccagtactctgcggtacatccgagtaaccc ttccattgatcagcccaaacgcaatatgcaacgactctacatacggccaccgagtgcttatccttcgctatcaccgcacaaaaatcccatccgcgaactcatccgaggtgatagattgcgatcggggttattcgggttaaggtgcgactagggatccctgaatc ttttggggatttccccgggtctcgtcctgcatgcttatcatcagtctcgtgggtatttggatcgctgcgcatgccataacagag cgctcataatatttgctgcggcggtggtgctggcaaaatcccctgcgtaccgggcgcctgtcaagccaaccccgccgtgc ggcactcccctgcagatccatcacc^ZGafcgagcaggacggccfccacgccggcfcccccgccgccZgggZggag cgcctgttcggctacgactgggcccagcagaccatcggctgctccgacgccgccgtgttccgcctgtccgcccagggc cgccccgtgctgttcgtgaagaccgacctgtccggcgccctgaacgagctgcaggacgaggccgcccgcctgtcctg gclggccaccaccggcglgccclgcgccgccglgclggacglgglgaccgaggccggccgcgaclggclgclgclgg gcgaggtgcccggccaggacctgctgtcctcccacctggcccccgccgagaaggtgtccatcatggccgacgccatg cgccgcctgcacaccctggaccccgccacctgccccttcgaccaccaggccaagcaccgcatcgagcgcgcccgca cccgcatggaggccggcctggtggaccaggacgacctggacgaggagcaccagggcctggcccccgccgagctgt tcgcccgcctgaaggcccgcatgcccgacggcgaggacctggtggtgacccacggcgacgcctgcctgcccaacat catggtggagaacggccgcttctccggcttcatcgactgcggccgcctgggcgtggccgaccgctaccaggacatcgc cctggccacccgcgacatcgccgaggagctgggcggcgagtgggccgaccgcttcctggtgctgtacggcatcgccg cccccgactcccagcgcatcgccttctaccgcctgctggacgagttcttcTGAGCTGUCCTAGGAACGTGGAGG AGGTGCAAGGAGGGTGATCTCACCCTGGTGTGTCTCTTCATGGAGCTCAGATCTTGAAAACTGTGAG GTGCTTATCCGATACCTGCTTCGTGCATGGCTTGTGCGATATGTACACGCATTTGCAGATTGGTGGGA GCAGCAGATTGGTGGGAGCAGCATAGAGCTTTAGAAGGGGCTTAGGAGCGGGAATGTGAAACTCAG GCGGiTGGGCCAGATGAGAGCGCAAAGtacgtaCAACGCTACGCAACTCCCTTCGATGG CTTCAAGTACGGAGATGTGGGCATCCAGGATTCGCATGTGCTGCTTCAGC CCTCCTCATGCCACTAGCACTCATTTTTCGACTCCCGGATTGCCAGGTTCA AGGGCATCAAGGAGTCGGAGATCAGCCGCGCCATGACCTCCCGCTACTTC GAGGACCTAAACGTCAATGCCGAGGTGCTTTTGCATATATTTACAGCTAA TTATGATGGGTGTGGTGCGCGATATGCTTGCAAGGTCTCCGGTGAGCTAA TGATCGGCACATCCCTTCCGCGCATCCGCAGGTCGATGTCGTCATTGTTGG GGCTGGGTCTGCGGGCCTCTCGTGCGCCTATGAGCTGAGCAAGCACCCGG ATGTCAAGGTATGGGCTGAGCAGGGCACATCCTCAGATGATGTTGCTGTA ATTGCAATTGAAACTTGCGGTTGTTCCCAGCACAGCCTCAATCAATCATGT GTGCTGCGTTGGAAACGCTATGATACCCCAGCCTTCAACATGGGGCAGGG ATATCGTTTACACCTGCTTGAACCCCCCGCAACAGGTGGCCATCATCGAG CAGGGCGTCGCCCCTGGGGGTGGAGCGTGGCTGGGGGGTCAGCTCTTCTC GGCTATGTGTGTGAGTCTAGGCACGGGGACGGGTGGACTGAAGCAAGGG TTGGGCGCAGGGTGTTGATATCCATGTGTTGGACATTCTCGTTGGGAAAACAAGATGTGTGTATTTAGTGCTATCTCGGTGGCTGCATTCCaagctt (SEQ ID NO: 12)[000212] Relevant restriction sites in the construct are indicated in lowercase bold text and are from 5’ to 3’ Hindlll, Xbal, Spel, Bmtl, SnaBI, and Hindlll, respectively. Hindlll restriction endonuclease site used to generate linear DNA is indicated in lowercase bold and delimits the 5’ and 3’ ends of the transforming DNA. Underlined uppercase text at the 5’ and 3’ flanks of the construct represent genomic DNA from A. protothecoides that enable targeted integration of the transforming DNA via homologous recombination at the Thi4 locus within the genome. Proceeding in the 5’ to 3’ direction, the A. protothecoides stearoyl ACP desaturase (ApSAD2vl) promoter, driving the expression of codon-optimized Pt-FADdelta6 desaturase, is indicated by the lowercase boxed text. The initiator ATG and terminator TGA for Pt-FADdelta6 are indicated in uppercase italics, while the coding region is indicated in lowercase italics. The terminator region of the A protothecoides stearoyl ACP desaturase (ApSAD2vl terminator) gene is indicated by small capitals followed by the A. protothecoides ammonium transporter 2 (ApAMT2vl) promoter (indicated as small case boxed text) driving the expression of codon-optimized Pt-FADdelta6 ELO. The initiator ATG and terminator TGA for Pt-FAD delta6 ELO are indicated in uppercase italics, while the coding region is indicated in lowercase italics. The terminator region of the A. protothecoides enolase gene (ApPGH) gene indicated in small capitals followed by A. protothecoides phosphoglycerate kinase 1 (ApPGKl) promoter in lowercase, boxed text, driving expression of neomycin phosphotransferase II gene (Neo, codon- optimized for expression in A. protothecoides and encoding neomycin phosphotransferase II, thereby enabling the strain to grow on aminoglycoside antibiotic G418). The initiator ATG and terminator TGA for Neo are indicated in uppercase italics while the rest of the sequence is indicated in lowercase italics. The terminator region of the A protothecoides phosphoglycerate kinase 1 (ApPGKl terminator) is indicated by small capitals followed by A. protothecoides PB5 THI4 genomic region indicated by the underlined uppercase text. The final construct was sequenced to ensure the correct reading frames and targeting sequences.[000213] pPB0406 was transformed into A. protothecoides . Transformants were grown under lipid production conditions, and the fatty acid profiles from the transformants are shown in Table 6.Table 6. Fatty Acid Profiles[000214] Transformants expressing Pt-FADdelta6 desaturase and Pt-FADdelta6 ELO (PB5;406 lines) produced C20:3n6 (DGLA) in addition to GLA (C18:3y or C18:3n6) over the control PB5 (Table 6). The production of GLA and DGLA was concomitant with the diminution of the linoleic acid (C18:2n6), demonstrating the conversion of C18:2n6 to GLA followed by elongation of GLA to DGLA. As expected, no non-specific modulation of alpha-linolenic acid (C18:3n3) levels was observed in any derivative lines. Derivative transgenic PB5;406-2 was banked as PES38 and used as a parent strain for relevant subsequent transformations.Example 7. Other Desaturases and Elongases[000215] Having identified enzymes that could desaturate C18:2n6 to GLA and then elongate GLA to DGLA, we decided to express other known FADdelta6 desaturases and FADdelta6 ELO in A. protothecoides and identified relevant enzymes from public databases. Other FADdelta6 desaturase proteins include, for example, desaturases from Borage officinalis (Accession number: AAC49700.1), Caenorhabditis elegans (Accession number: AF031477), Mortierella alpina (Accession number: AAF08685, ADE06661, AIG59045, and CAE53093), Phaeodactylum tricomutum (Accession number: ABP49078, ADI49410, and XP_002182901) and Synechocystis sp. (Accession number: WP_010873125). While these proteins are fairly divergent overall, significant identity is observed in regions known to be responsible for FADdelta6 desaturase activity within these proteins. FIG. 5 and FIG. 6 show the alignment and % identity between these FADdelta6 desaturase proteins.[000216] Other FADdelta6 elongase proteins include, for example, elongases from Phaeodactylum tricomutum (Accession number: XP 002180428, ADI49411,ABQ18315, and AAW70157), Mortierella antarctica (KAF9982696), and Mortierella alpina (ACD31685, ADE06662, and KAF9943255). While the proteins are fairly divergent overall, significant identity is observed in regions known to be responsible for FADdelta6 elongase activity within these proteins. FIG. 7 and FIG. 8 show the alignment and % identity between these FADdelta6 elongase proteins.Example 8. Production of Fatty Acids with Desaturase and Elongase from B. Officinalis and M. Alpina[000217] Since B. officinalis and M. alpina are known to produce significant amounts of GLA and DGLA, constructs were made encoding the desaturase and elongase from these organisms. Nucleic acids encoding these desaturases and elongases were mixed and matched to prepare pPB0322, pPB0323, pPB0324, pPB0325, pPB0326, pPB0327, pPB0328, pPB0329, and pPB0330. All these constructs have the same vector backbone targeting the transforming DNA to the D-aspartate oxidase 1 (DAO1) genomic locus within the A protothecoides genome.[000218] The construct pPB0322 (ApDA01 ::CrTUB2-ScSUC2-ApPGH:vl-At- LPC AT 1 - Ap S AD2v 13UTR: Ap S AD2v 1 -Bo-F ADdelta6 Desaturase 1 -ApPGK13UTR:ApAMTlvl-Ma-deltaO6 elongase l-ApHSP903UTR::ApDAOl) has the sequence: gctagcCAAGGTCGCTAGGACAGGACCAGACTCGAGAATCAGTTTTCCGCAG AAATTGAAGCTTTACGTTGAGTGCTCAAGCTCTTCGGTTGCAAAATTGTGC TCGATGGAAGGCGGGACAAAATGCGCAATTACATGCAGGTGAAAGTTCA ATACGACGATCTGGGAGTGTGAGTGGGTCCACAATGCTCCCGAGTAGCAC ATGCAATTTTTAGCTCTTCACCTCCCCGTCAATTCTGTTTTCTTCCGCTTTT TCCAAATGGGATGCTGTTGGCAGTGAGAACAGCGTTATTGATGTTCGGTTT ATGGATCTTATTATCTGACACTGCTGTGCGTGCACTGCTGTATTGCAGCCA CCTGCGGCATTTGCATGCAGAATTCGATCAAACATTTCTTTCTATCGGGCC AGTAGAGAATGGTGGACCATTGCAAGCTTGGAATCTACAGCGCTCATCCT GGCCAAGCAGGTTTCTGTCTCGGCATCAGGCATCGAGCGCGGGTCGCCGA CAAGGGCCTCCGGAACCGGTCGAGATCAGGGCGTAATCAGGCAAAGCCA AACAACCCAACAGCTTGTATTTGTTGATTGGTTCTGTAGTCGGGAGGTTGC CCTTAGCTCGAGCCGCGGACCTCGCAATGGACCAGAGCACCCGGCGACGT GTCAGGCACTTGACGGAACTCCTCTCACCCGCATCTCATCCCCTGGGGTTCGATGAACCGGTGAGAGCCGTCAAGTGTTCATCCCGGCGAAGCTCCCGAGT CTGCGTGCTGGGAGCTGGCGTGGTGGGGCTGACCACGGCCCTCAGACTCC TCGAGCGATTCCactagt|ctttcttgcgctatgacacttccagcaaaaggtagggcgggctgcgagacggctc ccggcgctgcatgcaacaccgatgatgcttcgaccccccgaagctccttcggggctgcatgggcgctccgatgccgctcc agggcgagcgctgtttaaatagccaggcccccgattgcaaagacattatagcgagctaccaaagccatattcaaacaccta gatcactaccactctacacaggccactcgagctgtgatcgcactccgctaagggggcgcctcttcctcttcgttcagtca ca^ccc^&aacA TGclgclgcaggccllcclgllcclgclggccggcllcgccgccaagalcagcgcclccalgacg aacgagacgtccgaccgccccctggtgcacttcacccccaacaagggctggatgaacgaccccaacggcctgtggt acgacgagaaggacgccaagtggcacctgtacttccagtacaacccgaacgacaccgtctgggggacgcccttgttc tggggccacgccacgtccgacgacctgaccaactgggaggaccagcccatcgccatcgccccgaagcgcaacgac tccggcgccttctccggctccatggtggtggactacaacaacacctccggcttcttcaacgacaccatcgacccgcgcc agcgctgcgtggccatctggacctacaacaccccggagtccgaggagcagtacatctcctacagcctggacggcggc tacaccttcaccgagtaccagaagaaccccgtgctggccgccaactccacccagttccgcgacccgaaggtcttctgg tacgagccctcccagaagtggatcatgaccgcggccaagtcccaggactacaagatcgagatctactcctccgacga cctgaagtcctggaagctggagtccgcgttcgccaacgagggcttcctcggctaccagtacgagtgccccggcctgat cgaggtccccaccgagcaggaccccagcaagtcctactgggtgatgttcatctccatcaaccccggcgccccggccg gcggctccttcaaccagtacttcgtcggcagcttcaacggcacccacttcgaggccttcgacaaccagtcccgcgtggt ggacttcggcaaggactactacgccctgcagaccttcttcaacaccgacccgacctacgggagcgccctgggcatcg cgtgggcctccaactgggagtactccgccttcgtgcccaccaacccctggcgctcctccatgtccctcgtgcgcaagttc tccctcaacaccgagtaccaggccaacccggagacggagctgatcaacctgaaggccgagccgatcctgaacatca gcaacgccggcccctggagccggttcgccaccaacaccacgttgacgaaggccaacagctacaacgtcgacctgtc caacagcaccggcaccctggagttcgagctggtgtacgccgtcaacaccacccagacgatctccaagtccgtgttcgc ggacctctccctctggttcaagggcctggaggaccccgaggagtacctccgcatgggcttcgaggtgtccgcgtcctcc ttcttcctggaccgcgggaacagcaaggtgaagttcgtgaaggagaacccctacttcaccaaccgcatgagcgtgaa caaccagcccttcaagagcgagaacgacctgtcctactacaaggtgtacggcttgctggaccagaacatcctggagct gtacttcaacgacggcgacgtcgtgtccaccaacacctacttcatgaccaccgggaacgccctgggctccgtgaacat gacgacggggglggacaacclgllclacalcgacaagllccagglgcgcgagglcaagT(jA'\'\(.ti\'\'\(.t(.ti\i\C'\c ACAAAGCGGCCCACGGCTTCGAACGTCCCGTGTCAATTGCGCGGGGTGTGCCAGAGTTTCTGCGCCA CCGATGCTCACCCTAGGGGGGGATGCCCTTTGACATTCATGTGTGCCTGCATGCACGTTTGTATCAGT CTCACCACACCTTGAAGATTTTTGGGAGGGGGGGGGAAGTCGGAATGGAAACgCggCCgc|gaCggCtC gcttgtttgccgacgcccttgccgctcggatgggaaccatgactctccccctcgccaaggtcatccccatttggtggctgtg gctgacgaggcgttctttcccggctcccaggcctcggcccacttgtcagagctggcggttgtgaaggagctggcagccatggtgtatgcgagcgggccgccccaggactgataatcctggaactgaacttggagacagtgctgccaaatacaacagggc tctctggcaaacgatgagtgcgctgcaatactcctcacccgaacttagatgtactggactatgactctacacgtgggcacg agtcttttgtaggcagaaaatttggagactcccaccacgtccgggggtccatgtagtcgtgcaagtggtgggctagggttgt gcccctcgagttcttttgcgacgctgtttgcctctggtcatctgctgataccgatcataagtgtatggagtcatgtggcggcg