Epigenetic regulatory factor zmult1 related to corn grain size regulation and heat stress response, and use thereof

The content of ZmULT1 protein in corn is reduced or the expression of its encoding gene is inhibited, which solves the problems of corn grain size and heat tolerance, and achieves the improvement of grain enlargement, heat tolerance and inverted resistance.

WO2025179741A1PCT designated stage Publication Date: 2025-09-04THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI

Patent Information

Application Number
PCT/CN2024/103300
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-02-27
Filing Date
2024-07-03
Publication Date
2025-09-04

AI Technical Summary

Technical Problem

How to improve corn kernel size and/or heat resistance and/or invert resistance.

Method used

Gene editing is performed using the CRISPR/Cas9 system, including using sgRNA and Cas9 plasmids targeting the ZmULT1 gene encoding gene to achieve knockout or silencing by reducing or inhibiting the content of ZmULT1 protein in corn or inhibiting the expression of its encoding gene.

Benefits of technology

Significantly increase the size of corn grains (greater length, width and weight of 100 grains), enhance the heat resistance and inverted resistance of corn (plant height becomes shorter and ear height decreases), and improve the survival rate of corn under heat stress.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure PCTCN2024103300-FTAPPB-I100001
    Figure PCTCN2024103300-FTAPPB-I100001
  • Figure PCTCN2024103300-FTAPPB-I100002
    Figure PCTCN2024103300-FTAPPB-I100002
  • Figure PCTCN2024103300-FTAPPB-I100003
    Figure PCTCN2024103300-FTAPPB-I100003
Patent Text Reader

Abstract

An epigenetic regulatory factor ZmULT1 related to corn grain size regulation and heat stress response and the use thereof, which solve the technical problems of how to increase the grain size and / or heat resistance and / or lodging resistance of corn. Use of a substance for reducing the content of the protein ZmULT1 or a substance for inhibiting the expression of the encoding gene of the protein ZmULT1, which use is any one of the following: P1, the use in increasing the grain size of corn; P2, the use in improving the heat resistance of corn; P3, the use in increasing the lodging resistance of corn; and P4, the use in plant breeding. The homozygous mutant strain with knockout of the ZmULT1 gene has a reduced plant height and an increased grain size, and exhibits significant heat stress resistance, this indicates that the research on the gene can further enrich the use of epigenetics in crops and is of important significance for improving the grain size, heat resistance and lodging resistance of corn.
Need to check novelty before this filing date? Find Prior Art

Description

Epigenetic regulatory factor ZmULT1 related to maize kernel size regulation and heat stress response and its application

[0001] This application claims priority to Chinese patent application No. 2024102133726, filed with the Patent Office of China on February 27, 2024, entitled “Epigenetic regulatory factor ZmULT1 related to corn grain size regulation and heat stress response and its application”, the entire contents of which are incorporated herein by reference. Technical Field

[0002] The present invention relates to an epigenetic regulatory factor ZmULT1 related to corn kernel size regulation and heat stress response in the field of biotechnology and an application thereof. Background Art

[0003] In recent years, with the rapid growth of the global population, food security has become a growing concern (von Koerber and Leitzmann, 2011; Stevens and Madani, 2016). As one of the world's most important food and cash crops, the steady increase in maize yield is crucial for ensuring global food security (Khan et al., 2021). Among the key factors that determine maize yield, kernel size plays a crucial role, directly impacting crop yield. With the intensification of the greenhouse effect and the frequent occurrence of extreme weather events worldwide, maize yield is significantly impacted. Continued greenhouse gas emissions are causing global temperatures to rise, making the discovery of heat-resistant maize components and new varieties crucial for food security. Maize varieties that combine high-yield traits with enlarged kernels and heat stress tolerance will have significant applications in agricultural production. Exploring the specific regulatory mechanisms of these high-yield and heat-resistant maize genes will provide a theoretical basis for achieving high and stable maize yields.

