Genetically-engineered yarrowia lipolytica strain highly producing carotenoids, and use thereof

Abstract

Disclosed in the present invention is a genetically-engineered Yarrowia lipolytica strain highly producing carotenoids, which is obtained by constructing a xylose-induced activation system in the genetically-engineered Yarrowia lipolytica strain XK17 to control the induced expression of critical enzymes for synthesis of astaxanthin, wherein the critical enzymes for synthesis of astaxanthin comprise β-carotene hydroxylase CrtZ and β-carotene ketonase CrtW. Further disclosed in the present invention is the use of the genetically-engineered Yarrowia lipolytica strain in fermentation production of carotenoids. The present invention starts from the Yarrowia lipolytica strain XK17 highly producing β-carotene, and uses the xylose-induced activation system to separately control the expressions of the β-carotene hydroxylase (CrtZ) and β-carotene ketonase (CrtW) or only control the expression of the CrtW or the CrtZ, thereby separately achieving highly producing astaxanthin, or canthaxanthin, or zeaxanthin under the functions of a proper xylose induction concentration and induction opportunity.

Description

A genetically engineered Yarrowia lipolytica strain with high carotenoid production and its application Technical Field

[0001] The present invention belongs to the field of synthetic biology, and in particular relates to a genetically engineered Yarrowia lipolytica bacteria that utilizes a xylose-induced activation system to efficiently produce carotenoids and an application thereof. Background Art

[0002] Carotenoids, a class of natural products, possess diverse biological activities. Among these carotenoids, canthaxanthin, zeaxanthin, and astaxanthin possess significant economic value. Zeaxanthin, a dihydroxy derivative of β-carotene, is abundant in plant tissues such as green vegetables, corn seeds, wolfberries, and Physalis fruits, as well as in some non-photosynthetic bacteria. Numerous studies have demonstrated that zeaxanthin has health benefits, including antioxidant activity, prevention of macular degeneration, treatment of cataracts, prevention of cardiovascular disease, immune enhancement, and mitigation of atherosclerosis. Zeaxanthin is closely related to human health and is a natural food colorant, increasingly replacing synthetic pigments such as tartrazine and sunset yellow. Canthaxanthin, a diketone derivative of β-carotene, is primarily found in crustaceans, fungi, and fish. It can be used as a colorant in foods such as jams, candies, syrups, and sauces. However, canthaxanthin is more commonly used in animal feed rather than as a food colorant, making egg yolks and poultry more vibrant and salmon more reddish. Astaxanthin is primarily found in photosynthetic algae and crustaceans, and is also found in small quantities in bacteria, yeast, and plants. Because it consists of four isoprene units and two β-ionone rings, astaxanthin exists in a variety of geometric and optical isomers. Currently, the three all-trans structures are predominantly found on the market: 3S-3′S, 3R-3′S, and 3R-3′R. Only the most biologically active 3S-3′S is approved for human use. Due to its exceptional coloring power, high antioxidant properties, and potential for anti-inflammatory, anti-cancer, immune-enhancing, and Helicobacter pylori resistance, astaxanthin has been widely used in the aquatic products, poultry, eggs, health foods, and pharmaceutical industries, and holds great market potential.

[0003] Currently, carotenoid production is still primarily based on chemical synthesis and biological extraction. While chemical synthesis is less expensive, the products produced by this method are of low purity and contain multiple optical isomers, raising safety concerns. Furthermore, the production process is highly polluting, leading to its prohibition by the U.S. Food and Drug Administration (FDA) for use in health supplements, significantly impacting its market value. Biological extraction, on the other hand, involves direct isolation from natural carotenoid producers. However, the commonly used algae, Haematococcus pluvialis, is not suitable for high-density cultivation, requires a demanding cultivation environment, and is difficult to separate from, resulting in high production costs. Furthermore, astaxanthin extracted from Phaffia rhodozyma is mostly in the 3R-3′R configuration, resulting in a relatively low market value.

[0004] Studies have found that introducing exogenous genes of the astaxanthin synthesis pathway into microbial cells of different chassis to produce astaxanthin can overcome the problems of low content, long cycle, complex product structure and complex process in natural host production. It has the advantages of simple production process, short cycle and good quality, and has become one of the current research hotspots.

[0005] The biosynthesis of canthaxanthin, zeaxanthin, and astaxanthin can be divided into three main modules: the terpenoid precursor synthesis module, the β-carotene synthesis module, and the astaxanthin synthesis module. The terpenoid precursor synthesis module involves the conversion of pyruvate to the terpenoid precursors isoprenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP) via the mevalonate pathway (MVA pathway) and the 2-methyl-D-erythritol-4-phosphate pathway (MEP pathway). The β-carotene synthesis module involves the multi-step synthesis of lycopene and, subsequently, β-carotene from terpenoid precursors. In the third module, β-carotene can be converted to the diketonated product canthaxanthin by β-carotene ketolase (CrtW) or to the dihydroxylated product zeaxanthin by β-carotene hydroxylase (CrtZ). If both CrtW and CrtZ act simultaneously, the final diketonated and dihydroxylated product, astaxanthin, is obtained. The genes encoding CrtW and CrtZ and the natural pathway for synthesizing astaxanthin from β-carotene are present in many algae such as Haematococcus pluvialis, Chromochloris zofingiensis, bacteria such as Paracoccus sp., and fungi such as Schizochytrium.