attcaggggccctttccctgccatctgttccaatttcgtaaaattcccagtcgtccgcacaggtgtggccgccgtcgtaccga gtcatggcaccagcttccggccgacgaggagcggggtggctgcaaagccctagcgactgcgcgaattgaggtgtcagg gtcgaagcagcaggtggggggcctccgagcactctggagctgtggcgaccgaggccacatgagaatgccatggagg aaagtgggaccaagcccatcggcccggtgacctagggcaacactttggacaacttgcgccatccaagtggatccattgc attgttcctggatttaacactctgccatcggcattaacggaggctggacgcacctggggcgcacatcatcgccggtcggct caaccctaggtgcgcgcacaaaccccggcgcaacaccggcctcgcggtgttcgcgctgcgcatggccggtatgcctctt cagccgcaatgtgtccgattttgtcgccatgaacgccaccatcggctccgtctcatcctaaaccatctcgtttgtgcaaccc tagctgtgccgcgaatccaatctcctgtctcacttgccgtgtccgttggaaccattcgcgccggtctccagcctgcgcgttgc gccaattcttccaccaccatttcaaatgcatcattccttcacattgccgtgtctccatgagctggacgtacgagttttggagtcc caccggtccccccggccctgccgccatcgcagttcgaaggagcacctgtcacc^ZGffacaZfftecfccaZffffccffffcZ ccatcggcgtgtccgtggccgtgctgcgcttcctgctgtgcttcgtggccaccatccccgtgtccttcgcctgccgcatcgt gccctcccgcctgggcaagcacctgtacgccgccgcctccggcgccttcctgtcctacctgtccttcggcttctcctccaa cctgcacttcctggtgcccatgaccatcggctacgcctccatggccatctaccgccccaagtgcggcatcatcaccttctt cctgggcttcgcctacctgatcggctgccacgtgttctacatgtccggcgacgcctggaaggagggcggcatcgactcc accggcgccctgatggtgctgaccctgaaggtgatctcctgctccatgaactacaacgacggcatgctgaaggagga gggcctgcgcgaggcccagaagaagaaccgcctgatccagatgccctccctgatcgagtacttcggctactgcctgtg ctgcggctcccacttcgccggccccgtgtacgagatgaaggactacctggagtggaccgagggcaagggcatctggg acaccaccgagaagcgcaagaagccctccccctacggcgccaccatccgcgccatcctgcaggccgccatctgcat ggccctgtacctgtacctggtgccccagtaccccctgacccgcttcaccgagcccgtgtaccaggagtggggcttcctg cgcaagttctcctaccagtacatggccggcttcaccgcccgctggaagtactacttcatctggtccatctccgaggcctcc atcatcatctccggcctgggcttctccggctggaccgacgacgcctcccccaagcccaagtgggaccgcgccaagaa cgtggacatcctgggcgtggagctggccaagtccgccgtgcagatccccctggtgtggaacatccaggtgtccacctg gctgcgccactacgtgtacgagcgcctggtgcagaacggcaagaaggccggcttcttccagctgctggccacccaga ccgtgtccgccgtgtggcacggcctgtaccccggctacatgatgttcttcgtgcagtccgccctgatgatcgccggctccc gcgtgatctaccgctggcagcaggccatctcccccaagatggccatgctgcgcaacatcatggtgttcatcaacttcctg tacaccgtgctggtgctgaactactccgccgtgggcttcatggtgctgtccctgcacgagaccctgaccgcctacggctc cgtgtactacatcggcaccatcatccccgtgggcctgatcctgctgtcctacgtggtgcccgccaagccctcccgccccaagCCCCgCaaggaggagTGAGCGGAGGCCTTGGAAATATTCGCGTCACGCGAGGAGTAGGCTCTGCT GGTCGGCCCTGGATACGCTGACTCTTCAAGCAGTGGGGCACCACACCCACCTTTTGCCAAGGGCAAG GAGTCGGAAGGGGGCGGGGCTGCCATGCACCCCTGACGGGCATGGCCGTTCCGCGAGGGCGCCAAC TGCGGCGGCCTGCCCGCTGGCTCGTGCCCCCCTACCCCCACCATTGCCTGGAGCGTTTCCATCCCCAA ATCACATTCCATCCAAGTTGTATCACTATGCCCCTTTGGCTCTATACACTCACGGCCTGAGGTCCCTT CTCGGCCGTGGCGGCACACGCCCAACCCCCCACCATACTCTTTCCATACACTGCAATGCTTCGAGCCT GCCTGCCACCTGCTCTGCTTGTCTCCCCTCCCTTCCCTTGAGGTTTTCCAATGCAGTAAGAGAAGTCG ACGTGCATGGACAGATGATTGAAGATGAGcttaagcttgcagtgccccaaaaactggctaccacctaacaattct cacgcagttttatcctctgcacttgatgtcagcttttgattcgtctgcgtacattacagcgttgagtggccagcaggaaggag accgcggtccgagacgagtctgagggcgcgctctcgcaacttggattccggatttctaccctgcatcgacctcggcctgg agtcgatcagaaattgtcattgccagattgcctggcgaggacgggtgatatactcaaggcgttgcatcgcccacaaaacac acacttatctgcaagggagtactgcatcaggctctgctcaacagctcgtgacatcgatcgttcagctccccagcaggtgcg tgtccgcatggagcacccctcccgagacacctgcgttgggtgtcggaggagctcacatgccagggaggtgcccacattg caccacgcgaccgcgaaataggcagactcgggcatcctgtcatcgcatgtccgctggccgggaatcatggcctcccca ccaggcgtcacgcgctgcccacctccctccccttgctgcgcagggcaccgcgttcctgtggagagccgacca447Uff ccgcgcagatcaagaagtacatcaccagcgacgagctgaagaaccatgacaagcccggcgatctctggatcagcat ccagggtaaggcctacgacgtctctgactgggtgaaggaccacccaggtggctctttccccctgaagtccctcgcgggt caggaggtcacggacgccttcgtcgcgttccaccccgcctctacctggaagaacctggacaagtttttcacgggctact acctgaaggactactcggtgtccgaggtgtcgaaggactaccgcaagctcgtgtttgagttctccaagatgggcctgta cgataagaagggccatatcatgttcgcgacgctgtgcttcatcgcgatgctcttcgccatgtcggtctacggggtgctgtt ctgcgagggcgtgctggtgcacctgttcgggctgcctgatgggcttctgtggatccaatccggctggatcggccacg acgcgggccactacatggtcgtgtctgacagccggctgaacaagttcatgggcatctttgccgcgaactgtctctccgg catcagcatcggctggtggaagtggaaccacaacgcgcaccatatcgcctgcaactccctcgagtacgatccggacc tccagtacatcccctttctcgtggtctcttcgaagtttttcggaagcctgaccagccacttctacgagaagcgcctgacctt cgactcgctgtcgcgctttttcgtgtcttaccagcattggaccttttaccccatcatgtgcgcggcccggctgaacatgtac gtgcaaagcctgatcatgctcctgacgaagcggaacgtgtcgtaccgagctcacgagctcctgggctgcctcgtgttct ccatctggtaccccctgctcgtgtcctgcctgcctaactggggcgagcggatcatgttcgtcatcgcttcgctctcggtgac ggggatgcaacaggtgcagttcagcctgaaccacttctcctctagcgtgtacgtcggcaagcccaagggcaacaact ggttcgagaagcaaacggacggcaccctcgacatctcgtgccctccgtggatggactggtttcacggtggcctccagtt ccagatcgagcatcacctgtttccgaagatgccccgctgcaacctgcgtaagatcagcccgtacgtgatcgagctctgc aagaagcacaacctcccctacaactacgcttcgttcagcaaggcgaacgagatgacgctgcggacgctgcggaaca cggccctgcaggcccgagacatcaccaagcccctccccaagaacctcgtgtgggaggcgctgcacacccacggcTG4GCTGTTCCTAGGAACGTGGAGGAGGTGCAAGGAGGGTGATCTCACCCTGGTGTGTCTCTTCATGG AGCTCAGATCTTGAAAACTGTGAGGTGCTTATCCGATACCTGCTTCGTGCATGGCTTGTGCGATATGTACACGCATTTGCAGATTGGTGGGAGCAGCAGATTGGTGGGAGCAGCATAGAGCTTTAGAAGGGGCT TAGGAGCGGGAATGTGAAACTCAGGCGGTTGGGCCAGATGAGAGCGCAAAGtctaga|ggacateatgg gtctccagggctctaggccctccccttcgctgcaagtaaacagttgcaggtcgcataagtcccctggcatgcctctgctcat gcacttcaggtcagcaataatgataccgcatggcttggttatattcctttcttaatactgtacgacatgcagctggaggtggca acatgagcgatgaactgcacgatggacaagccggccctatggcgggagatgaagattgggttcggaccacatccctcta ccctcctggtacggaagggggcccaacgtcccttgatacggtcgattgatagcttgagataatgctacttcatgagaacga gatcgccagtggttgccgtgccttctcccacggcgggacccctgcgacactcttctgacctccgagcgatgagcgactgg acactatgcgacagtgccaaggacccttggtatagcagaccatgtatgcatggcatgacttcatggaacagggccctgtcc gagtgtgacctctgggcgataggggatacgacgaagattagggttttcctgatgcgtgacttggttctcgcgccactgtcaa tggcagacatcgcaccacgccgtggagctatttatggtaactttgagtccactcgagggctccatgctgcattctgcccttcg gtacctcgggacatttctcagagtctcgcgtttggctcccggagatcaaccacagaaaaggaaagatcgaacacaagatc acggatcccgggtgtcatttgtgttgtcaacctagggtctctgcgccaacctagggtaaaggctgtcacaccctggaagcg ctttatttcaccccgggtttcactgtcacatctcaacatatcggtgtccactcgggcacccggagtcgccggttacaactcc cagcagcatctaatctcccaagccctagacctacagcaccggccgcacaggacgagcgccgttgccccagccctccaca ^ / i TGgagagcalcgcgcaglllclccccagcaagalgccccaagacclgllcalcgacclggcccgcgcgalcgg cgtgcaggctgccccctacgtggaccccctggaggcggctctcgtggcgcaggccgagaagtttttccccaccgtggtc catcacacgcggggcttcctcgtcgcggtcgagtcgccgctggcccgagagctgcccctgatgaacccgttccacgtg ctcctgatcgccctggcctacctggtcaccgtgttcgtcggcatgcaaatcatgaagaacttcgagcggtttgaggtcaa gaccttctcgctgttccacaacttctgcctggtcagcatctccgcctacatgtgcgggggcatcctgtacgaggcctacca agccaactacggtctgttcgagaacgctgccgaccacaccgtgcagggtctccctatggcgaagatgatctggctcttc tacttttccaagatcatggagttcgtggacacgatgatcatggtcctgaagaagaacaaccgtcagatcagctttctgca cgtgtaccaccatagctccatctttaccatctggtggctggtcacgttcgtggcgccaaacggcgaggcttacttctctgc cgcgctgaactccttcatccacgtcatcatgtacggctactactttctgagcgccctgggctttaagcaagtgtccttcatc aagttctacatcacccgctcccagatgacccaattctgcatgatgtcgatccagtcgtcctgggacatgtacgccatgaa ggtcctgggtcgcccgggctacccgtttttcatcaccgccctgctctggttctacatgtggacgatgctgggcctcttctac aacttctaccgaaagaacgcgaagctcgccaagcaggctaagatcgacgccgcgaaggagaaggcccgcaagct gcagZU^GTCCTGGCGACCCTGCTCCCCTGACCCCTGTTCCCCTGCGCTGCTTCTCCCCGGTGACATC CGACCTGCTGCAAAATTCCCGTTCCTGCACAACACTTGCCTGACCGAGGGTCGGGTCGCGAAGTAAA AGCCACAATCAACACCCCAGGCACATTAAGAGTGCACAGCATGACGCAGCATAGGGTTTGTGTCGG AGGAAGGGGGTCGAGTCGCGTTGGCGAGGGGGTGGTCACGATGACCACATCTGCGGGATAATTGAA TCCTCAGGGGAAAATACCAGTCTCTGCTTCCAGGTGCTCCGGggCgCgCcTGGATCTGGTGGC CAAATGGGGAGCTGCCACATTTCAGCACTACATGGATCTGTATCGCACCAAGCACGCTGCCGACGCAGGCGAGCGGTCATGGGAGAAGGGACGGTGAGA AGCATTTACTTGCGAGGCGTACAAGCCGTCTTCTGCTAAATTTGCTGAGAC TGAATGCCCAGATCCACATGAAGCACTCCATCTTCCTCCTGCCCCCTTCCA CCCACTCCCTCAGGTGTCATGCTGACTGGTGGGTATGACCTCTCGTCGGTA CCCCTCCCAGAGGAGAAGCCTTTCTGGGCCGACATCTTGCTTGCCTTCAGA CGGCTGGAAAGCAGTGAGCTGGCCGCCTTCGATCCAAGCGGTACATCCGT CGATGGCTACGGATTCACCACAATTGTGACGTGAGGCGGCCAATTATGGG AAAGGAAGCTCCACTTCAAGCGGCATGCCCTTGCAAGCTGAGGGGGAGTG CAGACCTCCTCATGCCTTGAATTTGCAGGGAGGCCAGCGACTCTGCCCCTT TCCACCGAGCAGGGAGGGGCGACTTTACCTGGTCTGGTTGATGAAGCAGA TTGAGCAGCTGGGCGGCAGGCACGAGCGCCGTCATGTCAGCAGCTTGGAT GAGCTGGCCGATTACGATGCCGTGGTCAACTGCACAGGTGCGCACGTGGT CGGGTTGCATGAGCCAGCACGGGGGGCGCAGCCCTCCCCTGCTCCCGGGA CAGGCACGCCGACGCCGTTTTGCATCATCAGCCGAGAGCCTCTGTGAGGC AGGCCCACATTCCTCACCCCATCgctasc (SEQ ID NO: 13)[000219] Relevant restriction sites in the construct are indicated in lowercase, bold, and are from 5’ to 3’ Bmtl, Spel, Notl, Aflll, Xbal, Asci, and Bmtl, respectively. Bmtl restriction endonuclease site used to generate linear DNA and for cloning is indicated in lowercase bold and delimits the 5’ and 3’ ends of the transforming DNA. Underlined, uppercase sequences represent genomic DNA from PB5 that permit targeted integration of the transforming DNA at the DAO1 locus via homologous recombination. Proceeding from 5’ to 3’, the selection cassette contains the C. reinhardtii beta tubulin 2 (CrTUB2) promoter in lowercase, boxed text, driving expression of Saccharomyces cerevisiae SUC2 gene (ScSUC2), codon-optimized for expression in A. protothecoides and encoding sucrose invertase, thereby enabling the strain to utilize exogenous sucrose. The initiator ATG and terminator TGA for ScSUC2 are indicated in uppercase italics while the rest of the sequence is indicated in lowercase italics. The terminator region of the A. protothecoides enolase gene (ApPGH) gene is indicated in small capitals followed by A. protothecoides ammonium transporter 2 (ApAMT2vl) promoter (indicated as small case boxed text) driving the expression of codon-optimized At-LPCATl . The initiator ATG and terminator TGA for At-LPCATl are indicated in uppercase italics, while the coding region is indicated in lowercaseitalics. The ApSAD2vl terminator region is indicated by small capitals followed by A. protothecoides stearoyl ACP desaturase (ApSAD2vl) promoter driving the expression of codon-optimized B. officinalis FADdelta6 desaturase (Bo-FADdelta6 desaturase; AAC49700.1) indicated by the lowercase boxed text. The initiator ATG and terminator TGA for Bo-FADdelta6 desaturase are indicated in uppercase italics, while the coding region is indicated in lowercase italics. The terminator region of the A. protothecoides phosphoglycerate kinase 1 (ApPGKl) gene is indicated by small capitals followed by A. protothecoides ammonium transporter 1 (ApAMTl) promoter, indicated as small case boxed text, and driving the expression of codon-optimized M. alpina M FADdelta6 ELO 1 (Ma-FADdelta6 ELO 1; ACD31685). The initiator ATG and terminator TGA for Ma-FADdelta6 ELO1 are indicated in uppercase italics, while the coding region is indicated with lowercase italics. The ApHSP90 terminator region is indicated by small capitals followed by the PB5 genomic region indicated by the underlined uppercase text. The final construct was sequenced to ensure correct reading frames and targeting sequences.