[0004] Epigenetic modifications can influence various agronomic traits of maize and play a crucial role in maize yield. Epigenetic modifications are primarily categorized into DNA / RNA methylation, histone modifications, chromatin remodeling, and noncoding RNAs. Polycomb Group (PcG) and trithorax Group (trxG) proteins form a highly conserved epigenetic regulatory complex that primarily regulates target gene expression through histone modifications. The PcG complex silences gene expression by adding repressive marks such as H3K27me3 and H2AK119ub, while trxG activates gene transcription by adding H3K4me3 (de la Paz Sanchez et al., 2015). The PcG and trxG complexes play crucial regulatory roles in plant gametophyte formation (Leroy et al., 2007), seed development (Xu et al., 2018), and the transitions between vegetative and reproductive growth, as well as between these stages (Saleh et al., 2007; Pu et al., 2013; Li et al., 2015). In rice, the Enhancer of zeste [E(z)] homolog, SET domain group protein 711 (SDG711) (Lu et al., 2023), positively regulates grain size by affecting genes involved in cytokinin metabolism. Mutations in the Fertilization Independent Endosperm 1 (FIE1) homolog, OsFIE1, in rice result in smaller grains (Huang et al., 2016). In rice, the EMBRYONIC FLOWER1 (EMF1) homolog OsEMF1 interacts with OsARF11 to regulate grain size by affecting cell expansion (Liu et al., 2018). Mutations in the Oryza sativa LIKE HETEROCHROMATIN PROTEIN 1 (OsLHP1) gene result in smaller rice grains. However, few studies have reported that PcG family homologs regulate grain size in maize.

[0005] OsSDG725, a member of the trxG family, encodes an H3K36 methyltransferase. Mutations in this gene regulate seed size by affecting the expression of several brassinosteroid biosynthesis genes, including D11, BRI1, and BU1 (Sui et al., 2012). In Arabidopsis, ULTRAPETALA1 (ULT1), a member of the trxG family, interacts with the H3K4 trimethylase ARABIDOPSIS TRITHORAX 1 (ATX1) to regulate H3K4me3 enrichment at floral development genes. ULT1 has been reported to regulate the size of both the shoot and floral meristems in Arabidopsis (Carles et al., 2004; Carles et al., 2005), but its mechanism of seed size regulation remains unclear.

[0006] References

[0007] Carles,CC,Lertpiriyapong,K.,Reville,K.,and Fletcher,JC(2004).The ULTRAPETALA1 gene functions early in Arabidopsis development to restrict shoot apical meristem activity and acts through WUSCHEL to regulate floral meristem determinacy.Genetics 167,1893-1903.

[0008] Carles, CC, Choffnes-Inada, D., Reville, K., Lertpiriyapong, K., and Fletcher, JC (2005). ULTRAPETALA1 encodes a SAND domain putative transcriptional regulator that controls shoot and floral meristem activity in Arabidopsis. Development 132,897-911.

[0009] de la Paz Sanchez,M.,Aceves-Garcia,P.,Petrone,E.,Steckenborn,S.,Vega-Leon,R.,Alvarez-Buylla,E.R.,Garay-Arroyo,A.,and Garcia-Ponce,B.(2015).The impact of Polycomb group(PcG)and Trithorax group(TrxG)epigenetic factors in plant plasticity.New Phytol 208,684-694.

[0010] Huang,X.,Lu,Z.,Wang,X.,Ouyang,Y.,Chen,W.,Xie,K.,Wang,D.,Luo,M.,Luo,J.,and Yao,J.(2016).Imprinted gene OsFIE1 modulates rice seed development by influencing nutrient metabolism and modifying genome H3K27me3.Plant J 87,305-317.

[0011] Khan,I.,Lei,H.D.,Khan,A.,Muhammad,I.,Javeed,T.,Khan,A.,and Huo,X.X.(2021).Yield gap analysis of major food crops in Pakistan:prospects for food security.Environ Sci Pollut R 28,7994-8011.

[0012] Leroy,O.,Hennig,L.,Breuninger,H.,Laux,T.,and Kohler,C.(2007).Polycomb group proteins function in the female gametophyte to determine seed development in plants. Development 134,3639-3648.

[0013] Li,C.,Chen,C.,Gao,L.,Yang,S.,Nguyen,V.,Shi,X.,Siminovitch,K.,Kohalmi,S.E.,Huang,S.,Wu,K.,Chen,X.,and Cui,Y.(2015).The Arabidopsis SWI2 / SNF2 chromatin Remodeler BRAHMA regulates polycomb function during vegetative development and directly activates the flowering repressor gene SVP.PLoS Genet 11,e1004944.

[0014] Liu,X.,Yang,C.Y.,Miao,R.,Zhou,C.L.,Cao,P.H.,Lan,J.,Zhu,X.J.,Mou,C.L.,Huang,Y.S.,Liu,S.J.,Tian,Y.L.,Nguyen,T.L.,Jiang,L.,and Wan,J.M.(2018).DS1 / OsEMF1 interacts with OsARF11 to control rice architecture by regulation of brassinosteroid signaling.Rice(N Y)11,46.