[0006] Current studies have achieved the synthesis of zeaxanthin, canthaxanthin, and astaxanthin in microbial cell factories by introducing heterologous synthesis pathways from astaxanthin, using hosts such as Escherichia coli and Saccharomyces cerevisiae. In addition to the safety risks inherent in the host cells, the production of zeaxanthin, canthaxanthin, and astaxanthin still cannot meet industrial production requirements.

[0007] In Yarrowia lipolytica, high astaxanthin production is typically achieved by using a strong constitutive promoter to control the expression of key genes in the biosynthesis pathway. However, these strategies present challenges such as competition between product synthesis and bacterial growth, and product accumulation leading to feedback inhibition of the biosynthesis pathway, thus limiting production. Furthermore, while patents have successfully utilized a lactose-inducible system for astaxanthin production in Saccharomyces cerevisiae, the added inducer IPTG is biologically toxic and expensive, making it unsuitable for industrial production.

[0008] Summary of the Invention

[0009] In view of the shortcomings of the existing technology, the present invention proposes an engineered Yarrowia lipolytica that utilizes a xylose-induced activation system to high-produce carotenoids such as astaxanthin, canthaxanthin and zeaxanthin, thereby achieving high production of astaxanthin and other carotenoids by a biofermentation method.

[0010] To achieve the above objectives, the first aspect of the present invention provides a genetically engineered Yarrowia lipolytica strain that produces high carotenoid production. The genetically engineered Yarrowia lipolytica strain is obtained by constructing a xylose-induced activation system in the engineered Yarrowia lipolytica strain XK17 to control the induced expression of key enzymes in astaxanthin synthesis, wherein:

[0011] The key enzymes for astaxanthin synthesis include β-carotene hydroxylase CrtZ and β-carotene ketolase CrtW.

[0012] According to the present invention, the carotenoids include astaxanthin, canthaxanthin, and zeaxanthin.

[0013] According to the present invention, the β-carotene hydroxylase CrtZ used to produce zeaxanthin is from Pantoea ananatis, with GenBank accession number ADD79330.1; the β-carotene ketolase CrtW used to produce canthaxanthin is from Paracoccus sp.N81106, with GenBank accession number BAE47465.1; the β-carotene ketolase CrtW used to synthesize astaxanthin is from Paracoccus sp.N81106, with GenBank accession number BAE47465.1, and the β-carotene hydroxylase CrtZ is from Haematococcus Pluvialis, with GenBank accession number AKQ20654.1.

[0014] According to a preferred embodiment of the present invention, the carotenoid is canthaxanthin, and the corresponding key enzyme for astaxanthin synthesis is β-carotene ketolase CrtW derived from Paracoccus sp.

[0015] According to another preferred embodiment of the present invention, the carotenoid is zeaxanthin, and the corresponding key enzyme for astaxanthin synthesis is β-carotene hydroxylase CrtZ from Pantoea ananatis.

[0016] According to another preferred embodiment of the present invention, the carotenoid is astaxanthin, and the corresponding key enzymes for astaxanthin synthesis are β-carotene ketolase CrtW from Paracoccus sp. and β-carotene hydroxylase CrtZ from Haematococcus Pluvialis, or β-carotene hydroxylase CrtZ from Haematococcus Pluvialis alone.

[0017] According to another preferred embodiment of the present invention, the engineered bacteria further knocks out the xylose utilization gene xyl1.

[0018] The second aspect of the present invention provides the use of the genetically engineered Yarrowia lipolytica for fermentation production of carotenoids.

[0019] Furthermore, the carotenoids include astaxanthin, canthaxanthin, and zeaxanthin.

[0020] The present invention has the following beneficial effects:

[0021] 1. The present invention uses synthetic biology technology to construct a xylose-induced activation system (VPRHX-pXO) to timely control the induced expression of key enzymes in astaxanthin synthesis, thereby achieving high production of astaxanthin and carotenoids such as canthaxanthin and zeaxanthin in the Yarrowia lipolytica host.

[0022] 2. Starting from the high-β-carotene-producing Yarrowia lipolytica XK17, the xylose-induced activation system was used to control the expression of β-carotene hydroxylase (CrtZ) and β-carotene ketolase (CrtW), respectively, or to control only the expression of CrtW or CrtZ, so as to achieve high production of astaxanthin, canthaxanthin or zeaxanthin under the appropriate xylose induction concentration and induction timing.

[0023] 3. Because Yarrowia lipolytica has an endogenous xylose utilization pathway, it can slowly utilize xylose. The present invention further utilizes the CRISPR / Cas9 system to knock out the endogenous xylose utilization gene xyl1 from the Y. lipolytica genome, preventing the double-induced and single-induced engineered bacteria from consuming xylose. This can further reduce inducer consumption and improve the xylose-induced expression effect. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 shows the construction process of plasmid pVPRHX-Pxo-Ptef-pspcrtW-XPR2t.

[0025] Figure 2 shows a plasmid map of pVPRHX-Pxo-Ptef-hpcrtZ-XPR2t-Pxo-Ptef-pspcrtW-XPR2t.

[0026] Figure 3 shows a plasmid map of pVPRHX-Pxo-Ptef-hpcrtZ-XPR2t-Ptef-pspcrtW-XPR2t.

[0027] FIG4 shows the xylose-induced fermentation results of the engineered bacteria YL-TY-W.

[0028] FIG5 shows the xylose-induced fermentation results of the engineered bacteria YL-TY-Z.

[0029] Figure 6 shows the fermentation optimization results of the YL-TY-3 induction conditions, where a is the yield of various carotenoid intermediates of YL-TY-3; b is the dry weight of the YL-TY-3 strain.