[000220] The constructs pPB0323 (ApDA01 ::CrTUB2-ScSUC2-ApPGH:vl- At-LPC AT 1 - ApS AD2v 13UTR: ApS AD2v 1 -Ma-F ADdelta6 Desaturase 1 - ApPGK13UTR:ApAMTlvl-Ma-deltaO6 elongase l-ApHSP903UTR::ApDAOl), pPB0324 (ApD AO 1 : :CrTUB2-ScSUC2- ApPGH: ApAMT2v 1 - At-LPC AT 1 - ApSAD2vl3UTR:ApSAD2vl-Ma-FADdelta6 desaturase 2- ApPGK13UTR:ApAMTlvl-Ma-FADdelta6 elongase l-ApHSP903UTR::ApDAOl), pPB0325 (ApD AO 1 : :CrTUB2-ScSUC2- ApPGH: ApAMT2v 1 - At-LPC AT 1 - Ap S AD2v 13UTR: Ap S AD2v 1 -Bo-F ADdelta6 desaturase- ApPGK13UTR:ApAMTlvl-Ma-FADdelta6 elongase 2-ApHSP903UTR::ApDAOl), pPB0326 (ApD AO 1 : :CrTUB2-ScSUC2- ApPGH: ApAMT2v 1 - At-LPC AT 1 - ApSAD2vl3UTR:ApSAD2vl-Ma-FADdelta6 desaturase 1- ApPGK13UTR:ApAMTlvl-Ma-deltaO6 elongase 2-ApHSP903UTR::ApDAOl), pPB0327 (ApD AO 1 : :CrTUB2-ScSUC2- ApPGH: ApAMT2v 1 - At-LPC AT 1 - ApSAD2vl3UTR:ApSAD2vl-Ma-FADdelta6 desaturase 2- ApPGK13UTR:ApAMTlvl-Ma-FADdelta6 elongase 2-ApHSP903UTR::ApDAOl), pPB0328 (ApD AO 1 : :CrTUB2-ScSUC2- ApPGH: ApAMT2v 1 - At-LPC AT 1 - Ap S AD2v 13UTR: Ap S AD2v 1 -Bo-F ADdelta6 desaturase-ApPGK13UTR:ApAMTlvl-Ma-FADdelta6 elongase 3-ApHSP903UTR::ApDAOl), pPB0329 (ApD AO 1 : :CrTUB2-ScSUC2- ApPGH: ApAMT2v 1 - At-LPC AT 1 -ApSAD2vl3UTR:ApSAD2vl-Ma-FADdelta6 desaturase 1-ApPGK13UTR:ApAMTlvl-Ma-FADdelta6 elongase 3-ApHSP903UTR::ApDAOl), and pPB0330 (ApDA01 ::CrTUB2-ScSUC2-ApPGH:ApAMT2vl-At-LPCATl- ApSAD2vl3UTR:ApSAD2vl-Ma-FADdelta6 desaturase 2-ApPGK13UTR:ApAMTlvl-Ma-FADdelta6 elongase 3-ApHSP903UTR::ApDAOl), have the same vector backbone, selectable marker, and AtLPCATl cassette as pPB0322 differing only in the combination of FADdelta6 desaturase and the FADdelta6 ELO being tested.[000221] pPB0323 contains M. alpina FADdelta6 desaturase 1 (Ma-FADdelta6 desaturase 1; AAF0868) while pPB0324 contains M. alpina FADdelta6 desaturase 2 (MaFADdelta6 desaturase 2; ADE06661) in place of Bo-FADdelta6 desaturase contained in pPB0322. The sequence of Ma-FADdelta6 desaturase 1 (AAF08685) in pPB0323 is shown in SEQ ID NO: 14 while the sequence of MaFADdelta6 desaturase 2 (ADE06661) in pPB0324 is shown in SQ ID NO: 15.ATGgccgctgcccccagcgtgcgcacgttcacccgcgctgaggtcctcaacgccgaggccctcaacgaggggaag aaggacgcggaggcccccttcctgatgattatcgacaacaaggtgtacgatgtgcgggagttcgtcccggaccacccc ggcggttctgtgatcctgacccatgtgggcaaggacggcacggacgtgttcgacaccttccaccccgaggccgcgtgg gagaccctggcgaacttctacgtgggcgacatcgacgagagcgaccgggacatcaagaacgatgacttcgcggccg aggtccgcaagctgcgcacgctgtttcagtcgctgggctactacgactcctcgaaggcgtactacgccttcaaggtgtc gtttaacctctgcatctgggggctctcgaccgtgatcgtggcgaagtggggtcagacgtccaccctggccaacgtcctct cggcggctctcctgggactgttctggcaacagtgcggctggctggcgcacgactttctccatcaccaggtgtttcaagac cgcttctggggcgacctgtttggcgcgttcctgggcggtgtctgccagggcttttcttcgtcctggtggaaggacaagcac aacacgcaccatgccgcgcccaacgtgcacggtgaggaccccgatatcgacacccaccccctgctcacgtggtcgg agcacgccctggagatgttcagcgacgtccccgatgaggagctcacccgcatgtggtcgcgcttcatggtcctcaacc agacgtggttttacttccccatcctgtcctttgcccgtctctcgtggtgcctgcagagcatcctgttcgtcctgcctaacggcc aggcccacaagccatcgggcgcgcgagtgccgatctctctggtcgagcagctgtctctggcgatgcactggacgtggt acctcgcgacgatgttcctcttcatcaaggatcccgtcaacatgctggtctacttcctggtgtcccaggctgtctgcggtaa cctcctggcgattgtgttctctctgaaccacaacggcatgccggtcatcagcaaggaggaggccgtcgacatggacttc tttacgaagcagattatcacgggtcgcgacgtgcacccgggcctgttcgccaactggttcacgggtggcctgaactaccaaatcgagcatcacctgttccccagcatgccgcgccacaacttttcgaagatccagccagccgtcgagaccctgtgca agaagtacaacgtgcgctaccacacgaccggcatgatcgagggcaccgcggaggtgttttcgcgcctgaacgaggt gtccaaggctgcgtcgaagatgggcaaggcgcagTGA (SEQ ID NO: 14)ATGgccgctgcgccctcggtgcgcaccttcacgcgtgccgagattctgaacgccgaggccctgaacgagggcaag aaggatgcggaggcgcctttcctgatgattatcgacaacaaggtgtacgacgtccgcgagttcgtcccggaccacccg ggaggctctgtgattctgacccatgtcggcaaggacggcaccgacgtctttgacaccttccacccggaggcggcctgg gagacgctggcgaacttctacgtcggcgacatccacgagtccgaccgtgacatcaagaacgatgactttgccgcgga ggtgcgcaagctgcgaacgctcttccagtccctgggctactacgacagctcgaaggcgtactacgcgttcaaggtgtcc ttcaacctctgcatctggggcctgtccacctttgtggtcgcgaagtggggccagacctccacgctggctaacgtcgtgtc ggccgcgctcctgggcctgttctggcagcaatgtggctggctcgctcacgacttcctgcatcaccaggtcttccaggacc ggllclgggglgacclgllcggcgcgllcclcgggggcglglgccagggallclcclcglcllgglggaaggacaagcac aacacgcatcacgcggcccctaacgtgcacggcgaggacccggacatcgacacgcacccactgctcacctggtctg agcacgcgctcgagatgttctccgacgtccccgacgaggagctcacccgcatgtggtcccggttcatggtcctgaacc agacctggttctacttccccatcctgagcttcgcccggctctcttggtgcctgcaaagcatcctgtttgtgatgccgaacgg ccaggcccacaagccgtcgggcgcgcgcgtgcccatctcgctggtggagcagctgtcgctggccatgcactggacct ggtacctcgcgacgatgttcctgtttgtcaaggaccccatcaacatgttcgtgtacttcctggtgtcgcaagccgtgtgtgg aaacctgctcgccctggtcttttcgctgaaccacaacggcatgccagtgatctccaaggaggaggccgtcgatatgga ctttttcacgaagcagattatcaccggccgggacgtccaccctggcctgttcgctaactggttcaccgggggcctgaact accagatcgagcatcacctgtttccctcgatgccacgccataacttctccaagatccagccggccgtggagacgctctg caagaagtacaacgtgcgataccacacgaccgggatgatcgagggcacggccgaggtgttctctcgcctcaacgag gtctcccgcgctgcgagcaagatgggcaaggcccagTGA (SEQ ID NO: 15)[000222] pPB0325, pPB0326, and pPB0327 contain the same sequence as pPB0322, pPB0323, and pPB0324 respectively differing only in the FADdelta6 ELO gene being tested. These constructs were designed to test M. alpina FADdelta6 ELO2 (Ma-FADdelta6 ELO2; ADE06662) instead of Ma-FADdelta6 ELO1 (ACD31685). The sequence of Ma-FADdelta6 ELO2 (ADE06662) in pPB0325, pPB0326 and pPB0327 is shown in SEQ ID NO: 16.ATGgagtccatcgctcagttcctgccgagcaagatgccacaagacctgtttatcgacctcgcggccgcgatcggcgt ccgcgcggctccttacgtggaccccctcgaggcggccctggtggcgcaggccgagaagtacatccctacgatcgtgc accatacgcgaggctttctggtggccgtggagtccccgctggtgcgtgagctgcctctgatgaaccctttccacgtgctcc tgatcgtcctggcctacctggtcaccgtcttcgtcgggatgcaaatcatgaagaacttcgatcgctttgaggtgaagacgttttccctcttccacaacttttgcctcgtgagcatctccgcctacatgtgcgggggtatcctgtacgaggcctaccaagccaa ctacggcctctttgagaacgccgcggaccataccgcgaagggcttccccatggccaagatgatttggctgttctacttta gcaagatcatggagtttgtggacacgatgatcatggtgctcaagaagaacaaccgccagatctccttcctccacgtcta ccatcactcgtccatcttcaccatctggtggctcgtgacgtttgtggccccgaacggtgaggcctacttctctgctgccctg aactcgttcatccacgtcatcatgtacggctactacttcctgtcggcgctcgggtttaagcaggtgtcgttcgtcaagttcta catcacgcgaagccaaatgacccagttctgcatgatgagcatccagtcgtcttgggacatgtacgcgatgaaggtcctg ggccgcccgggctacccgtttttcatcaccgccctgctctggttctacatgtggaccatgctcggcctgttttacaactttta ccggaagaacgcgaagctggccaagcaggcgaaggccgatgctgcgaaggagaaggcccgcaagctccaaTG A (SEQ ID NO: 16)[000223] pPB0328, pPB0329, and pPB0330 also contain same sequence as pPB0322, pPB0323, and pPB0324 respectively differing only in the FADdelta6 ELO gene being tested. These constructs were designed to test M. alpina FADdelta6 ELO 3 (Ma-FADdelta6 ELO 3; KAF9943255) instead of Ma-FADdelta6 ELO1 (ACD31685). The sequence of Ma-FADdelta6 ELO 3 (KAF9943255) is shown in SEQ ID NO: 17.ATGgagtcgatcgcgcagttcctgccctccaagatgccacaggacctcttcatcgacctggcggccgcgatcggcgt gcgcgcggccccgtacgtcgacccactggaggctgcgctcgtcagccaggccgagaagtacttcccaaccattgtgc atcacacccgcgggttcctcgtcgccgtggagtccccactggtgcgggagctgcctctgatgaacccgttccatgtgctc ctgattgccctgggctacctcatcaccgtcttcgtgggcatgcagatcatgaagcactttgaccgttttgaggtcaagacc ttttccctgtttcacaacttttgcctggtctcgatcagcgcgtacatgtgcgggggcatcctgtacgaggcgtaccaggcca actacggcctgttcgagaacgccgcggatcacaccgcccaggggctgccgatggccaagatgatctggctgttctactt ttcgaagatcatggagttcgtcgacacgatgatcatggtcctcaagaagaacaaccggcagatcagcttcctgcatgtg taccatcactccagcatctttacgatctggtggctcgtgacgttcgtcgcccccaacggcgaggcctacttttcggcggcc ctgaactcttttatccacgtgatcatgtacgggtactacttcctctccgctctcggcttcaagcaagtgtccttcgtcaagttc tacatcacccgctcgcagatgacccagttctgcatgatgtcgatccaatccagctgggacatgtacgcgatgaaggtgc tgggccggcccggatacccgtttttcatcaccgcgctgctctggttctacatgtggacgatgctgggcctgttctacaactt ctaccgtaagaacgccaagctggcgaagcaggctaaggcggacgcggccaaggagaaggcgcggaagctgcag TGA (SEQ ID NO: 17)[000224] pPB0323, pPB0324, pPB0325, pPB0326, pPB0327, pPB0328, and pPB0329 were transformed into A. protothecoides . Transformants were grown under lipid production conditions, and fatty acid profiles were obtained for each. Table 7 shows these results.Table 7. Fatty Acid Profiles[000225] AtLPCATl expression in the derivative lines arising out of the transformations with pPB0323 to pPB0329 resulted in elevated Cl 8:2 levels in all derivative lines but none of derivative lines produced any GLA and / or DGLA underscoring the significance of the GLA and DGLA profiles that we were able to obtain from pPB0405 (expressing Pt-FADdelta6 desaturase) and pPB0406 (expressing a combination of Pt-FAD delta6 desaturase and Pt-FADdelta6 ELO genes) detailed in Tables 1 and 6 above. It is quite surprising that even B. officinalis FADdelta6 desaturase expression in A. protothecoides PB5 did not kickstart any GLA production in derivative transgenic lines (arising out of transformations with pPB0325 andpPB0328) since B. officinalis is currently the major plant seed oil used in products containing GLA.Example 9. Production of Eicosenoic, Erucic, and Nervonic acids in A. protothecoides[000226] KCS enzymes from Malania oleifera (Accession numbers: QDA34238, XP_057960190, and XP_057960186 named Mole-KCSl, MoleKCS2, and MoleKCS3 respectively), Cardamine graeca (Accession number: ACJ61778), Crambe abysinnica (Accession number: AAX22298), Lunaria annua (Accession number: ACJ61777), Limnanthes douglasii (Accession number: AF247134 1) and a KCS enzyme from Alliaria petiolata were used. All the KCS enzymes showed significant homology in regions known to confer KCS activity. A. petiolata KCS encoded a protein with shorter n-terminal while Mole-KCSl, 2 and 3 encoded proteins with extended n-termini. FIG. 9 and FIG. 10 show alignments and % identity between KCS enzymes from various plant species.[000227] FIG. 11 and FIG. 12 show alignments and % identity between KCR enzymes from various plant species.[000228] FIG. 13 and FIG. 14 show alignments and % identity between HACD enzymes from various plant species.[000229] FIG. 15 and FIG. 16 show alignments and % identity between ECR enzymes from various plant species.[000230] Constructs encoding A. petiolata KCS (Apet-KCS), Cardamine graeca KCS (CgKCS), Crambe hispanica abyssinica KCS (CrhKCS), Lunaria annua KCS (LaKCS), Limnanthes douglasii KCS (LdKCS), or M. oleifera KCS (Mole-KCSl, MoleKCS2, Mole-KCS3) were made. pPB0377 (ApACCase::ASAD2vl-Apet-KCS- Ap S AD2v 13UTR: ApHUP 1 - AtTHIC- ApHSP90 : ApF AT Av 1 - Ap ACCase), and pPB0378 (ApACCase::ASAD2vl-Mole-KCSl-ApSAD2vl3UTR:ApHUPl-AtTHIC- ApHSP90:ApFATAvl-ApACCase) sequences are below: pPB0377 aagcttGTCTGTCGCATCCTGGTGAAGGGCAGGGGGAGGGGAGCACTGTTCA GCTCGCCACCAGATCCAGGGGTTGGGGGTTTTCTCCCCCAGGCGTTCAGG AGGCGCCCTGGCCTCGTGGCATGCCTCTCCCTCGTACCGGATAGTCGAATTGCAATTTCTCGAGAGCAGCTGCAGCTCTTCGAGCATCGGACACGGGCTCT GGAGGGGCAGCCAGGGCGTCTCTCAAGGCATCAATGAACTGGGTCCTGGA GTCGGGGGCGGGGGTGAGGGTGGCGTTCACCATGATGCCCTCCTCCGGCA CCCACCTTCGCCCTCCGGGAAATTTTGCGATGTGGAAGAGTATTTCAGCGT ATGTGTGTGATGAGCACCATCGTCTCGCTGGGCAGGGCCTCCCTTGCTCGA CGTGGCAGAAAGCCAGCGGCCATTTGAACCCACCACGCGGGGGCGCGCG TCCGTCAGCCTCGAGAGCACCGCATGGCTGCAACGAACCCCCCGACTGCA TGTCATGACAGGTCTGCTCTCGTAATGCATTGTGCGCAGATTGCGAGTCAC ATACCGAAGCGTTGTGTGGGAAGGTATCGACGCCTGACCCTGCCGTGCCC GGCTCCCCACTGACGTCCGGTCGTCTTCACAGACTGCTTTGCAGAGCAGC ATCTTGTATCAATCCCCCAGAGTTGGACAGTCTACCTTGCAGACGCCTCCT TGCATAGAGTGAGGGTGATCAGGGTCCCAAAGggtacc|ctgcagtgccccaaaaactgg ctaccacctaacaattctcacgcagttttatcctctgcactttgatgtcagcttttgattcgtctgcgtacattacagcgttgagt ggccagcaggaaggagaccgcggtccgagacgagtctgagggcgcgctctcgcaacttggattccggatttcttaccct gcatcgacctcggcctggagtcgatcagaaattgtcattgccagattgcctggcgaggacgggtgatatactcaaggcgtt gcatcgcccacaaaacacacactatctgcaagggagttactgcatcaggctctgctcaacagctcgtgacatcgatcgttc agctccccagcaggtgcgtgtccgcatggagcacccctcccgagacacctgcgttgggtgtcggaggagctcacatgcc agggaggtgcccacattgcaccacgcgaccgcgaaataggcagacttcgggcatcctgtcatcgcatgtccgctggccg ggaatcatggcctccccaccaggcgtcacgcgctgcccacctccctcccctgctgcgcagggcaccgcgttcctgtgga ^^c^ccacATGacctccgtgaacgtgaagctgctgtaccactacgtgctgaccaacctgttcaacctgtgcctgtt