[0015] Lu,J.,Jiang,Z.,Chen,J.,Xie,M.,Huang,W.,Li,J.,Zhuang,C.,Liu,Z.,and Zheng,S.(2023).SET DOMAIN GROUP 711-mediated H3K27me3 methylation of cytokinin metabolism genes regulates organ size in rice.Plant Physiol.

[0016] Saleh,A.,Al-Abdallat,A.,Ndamukong,I.,Alvarez-Venegas,R.,and Avramova,Z.(2007).The Arabidopsis homologs of trithorax(ATX1)and enhancer of zeste(CLF)establish'bivalent chromatin marks'at the silent AGAMOUS locus.Nucleic Acids Res 35,6290-6296.

[0017] Stevens,T.,and Madani,K.(2016).Future climate impacts on maize farming and food security in Malawi.Sci Rep-Uk 6.

[0018] Sui,P.F.,Jin,J.,Ye,S.,Mu,C.,Gao,J.,Feng,H.Y.,Shen,W.H.,Yu,Y.,and W.,D.A.(2012).H3K36 methylation is critical for brassinosteroid-regulated plant growth and development in rice.Plant J 70,340-347.

[0019] von Koerber,K.,and Leitzmann,C.(2011).World Food global food supply for a growing world population.Ernahrungs Umschau 58,668-673.

[0020] Xu,F.,Kuo,T.,Rosli,Y.,Liu,MS,Wu,LM,Chen,LFO,Fletcher,JC,Sung,ZR,and Pu,L.(2018).Trithorax Group Proteins Act Together with a Polycomb Group Protein to Maintain Chromatin Integrity for Epigenetic Silencing during Seed Germination in Arabidopsis.Molecular Plant 11,659-677.

[0021] Summary of the Invention

[0022] The technical problem to be solved by the present invention is how to improve the kernel size and / or heat resistance and / or lodging resistance of corn.

[0023] To solve the above technical problems, the present invention first provides the use of a substance that reduces the content of the protein ZmULT1 or a substance that inhibits the expression of the gene encoding the protein ZmULT1, wherein the use is any of the following:

[0024] P1. Application in increasing corn kernel size;

[0025] P2. Application in improving heat tolerance of corn;

[0026] P3, application in increasing lodging resistance of corn;

[0027] P4. Application in plant breeding;

[0028] The protein ZmULT1 is the following A1, A2 or A3 protein:

[0029] A1, the amino acid sequence is the protein shown in SEQ ID No. 2 in the sequence listing;

[0030] A2, a protein having more than 80% identity with the protein shown in A1) and having the same function as the protein shown in A1) obtained by substituting and / or deleting and / or adding amino acid residues of the amino acid sequence shown in SEQ ID No. 2 in the sequence listing;

[0031] A3: A fusion protein obtained by connecting a protein tag to the N-terminus or / and C-terminus of A1) or A2).

[0032] In the above application, SEQ ID No. 2 in the sequence listing consists of 242 amino acid residues.

[0033] In the above application, identity refers to amino acid sequence identity. Amino acid sequence identity can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, the identity of a pair of amino acid sequences can be calculated by searching in Advanced BLAST 2.1 using blastp as the program, setting the Expect value to 10, all filters to OFF, BLOSUM62 as the matrix, and setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values), respectively. The identity value (%) can then be obtained.

[0034] In the above applications, the above 80% or greater identity may be at least 81%, 85%, 90%, 91%, 92%, 95%, 96%, 98%, 99% or 100% identity.

[0035] In the above application, the protein ZmULT1 may be derived from corn.

[0036] In the above application, the gene encoding the protein ZmULT1 is the ZmULT1 gene, which can be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA.

[0037] In the above application, the protein ZmULT1 encoding gene may be a nucleic acid molecule whose coding sequence is SEQ ID No. 1. More specifically, the protein ZmULT1 encoding gene may be a nucleic acid molecule whose sequence is SEQ ID No. 3.

[0038] In the above application, the reducing the content of the protein ZmULT1 or the inhibiting or reducing the expression of the gene encoding the protein ZmULT1 can be achieved by gene knockout or gene silencing.

[0039] Gene knockout refers to the phenomenon of inactivating a specific target gene through homologous recombination. Gene knockout is the inactivation of a specific target gene by changing its DNA sequence.