[0030] FIG7 shows the fermentation optimization results of the induction conditions of YL-TY-4, wherein a is the yield of various carotenoid intermediates of YL-TY-4; b is the dry weight of the YL-TY-4 strain.

[0031] FIG8 shows the astaxanthin production by xylose-induced fermentation of YL-TY-3-Δxyl1.

[0032] FIG9 shows the astaxanthin production by xylose-induced fermentation of YL-TY-4-Δxyl1. DETAILED DESCRIPTION

[0033] The present invention will be further described in detail below with reference to specific examples. It should be understood that the following examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention.

[0034] Materials and methods

[0035] β-Carotene hydroxylase CrtZ for zeaxanthin production from Pantoea ananatis (GenBank: ADD79330.1);

[0036] β-carotene ketolase CrtW for producing canthaxanthin is from Paracoccus sp. N81106 (GenBank: BAE47465.1);

[0037] The β-carotene ketolase CrtW used to synthesize astaxanthin was derived from Paracoccus sp. N81106 (GenBank: BAE47465.1), and the β-carotene hydroxylase CrtZ was derived from Haematococcus Pluvialis (GenBank: AKQ20654.1).

[0038] The "xylose-induced activation system" described in the context of the present invention includes two parts: the transcription factor VPRHX that enhances transcription after binding to xylose and the xylose-responsive promoter pXO. Its function is to activate the expression of the target gene downstream of the xylose-responsive promoter by xylose induction. The construction process is obtained by referring to the method disclosed in the document (Wei W, Shang Y, Zhang P, Liu Y, You D, Yin B, Ye B: Engineering Prokaryotic Transcriptional Activator XylR as a Xylose-Inducible Biosensor for Transcription Activation in Yeast. ACS Synth Biol 2020, 9: 1022-1029).

[0039] The Yarrowia lipolytica XK17 strain with high beta-carotene production was obtained according to the method disclosed in CN111321087A.

[0040] pVPRHX: integration plasmid containing promoter P hp4d , xylose-induced transcription factor gene VPRH-XylR, terminator XPR2t, kana R , and contains ura3; obtained by reference to the document (Wei W, Zhang P, Shang Y, et al. Metabolically engineering of Yarrowia lipolytica for the biosynthesis of naringenin from a mixture of glucose and xylose[J]. Bioresource Technology, 2020, 314: 123726).

[0041] pUC19-hpcrtZ: A commercial plasmid containing the gene hpcrtZ from Haematococcus pluvialis.

[0042] pUC19-pacrtZ: A commercial plasmid containing the pacrtZ gene from Pantoea ananatis.

[0043] pUC19-pspcrtW: A commercial plasmid containing the gene pspcrtW from Paracoccus sp.

[0044] pPtef-Pxo: Contains the hybrid promoter Ptef-Pxo sequence, obtained from (Wei W, Zhang P, Shang Y, et al. Metabolically engineering of Yarrowia lipolytica for the biosynthesis of naringenin from a mixture of glucose and xylose[J]. Bioresource Technology, 2020, 314: 123726).

[0045] pUAS1B-Ptef: Contains the constitutive strong promoter UAS1B-Ptef sequence, obtained with reference to CN111321087A.

[0046] pINA1312: Contains the XPR2 terminator sequence, obtained from reference document (1. Zhang, XK; Wang, DN; Chen, J.; Liu, ZJ; Wei, LJ; Hua, Q., Metabolic engineering of beta-carotene biosynthesis in Yarrowia lipolytica[J]. Biotechnol Lett 2020, 42(6), 945-956).

[0047] pCRISPRyl_A08: Contains the CRISPR / Cas9 system sequence, obtained from reference file (1. Zhang, XK; Wang, DN; Chen, J.; Liu, ZJ; Wei, LJ; Hua, Q., Metabolic engineering of beta-carotene biosynthesis in Yarrowia lipolytica[J]. Biotechnol Lett 2020, 42(6), 945-956).

[0048] The molecular operations involved in the following examples, unless otherwise specified, were performed in accordance with the product instructions. Among them, the operation of integrating the gene expression cassette into the yeast host was carried out according to the method disclosed in the literature (Li YW, Yang CL, Shen Q, et al. YALIcloneNHEJ: An Efficient Modular Cloning Toolkit for NHEJ Integration of Multigene Pathway and Terpenoid Production in Yarrowia lipolytica [J]. Frontiers in Bioengineering and Biotechnology, 2021, 9: 816980).

[0049] The primer sequences used in the following examples are as follows:

[0050] ZZ-tef-pxo-F: CTAGATAGAGTCGACAAAGGGTAATATTGGGCACTCCCTTTCA;

[0051] ZZ-tef-pxo-wR:GGCAGAGCGTGAGCAGACATTTTGAATGATTCTTATACTCAGAAGG;

[0052] ZZ-tef-pxo-zR: ATCAGAGAGTTCACCAGCATTTTGAATGATTCTTATACTCAGAAGG;

[0053] ZZ-1312-wF: CCTTCTGAGTATAAGAATCATTCAAAATGTCTGCTCACGCTCTG;

[0054] ZZ-1312-wR: ACGTGGGGACAGGCCATGGACTAGGCGGTGTCTCCCTT;

[0055] ZZ-1312-zF: CCTTCTGAGTATAAGAATCATTCAAAATGCTGGTGAACTCTCTGAT;

[0056] ZZ-1312-zR: CGTGGGGACAGGCCATGGACTACTCGGGGGAAGAGGAAG;

[0057] ZZ-XPR-wF: CCAAGGGAGACACCGCCTAGTCCATGGCCTGTCCCCAC;

[0058] ZZ-XPR-zF:CTTCCTCTTCCCCCGAGTAGTCCATGGCCTGTCCCCAC;

[0059] ZZ-XPR-R:TCTGTACACCGAGAAACAGGCTATTTACAACAATCTGG.