ccccctgaccgccttcgtggccggcaaggcctgccgcctgaccaccaacgacctgcaccacttctactcccacctgca gcacaacctgatcaccgtgaccctgctgttcgccttcaccgtgttcggctccgtgctgtacatcgtgacccgccccaagc ccgtgtacctggtggactactcctgctacctgccccccccccaccagtccgtgtccatctccaaggtgatggacgtgttcg accagatccgcaaggccgaccccctgcgcaacgtgtcctgcgacgactcctcctccctggacttcctgcgcaaggtgc aggagcgctccggcctgggcgacgagacctacggccccgagggcctgctgcacgtgcccccccgcaagaacttcac cgccgcccgcgaggagaccgagcaggtgatcaccggcgccctggagaacctgttcaagaacaccaaggtgaaccc ccgcgagatcggcatcctggtggtgaactcctccatgttcaaccccaccccctccctgtccgccatggtggtgaacacct tcaagctgcgctccaacatcaagtccttctccctgggcggcatgggctgctccgccggcgtgatcgccatcgacctggc caaggacctgctgcacgtgcacaagaacacctacgccctggtggtgtccaccgagaacatcacctaccacatctacg gcggcgacaaccgctccatgatggtgtccaactgcctgttccgcgtgggcggcgccgccatcctgctgtccaacaagc ccggcgaccgccgccgctccaagtacaagctggcccacaccgtgcgcacccacaccggcgccgacgacaagtcctt ccgctgcgtgcagcaggaggacgacgagtccggccgcaccggcgtgtgcctgtccaaggacatcaccgacgtggccggcaccaccctgaagaagaacatcgccaccctgggccccctgatcctgcccctgtccgagaagatcctgtacttcgtg atcttcatggccaagaagctgctgaaggaccagatcaagcactactacgtgcccgacttcaagctggccatcgaccac ttctgcatccacgccggcggccgcggcgtgatcgacgccctggagaagtccctgggcctgtcccccatcgacgtggag gcctcccgctccaccctgcaccgcttcggcaacacctcctcctcctccatctggtacgagctggcctacatcgaggcca agggccgcatgaagaagggcaacaaggcctggcagatcgccctgggctccggcttcaagtgcaactccgccgtgtg ggtggccctgcgcaacgtgaaggcctccgccaactccccctgggagcactgcatcgaccgctaccccgtgcagcccg acttcgactcctccaagtccgagacccgcgtgaagaacggccgctccTGAGCGGAGGCC'Y'YGGJ^J^KY'YCG CGTCACGCGAGGAGTAGGCTCTGCTGGTCGGCCCTGGATACGCTGACTCTTCAAGCAGTGGGGCACC ACACCCACCTTTTGCCAAGGGCAAGGAGTCGGAAGGGGGCGGGGCTGCCATGCACCCCTGACGGGC ATGGCCGTTCCGCGAGGGCGCCAACTGCGGCGGCCTGCCCGCTGGCTCGTGCCCCCCTACCCCCACC ATTGCCTGGAGCGTTTCCATCCCCAAATCACATTCCATCCAAGTTGTATCACTATGCCCCTTTGGCTC TATACACTCACGGCCTGAGGTCCCTTCTCGGCCGTGGCGGCACACGCCCAACCCCCCACCATACTCTT TCCATACACTGCAATGCTTCGAGCCTGCCTGCCACCTGCTCTGCTTGTCTCCCCTCCCTTCCCTTGAGG TTTTCCAATGCAGTAAGAGAAGTCGACGTGCATGGACAGATGATTGAGAGATGAGCttaag^CCCgCttt ttaattgagcccctttcgtcgctgaatcagcgaaagcaccgcgaaacaatgcctgtcccgtccatgcatctcaacagcctca tgcaaggttgcacaagcaagaccattctgatctgggaacttgtaggtgttgtatgggggaggttgtgctctgaatcaagtg gtatcacgttccggaacaccccgaaacgtgcatgggcttattgcgatgagagcatttcccaccgcgattgtctcacgcgca tttcggagaaggtttgcagaacactccaggacatgaaatgccttgtcacgtatgaaccatctcccacggccttgaaaagatc gctcgacttccattctagatggtgcaaaaccctacgactcaagaaggtgccaccgactcaggcattgggcacggcgggca gggagaagagaggagttgatcaaaactgctcgatcacgttcccccatggcgatccgagcagcacatgatgcatcgaggt ggcgccgttgcaaaggagttgcgcatgggtcgaagcagggagaaggaaacggcgaggcgtgccgcgggggtgaattc agagtcaaatctgcgcctgccccggcgctcctgacggggattaacccccacgactgtatccatcgacactcgtctcgggg gaataaaagcggcgacccagctccagaggcgcaatccttctcacaatctgtttaactttcaacaaagtataagtcaattcaac ^^cacaATGgccgcgtccgtccactgcaccctgatgtccgtggtctgcaacaacaagaaccactccgcccgcccc aagctgcccaactcctccctgctgcccggcttcgacgtggtggtccaggccgcggccacccgcttcaagaaggagac gacgaccacccgcgccacgctgacgttcgacccccccacgaccaactccgagcgcgccaagcagcgcaagcaca ccatcgacccctcctcccccgacttccagcccatcccctccttcgaggagtgcttccccaagtccacgaaggagcacaa ggGgglgglgcacgaggaglccggccacglcclgaagglgcccllccgccgcglgcacclglccggcggcgagcccg ccttcgacaactacgacacgtccggcccccagaacgtcaacgcccacatcggcctggcgaagctgcgcaaggagtg gatcgaccgccgcgagaagctgggcacgccccgctacacgcagatgtactacgcgaagcagggcatcatcacgga ggagalgclglaclgcgcgacgcgcgagaagclggaccccgagllcglccgclccgagglcgcgcggggccgcgcc atcatcccctccaacaagaagcacctggagctggagcccatgatcgtgggccgcaagttcctggtgaaggtgaacgc gaacatcggcaactccgccgtggcctcctccatcgaggaggaggtctacaaggtgcagtgggccaccatgtggggcgccgacaccatcatggacctgtccacgggccgccacatccacgagacgcgcgagtggatcctgcgcaactccgcggtc cccgtgggcaccgtccccatctaccaggcgctggagaaggtggacggcatcgcggagaacctgaactgggaggtgt tccgcgagacgctgatcgagcaggccgagcagggcgtggactacttcacgatccacgcgggcgtgctgctgcgctac atccccctgaccgccaagcgcctgacgggcatcgtgtcccgcggcggctccatccacgcgaagtggtgcctggcctac cacaaggagaacttcgcctacgagcactgggacgacatcctggacatctgcaaccagtacgacgtcgccctgtccat cggcgacggcctgcgccccggctccatctacgacgccaacgacacggcccagttcgccgagctgctgacccagggc gagctgacgcgccgcgcgtgggagaaggacgtgcaggtgatgaacgagggccccggccacgtgcccatgcacaa gatccccgagaacatgcagaagcagctggagtggtgcaacgaggcgcccttctacaccctgggccccctgacgacc gacatcgcgcccggctacgaccacatcacctccgccatcggcgcggccaacatcggcgccctgggcaccgccctgct gtgctacgtgacgcccaaggagcacctgggcctgcccaaccgcgacgacgtgaaggcgggcgtcatcgcctacaag atcgccgcccacgcggccgacctggccaagcagcacccccacgcccaggcgtgggacgacgcgctgtccaaggcg cgcttcgagttccgctggatggaccagttcgcgctgtccctggaccccatgacggcgatgtccttccacgacgagacgc tgcccgcggacggcgcgaaggtcgcccacttctgctccatgtgcggccccaagttctgctccatgaagatcacggagg acatccgcaagtacgccgaggagaacggctacggctccgccgaggaggccatccgccagggcatggacgccatgt ccgaggagttcaacatcgccaagaagacgatctccggcgagcagcacggcgaggtcggcggcgagatctacctgc ccgagtcctacgtcaaggccgcgcagaagTGAGTCCTGGCGACCCTGCTCCCCTGACCCCTGTTCCCCTG CGCTGCTTCTCCCCGGTGACATCCGACCTGCTGCAAAATTCCCGTTCCTGCACAACACTTGCCTGACC GAGGGTCGGGTCGCGAAGTAAAAGCCACAATCAACACCCCAGGCACATTAAGAGTGCACAGCATGA CGCAGCATAGGGTTTGTGTCGGAGGAAGGGGGTCGAGTCGCGTTGGCGAGGGGGTGGTCACGATGA CCACATCTGCGGGATAATTGAATCCTCAGGGGAAAATACCAGTCTCTGCTTCCAGGTGCTCCGactag t|ggaatcccgcctccgagatgaagccgtggttggcacggaggaggccgctgcgggccagagtgttcttctgctgcacgt cctccggctttggtggctcgctgggcttgggtgcggccatgagctgcagtgcaagtgtacatataggtcaatcttatgaccc ggcactaccaatgatgatcaacaccgagcggccctctgtgttgtgcttgcctcttaccttcactgcgtactgctgcaggagc ttcatgaggatcacactgacggtcagggggatcagcacccagtcccggacatcccgatccagtacgaggtcctggctgac catgatggtaggtgaagttgggccctgggaggagcgctagaggagcctcggggcaaagatcaccctactctgacgtggc tggctcaatcacccatccctcccctttgaagtcggctctcagtttgcgttgtttcgaaatcgagccacaatcgaatatacacta cctaaaggctctcaccacctggcgtacctcggaatgcccatcagcccaaacacatgagaaaaggcgcgcgcggttcgac cccagtccgtcgattgacgcagtggggagctccatctgtcagctcttgggtggccaggtcgctgacagattggcacatac aggaccctgccgacccgttcctccagcactttgtgaatttaagcagcgcattagatcgtcgatggcttagagaaccccgcg cctgctcccccatctccctttcacacgttgaacacccggaccggccATGACGGTGCCTAAGCCGGCAGACTCGGCCCCCGAGTCCACCAATCCGTCCAAGCCATCCGCCATGGCGGA TAACGGGGCAGCGAAGTTGGCCAAGACCAACTCCACCCGCTCCCTCCTGTCGGTATCGTACCGGGAGCTGAGCAGGTGCGGCAGTTGAGGGACCTGGGG CTGACCTGGCCTGCACCGCCAAACAGGGTTCACCCCCCTTGTACCTGCCTC TGCAATCGTCGCACATGCCATGCTGCCCCATAGAAATGACCGTGAAGACT CCCACTCCACCCCCTCCCAATCCACAGTACCACCTCCTCAAGGGGGGTGC CCCGTCGCACGGCCGACGTCTCGGCTGCACTCGAGCAGCGTATCCAGGAG TGGGGCGGCGACAGGGCCATCCACAGGTGCGGTGCGGTGGGCTGGACTG CTTGCTTCCCTGAGAGGGAGGCTGACATGAGGGGACAGTCCGGGTTCTCT ATTCCAAGTGGTCGAGGGTCCCCGGACGTGAGACCTCGCCCTCTGTGGTA AAACGTCAGGTTATCTGCGGGCAGCTCTCCGCCCCGCGCCATGCCTGGAC CTGCACGGCCAACTGCATCACCTGGGATCCTCACGATAACCCACGCCCTC CTCACTTCCTTGCAGCGTCTTGGTGGCGAACAACGGCCTCGCCGCCGTCAA GTTCATCCGCTCCATCCGCTCCTGGGCGTACAAGACCTTTGGCAATGAGCGCACAGaasctt (SEQ ID NO: 18)[000231] The sequence of the transforming DNA construct pPB0377 is shown in SEQ ID NO: 18. The plasmid was constructed in such a way as to express a heterologous KCS and AtTHIC marker cassette in addition to upregulating the endogenous homomeric ACCase activity via “promoter hijack” methodology (for example see PCT application serial no. PCT / IB2022 / 062048, published as WO 2023 / 105498, which is hereby incorporated by reference in its entirety for all purposes). This was achieved by inserting the Apet-KCS and AtTHIC cassettes followed by the A. protothecoides acyl-ACP thioesterase (ApFATAvl) promoter right before the ATG of the downstream ACCase gene.[000232] Relevant restriction sites in the construct are indicated in lowercase, bold, and are from 5’ to 3’ Hindlll, Kpnl, Aflll, Spel, and Hindlll, respectively. Hindlll sites delimit the 5’ and 3’ ends of the transforming DNA at the A. protothecoides ACCase locus. Underlined, uppercase sequences represent genomic DNA from A. protothecoides that permit targeted integration of heterologous gene cassettes and ApFATAvl promoter at the ApACCase-2 locus via homologous recombination. Proceeding in the 5’ to 3’ direction, the A. protothecoides stearoyl ACP desaturase (ApSAD2vl) promoter, driving the expression of codon-optimized Apet-KCS, is indicated by the lowercase boxed text. The initiator ATG and terminator TGA for Apet-KCS are indicated in uppercase italics, while the coding region is indicated inlowercase italics. The terminator region of the A. protothecoides stearoyl ACP desaturase (ApSAD2vl terminator) gene is indicated by small capitals followed by the A. protothecoides HUP1 (hexose / H+ symporter) promoter (Ap-HUPl), indicated in lowercase, boxed text, driving the expression of the A. thaliana thiaminC gene (At- THIC), codon-optimized for expression in d. protothecoides and encoding 4-amino-5- hydroxymethyl-2-methylpyrimidine synthase activity, thereby permitting the strain to grow in the absence of exogenous thiamine. The initiator ATG and terminator TGA for At-THIC are indicated in uppercase italics, while the coding region is indicated with lowercase italics. The terminator region of the A. protothecoides heat shock protein 90 (Ap-HSP90) gene is indicated by small capitals followed by promoter from the A. protothecoides FATAvl gene, encoding the acyl-ACP thioesterase, to replace to endogenous promoter of ACCase gene. Immediately following the ApFATAvl promoter is the ApACCase genomic region indicated by underlined uppercase text with the ATG initiator codon of the ACCase gene in bold letters. The final construct was sequenced to ensure correct reading frames and targeting sequences.[000233] pPB0378 has the same vector backbone; selectable marker, promoters, and 3’ untranslated region (UTR) as pPB0377, differing only in the respective KCS gene being tested. In pPB0378, we tested the function of M. oleifera KCS1 instead of A. petiolata KCS contained in pPB0377. Relevant restriction sites in pPB0378 are also the same as in pPB0377. SEQ ID NO: 19 indicates the sequence of Mole-KCSl in lowercase with the initiator ATG and terminator TGA codons in uppercase italics. pPB0378ATGgcccagcccaagctggtgaagcccctgatcgccccctccgcctccccccgcctgcccgacttcaagcagggcg tgaagctgaagtacgtgaagctgggctaccactacctggtgacccacgccatgtacctgttcctgccccccctggccgt gatcgccgccgtgcagctgtccaccttctccctgcaggacgtgcacgacctgctgggccagctgcgctacaacctgatc tccgtgatcctgtgctcctccaccctggtgttcctgtccaccctgtacttcctgacccgcccccgccccgtgtacctggtgg acttctcctgcttcaagcccgacgacgacgacaagaagtgctcctggcagcgcttcatgaagtgctccgagtcccgcg gcaccttcaccgaggagaacatcgagttccagcgcaagatcatggcccgctccggcatcggcgagtccacctacctg ccccccgccgtgatgaagatcccccccaactcctccatggccgaggcccgcgaggaggccaagatgatcatcttcgg cgtgctggaccgcctgttcgagaagacctccgtgaagcccaaggacatctccatcctgatcgtgaactgctccctgttca accccgtgccctccctgtccgccatggtggtgaaccactacaagctgcgcggcaacacccgcacctacaacctgggc ggcatgggctgctccgccggcctgatctccatcgacctggccaaggacctgctgcgcgtgcaccccaactcctacgccctggtggtgtccatggagtccatcaccatgaactggtacttcggcaacgagcgctccatgatcgtgcccaactgcctgtt ccgcatgggcggcgccgccgtgctgctgtccaacaagatgtccgaccgctggcactccaagtacaagctggtgcaca ccgtgcgcacccacaagggctccgacgacaagtgctacacctgcgtgacccagcgcgaggactccatcggcaagat cggcatctccctgtccaaggacctgatggccgtggccggcgacgccctgaaggccaacatcaccaccctgggccccc tggtgctgcccatgtccgagcagctgctgttcttcgccaccctggtgggccgcaagttcttcaaggtgaaggtgaagccc tacatccccgacttcaagctggccttcgagcacttctgcatccacgccggcggccgcgccgtgctggacgagctgcag aagaacctgcagctgaccgactggcacatcgagccctcccgcatgaccctgtaccgcttcggcaacacctcctcctcct ccctgtggtacgagctggcctacaccgaggccaagggccgcgtgaagaagggcgaccgcacctggcagatcgcctt cggctccggcttcaagtgcaactccgccgtgtgggaggccctgcgcaccatcaaccccgccaaggagaagaacccc tggatgaccgagatccaccagttccccatcaacgtgccccaggtgtccgccatcTGA (SEQ ID NO: 19)[000234] pPB0377 and pPB0378 were transformed separately into A. protothecoides. Transformants were grown under lipid production conditions and fatty acid profiles were obtained.Table 8. Fatty Acid Profiles[000235] Transformants expressing either Apet-KCS or Mole-KCSl showed accumulation of various very long chain fatty acids (VLCFA’s) including eicosenoic(C20: l) and erucic (C22:l) over the parent PB5 (Table 8). There was also noticeable accumulation of C20:0 (arachidic acid) in all transgenic lines expressing either of the KCS genes. However, while Apet-KCS resulted in significantly more C20: 1 and C22: 1, derivative lines expressing Mole-KCSl resulted in the production of C22:0 (docosanoic or behenic acid) and C24:0 (tetracosanic or lignoceric acid) besides C20: l and C22:l. This suggests that, while Apet-KCS has more propensity to elongate unsaturated fatty acids, Mole-KCSl might be a broad range elongase that tends to elongate both saturated (C18:0) and unsaturated (C18: ln9) fatty acids. Closer examination of GC profile peaks showed that lines expressing Mole-KCSl also produced nervonic acid (C24: 1). A clear and specific peak corresponding to nervonic acid was observed in multiple lines expressing Mole-KCSl while no such peak was detected in lines expressing Apet-KCS (FIG. 17).