[0040] Gene silencing refers to the phenomenon of suppressing or under-expressing a gene without damaging the original DNA. Gene silencing is based on the premise of not changing the DNA sequence, resulting in suppressing or under-expressing the gene. Gene silencing can occur at two levels: transcriptional gene silencing due to DNA methylation, heterochromatinization, and position effects; and post-transcriptional gene silencing, which inactivates the gene by specifically inhibiting the target RNA at the post-transcriptional level. This includes antisense RNA, co-suppression, gene quelling, RNA interference (RNAi), and microRNA (miRNA)-mediated translational inhibition.

[0041] In the above application, the substance that reduces the content of the protein ZmULT1 or inhibits the expression of the gene encoding the protein ZmULT1 can be an agent for knocking out the gene encoding the protein ZmULT1, such as an agent for knocking out the gene encoding the ZmULT1 by homologous recombination, or an agent for knocking out the gene encoding the ZmULT1 by CRISPR-Cas9. The agent for knocking out the gene encoding the ZmULT1 by CRISPR-Cas9 contains the following F1), F2) or F3):

[0042] F1) sgRNA targeting the gene encoding ZmULT1;

[0043] F2) generating a DNA molecule targeting the sgRNA encoding gene of ZmULT1;

[0044] F3) Producing an expression vector for sgRNA targeting the gene encoding ZmULT1.

[0045] In the above application, the target sequence of the sgRNA is positions 514-536 of SEQ ID No. 3.

[0046] To solve the above technical problems, the present invention also provides a method for increasing corn kernel size, comprising the steps of inhibiting the expression of the gene encoding the protein ZmULT1 in the recipient corn to obtain corn kernel size larger than that of the recipient corn; the recipient corn is corn containing the encoding gene.

[0047] The present invention also provides a method for improving the heat resistance of corn, comprising the steps of inhibiting the expression of the gene encoding the protein ZmULT1 in the recipient corn to obtain corn with higher heat resistance than the recipient corn; the recipient corn is corn containing the encoding gene.

[0048] The present invention also provides a method for improving lodging resistance of corn, comprising the steps of inhibiting the expression of the gene encoding the protein ZmULT1 in the recipient corn to obtain corn with higher lodging resistance than the recipient corn; the recipient corn is corn containing the encoding gene.

[0049] In the above method, the inhibition of the expression of the gene encoding the protein ZmULT1 in the recipient maize is achieved by gene editing the gene encoding the protein ZmULT1 in the recipient maize. The gene editing is achieved with the help of the CRISPR / Cas9 system.

[0050] In the above method, the CRISPR / Cas9 system includes a plasmid expressing Cas9 and sgRNA, and the target sequence of the sgRNA may be positions 514-536 of SEQ ID No. 3.

[0051] In the above method, the nucleotide sequence of the sgRNA is shown as SEQ ID No. 4 in the sequence listing.

[0052] The present invention also improves the protein ZmULT1 and the gene encoding the protein ZmULT1.

[0053] In this application, the improvement of corn kernel size can be embodied in any one, two or three of the following:

[0054] Z1, grain length increased;

[0055] Z2, increased grain width;

[0056] Z3. The 100-grain weight increases.

[0057] In the present application, the improvement of corn heat tolerance can be reflected in an increase in corn survival rate under heat stress.

[0058] In the present application, the improvement of corn lodging resistance can be reflected in a reduction in corn plant height and / or a reduction in ear height.

[0059] Experimental studies have confirmed that ZmULT1 is highly homologous to ULT1 proteins reported in Arabidopsis and rice. Knockout of the gene encoding ZmULT1 in maize generated a zmult1 homozygous mutant. Phenotypic analysis of wild-type and zmult1 homozygous mutant plants, as well as heat stress phenotypes, revealed that compared with the wild-type, the zmult1 homozygous mutant had reduced plant height, larger kernels, and exhibited significant heat stress resistance, suggesting that this gene plays an important role in regulating kernel size, heat stress resistance, and lodging resistance in maize. Research on this gene can further enrich the application of epigenetic inheritance in crops and has important implications for improving kernel size, heat tolerance, and lodging resistance in maize. BRIEF DESCRIPTION OF THE DRAWINGS

[0060] Figure 1 shows the homology alignment and conserved domain analysis results of the ULT1 protein in Arabidopsis, rice, and maize in Example 1 of the present invention. Figure 1A shows the homology alignment results, and Figure 1B shows the conserved domain analysis results. Among them, AtULT1 is a ULT1 homologous protein in Arabidopsis, AtULT2 is a protein ULT2 with high homology to ULT1 in Arabidopsis, Os05g0502700 is a ULT1 homologous protein in rice, Zm00001d043270 is a ULT1 homologous protein in maize, Zm00001d012619 is a ULT1 homologous protein in maize, Os01g0780800 is a ULT1 homologous protein in rice, TraesCS3A02G317100 is a ULT1 homologous protein in wheat, TraesCS3B02G349300 is a ULT1 homologous protein in wheat, and TraesCS3D02G314100 is a ULT1 homologous protein in wheat.