[0060] ZZ-tef-F:GGTACCCGAATTCCTGAGGT;

[0061] ZZ-tef-wR:ATGCCCTCCTACGAAGCT;

[0062] Zz-tef-zR:CTACTCGGGGGAAGAGGAAG.

[0063] ZZ-hpcrtZ-F:TACATACGCAAGTGAGATGC;

[0064] ZZ-hpcrtZ-R:CCAGAGCGAGTGTTACACAT;

[0065] ZZ-tef-F:CTAGATAGAGTCGACAAAGGGGTACCCGAATTCCTGAGGT1

[0066] ZZ-tef-R:GGCAGAGCGTGAGCAGACATTTTGAATGATTCTTATACTCAGAAGG;

[0067] Dxyl1-1-F:TCCTGGAGAAGATGGACGGA.

[0068] Dxyl1-1-R:TCAAGCTCGCCTCCGGAAAGACGTCAACCTGCGCCGACCC;

[0069] Dxyl1-2-F:CTTTCCGGAGGCGAGCTTGAGTTTTAGAGCTAGAAATAGC1

[0070] Dxyl1-2-R:TCCGTCCATCTTCTCCAGGA.

[0071] CX-xyl1-F:AATCTGTCACATGTCTTCCC;

[0072] CX-xyl1-R:TCGGAGGGGAATGTACTG。

[0073] In the following examples, the shake flask fermentation method of the engineered bacteria is as follows:

[0074] First-stage seed solution: Pick a single colony and transfer it to 5 mL of YPD liquid medium. Incubate overnight in a shaker at 220 rpm and 30°C.

[0075] Secondary seed solution: 100 μL of bacterial solution was added to 50 mL of YPD liquid medium and cultured in a shaking incubator at 220 rpm and 30°C for 24 h.

[0076] Fermentation broth culture: Take an appropriate amount of secondary seed liquid and dilute it to measure OD 600 The bacterial liquid was inoculated into a 250 mL shake flask containing 50 mL YPD liquid medium, and the OD of each bottle of fermentation liquid after inoculation was 600 The value was 0.01; the culture was placed in a shaker at 220 rpm and 30°C for constant temperature culture and fermentation for 120 h.

[0077] Sampling is performed at specific time points for parameter measurement and analysis.

[0078] YPD medium: 20 g / L tryptone, 20 g / L glucose, 10 g / L yeast extract, 20 g / L agar (solid), sterilization conditions 121°C, 30 min.

[0079] In the following examples, the carotenoid product extraction and detection methods are as follows:

[0080] ⅰ. Carotenoid Product Extraction Method

[0081] Take 50 μL of fermentation broth into a 1.5 mL centrifuge tube and centrifuge at 13200 g for 3 min; discard the supernatant, add 500 μL of DMSO, mix by pipetting, and vortex for 30 s; incubate at 65°C in the dark for 10 min; add 500 μL of acetone, vortex for 30 s, and incubate at 65°C in the dark for 15 min; centrifuge at 13200 g for 3 min; take the supernatant and filter it with a 0.22 μm filter membrane for HPLC detection.

[0082] II. Quantitative Detection Method for Carotenoid Products

[0083] Standard curves for astaxanthin, β-carotene, canthaxanthin, β-cryptoxanthin, and zeaxanthin were prepared by weighing β-carotene, astaxanthin, and the intermediate standard product and dissolving them in a 9:1 methanol:acetone mixture. The concentrations were then diluted with acetone to 100 mg / L, 80 mg / L, 50 mg / L, 30 mg / L, 20 mg / L, 10 mg / L, 5 mg / L, and 2 mg / L, respectively. The diluted samples were filtered through a 0.22 μm filter and analyzed by HPLC. The corresponding peak areas were recorded and the standard curve was plotted.

[0084] Preparation of an echinone standard curve: Weigh the echinone standard, dissolve it in DMSO, and dilute it with acetone to 20 mg / L, 10 mg / L, 5 mg / L, 3 mg / L, 2 mg / L, 1 mg / L, 0.5 mg / L, and 0.2 mg / L. Filter the diluted samples through a 0.22 μm filter membrane and perform HPLC analysis. Record the corresponding peak areas and plot a standard curve.

[0085] HPLC detection conditions: chromatographic column: Agilent ZORBAX SB-Aq 250*4.6mm, 5μm; mobile phase: acetonitrile:methanol:isopropanol:water = 4.5:3:2:0.5; injection volume: 20μL; detection wavelength: 480nm, flow rate: 1mL / min; column temperature: 40℃.

[0086] ⅲ. Reducing sugar content detection

[0087] 1) DNS reagent configuration

[0088] Measure 75 mL of deionized water, heat it to a slight heat, then add 1.00 g of 3,5-dinitrosalicylic acid (DNS), 1.60 g of NaOH, 0.50 g of phenol, 0.50 g of sodium sulfite, and 30.00 g of potassium sodium tartrate in sequence. After dissolution, dilute to 100 mL and store in a brown bottle at room temperature in the dark.