[000236] Expression of a heterologous 3 -ketoacyl -Co A synthase (KCS), also known as fatty acid elongase (FAE), gene from Malania oleifera (Mole-KCSl; Accession number: QDA34238) lead to production of very long chain fatty acids such as eicosenoic (C2O: 1A11), erucic (C22:1A13), and nervonic (C24:l A15) acids in A. protothecoides. On the other hand, a candidate KCS gene from Alliaria petiolata (Apet-KCS), while resulting in an increase in eicosenoic (C2O: 1A11) and erucic (C22: 1A13) acids, produced no detectable nervonic acid in Auxenochlorella protothecoides. Interestingly, the unsaturated fatty acid profile obtained with heterologous expression of Mole-KCSl in A. protothecoides also resulted in a noticeable increase in arachidic (20:0) and lignoceric (C24:0) acids indicating that elongation by Mole-KCSl is likely not restricted to unsaturated fatty acids. Apet-KCS, however, exclusively elongated Cl 8: 1 to eicosenoic and erucic acids. These results suggest that A protothecoides is able to produce very long-chain fatty acids, including eicosenoic, erucic, and nervonic acids. Such very long chain fatty acids have applications in personal care, therapeutics, and overall human health when heterologous genes encoding specific 3-ketoacyl-CoA synthase enzymes are expressed therein. PB5;377-2 and PB5;378-2 were banked as PES45 and PES46 respectively and used as parent strains for relevant subsequent transformations.[000237] We also made constructs pPB0546, pPB0547, pPB0548, pPB0549, pPB0550, and pPB0551 harboring CgKCS, CrhKCS, LaKCS, LdKCS, MoleKCS2and MoleKCS3 respectively. pPB0546 (ApFAD2vlvA::ApSAD2vl-CgKCS- ApSAD2vl3UTR:ApPGKlp-Neo-ApPGK3UTR::ApFAD2-lvB), pPB0547 (ApFAD2vlvA::ApSAD2vl-CrhKCS-ApSAD2vl3UTR:ApPGKlp-Neo- ApPGK3UTR::ApFAD2-lvB), pPB0548 (ApFAD2vlvA::ApSAD2vl-LaKCS- ApSAD2vl3UTR:ApPGKlp-Neo-ApPGK3UTR::ApFAD2-lvB), pPB0549 (ApFAD2vlvA::ApSAD2vl-LdKCS-ApSAD2vl3UTR:ApPGKlp-Neo- ApPGK3UTR::ApFAD2-lvB), pPB0550 (ApFAD2vlvA::ApSAD2vl-MoleKCS2- ApSAD2vl3UTR:ApPGKlp-Neo-ApPGK3UTR::ApFAD2-lvB), and pPB0551(ApFAD2vlvA::ApSAD2vl-MoleKCS3-ApSAD2vl3UTR:ApPGKlp-Neo- ApPGK3UTR::ApFAD2-lvB) sequences are below.[000238] The sequence of the transforming DNA construct pPB0546 is shown in SEQ ID NO: 20. The plasmid was constructed to express a heterologous KCS from C. graeca at the fatty acid desaturase 2vl (ApFAD2vl) locus within the host A. protothecoides genome. pPB0546 aagcttGGTGGGCATCTGTTGCAGGTGCATAGTGCCTGCCGGTGCTCTAAATA TCGTTGCAGCCTCTCTGGTAAAATAAAGAACATATTCTGTGACTGGCAGG GGTACAGTTTGTAGCTCAGGAATCGCGAGGTCATGCATGGCTTTCTCATTG GAGCATGATTAACGTCCAACACCATACGATTATCTTTCTTGCCCAAGCTCC GATTGACAGCTGCCCTCTGTGAAGACTCAATGCCAGCCTGATAGGATTCC GCTGCCTGAGAGCGGCAGCTGTGATCAATGGTGATCAAGGTCTGTCCAGC TGAGGCGAGCTGAGCATGGCAAGCAGCGGTACGACCATCCTCCACCATTT CCATAAGATGTATTTGGCTCAAGTAATCAGAAAAATCAATGAGCACCCAT TGTCTGTGTAGTCGGGACTCGAATGCGTGGGCAAAAGGTGAAAAGCGGTA CCAGGTATAATTCGGCGGACTCGGACAAGAAGGCATAGGTATTCGAAAAT CTACAGCCGACTCGCTGTTGAGGGAGCACGGCAAGATACAAGAGAAACC CCAGCAAGAATAGTGTTAGAAGCTGGTTCTGCGGAGGATTGACAATCTGT AGAAACCCGGCGCGATTTTCGCTGACGCAGGAAAGGGGCACTCGAATCTC TCTGGCTACTTAGCCATGGGCCGTGTCATCCATTCAATGCGACGTGTACAG CTTGGGCTCGGCCAGATTGATCGAGACTTTTTTGGGCTGACAACCCCTTGA GACTGCCTTAAGACAGCTTTGCAGCCCCGCCCTGTCGGGCTGCTGTCCCCa ctagtjcttgcagtgccccaaaaactggctaccacctaacaattctcacgcagttttatcctctgcactttgatgtcagctttttgattcgtctgcgtacattacagcgttgagtggccagcaggaaggagaccgcggtccgagacgagtctgagggcgcgctctc gcaacttggattccggatttcttaccctgcatcgacctcggcctggagtcgatcagaaattgtcattgccagatgcctggcg aggacgggtgatatactcaaggcgttgcatcgcccacaaaacacacacttatctgcaagggagtactgcatcaggctctg ctcaacagctcgtgacatcgatcgttcagctccccagcaggtgcgtgtccgcatggagcacccctcccgagacacctgcg ttgggtgtcggaggagctcacatgccagggaggtgcccacattgcaccacgcgaccgcgaaataggcagacttcgggc atcctgtcatcgcatgtccgctggccgggaatcatggcctccccaccaggcgtcacgcgctgcccacctccctccccttgc tgcgcagggcaccgcgttcctgtggagagccgaccac^ZGaccfccafcaacgZgaagcZgcZgtoccactocgZgcZ gaccaacttcttcaacctgtgcctgttccccctgaccgccttccccgccggcaaggcctcccagctgaccaccaacgac ctgcaccacctgtactcctacctgcaccacaacctgatcaccgtgaccctgctgttcgccttcaccgtgttcggctccatcc tgtacatcgtgacccgccccaagcccgtgtacctggtggactactcctgctacctgcccccccgccacctgtcctgcggc atctcccgcgtgatggagatcttctacgagatccgcaagtccgacccctcccgcgaggtgcccttcgacgacccctcct ccctggagttcctgcgcaagatccaggagcgctccggcctgggcgacgagacctacggcccccagggcctggtgca cgacatgcccctgcgcatgaacttcgccgccgcccgcgaggagaccgagcaggtgatcaacggcgccctggagaa gctgttcgagaacaccaaggtgaacccccgcgagatcggcatcctggtggtgaactcctccatgttcaaccccacccc ctccctgtccgccatggtggtgaacaccttcaagctgcgctccaacatcaagtccttctccctgggcggcatgggctgct ccgccggcatcatcgccatcgacctggccaaggacctgctgcacgtgcacaagaacacctacgccctggtggtgtcc accgagaacatcacccactccacctacaccggcgacaaccgctccatgatggtgtccaactgcctgttccgcatgggc ggcgccgccatcctgctgtccaacaaggccggcgaccgccgccgctccaagtacaagctggcccacaccgtgcgca cccacaccggcgccgacgaccagtccttccgctgcgtgcgccaggaggacgacgaccgcggcaagatcggcgtgt gcctgtccaaggacatcaccgccgtggccggcaagaccgtgaccaagaacatcgccaccctgggccccctggtgct gcccctgtccgagaagttcctgtacgtggtgtccctgatggccaagaagctgttcaagaacaagatcaagcacaccta cgtgcccgacttcaagctggccatcgaccacttctgcatccacgccggcggccgcgccgtgatcgacgtgctggagaa gaacctggccctgtcccccgtggacgtggaggcctcccgctccaccctgcaccgcttcggcaacacctcctcctcctcc atctggtacgagctggcctacatcgaggccaagggccgcatgaagaagggcaacaaggtgtggcagatcgccatcg gctccggcttcaagtgcaactccgccgtgtgggtggccctgtgcaacgtgaagccctccgtgaactccccctgggagc actgcatcgaccgctaccccgtggagatcaactacggctcctccaagtccgagacccgcgcccagaacggccgctcc ZU^GCGGAGGCCTTGGAAATATTCGCGTCACGCGAGGAGTAGGCTCTGCTGGTCGGCCCTGGATAC GCTGACTCTTCAAGCAGTGGGGCACCACACCCACCTTTTGCCAAGGGCAAGGAGTCGGAAGGGGGC GGGGCTGCCATGCACCCCTGACGGGCATGGCCGTTCCGCGAGGGCGCCAACTGCGGCGGCCTGCCCG CTGGCTCGTGCCCCCCTACCCCCACCATTGCCTGGAGCGTTTCCATCCCCAAATCACATTCCATCCAA GTTGTATCACTATGCCCCTTTGGCTCTATACACTCACGGCCTGAGGTCCCTTCTCGGCCGTGGCGGCA CACGCCCAACCCCCCACCATACTCTTTCCATACACTGCAATGCTTCGAGCCTGCCTGCCACCTGCTCT GCTTGTCTCCCCTCCCTTCCCTTGAGGTTTTCCAATGCAGTAAGAGAAGTCGACGTGCATGGACAGATGATTGAGAGATGAGgaattCggcttactcgttctgatcaagggagcctctgcaccttaaccctgccaggatcgaaaccaaccttgtcagtcccgtggtgggc aacatcatcctcgtgaagctgattgaccaggaaaacatgatgagtcggtatgaggacgagcatgagtggcccaacatcga tatgacacatcttggagtttacggcaaatgtatcacacttccatcctggcttgcaccacaatattagtggacccctccttgcagt ggcacggtgagaagctagtttgtagtaatcttcttaatgacgaaccagacgtgtgtaatggcctccttgagtgatggaagg atggaacctaccccccccctccccagtactctgcggtacatccgagtaacccttccattgatcagcccaaacgcaatatgca acgactctacatacggccaccgagtgcttattccttcgctatcaccgcacaaaaatcccatccgcgaactcatccgaggtga tagattgcgatcggggtatcgggttaaggtgcgactagggatccctgaatcttttggggatttccccgggtctcgtcctgca tgcttatcatcagtctcgtgggttattggatcgctgcgcatgccataacagagcgctcataatatttgctgcggcggtggtgc tggcaaaatcccctgcgtaccgggcgcctgtcaagccaaccccgccgtgcggcactcccctgcagatccatcacq47U atcgagcaggacggcctccacgccggctcccccgccgcctgggtggagcgcctgttcggctacgactgggcccagca gaccatcggctgctccgacgccgccgtgttccgcctgtccgcccagggccgccccgtgctgttcgtgaagaccgacctg tccggcgccctgaacgagctgcaggacgaggccgcccgcctgtcctggctggccaccaccggcgtgccctgcgccg ccgtgctggacgtggtgaccgaggccggccgcgactggctgctgctgggcgaggtgcccggccaggacctgctgtcc tcccacctggcccccgccgagaaggtgtccatcatggccgacgccatgcgccgcctgcacaccctggaccccgccac ctgccccttcgaccaccaggccaagcaccgcatcgagcgcgcccgcacccgcatggaggccggcctggtggacca ggacgacctggacgaggagcaccagggcctggcccccgccgagctgttcgcccgcctgaaggcccgcatgcccga cggcgaggacctggtggtgacccacggcgacgcctgcctgcccaacatcatggtggagaacggccgcttctccggct tcatcgactgcggccgcctgggcgtggccgaccgctaccaggacatcgccctggccacccgcgacatcgccgagga gctgggcggcgagtgggccgaccgcttcctggtgctgtacggcatcgccgcccccgactcccagcgcatcgccttcta CCgCCZgcZggacgagZfcZfcZGz4GCTGTTCCTAGGAACGTGGAGGAGGTGCAAGGAGGGTGATCTCAC CCTGGTGTGTCTCTTCATGGAGCTCAGATCTTGAAAACTGTGAGGTGCTTATCCGATACCTGCTTCGT GCATGGCTTGTGCGATATGTACACGCATTTGCAGATTGGTGGGAGCAGCAGATTGGTGGGAGCAGCA TAGAGCTTTAGAAGGGGCTTAGGAGCGGGAATGTGAAACTCAGGCGGTTGGGCCAGATGAGAGCGC AAAOgatatcGCGGGAGGCGGAAGCCCTGGAAGCATGCCGTCGGACGTGGCA GCCGCTGCGCACCTGTACAGGGCGGACTCGTCACTGGCCCCCAGCGAAAG CAATCTCGGTGTCTCATGCCTGTCCCGTGGGTAGACAGTGCGCCTTCAGTGGAAAGCTGCACTCCTAGCGCAGAGGGTCAGCCCTTCATGACTGTCCAACC TGCTGCAGTGCCTGTATCTTATAGCTCAGGGAACCAGGGGCAGGGTGAAG GATGGAGGGGGCCATCAACTTCAAAGGTGCGGGAACGATTGTCCGAGGT GTATCCGGTCGCTCGCAAAACACCCTGATGAGGGCTGGGCGTTTGTGAAC CAGGCTCCTCATGAACCTCCTCCTAGGAGCGCGTTCGAGAGCAAGAAGCTACCCCTTTGATTGTACCTTCGACACCTTGACAATCAGAGGCGAGGCCCGCT GCATCCGGCGGATGCGCGCCGGACCCAAGCTCGCTCTGGCCACGATCACC CTCCTCTCCGCCTGGGGCATTGCCACCGTCCACTGGTACCAGCAGGAGGA ACGCGAGGTGAGGGGGAAGGCCGGTAGGGGCTTCGAGGGCGTCACGGGG CAGGCCGACACGCAACCTTCAATCCCCAGCCCCCGCCCGCAAACATGTCA GGCCTTGCACAAGGGCGTGATCCGGGATGAGGAGCTGTACAAGCTGAAG GTGGAGCAGTTTCGGAAGGCTGCCCAGCATCAGGGGGGCAGCAACTGAT GGTGGGCGACAAGACCCTCCATGCATGCAAGGTCCCTGACTGTGGGGGTC ACGGGAGACAGCGCGCCCCTACAAGGCTGTGAGCAAGGAATACAGCCCA CCaagctt (SEQ ID NO: 20)[000239] Relevant restriction sites in the construct are indicated in lowercase, bold, and are from 5’ to 3’ Hindlll, Spel, EcoRI, EcoRV, and Hindlll, respectively. Hindlll sites delimit the 5’ and 3’ ends of the transforming DNA at the A. protothecoides FAD2 locus. Underlined, uppercase sequences represent genomic DNA from A. protothecoides that permit targeted integration of heterologous gene cassettes at the ApFAD2 locus via homologous recombination. Proceeding in the 5’ to 3’ direction, the A. protothecoides stearoyl ACP desaturase (ApSAD2vl) promoter, driving the expression of codon-optimized Cg-KCS, is indicated by the lowercase boxed text. The initiator ATG and terminator TGA for Cg-KCS are indicated in uppercase italics, while the coding region is indicated in lowercase italics. The terminator region of the A. protothecoides stearoyl ACP desaturase (ApSAD2vl terminator) gene is indicated by small capitals followed by the A. protothecoides phosphoglycerate kinase 1 (ApPGKl) promoter in, indicated in lowercase, boxed text, driving expression of neomycin phosphotransferase II gene (Neo, codon-optimized for expression in d. protothecoides and encoding neomycin phosphotransferase II, thereby enabling the strain to grow on aminoglycoside antibiotic G418). The initiator ATG and terminator TGA for Neo are indicated in uppercase italics while the rest of the sequence is indicated in lowercase italics. The terminator region of the A. protothecoides phosphoglycerate kinase 1 (ApPGKl) terminator is indicated by small capitals followed by A. protothecoides ApFAD2 genomic region indicated by the underlined uppercase text.