[0061] FIG2 is an expression profile analysis of ZmULT1 in various maize tissues in Example 1 of the present invention, wherein the internal reference gene is maize ACTIN (Zm00001d010159).

[0062] Figure 3 shows the phenotype of the zmult1 mutant, the effect of gene editing on the ZmULT1 gene, and the expression analysis results of the ZmULT1 gene in wild-type maize KN5585 and the zmult1 mutant plants, as described in Example 2 of the present invention. Figure 3A shows the phenotype of the zmult1 mutant, Figure 3B shows the effect of gene editing on the ZmULT1 gene in the zmult1 mutant, and Figure 3C shows the expression analysis results of the ZmULT1 gene in wild-type maize KN5585 and the zmult1 mutant plants. Data shown in the figure are mean ± SD, with three replicates. ** indicates a significance level of P < 0.01 compared to the control KN5585.

[0063] Figure 4 shows the phenotypic analysis of the wild-type maize KN5585 and mutant zmult1 lines in the field according to Example 2 of the present invention. Figure 4A is a photograph of the phenotypic changes in the field, Figure 4B is a photograph of the tassel phenotypic changes, and Figure 4C shows the statistical results of plant height, ear height, tassel length, and tassel branch number. Data shown in the figure are mean ± standard deviation, with three replicates. ** indicates a significance analysis result of P < 0.01 compared to the control KN5585.

[0064] Figure 5 shows the mature kernel phenotypes of wild-type corn KN5585 and the mutant zmult1 strain in Example 2 of the present invention. Figure 5A is a photograph of the kernels, with wild-type corn KN5585 kernels on the left and mutant zmult1 kernels on the right. Figure 5B is a photograph of the kernels, with the top row showing wild-type corn KN5585 kernels and the bottom row showing mutant zmult1 kernels. Figure 5C shows the statistical results of kernel length, width, and 100-kernel weight. Data shown in the figure are mean ± standard deviation, with 3 replicates. ** indicates a significance analysis result of P < 0.01 compared to the control KN5585.

[0065] Figure 6 shows phenotypic analysis of wild-type maize KN5585 and the zmult1 mutant strain after two days of heat stress treatment in Example 2 of the present invention. Figures 6A and 6B show wild-type maize KN5585 (labeled KN5585) and the zmult1 mutant strain (labeled zmult1) at room temperature. Figures 6C and 6D show wild-type maize KN5585 (labeled KN5585+HS2D) and the zmult1 mutant strain (labeled zmult1+HS2D) under heat stress. Figure 6E shows the survival rate of wild-type maize KN5585 (labeled KN5585) and the zmult1 mutant strain (labeled zmult1) after two days of heat stress treatment at 42°C. Data shown in the figure are mean ± SD, with three replicates. ** indicates a significance level of P < 0.01 compared to the control KN5585. DETAILED DESCRIPTION

[0066] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0067] The quantitative tests in the following examples were all repeated three times, and the results were averaged.

[0068] The experimental methods in the following examples are conventional methods unless otherwise specified. The materials and reagents used in the following examples are commercially available unless otherwise specified.

[0069] The corn variety KN5585 in the following examples was obtained from the corn transformation company Weimi Biotechnology (Jiangsu) Co., Ltd.

[0070] In the following examples, the vector pGL3-U6-sgRNA is a product of Weimi Biotechnology (Jiangsu) Co., Ltd., a corn transformation company.

[0071] The data in the following examples were processed using SPSS statistical software. The experimental results were expressed as mean ± standard deviation and were tested using Student t-test. P < 0.05 (*) indicated a significant difference, and P < 0.01 (**) indicated a very significant difference.