[0089] 2) Preparation of xylose standard solution

[0090] Accurately weigh 1.000 g of anhydrous xylose, dissolve it in deionized water, and then dilute to 1000 mL to obtain a xylose standard solution with a concentration of 1 mg / mL.

[0091] 3) Preparation of standard curve

[0092] Prepare 6 1.5mL centrifuge tubes, add 0, 0.02, 0.04, 0.06, 0.08, and 0.10mL of xylose standard solution respectively, add deionized water to 0.10mL, then add 0.3mL of DNS color developer respectively, mix well, boil in a metal bath for 5 minutes, and quickly cool to room temperature. Transfer each reaction solution to a 5mL centrifuge tube, add deionized water to 4mL, shake well, measure the absorbance at 500nm, and use this to prepare the xylose standard curve, and calculate the regression equation and regression coefficient (R 2 ).

[0093] 4) Xylose concentration detection

[0094] Transfer 50 μL of fermentation broth to a 1.5 mL centrifuge tube and centrifuge at 13,200 g for 3 minutes. Add 0.10 mL of fermentation broth to each tube and add 0.3 mL of DNS colorimetric reagent. Mix thoroughly, boil in a metal bath for 5 minutes, and quickly cool to room temperature. Transfer each reaction solution to a 5 mL centrifuge tube, add deionized water to a final volume of 4 mL, shake well, measure absorbance at 500 nm, and calculate xylose concentration using the standard curve.

[0095] Example 1: Using the xylose-induced activation system to regulate the expression of crtW or crtZ to promote the synthesis of canthaxanthin or zeaxanthin

[0096] 1.1. Construction of plasmid pVPRHX-Pxo-Ptef-pspcrtW / pacrtZ-XPR2t containing xylose-inducible crtW or crtZ expression cassettes

[0097] The construction process of plasmid pVPRHX-Pxo-Ptef-pspcrtW-XPR2t is shown in Figure 1 and is as follows:

[0098] Using pPtef-Pxo, pUC19-pspcrtW, and pINA1312 as templates, respectively, with primer pairs ZZ-tef-pxo-F, ZZ-tef-pxo-wR, ZZ-1312-wF, ZZ-1312-wR, and ZZ-XPR-wF, ZZ-XPR-R, we amplified the Ptef-Pxo, pspcrtW, and XPR2 gene fragments containing 20-bp front and back homology arms, respectively. The theoretical lengths of the three fragments were 383, 775, and 326 bp, respectively. The reaction mixtures of the fragments with verified correct band sizes were purified.

[0099] The plasmid pVPRHX was digested with the restriction endonuclease Stu I, and the larger fragment was recovered using a gel extraction kit as the vector. A NovoRec Plus PCR recombinase reaction system was configured to perform a four-fragment ligation of the vector and the three amplified target fragments. The fragments were then transformed into E. coli DH10b. Single colonies were then picked on LB-Kan plates and verified by PCR. Correct transformants were selected and verified by sequencing to obtain the pVPRHX-Pxo-Ptef-pspcrtW-XPR2t plasmid.

[0100] Following the same method, the pspcrtW gene was replaced with the pacrtZ gene (using primer pairs ZZ-tef-pxo-F, ZZ-tef-pxo-zR, ZZ-1312-zF, ZZ-1312-zR, and ZZ-XPR-zF, ZZ-XPR-R) to construct the pVPRHX-Pxo-Ptef-pacrtZ-XPR2t plasmid.

[0101] 1.2 Construction of xylose-induced CrtW / CrtZ expression strain

[0102] The pVPRHX-Pxo-Ptef-pspcrtW-XPR2t plasmid and pVPRHX-Pxo-Ptef-pacrtZ-XPR2t plasmid constructed in 1.1 above were linearized with restriction endonuclease NotⅠ, transformed into competent cells of Yarrowia lipolytica XK17 (Ura-), and incubated at 30°C for 45 minutes.

[0103] Spread the incubated bacterial suspension onto YNB-Ura solid medium (commercial medium without uracil) and incubate at 30°C for 2-4 days. Since the plasmid carries the URA gene, insertion into the host genome allows the host to grow on medium lacking uracil, positive clones may have undergone random integration.

[0104] Single clones were selected for genome extraction and PCR was performed to identify colonies with random integration. Single clones with the correct band size were verified by PCR and sequencing of the target fragment, resulting in recombinant engineered strains TY-W (xylose-induced regulation of crtW expression) and TY-Z (xylose-induced regulation of crtZ expression).

[0105] 1.3. Construction of a strong promoter UAS1B8-Tef high-expression CrtW / CrtZ engineered strain

[0106] Using pUAS1B-Ptef, pUC19-pacrtZ, and pINA1312 as templates, and primer pairs ZZ-tef-F, ZZ-tef-zR, ZZ-1312-zF, ZZ-1312-zR, and ZZ-XPR-zF, ZZ-XPR-R, respectively, PCR amplification was performed with high-fidelity Primestar GXL DNA polymerase. These fragments, each containing a 20-bp homology arm, were amplified to generate Ptef-Pxo, pacrtZ, and XPR2 gene fragments. The theoretical lengths of the three fragments were 383 bp, 571 bp, and 326 bp, respectively. The reaction mixtures of the fragments, each with confirmed band size, were purified. The NovoRec Plus PCR recombinase reaction system was configured to ligate the vector and the three amplified target fragments, and the fragments were transformed into E. coli DH10b. Single colonies were then picked on LB-Kan plates and verified by PCR. The correct transformants were selected and sequenced to obtain the Ptef-pacrtZ-XPR2t plasmid.