[000240] pPB0547, pPB0548, pPB0549, pPB0550, and pPB0551 have the same vector backbone; selectable marker, promoters, and 3’ untranslated region (UTR) as pPB0546, differing only in the respective KCS gene being tested. In these constructs, we tested the function of C. hispanica abyssinica (pPB0547), L. annua (pPB0548), L. douglasii (pPB0549), or M. oleifera (KCS2 and KCS3, pPB0550 and pPB0551 respectively) KCS instead of C. graeca KCS contained in pPB0546. Relevant restriction sites in all these constructs are also the same as in pPB0546. SEQ ID NO: 21, 22, 23, 24, and 25 indicates the sequences of CrhKCS, LaKCS, LdKCS, MoleKCS2, and MoleKCS3 in lowercase with the initiator ATG and terminator TGA codons in uppercase italics. pPB0547ATGacctccatcaacgtgaagctgctgtaccactacgtgatcaccaacctgttcaacctgtgcttcttccccctgaccgc catcgtggccggcaaggcctcccgcctgaccatcgacgacctgcaccacctgtactactcctacctgcagcacaacgt gatcaccatcgcccccctgttcgccttcaccgtgttcggctccatcctgtacatcgtgacccgccccaagcccgtgtacct ggtggagtactcctgctacctgccccccacccagtgccgctcctccatctccaaggtgatggacatcttctaccaggtgc gcaaggccgaccccttccgcaacggcacctgcgacgactcctcctggctggacttcctgcgcaagatccaggagcgc tccggcctgggcgacgagacccacggccccgagggcctgctgcaggtgcccccccgcaagaccttcgccgccgccc gcgaggagaccgagcaggtgatcgtgggcgccctgaagaacctgttcgagaacaccaaggtgaaccccaaggac atcggcatcctggtggtgaactcctccatgttcaaccccaccccctccctgtccgccatggtggtgaacaccttcaagctg cgctccaacgtgcgctccttcaacctgggcggcatgggctgctccgccggcgtgatcgccatcgacctggccaaggac ctgctgcacgtgcacaagaacacctacgccctggtggtgtccaccgagaacatcacctacaacatctacgccggcga caaccgctccatgatggtgtccaactgcctgttccgcgtgggcggcgccgccatcctgctgtccaacaagccccgcga ccgccgccgctccaagtacgagctggtgcacaccgtgcgcacccacaccggcgccgacgacaagtccttccgctgc gtgcagcagggcgacgacgagaacggcaagaccggcgtgtccctgtccaaggacatcaccgaggtggccggccg caccgtgaagaagaacatcgccaccctgggccccctgatcctgcccctgtccgagaagctgctgttcttcgtgaccttca tggccaagaagctgttcaaggacaaggtgaagcactactacgtgcccgacttcaagctggccatcgaccacttctgca tccacgccggcggccgcgccgtgatcgacgtgctggagaagaacctgggcctggcccccatcgacgtggaggcctc ccgctccaccctgcaccgcttcggcaacacctcctcctcctccatctggtacgagctggcctacatcgaggccaagggc cgcatgaagaagggcaacaaggtgtggcagatcgccctgggctccggcttcaagtgcaactccgccgtgtgggtggc cctgtccaacgtgaaggcctccaccaactccccctgggagcactgcatcgaccgctaccccgtgaagatcgactccga ctccgccaagtccgagacccgcgcccagaacggccgctccTGA (SEQ ID NO: 21)pPB0548ATGacctccatcaacgtgaagctgctgtaccactacgtgatcaccaacttcttcaacctgtgcttcttccccctgaccgc catcctggccggcaaggcctcccgcctgaccaccaacgacctgcaccacttctactcctacctgcagcacaacctgat caccctgaccctgctgttcgccttcaccgtgttcggctccgtgctgtacttcgtgacccgccccaagcccgtgtacctggtg gactactcctgctacctgcccccccagcacctgtccgccggcatctccaagaccatggagatcttctaccagatccgca agtccgaccccctgcgcaacgtggccctggacgactcctcctccctggacttcctgcgcaagatccaggagcgctccg gcctgggcgacgagacctacggccccgagggcctgttcgagatccccccccgcaagaacctggcctccgcccgcga ggagaccgagcaggtgatcaacggcgccctgaagaacctgttcgagaacaccaaggtgaaccccaaggagatcg gcatcctggtggtgaactcctccatgttcaaccccaccccctccctgtccgccatggtggtgaacaccttcaagctgcgct ccaacatcaagtccttcaacctgggcggcatgggctgctccgccggcgtgatcgccatcgacctggccaaggacctgc tgcacgtgcacaagaacacctacgccctggtggtgtccaccgagaacatcacccagaacatctacaccggcgacaa ccgctccatgatggtgtccaactgcctgttccgcgtgggcggcgccgccatcctgctgtccaacaagcccggcgaccg ccgccgctccaagtaccgcctggcccacaccgtgcgcacccacaccggcgccgacgacaagtccttcggctgcgtgc gccaggaggaggacgactccggcaagaccggcgtgtccctgtccaaggacatcaccggcgtggccggcatcaccgt gcagaagaacatcaccaccctgggccccctggtgctgcccctgtccgagaagatcctgttcgtggtgaccttcgtggcc aagaagctgctgaaggacaagatcaagcactactacgtgcccgacttcaagctggccgtggaccacttctgcatccac gccggcggccgcgccgtgatcgacgtgctggagaagaacctgggcctgtcccccatcgacgtggaggcctcccgctc caccctgcaccgcttcggcaacacctcctcctcctccatctggtacgagctggcctacatcgaggccaagggccgcatg aagaagggcaacaaggcctggcagatcgccgtgggctccggcttcaagtgcaactccgccgtgtgggtggccctgcg caacgtgaaggcctccgccaactccccctgggagcactgcatccacaagtaccccgtgcagatgtactccggctcctc caagtccgagacccgcgcccagaacggccgctccTGA (SEQ ID NO: 22) pPB0549ATGtccgagaccaagcccgagaagcccctgatcgccaccgtgaagaacaccctgcccgacctgaagctgtccatc aacctgaagcacgtgaagctgggctaccactacctgatcacccacggcatgtacctgtgcctgccccccctggccctg gtgctgttcgcccagatctccaccctgtccctgaaggacttcaacgacatctgggagcagctgcagttcaacctgatctc cgtggtggtgtcctccaccctgctggtgtccctgctgatcctgtacttcatgacccgcccccgccccgtgtacctgatggac ttcgcctgctacaagcccgacgagacccgcaagtccacccgcgagcacttcatgaagtgcggcgagtccctgggctc cttcaccgaggacaacatcgacttccagcgcaagctggtggcccgctccggcctgggcgacgccacctacctgcccg aggccatcggcaccatccccgcccacccctccatgaaggccgcccgccgcgaggccgagctggtgatgttcggcgc catcgaccagctgctggagaagaccaaggtgaaccccaaggacatcggcatcctggtggtgaactgctccctgttctc ccccaccccctccctgtcctccatgatcgtgaaccactacaagctgcgcggcaacatcatctcctacaacctgggcggc atgggctgctccgccggcctgatctccgtggacctggccaagcgcctgctggagaccaaccccaacacctacgccctggtgatgtccaccgagaacatcaccctgaactggtacatgggcaacgaccgctccaagctggtgtccaactgcctgttcc gcatgggcggcgccgccgtgctgctgtccaacaagacctccgacaagaagcgctccaagtaccagctggtgaccac cgtgcgctcccacaagggcgccgacgacaactgctacggctgcatcttccaggaggaggactccaacggcaagatc ggcgtgtccctgtccaagaacctgatggccgtggccggcgacgccctgaagaccaacatcaccaccctgggccccct ggtgctgcccatgtccgagcagctgctgttcttcgccaccctggtggcccgcaaggtgttcaagaagaagatcaagccc tacatccccgacttcaagctggccttcgaccacttctgcatccacgccggcggccgcgccgtgctggacgagctggag aagaacctgcagctgtcctcctggcacctggagccctcccgcatgaccctgtaccgcttcggcaacacctcctcctcctc cctgtggtacgagctggcctactccgaggccaagggccgcatccgcaagggcgagcgcgtgtggcagatcggcttcg gctccggcttcaagtgcaactccgccgtgtggaaggccctgaagtccgtggaccccaagaaggagaagaacccctg gatggacgagatccaccagttccccgtggccgtggtgTGA (SEQ ID NO: 23) pPB0550ATGgccgagcccaagctggacaagcccctgatcgcccccagcgccagcagccgcctgcccgacttcaagcaggg cgtgaagctgaagtacgtgaagctgggctaccactacctggtgacccacgccatgtacctgttcctgagccccctggcc gtgatcaccgtggtgcagctgagcaccttcagcctgcaggacgtgcacgacctgctgggcaagctgcgctacaacctg atcagcgtgatcctgtgcagcagcaccctggtgttcctgagcaccctgtacttcctgacccgcccccgccccgtgtacct ggtggacttcagctgcttcaagcccgacgacgacgacaagaagtgcagctggcagcgcttcatcaagtgcagcgag agcatcggcaccaccaccgaggagaacatcgagttccagcgcaagatcatggtgcgcagcggcctgggcgagagc acctacctgccccccgccatcctgaacatcccccccaaccccagcatggccgaggccaccgaggaggtgaagatga tcatgttcggcgccctggaccacctgttcgagaagaccagcgtgaaccccaaggacatcagcatcctgatcgtgaact gcagcatcttcaaccccacccccagcctgagcgccatggtggtgaaccactacaagctgcgcgagaacatccgcacc tacaacctgggcggcatgggctgcagcgccagcctgatcagcatcgacctggccaaggacctgctgcgcgtgaaca gcaacagctacgccctggtggtgagcatggagagcatcaccatgaactggtacttcggcaacgagaagagcatgatc ctgagcaactgcctgttccgcatgggcggcgccgccgtgctgctgagcaacaagatgagcgaccgctggcacagca agtacaagctggtgcacaccgtgcgcacccaccgcggcagcgacgacaagtgctacacctgcgccacccagcgcg aggacagcatcggcaagatcggcatcagcctgagcaaggacctgatggccgtggccggcgacgccctgaaggcca acatcaccaccctggaccccctggtgctgcccatcagcaagcagctgctgttcttcgccaccctggtgggccgcaagtt cttcaaggtgaagatgaagccctacatccccgacctgaagctggccttcgagcacttctgcatccacgccggcggccg cgccgtgctggacgagctgcagaagaacctgcagctgaccgactggcacatcgagcccagccgcatgaccctgtac cgcttcggcaacatcctgagcagcagcatctggtacgagctggcctacaccgaggccaagggccgcgtgaagaagg gcgaccgcacctggcagatcaccctgggcagcggcttcaagtgcaacagcgccgtgtgggaggccctgcgcaccatcaaccccgagaaggagaagaacccctggatgatcgagatccaccagttccccgtgaacgtgcccaaggtgagcgc catcTGA (SEQ ID NO: 24) pPB0551ATGgccgagcccaagctggacaagcccctgatcgcccccagcgccagcccccgcctgcccgacttcaagcaggg cctgaagctgaagtacgtgaagctgggctaccactacctggtgacccacgccatgtacctgttcctgagccccctggcc gtgatcaccgtggtgcagctgagcgccttcagcctgcaggacgtgcacgacctgctgggccagctgcagtacaacatc atcagcgtgatcctgtgcagcagcaccctgctgttcctgagcaccctgtacttcctgacccgcccccgccccgtgtacct ggtggacttcagctgcttcaagcccgacgacgacaacaagtgcagctggcagcgcttcatgaagtgcagcgagagc atcggcaccttcaccgaggagaacatcgagttccagcgcaagatcatggcccgcagcggcctgggcgagagcacct acctgccccccgccgtgatgaacatcccccccaaccccagcatggccggcgcccgcgaggaggccaagatgatcat gttcggcgccctggaccgcctgttcgagaagaccagcgtgaagcccaaggacatcagcatcctgatcgtgaactgca gcctgttcaaccccgtgcccagcctgagcgccatggtggtgaaccactacaagctgcgcggcaacatccgcacctac aacctgggcggcatgggctgcagcgccggcctgatcagcatcgacctggccaaggacctgctgcgcgtgcacccca acagctacgccctggtggtgagcatggagagcatcaccaccaactggtacttcggcaacgaccgcagcatgatcctg agcaactgcctgatccgcatgggcggcgccgccgtgctgctgagcaacaagatgagcgaccgctggcacagcaagt acaagctggtgcacaccgtgcgcacccacaagggcagcgacgacaagtgctacacctgcgtgacccagcgcgagg acagcatcggcaagatcggcatcagcctgagcaaggacctgatggccgtggccggcgacgccctgaaggccaaca tcaccaccctgggccccctgatgctgcccatgagcgagcagctgcccttcttcgccaccctggtgcgccgcaagttcttc aaggtgaaggtgaagccctacatccccgacttcaagctggccttcaagcacttctgcatccacgccggcggccgcgcc gtgctggacgagctgcagaagaacctgcagatcaccgactggcacatcgagcccagccgcatgaccctgtaccgctt cggcaacaccctgagcagcagcctgtggtacgagctggcctacatcgaggccaagggccgcgtgaagaagggcga ccgcacctggcagatcgccttcggccccggcttcaagtgcaacagcgccgtgtgggaggccctgcgcaccatcaacc ccgccaaggagaagaacccctggatgaccgagatcgaccgcttccccTGA (SEQ ID NO: 25)[000241] pPB0547, pPB0548, pPB0549, pPB0550, and pPB0551 were transformed separately into A. protothecoides. Transformants were grown under lipid production conditions and fatty acid profiles were obtained. Fatty acid profiles from representative lines transformed with pPB0546, pPB0547, and pPB0549 are shown in Table 9.Table 9. Fatty Acid Profiles[000242] As previously observed with Apet-KCS (pPB0377) and Mole-KCSl (pPB0378), the expression of KCS enzymes from C. graeca (pPB0546), C. abyssinica (pPB0547), and a KCS variant from M. oleifera (MoleKCS2; pPB0549) in A. protothecoides led to the accumulation of very long-chain fatty acids (VLCFAs), including eicosenoic acid (C20: l) and erucic acid (C22:l), beyond the levels found in the parent strain PB5 (Table 9). Both CgKCS and MoleKCS2 facilitated the production of docosanoic acid (C22:0, also known as behenic acid), in addition to C20: l and C22: 1, indicating that these KCS enzymes have the capability to elongate both saturated (C18:0) and unsaturated (C18: ln9) fatty acids, similar to what was previously observed with Mole-KCSl. However, none of the newly expressed KCS enzymes resulted in elongation beyond C22:l, and no nervonic acid peaks were detected on the chromatogram.[000243] Example 10. Optimizing the production of VLCFAs in Auxenochlorella protothecoides[000244] In very long chain fatty acid (VLCFA) biosynthesis, the enzymes KCS (3 -ketoacyl -Co A synthase), KCR (3-ketoacyl-CoA reductase), ECR (enoyl-CoA reductase), and HACD (hydroxyacyl-CoA dehydratase) work sequentially to elongate fatty acids. KCS, which is the rate-limiting enzyme in this process, initiates the elongation by condensing a malonyl-CoA with a fatty acyl-CoA to form a 3-ketoacyl- CoA. KCR then reduces this 3-ketoacyl-CoA to a 3-hydroxyacyl-CoA. HACD subsequently dehydrates the 3-hydroxyacyl-CoA to form a trans-2,3-enoyl-CoA, whichECR finally reduces to produce a longer fatty acyl-CoA, completing one cycle of elongation.