[0072] Example 1. Acquisition of ZmULT1 gene

[0073] In addition to regulating plant development and organ size, ULT1 can also respond to external biotic and abiotic stresses. It has been reported that mutations in ULT1 in Arabidopsis thaliana reduce the salt tolerance of weak EMF1 mutants, suggesting that ULT1 can regulate plant salt stress. ULT1 can respond to biotic and abiotic stresses by regulating the synthesis and metabolism of glucosinolates. However, the specific regulatory mechanisms by which ULT1 responds to heat stress in maize remain unclear.

[0074] In summary, it is crucial to analyze the epigenetic regulatory mechanism of ZmULT1 in maize grain size and heat stress response. It will provide certain genetic materials for analyzing the regulatory mechanism of seed and organ size and response to heat stress of crops such as maize, and also provide certain theoretical support for the breeding of excellent maize varieties.

[0075] 1. Homologous alignment and conserved domain analysis of ZmULT1

[0076] Total RNA was extracted from the stem tissue of maize cultivar KN5585 seedlings and reverse transcribed to generate first-strand cDNA. The resulting cDNA was used as a template for PCR amplification using the primer pair consisting of ZmULT1-F and ZmULT1-R. The amplified product was obtained and sequenced.

[0077] Primer sequences:

[0078] ZmULT1-F: 5′-GATACACCTCCGAAGTAGTTGTTG-3′;

[0079] ZmULT1-R: 5′-ACTAGGCTAATGGAAAATGTTTAAAATA-3′.

[0080] Sequencing results showed that the ZmULT1 gene cloned by the inventors is 3398 bp long, with a nucleotide sequence of SEQ ID No. 3. Positions 1-467 constitute the 5'-UTR, positions 468-687 constitute the first exon, positions 688-2605 constitute the first intron, positions 2606-2939 constitute the second exon, positions 2940-3159 constitute the second intron, positions 3160-3334 constitute the third exon, and positions 3335-3398 constitute the 3'-UTR. The CDS sequence (SEQ ID No. 1) is 729 bp long and encodes the ZmULT1 protein with the amino acid sequence of SEQ ID No. 2. The ZmULT1 protein consists of 242 amino acid residues and has a molecular weight of 26.5 kDa.

[0081] SEQ ID No.1

[0082] SEQ ID No. 2

[0083] SEQ ID No. 3

[0084] The reported amino acid sequences of Arabidopsis and rice ULT1 were downloaded from the National Center for Biotechnology Information, and homology comparisons were performed in the maize database. A phylogenetic tree was constructed for these genes using MEGA software, and it was found that ZmULT1 was highly homologous to the ULT1 proteins reported in Arabidopsis and rice ( Figure 1A ).

[0085] The conserved domain analysis of ZmULT1 protein was performed using the uniprot website, and it was found that ZmULT1 protein, like ULT1 reported in other species, contains conserved SAND domain and B-box domain (see Figure 1B).

[0086] 2. Expression profile analysis of the ZmULT1 gene in various maize tissues

[0087] RNA was extracted from various tissues of maize KN5585 and reverse transcribed to generate cDNA, which served as a template for RT-qPCR. The relative expression of the ZmULT1 gene in various maize tissues was determined using the primer pair consisting of ZmULT1-qPCR-F and ZmULT1-qPCR-R. The maize ACTIN (Zm00001d010159) was used as a reference gene, using the primer pair consisting of ACT-qPCR-F and ACT-qPCR-R.

[0088] To clarify the role of ZmULT1 in maize growth and development, we used cDNA from shoots, roots, ears (35 days after pollination), seeds (35 days after pollination), silks (35 days after pollination), tassels, pre-pollination cobs (35 days after pollination), cobs (35 days after pollination), seeds (15 days after pollination), and roots (15 days after pollination) of maize cultivar KN5585 as templates. qRT-PCR was performed using primers ZmULT1-qPCR-F and ZmULT1-qPCR-R. Wild-type maize KN5585 was used as a control. Maize ACTIN (Zm00001d010159) was used as the reference gene. For RT-qPCR detection, three technical replicates were performed for each sample using 2 -ΔΔCt Methods The relative expression of genes was calculated. The primer sequences are as follows:

[0089] ZmULT1-qPCR-F: 5′-TGTGCTTCCCACCCCTCGGC-3′ (identical to positions 343-362 of SEQ ID No. 3);

[0090] ZmULT1-qPCR-R: 5′-CGTTCGCCGCGGCCATGTCT-3′ (reverse complement to the sequence at positions 464-483 of SEQ ID No. 3).