[0107] Using the plasmid pVPRHX-Pxo-Ptef-hpcrtZ-XPR2t-Ptef-pspcrtW-XPR2t and plasmid Ptef-pacrtZ-XPR2t in 2.2 as templates, primer pairs ZZ-tef-F and ZZ-tef-R were used, respectively, to amplify the Ptef-pspcrtW-XPR2t and Ptef-pacrtZ-XPR2t gene fragments by high-fidelity Primestar GXL DNA polymerase PCR. The recovered gene fragments were transformed into competent cells of Yarrowia lipolytica XK17 (Ura-) and incubated at 30°C for 45 min.

[0108] Spread the incubated bacterial suspension onto YNB-Ura solid medium (commercial medium without uracil) and incubate at 30°C for 2-4 days. Since the plasmid carries the URA gene, insertion into the host genome allows the host to grow on medium lacking uracil, positive clones may have undergone random integration.

[0109] Single clones were picked for genome extraction and PCR was performed to identify colonies with random integration. Single clones with the correct band size were verified by PCR and sequencing of the target fragments to obtain a UAS1B8-Tef engineered strain with high expression of CrtW and CrtZ.

[0110] 1.4 Analysis of fermentation products of xylose-induced crtW or crtZ expression engineered bacteria

[0111] The recombinant engineered bacteria TY-W obtained in 1.2 above was used for shake flask fermentation. Samples were taken at 120 hours of shake flask fermentation for parameter measurement and analysis. At the same time, an engineered strain highly expressing CrtW with the strong promoter UAS1B8-Tef was used as a control.

[0112] Figure 4 shows the results of shake flask fermentation using the recombinant engineered strain TY-W. When xylose was added at a concentration of 5 g / L for 12 hours, the accumulation of the monoketo product echinenone decreased from 300.05 mg / L to near zero, while the production of the diketo product canthaxanthin increased to 384.19 mg / L. In the engineered strain overexpressing CrtW using the strong UAS1B8-Tef promoter, canthaxanthin production reached 289.48 mg / L. This indicates that the xylose-inducible regulatory system increased canthaxanthin production by 32.71% compared to the constitutive strong promoter.

[0113] The recombinant engineered bacteria TY-Z obtained in 1.2 above was used for shake flask fermentation. Samples were taken at 120 hours of shake flask fermentation for parameter measurement and analysis. At the same time, an engineered strain that highly expressed CrtZ under the strong promoter UAS1B8-Tef was used as a control.

[0114] The results of shake flask fermentation of the recombinant engineered strain TY-Z are shown in Figure 5. When xylose was added at a concentration of 5 g / L for 12 hours, the accumulation of the monohydroxylated product β-cryptoxanthin decreased from 265.85 mg / L to 202.34 mg / L, while the production of the dihydroxylated product zeaxanthin increased to 150.23 mg / L. In the engineered strain overexpressing CrtZ using the strong UAS1B8-Tef promoter, zeaxanthin production was 33.12 mg / L. This indicates that the xylose-inducible regulatory system increased zeaxanthin production by 353.59% compared to the constitutive strong promoter.

[0115] Example 2: Effect of regulating the expression of crtW and crtZ using the xylose-induced activation system on astaxanthin production

[0116] 2.1. Construction of the plasmid pVPRHX-Pxo-Ptef-hpcrtZ-XPR2t-Pxo-Ptef-pspcrtW-XPR2t containing a xylose-inducible system to control the tandem expression cassettes of crtW and crtZ

[0117] Using pUC19-hpcrtZ as a template and primer pairs ZZ-hpcrtZ-F and ZZ-hpcrtZ-R, we amplified the Ptef-Pxo-hpcrtZ-XPR2t gene fragment containing 20-bp front and back homology arms via PCR with high-fidelity Primestar GXL DNA polymerase. The 1587-bp fragment was purified and its concentration was determined, completing the fragment preparation.

[0118] The plasmid pVPRHX-Pxo-Ptef-pspcrtW-XPR2t obtained in 1.1 was digested with the restriction endonuclease EcoRI and recovered using a gel extraction kit. A NovoRec Plus PCR recombinase reaction system was prepared (according to the product instructions), and the vector and target fragment Ptef-Pxo-hpcrtZ-XPR2t were ligated and transformed into E. coli DH10b. Subsequently, single colonies were picked on LB-Kana plates and verified by PCR. Correct transformants were selected and verified by sequencing to obtain the plasmid pVPRHX-Pxo-Ptef-hpcrtZ-XPR2t-Pxo-Ptef-pspcrtW-XPR2t. The plasmid map is shown in Figure 2.

[0119] 2.2 Construction of the plasmid pVPRHX-Pxo-Ptef-hpcrtZ-XPR2t-Ptef-pspcrtW-XPR2t containing the xylose-only inducible crtZ-constitutive crtW expression cassette

[0120] 2.2.1. Construction of plasmid pVPRHX-Ptef-pspcrtW-XPR2t

[0121] Using pUAS1B-Ptef, pUC19-pspcrtW, and pINA1312 as templates, and primer pairs ZZ-tef-F, ZZ-tef-wR, ZZ-1312-WF, ZZ-1312-WR, and ZZ-XPR-F, ZZ-XPR-R, respectively, PCR amplification with high-fidelity Primestar GXL DNA polymerase yielded UAS1B8-Ptef, pspcrtW, and XPR2 gene fragments containing 20 bp homology arms at the front and back, respectively. The theoretical lengths of the three fragments were 1094 bp, 775 bp, and 326 bp, respectively. The reaction mixtures of the fragments with verified correct band sizes were purified.