[000245] While KCS is the rate-limiting enzyme and thus plays a crucial role in determining the overall rate of VLCFA biosynthesis, KCR, ECR, and HACD are also essential for the process. These enzymes ensure the proper completion of each elongation cycle by sequentially converting the intermediates formed after KCS activity. Although they do not control the rate of the process, their activities are vital for the structural integrity and elongation of fatty acids. Suboptimal expression or any dysfunction in these enzymes can disrupt the VLCFA biosynthesis pathway, leading to incomplete or defective fatty acid products, which can have significant biological consequences.[000246] After identifying several heterologous KCS enzymes that exhibited activity in our host, A. protothecoides, we moved forward with evaluating the effects of co-expressing heterologous KCS, ECR, and HACD enzymes within the PES45 and PES46 backgrounds. Specifically, we assessed the impact of introducing an A. petiolata KCR (Apet-KCR) and M. oleifera KCR (Mole-KCR; Accession number: QDA34240) in both PES45 and PES46 strains. To achieve this, we constructed plasmids pPB0495 (ApDAOl : :CrTUB2-ScSUC2-ApPGHUTR: ApFATAlvlp- ApetKCR-ApSAD2vlUTR: ApDAOl), pPB0496 (ApDAOl ::CrTUB2-ScSUC2- ApPGHUTR:ApSAD2vlp-ApetKCR-ApSAD2vlUTR::ApDA01), pPB0497 (ApDAOl : :CrTUB2-ScSUC2-ApPGHUTR:ApMLDPp-ApetKCR-ApSAD2vlUTR: ApDAOl), and pPB0498 (ApDAOl ::CrTUB2-ScSUC2- ApPGHUTR:ApAMTlp-ApetKCR-ApSAD2vlUTR: ApDAOl), each designed to express Apet-KCR under the control of different promoters: ApFATA, ApSAD2, ApMLDPl, or ApAMTl, respectively. Similarly, plasmids pPB0499 (ApDAOl : :CrTUB2-ScSUC2-ApPGHUTR:ApF ATAlvlp-MoleKCR- ApSAD2vlUTR:: ApDAOl), pPB0500 (ApDA01 ::CrTUB2-ScSUC2- ApPGHUTR:ApSAD2vlp-MoleKCR-ApSAD2vlUTR: ApDAOl), pPB0501 (ApDAOl : :CrTUB2-ScSUC2-ApPGHUTR:ApMLDPp-MoleKCR- ApSAD2vlUTR: ApDAOl), and pPB0502 (ApDAOl ::CrTUB2-ScSUC2- ApPGHUTR:ApAMTlp-MoleKCR-ApSAD2vlUTR: ApDAOl) were engineered to express Mole-KCR, also driven by the ApFATA, ApSAD2, ApMLDPl, or ApAMTlpromoters, respectively. These constructs allowed us to systematically assess the impact of promoter selection on KCR expression and activity in our engineered strains.[000247] The sequence of pPB0495 is shown below (SEQ ID NO: 26) pPB0495 gatatcCAAGGTCGCTAGGACAGGACCAGACTCGAGAATCAGTTTTCCGCAGAAATTGAAGCTTTACGTTGAGTGCTCAAGCTCTTCGGTTGCAAAATTGTGC TCGATGGAAGGCGGGACAAAATGCGCAATTACATGCAGGTGAAAGTTCA ATACGACGATCTGGGAGTGTGAGTGGGTCCACAATGCTCCCGAGTAGCAC ATGCAATTTTTAGCTCTTCACCTCCCCGTCAATTCTGTTTTCTTCCGCTTTT TCCAAATGGGATGCTGTTGGCAGTGAGAACAGCGTTATTGATGTTCGGTTT ATGGATCTTATTATCTGACACTGCTGTGCGTGCACTGCTGTATTGCAGCCA CCTGCGGCATTTGCATGCAGAATTCGATCAAACATTTCTTTCTATCGGGCC AGTAGAGAATGGTGGACCATTGCAAGCTTGGAATCTACAGCGCTCATCCT GGCCAAGCAGGTTTCTGTCTCGGCATCAGGCATCGAGCGCGGGTCGCCGA CAAGGGCCTCCGGAACCGGTCGAGATCAGGGCGTAATCAGGCAAAGCCA AACAACCCAACAGCTTGTATTTGTTGATTGGTTCTGTAGTCGGGAGGTTGC CCTTAGCTCGAGCCGCGGACCTCGCAATGGACCAGAGCACCCGGCGACGTGTCAGGCACTTGACGGAACTCCTCTCACCCGCATCTCATCCCCTGGGGTTC GATGAACCGGTGAGAGCCGTCAAGTGTTCATCCCGGCGAAGCTCCCGAGT CTGCGTGCTGGGAGCTGGCGTGGTGGGGCTGACCACGGCCCTCAGACTCC TCGAGCGATTCCactagt|ctttcttgcgctatgacacttccagcaaaaggtagggcgggctgcgagacggcttc ccggcgctgcatgcaacaccgatgatgcttcgaccccccgaagctccttcggggctgcatgggcgctccgatgccgctcc agggcgagcgctgtttaaatagccaggcccccgattgcaaagacattatagcgagctaccaaagccatattcaaacaccta gatcactaccacttctacacaggccactcgagcttgtgatcgcactccgctaagggggcgcctcttcctcttcgtttcagtca ca^ccc^&aacA TGclgclgcaggccllcclgllcclgclggccggcllcgccgccaagalcagcgcclccalgacg aacgagacgtccgaccgccccctggtgcacttcacccccaacaagggctggatgaacgaccccaacggcctgtggt acgacgagaaggacgccaagtggcacctgtacttccagtacaacccgaacgacaccgtctgggggacgcccttgttc tggggccacgccacgtccgacgacctgaccaactgggaggaccagcccatcgccatcgccccgaagcgcaacgac tccggcgccttctccggctccatggtggtggactacaacaacacctccggcttcttcaacgacaccatcgacccgcgcc agcgctgcgtggccatctggacctacaacaccccggagtccgaggagcagtacatctcctacagcctggacggcggc tacaccttcaccgagtaccagaagaaccccgtgctggccgccaactccacccagttccgcgacccgaaggtcttctggtacgagccctcccagaagtggatcatgaccgcggccaagtcccaggactacaagatcgagatctactcctccgacga cctgaagtcctggaagctggagtccgcgttcgccaacgagggcttcctcggctaccagtacgagtgccccggcctgat cgaggtccccaccgagcaggaccccagcaagtcctactgggtgatgttcatctccatcaaccccggcgccccggccg gcggctccttcaaccagtacttcgtcggcagcttcaacggcacccacttcgaggccttcgacaaccagtcccgcgtggt ggacttcggcaaggactactacgccctgcagaccttcttcaacaccgacccgacctacgggagcgccctgggcatcg cgtgggcctccaactgggagtactccgccttcgtgcccaccaacccctggcgctcctccatgtccctcgtgcgcaagttc tccctcaacaccgagtaccaggccaacccggagacggagctgatcaacctgaaggccgagccgatcctgaacatca gcaacgccggcccctggagccggttcgccaccaacaccacgttgacgaaggccaacagctacaacgtcgacctgtc caacagcaccggcaccctggagttcgagctggtgtacgccgtcaacaccacccagacgatctccaagtccgtgttcgc ggacctctccctctggttcaagggcctggaggaccccgaggagtacctccgcatgggcttcgaggtgtccgcgtcctcc ttcttcctggaccgcgggaacagcaaggtgaagttcgtgaaggagaacccctacttcaccaaccgcatgagcgtgaa caaccagcccttcaagagcgagaacgacctgtcctactacaaggtgtacggcttgctggaccagaacatcctggagct gtacttcaacgacggcgacgtcgtgtccaccaacacctacttcatgaccaccgggaacgccctgggctccgtgaacat gacgacggggglggacaacclgllclacalcgacaagllccagglgcgcgagglcaagT(jA'\'\(.ti\'\'\(.t(.ti\i\C'\c ACAAAGCGGCCCACGGCTTCGAACGTCCCGTGTCAATTGCGCGGGGTGTGCCAGAGTTTCTGCGCCACCGATGCTCACCCTAGGGGGGGATGCCCTTTGACATTCATGTGTGCCTGCATGCACGTTTGTATCAGT CTCACCACACCTTGAAGATTTTTGGGAGGGGGGGGGAAGTCGGAATGGAAACgCggCCgc|ggaatCCC gcctccgagatgaagccgtggtggcacggaggaggccgctgcgggccagagtgtctctgctgcacgtcctccggctt tggtggctcgctgggcttgggtgcggccatgagctgcagtgcaagtgtacatataggtcaatcttatgacccggcactacc aatgatgatcaacaccgagcggccctctgtgtgtgcttgcctcttaccttcactgcgtactgctgcaggagcttcatgagga tcacactgacggtcagggggatcagcacccagtcccggacatcccgatccagtacgaggtcctggctgaccatgatggta ggtgaagttgggccctgggaggagcgctagaggagcctcggggcaaagatcaccctactctgacgtggctggctcaatc acccatccctcccctttgaagtcggctctcagtttgcgttgtttcgaaatcgagccacaatcgaatatacactacctaaaggct ctcaccacctggcgtacctcggaatgcccatcagcccaaacacatgagaaaaggcgcgcgcggttcgaccccagtccgt cgattgacgcagtggggagctccattctgtcagctcttgggtggccaggtcgctgacagattggcacatacaggaccctgc cgacccgttcctccagcactttgtgaatttaagcagcgcattagatcgtcgatggcttagagaaccccgcgcctgctccccc atctccctttcacacgtttgaacacccggaccggcc[47GgagafcZgcacctocZfcaagfcccagcccaccZggcZgcZ gatcctgttcctgctgggctccatctccatctccaagttcaccttcaccctgctgcgctccttctacatctacttcctgcgccc cgccaagaacctgcgcaagtacggctcctgggccctgatcaccggccccaccgacggcatcggcaaggccttcgcct tccagctggcccagaagggcttcaacctgatcctggtgggccgcaaccccgagaagctgaaggacgtgtccgagtcc atccgctccaagtacaacaagacccagatcctgaccgtggtgatggacttctccggcgacatcgacgagggcgtgaa gcgcatcaaggagaccatcgagggcctggaggtgggcgtgctgatcaactccgccggcatctcctacccctacgccaagtacttccacgaggtggaccaggagctgctgaacaacctgatcaagatcaacgtggagggcaccaccaaggtgac ccaggccgtgctgcccaacatgctggcccgcaagcgcggcgccatcgtgaacatgggctccggcgccgccgccctg atcccctcctaccccttctactccgtgtacgccggcgccaagacctacgtggaccagttcaccaagtgcctgcacgtgg agtacaagaagtccggcatcgacgtgcagtgccaggtgcccctgtacgtggccaccaagatgaccaagatccgcaa ggcctccttcctggtggcctcccccgagggctacgccaaggccgccctgcgcttcgtgggctacgaggcccagtgcac cccctactggccccacgccctgatgggcgccgtgatctccgccctgcccgagtccatcttcgagtccttcaacatcaagc gctgcctgcagatccgcaagaagggcctgcagaaggactccatgaagaaggagTAGGCGGAGGCC'Y'YGGkk ATATTCGCGTCACGCGAGGAGTAGGCTCTGCTGGTCGGCCCTGGATACGCTGACTCTTCAAGCAGTG GGGCACCACACCCACCTTTTGCCAAGGGCAAGGAGTCGGAAGGGGGCGGGGCTGCCATGCACCCCT GACGGGCATGGCCGTTCCGCGAGGGCGCCAACTGCGGCGGCCTGCCCGCTGGCTCGTGCCCCCCTAC CCCCACCATTGCCTGGAGCGTTTCCATCCCCAAATCACATTCCATCCAAGTTGTATCACTATGCCCCT TTGGCTCTATACACTCACGGCCTGAGGTCCCTTCTCGGCCGTGGCGGCACACGCCCAACCCCCCACC ATACTCTTTCCATACACTGCAATGCTTCGAGCCTGCCTGCCACCTGCTCTGCTTGTCTCCCCTCCCTTC CCTTGAGGTTTTCCAATGCAGTAAGAGAAGTCGACGTGCATGGACAGATGATTGAAGATGAGCttaagTGGATCTGGTGGCCAAATGGGGAGCTGCCACATTTCAGCACTACATGGAT CTGTATCGCACCAAGCACGCTGCCGACGCAGGCGAGCGGTCATGGGAGA AGGGACGGTGAGAAGCATTTACTTGCGAGGCGTACAAGCCGTCTTCTGCTAAATTTGCTGAGACTGAATGCCCAGATCCACATGAAGCACTCCATCTTCCT CCTGCCCCCTTCCACCCACTCCCTCAGGTGTCATGCTGACTGGTGGGTATG ACCTCTCGTCGGTACCCCTCCCAGAGGAGAAGCCTTTCTGGGCCGACATCT TGCTTGCCTTCAGACGGCTGGAAAGCAGTGAGCTGGCCGCCTTCGATCCA AGCGGTACATCCGTCGATGGCTACGGATTCACCACAATTGTGACGTGAGG CGGCCAATTATGGGAAAGGAAGCTCCACTTCAAGCGGCATGCCCTTGCAA GCTGAGGGGGAGTGCAGACCTCCTCATGCCTTGAATTTGCAGGGAGGCCA GCGACTCTGCCCCTTTCCACCGAGCAGGGAGGGGCGACTTTACCTGGTCT GGTTGATGAAGCAGATTGAGCAGCTGGGCGGCAGGCACGAGCGCCGTCA TGTCAGCAGCTTGGATGAGCTGGCCGATTACGATGCCGTGGTCAACTGCA CAGGTGCGCACGTGGTCGGGTTGCATGAGCCAGCACGGGGGGCGCAGCC CTCCCCTGCTCCCGGGACAGGCACGCCGACGCCGTTTTGCATCATCAGCC GAGAGCCTCTGTGAGGCAGGCCCACATTCCTCACCCCATCcatatg (SEQ IDNO: 26)[000248] Relevant restriction sites in the construct are indicated in lowercase, bold, and are from 5 ’to 3’ EcoRV, Spel, Notl, Aflll, EcoRV, respectively. EcoRV restriction endonuclease site used to generate linear DNA and for cloning is indicatedin lowercase bold and delimits the 5’ and 3’ ends of the transforming DNA. Underlined, uppercase sequences represent genomic DNA from A. protothecoides that permit targeted integration of the transforming DNA at the D-aspartate oxidase 1 (DA01) genomic locus via homologous recombination. Proceeding from 5’ to 3’, the selection cassette contains the C. reinhardtii beta tubulin 2 (CrTUB2) promoter in lowercase, boxed text, driving expression of Saccharomyces cerevisiae SUC2 gene (ScSUC2), codon-optimized for expression in A. protothecoides and encoding sucrose invertase, thereby enabling the strain to utilize exogenous sucrose. The initiator ATG and terminator TGA for ScSUC2 are indicated in uppercase italics while the rest of the sequence is indicated in lowercase italics. The terminator region of the A. protothecoides enolase gene (ApPGH) gene is indicated in small capitals followed by A. protothecoides acyl-ACP thioesterase (ApFATAvl) promoter (indicated as small case boxed text) driving the expression of codon-optimized Apet-KCR. The initiator ATG and terminator TGA for Apet-KCR are indicated in uppercase italics, while the coding region is indicated in lowercase italics. The ApSAD2vl terminator region is indicated by small capitals followed by the A protothecoides ApDAOl genomic region indicated by the underlined uppercase text. The final construct was sequenced to ensure correct reading frames and targeting sequences.[000249] pPB0496, pPB0497, and pPB0498, have the same vector backbone; selectable marker, Apet-KCR gene, and 3’ untranslated region (UTR) as pPB0495, differing only in the respective promoter being used to drive the Apet-KCR. In pPB0496, pPB0497, and pPB0498 we tested the effect of A. protothecoides stearoyl ACP desaturase (ApSAD2vl), major lipid droplet protein 1 (ApMLDPl), and ammonium transporter 1 (ApAMTlvl) promoters in driving the expression of A. petiolata KCR instead of ApFATAvl used in pPB0495. Relevant restriction sites in pPB0496, pPB0497, and pPB0498 are also the same as in pPB0495. SEQ ID NO: 27, 28, and 29 indicates the sequence of ApSAD2vl, ApMLDPl, and ApAMTlvl promoters in small case boxed text in pPB0496, pPB0497, and pPB0498 respectively. pPB0496 cttgcagtgccccaaaaactggctaccacctaacaattctcacgcagttttatcctctgcactttgatgtcagctttttgattcgt ctgcgtacattacagcgttgagtggccagcaggaaggagaccgcggtccgagacgagtctgagggcgcgctctcgcaacttggattccggattcttaccctgcatcgacctcggcctggagtcgatcagaaattgtcatgccagattgcctggcgagga cgggtgatatactcaaggcgttgcatcgcccacaaaacacacactatctgcaagggagttactgcatcaggctctgctcaa cagctcgtgacatcgatcgtcagctccccagcaggtgcgtgtccgcatggagcacccctcccgagacacctgcgtggg tgtcggaggagctcacatgccagggaggtgcccacattgcaccacgcgaccgcgaaataggcagacttcgggcatcctg tcatcgcatgtccgctggccgggaatcatggcctccccaccaggcgtcacgcgctgcccacctccctccccttgctgcgc agggcaccgcgttcctgtggagagccgaccac(SEQ ID N...