[0091] The reference gene used was the maize ACTIN gene (Zm00001d010159). The primer sequences for the ACTIN gene are as follows:

[0092] ACT-qPCR-F: 5′-ATGTTTCCTGGGATTGCCGAT-3′

[0093] ACT-qPCR-R: 5′-CCAGTTTCGTCATACTCTCCCTTG-3′

[0094] The results are shown in Figure 2. ZmULT1 is expressed in all tissues of corn, especially in seedling stems, seedling roots, filaments 35 days after pollination, and grains 15 days after pollination.

[0095] Example 2: Functional verification of the ZmULT1 gene

[0096] 1. Construction of gene-edited ZmULT1 transgenic maize

[0097] To verify the function of the ZmULT1 gene, gene-edited ZmULT1 transgenic maize was constructed as follows:

[0098] The ZmULT1 sgRNA coding sequence is: GTTTTAGGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC (SEQ ID No. 4), and the corresponding target sequence of the gene coding is CCGCGGCGAACGGAGCTGCCGCT (sequence 472-494 of SEQ ID No. 3).

[0099] The corn transformation company Weimi Biotechnology (Jiangsu) Co., Ltd. was commissioned to construct the gene editing recombinant plasmid pGL3-U6-sgRNA-ZmULT1. The plasmid was constructed by inserting the ZmULT1 sgRNA coding sequence (SEQ ID No. 4) used for gene encoding into a specific insertion site (Bsa1 single enzyme cutting site) behind the ZmU6 promoter of the pGL3-U6-sgRNA vector to obtain the recombinant plasmid pGL3-U6-sgRNA-ZmULT1.

[0100] The structure of the recombinant plasmid pGL3-U6-sgRNA-ZmULT1 is described as follows: The DNA molecule shown in SEQ ID NO. 4 was inserted into the restriction endonuclease Bsa1 site of the pGL3-U6-sgRNA vector to generate the recombinant plasmid. The recombinant plasmid pGL3-U6-sgRNA-ZmULT1 expresses the ZmULT1 sgRNA shown in SEQ ID NO. 4, which targets positions 472-494 of SEQ ID NO. 3.

[0101] The recombinant plasmid pGL3-U6-sgRNA-ZmULT1 was transformed into Agrobacterium tumefaciens AG1 to obtain recombinant Agrobacterium tumefaciens AG1 / pGL3-U6-sgRNA-ZmULT1.

[0102] The wild-type maize KN5585 was then infected with recombinant Agrobacterium AG1 / pGL3-U6-sgRNA-ZmULT1 to obtain T0 generation gene-edited ZmULT1 transgenic maize. The phenotypic photo is shown in Figure 3A.

[0103] 2. Functional verification of the ZmULT1 gene

[0104] 1) PCR amplification and sequencing

[0105] Design primers near the gene editing site with the following sequences:

[0106] ULT1-F: 5′-ACTTCGATCCGCCAGTTTGT-3′ (identical to positions 326-345 of SEQ ID No. 3);

[0107] ULT1-R: 5′-TGCATGCATGTTCATCTGCG-3′ (reverse complement to the sequence at positions 798-817 of SEQ ID No. 3).

[0108] Novozyme PCR mix high-fidelity enzyme was used to detect target gene editing. Genomic DNA from leaves of the gene-edited Zmult1 maize zmult1 mutant was used as a template for PCR amplification using ULT1-F and ULT1-R.

[0109] The above PCR reaction system is shown in Table 1:

[0110] Table 1

[0111] PCR reaction conditions: 95°C for 3 min, 95°C for 15 sec, 56°C for 20 sec, 72°C for 1 min, 72°C for 10 min, 35 cycles.

[0112] The resulting PCR products were sequenced and the editing effect was analyzed. The results are shown in Figure 3B: The zmult1 mutant is due to a large deletion of deoxyribonucleotides located in the first exon (a total of 53 bp from positions 477 to 529 of SEQ ID No. 3 is missing), resulting in premature termination of the coding of the ZmULT1 protein and effective editing of the targeted ZmULT1 gene.

[0113] 2) RT-PCR detection of gene expression

[0114] RNA was extracted from leaves of the gene-edited ZmULT1 maize zmult1 homozygous mutant and reverse transcribed to generate cDNA, which was used as a template for RT-qPCR using ZmULT1-qPCR-F and ZmULT1-qPCR-R. The internal control was maize ACTIN (Zm00001d010159), and the primer sequences for the ACTIN gene are as follows:

[0115] ACT-qPCR-F: 5′-ATGTTTCCTGGGATTGCCGAT-3′

[0116] ACT-qPCR-R: 5′-CCAGTTTCGTCATACTCTCCCTTG-3′

[0117] In the RT-qPCR test, wild-type maize KN5585 was used as the control, and each sample was repeated three times. -ΔΔCtMethods The relative expression of genes was calculated.