[0122] The plasmid pVPRHX was digested with the restriction endonuclease Stu I, and the larger fragment was recovered using a gel extraction kit as the vector. A NovoRec Plus PCR recombinase reaction system was configured to perform a four-fragment ligation of the vector and the three amplified target fragments, UAS1B8-Ptef, pspcrtW, and XPR2. The fragments were then transformed into E. coli DH10b. Single colonies were then picked on LB-Kana plates and verified by PCR using primers. Correct transformants were selected and sequenced to obtain the plasmid pVPRHX-Ptef-pspcrtW-XPR2t.

[0123] 2.2.2. Construction of plasmid pVPRHX-Pxo-Ptef-hpcrtZ-XPR2t-Ptef-pspcrtW-XPR2t

[0124] Using primer pairs ZZ-hpcrtZ-F and ZZ-hpcrtZ-R, PCR amplification with high-fidelity Primestar GXL DNA polymerase yielded a Ptef-Pxo-hpcrtZ-XPR2t gene fragment containing 20-bp front and back homology arms. The 1587-bp fragment was purified and its concentration determined, completing fragment preparation.

[0125] The plasmid pVPRHX-Pxo-Ptef-pspcrtW-XPR2t was digested with the restriction endonuclease EcoRI and recovered using a gel extraction kit. A NovoRec Plus PCR recombinase reaction system was prepared to ligate the vector and the target fragment, Ptef-Pxo-hpcrtZ-XPR2t, and transform the fragments into E. coli DH10b. Single colonies were then picked on LB-Kana plates and verified by PCR using primers. Correct transformants were selected and verified by sequencing to obtain the plasmid pVPRHX-Pxo-Ptef-hpcrtZ-XPR2t-Ptef-pspcrtW-XPR2t. The plasmid map is shown in Figure 3.

[0126] 2.3. Construction of xylose-induced crtW / crtZ engineered bacteria and xylose-induced crtZ-constitutive crtW engineered bacteria

[0127] Referring to the method of 1.2 of Example 1, the plasmid pVPRHX-Pxo-Ptef-hpcrtZ-XPR2t-Ptef-pspcrtW-XPR2t obtained in 2.1 above and the plasmid pVPRHX-Pxo-Ptef-hpcrtZ-XPR2t-Ptef-pspcrtW-XPR2t obtained in 2.2 were linearized and transformed into competent cells of Yarrowia lipolytica XK17 (Ura-). Correct recombinants were screened by uracil-deficient medium and colony PCR to obtain the engineered strain YL-TY-3 in which crtW and crtZ were simultaneously induced by xylose and the engineered strain YL-TY-4 in which crtZ and constitutive crtW were induced by xylose alone.

[0128] 2.4. Optimization of shake flask fermentation conditions for high-yield astaxanthin engineered strains YL-TY-3 and YL-TY-4

[0129] Dynamic metabolic regulation is achieved by precisely controlling metabolic pathways by turning on (enhancing) or off (reducing) gene expression at the appropriate stage. Therefore, optimizing the timing and dosage of inducer addition can make the xylose activation system work more efficiently and accurately.

[0130] Based on previous data analysis and literature research, this study investigated inducer addition times of 12, 18, and 24 hours, and xylose addition doses of 2.5 g / L, 5 g / L, 10 g / L, 20 g / L, and 40 g / L. Because induction time and inducer dose are related, these two conditions were combined in pairs, with a control group without inducer added, for fermentation optimization.

[0131] The shake flask fermentation results of YL-TY-3 are shown in Figure 6. When the xylose concentration was 10 g / L and the addition time was 12 h, the astaxanthin production of YL-TY-3 increased to 61.94±6.34 mg / L. At the same time, the addition of xylose significantly reduced the accumulation of β-carotene, echinone and canthaxanthin in YL-TY-3, which were 33%, 60% and 25% of the strain without xylose addition, respectively.

[0132] The shake flask fermentation results of YL-TY-4 are shown in Figure 7. When the xylose concentration was 10 g / L and the addition time was 24 h, the astaxanthin production of YL-TY-4 increased to 98.72±11.85 mg / L. At the same time, the addition of xylose significantly reduced the accumulation of β-carotene, echinone and canthaxanthin in YL-TY-4, which were 18%, 15% and 14% of the strain without xylose addition, respectively.

[0133] Example 3: Knockout of the xylose utilization gene xyl1 in recombinant engineered bacteria further enhances xylose induction

[0134] 3.1 Construction of xylose knockout plasmid pCRISPRyl_xyl1

[0135] In the engineered bacteria YL-TY-3 and YL-TY-4 obtained in Example 2, which contain a xylose-inducible activation system to control the expression of crtW and / or crtZ, the endogenous xylose utilization gene was knocked out using the CRISPR / Cas9 system in order to eliminate the host's ability to utilize xylose.

[0136] Using plasmid pCRISPRyl_A08 (Plasmid #84610) as a template, primer pairs Dxyl1-1-F and Dxyl1-1-R and Dxyl1-2-F and Dxyl1-2-R were used for PCR amplification using high-fidelity Primestar GXL DNA polymerase to obtain gene fragments containing 20bp homology arms at the front and back. The theoretical lengths of the two fragments are 5898bp and 5966bp, respectively. The reaction solutions of the fragments with correct band sizes were purified. The NovoRec Plus PCR recombinase reaction system was configured, and the two target fragments obtained above were ligated and transformed into E. coli DH10b. Subsequently, single clones were picked on LB-AMP plates and PCR verification was performed. The correct transformants were selected and sequenced to obtain plasmid pCRISPRyl_xyl1.