Claims

CLAIMSWe claim:

1. A method, comprising the steps of: providing a microalgae host cell wherein the microalgae host cell comprises a nucleic acid encoding a fatty acid desaturase-6, wherein the nucleic acid is operably linked to a control region; placing the microalgae cell into a media wherein the media includes a carbon source; and incubating the microalgae cell in the media under lipid production conditions, whereby a long chain, fatty acid is made.

2. The method of claim 1, wherein the fatty acid desaturase-6 is a delta-6 fatty acid desaturase from Phaeodactlum tricornutum, a delta-6 fatty acid desaturase from Borago officinalis, a delta-6 fatty acid desaturase from Caenorhabditis elegans, a delta-6 fatty acid desaturase from Mortierella alpina, or a delta-6 fatty acid desaturase from Synechocystis Sp.

3. The method of claim 1 or 2, wherein the microalgae further comprises a nucleic acid encoding a fatty acid delta-6 elongase, wherein the nucleic acid is operably linked to a control region.

4. The method of claim 3, wherein the fatty acid delta-6 elongase is a fatty acid delta-6 elongase from Phaeodactlum tricornutum, a fatty acid delta-6 elongase from Mortierella antarctica, or a fatty acid delta-6 elongase from Mortierella alpina.

5. The method of any one of claims 1-4, wherein the microalgae further comprises a nucleic acid encoding a lysophosphatidyl-choline acyltransferase, wherein the nucleic acid is operably linked to a control region.

6. The method of claim 5, wherein the lysophosphatidyl-choline acyltransferase is a lysophosphatidyl-choline acyltransferase from Arabidopsis thaliana, or a lysophosphatidyl-choline acyltransferase from Oblongichytrium sp. PB75.

7. The method of any one of claims 1-6, wherein the microalgae further comprises a nucleic acid encoding a phosphatidyl-choline:diacyl-glycerol-choline phosphotransferase, wherein the nucleic acid is operably linked to a control region.

8. The method of claim 7, wherein the phosphatidyl-choline:diacyl-glycerol- choline phosphotransferase is a phosphatidyl-choline:diacyl-glycerol-cholinephosphotransferase from Arabidopsis thaliana, or a phosphatidyl-choline:diacyl- glycerol-choline phosphotransferase from Oblongichytrium sp. PB75.

9. The method of any one of claims 1-8, wherein the microalgae further comprises a nucleic acid encoding a CDP-choline: l,2-sn-diacylglycerol choline phosphotransferase, wherein the nucleic acid is operably linked to a control region.

10. The method of claim 9, wherein the CDP-choline: 1,2-sn-diacylglycerol choline phosphotransferase is a phosphatidyl-choline:diacyl-glycerol-choline phosphotransferase from Arabidopsis thaliana, or a phosphatidyl-choline:diacyl- glycerol-choline phosphotransferase from Oblongichytrium sp. PB75.

11. The method of any one of claims 1-10, wherein the fatty acid desaturase-6 is a delta-6 fatty acid desaturase from Phaeodactylum tricornutum and the long chain fatty acid is a gamma linolenic acid.

12. The method of any one of claims 1-11, wherein the fatty acid desaturase-6 is a delta-6 fatty acid desaturase from Phaeodactylum tricornutum, the fatty acid delta-6 elongase is a fatty acid delta-6 elongase from Phaeodactylum tricornutum, and the long chain fatty acid is a gamma linolenic acid or a dihomo-gamma linolenic acid.

13. A method, comprising the steps of: providing a microalgae host cell wherein the microalgae host cell comprises a first nucleic acid encoding a ketoacyl Co-A synthase, wherein the first nucleic acid is operably linked to a control region; placing the microalgae cell into a media wherein the media includes a carbon source; and incubating the microalgae cell in the media under lipid production conditions, whereby a long chain, fatty acid is made.

14. The method of claim 13, wherein the ketoacyl Co-A synthase is a ketoacyl Co- A synthase from Brassica napus, a ketoacyl Co-A synthase from Alliaria petiolata, or a ketoacyl Co-A synthase from Malania oleifera.

15. The method of claim 13-14, wherein the microalgae cell further expresses ketoacyl-CoA reductase, enoyl-CoA reductase, and / or hydroxyacyl-CoA dehydratase in any combination, in addition to expressing ketoacyl-CoA synthase.

16. The method of claim 15, wherein: the ketoacyl Co-A reductase is a ketoacyl Co-A reductase from Aliaria petiolata, or a ketoacyl Co-A reductase from Malaniaoleifera; the enoyl Co-A reductase is an enoyl Co-A reductase from Aliaria petiolata; the hydroxyacyl-CoA dehydratase is a hydroxyacyl-CoA dehydratase from Aliaria petiolata.

17. The method of any one of claims 13-16, wherein the fatty acid is an eicosenoic acid.

18. The method of any one of claims 13-16, wherein the fatty acid is a erucic acid.

19. The method of any one of claims 13-16, wherein the fatty acid is an arachidic acid, behenic acid or lignoceric acid.

20. The method of any one of claims 13-16, wherein the fatty acid is a docosanoic acid.

21. The method of any one of claims 13-16, wherein the fatty acid is a tetracosanic acid.

22. The method of any one of claims 13-16, wherein the fatty acid is a nervonic acid.

Images