[0137] 3.2 Construction of YL-TY-3-Δxyl1 and YL-TY-4-Δxyl1 engineered bacteria

[0138] Transform the xylose knockout plasmid pCRISPRyl_xyl1 into competent cells of the corresponding engineered bacteria and incubate at 30°C for 45 minutes. Spread the incubated bacterial solution onto YNB solid medium and culture at 30°C for 2-4 days.

[0139] Single clones were picked and the genome was extracted. Sequencing primer pairs CX-xyl1-F and CX-xyl1-R were used to sequence clones with frameshift mutations, and the engineered bacteria YL-TY-3-Δxyl1 and YL-TY-4-Δxyl1 in which the xylose utilization gene xyl1 was knocked out were obtained.

[0140] 3.3 Xylose-induced fermentation of YL-TY-3-Δxyl1 and YL-TY-4-Δxyl1 engineered bacteria

[0141] Xylose-induced fermentation was performed on YL-TY-3-Δxyl1 and YL-TY-4-Δxyl1. Xylose was added at final concentrations of 2.5 g / L, 5 g / L, 10 g / L, 20 g / L, and 40 g / L at 12 h and 24 h, respectively. The results are shown in Figures 8 and 9.

[0142] The shake flask fermentation results in Figures 8 and 9 show that after knocking out the xylose utilization gene xyl1, the optimal induction concentration of the YL-TY-3-Δxyl1 engineered bacteria dropped from 10 g / L to 5 g / L compared with the strain in which the xylose utilization gene was not knocked out, while the YL-TY-4-Δxyl1 engineered bacteria also tolerated a higher xylose induction concentration, with the optimal induction concentration increasing from 10 g / L to 20 g / L; at the same time, because the consumption of xylose stopped, the induction effect was improved. After 120 hours of shake flask fermentation, the astaxanthin production of YL-TY-3-Δxyl1 and YL-TY-4-Δxyl1 engineered bacteria reached 62.76±0.76 mg / L and 112.86±6.96 mg / L, respectively.

[0143] It is easy for those skilled in the art to understand that in the above embodiments, the genes encoding the key enzymes for astaxanthin synthesis, β-carotene hydroxylase CrtZ and β-carotene ketolase CrtW, the gene hpcrtZ from Haematococcus Pluvialis, the gene pacrtZ from Pantoea ananatis, and the gene pspcrtW from Paracoccus sp. can be codon-optimized according to the preference of the host bacteria to further increase the yield. This is obvious and belongs to the conventional technical means in this field.

[0144] The preferred embodiments of the present invention are described in detail above. It should be noted that a person skilled in the art may make several improvements and modifications without departing from the principles of the present invention, and these improvements and modifications also fall within the scope of the present invention.

Claims

1. An engineered Yarrowia lipolytica strain with high carotenoid production, characterized in that: The Yarrowia lipolytica engineered bacterium is obtained by constructing a xylose induction activation system in the Yarrowia lipolytica engineered bacterium XK17 to control the induced expression of key enzymes for astaxanthin synthesis, wherein: The key enzymes for astaxanthin synthesis include β-carotene hydroxylase CrtZ and β-carotene ketolase CrtW.

2. The engineered Yarrowia lipolytica according to claim 1, characterized in that The carotenoids include astaxanthin, canthaxanthin, and zeaxanthin.

3. The engineered Yarrowia lipolytica according to claim 2, characterized in that: The β-carotene hydroxylase CrtZ used to produce zeaxanthin is from Pantoea ananatis , with GenBank accession number ADD79330.1; The β-carotene ketolase CrtW used to produce canthaxanthin was from Paracoccus sp. N81106, with GenBank accession number BAE47465.1; The β-carotene ketolase CrtW used to synthesize astaxanthin is from Paracoccus sp. N81106, with GenBank accession number BAE47465.1, and the β-carotene hydroxylase CrtZ is from Haematococcus Pluvialis, with GenBank accession number AKQ20654.

1.

4. The engineered Yarrowia lipolytica according to claim 1, characterized in that: The carotenoid is canthaxanthin, and the corresponding key enzyme for astaxanthin synthesis is β-carotene ketolase CrtW derived from Paracoccus sp.

5. The engineered Yarrowia lipolytica according to claim 1, characterized in that The carotenoid is zeaxanthin, and the corresponding key enzyme for astaxanthin synthesis is β-carotene hydroxylase CrtZ from Pantoea ananatis.

6. The engineered Yarrowia lipolytica according to claim 1, characterized in that The carotenoid is astaxanthin, and the corresponding key enzyme for astaxanthin synthesis is β-carotene ketolase CrtW from Paracoccus sp. and β-carotene hydroxylase CrtZ from Haematococcus Pluvialis, or β-carotene hydroxylase CrtZ from Haematococcus Pluvialis alone.

7. The engineered Yarrowia lipolytica according to claim 6, characterized in that The engineered bacteria further knocked out the xylose utilization gene xyl1.

8. Use of the engineered Yarrowia lipolytica according to any one of claims 1 to 7 for fermentation production of carotenoids.

9. The use according to claim 8, characterized in that: The carotenoids include astaxanthin, canthaxanthin, and zeaxanthin.

Images