[0118] The results are shown in Figure 3C. It can be seen that compared with the control (wild-type corn KN5585), the expression level of ZmULT1 in the gene-edited ZmULT1 corn (zmult1 homozygous mutant) is reduced, which also proves that the gene editing is successful. The zmult1 mutant is a gene-edited ZmULT1 corn that inhibits the expression of ZmULT1.

[0119] 3) Phenotypic detection

[0120] The gene-edited ZmULT1 maize homozygous mutant zmult1 was continuously self-pollinated and propagated to obtain the mutant zmult1 line, which was used for subsequent phenotypic testing.

[0121] Fifty plants each of the mutant zmult1 line and wild-type maize KN5585 (control) were planted in the field. After pollination and when the plants stopped growing, traits such as plant height, ear height, tassel length, and tassel branch number were measured.

[0122] The results are shown in FIG4 , which shows that compared with the wild-type corn, the mutant zmult1 line has a reduced plant height, a reduced ear height, a shorter tassel length, and fewer tassel branches.

[0123] 4) Phenotype of corn kernels

[0124] Fifty plants of the mutant zmult1 line and 50 plants of wild-type maize KN5585 (control) were planted in the field. After pollination, the grain characteristics were measured after the grains matured and developed.

[0125] The results are shown in FIG5 , which shows that compared with the wild-type corn, the mutant zmult1 line has increased grain length, width and 100-grain weight.

[0126] 5) Plant heat stress phenotype detection

[0127] In the laboratory, wild-type maize KN5585 and mutant zmult1 lines were simultaneously cultured hydroponically, with 3 bottles of each culture and 15 plants per bottle. The nutrient solution was replaced regularly during the culture period. When the hydroponic plants grew to the two-leaf and one-heart stage, they were subjected to 42°C heat stress treatment. The control was not subjected to heat treatment (wild-type maize KN5585 planted at room temperature was labeled KN5585, and the mutant zmult1 line planted at room temperature was labeled zmult1). The changes in the seedlings were observed every three hours until the two lines showed significantly different heat-resistant phenotypes. The phenotypes after 2 days of heat stress treatment are shown in Figures 6A, 6B, 6C, and 6D (wild-type maize KN5585 treated with heat stress at 42°C for 2 days was labeled KN5585+HS2D, and the mutant zmult1 line treated with heat stress at 42°C for 2 days was labeled zmult1+HS2D). The survival rates of wild-type maize KN5585 (labeled as KN5585) and the zmult1 mutant (labeled as zmult1) grown at 42°C were counted on the second day, as shown in Figure 6E. As can be seen from Figure 6, compared with wild-type maize KN5585, the zmult1 mutant was insensitive to heat stress and had a significant ability to resist heat stress.

[0128] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been given herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements to the present invention, including those made by conventional techniques known in the art that depart from the scope of the present invention. Applications of the essential features may be made within the scope of the following claims.

Claims

1. Use of a substance for reducing the content of the protein ZmULT1 or a substance for inhibiting the expression of a gene encoding the protein ZmULT1, characterized in that: The application is any of the following: P1. Application in increasing corn kernel size; P2. Application in improving heat tolerance of corn; P3, application in increasing lodging resistance of corn; P4. Application in plant breeding; The protein ZmULT1 is the following A1, A2 or A3 protein: A1, the amino acid sequence is the protein shown in SEQ ID No. 2 in the sequence listing; A2, a protein having more than 80% identity with the protein shown in A1) and having the same function as the protein shown in A1) obtained by substituting and / or deleting and / or adding amino acid residues of the amino acid sequence shown in SEQ ID No. 2 in the sequence listing; A3: A fusion protein obtained by connecting a protein tag to the N-terminus or / and C-terminus of A1) or A2).

2. The use according to claim 1, characterized in that: The protein ZmULT1 is derived from maize.

3. The use according to claim 1 or 2, characterized in that: The coding gene of the protein ZmULT1 is a nucleic acid molecule whose coding sequence is SEQ ID No.

1.

4. The use according to claim 3, characterized in that: The gene encoding the protein ZmULT1 is a nucleic acid molecule with a sequence of SEQ ID No.

3.

5. The use according to claim 4, characterized in that: The reducing of the content of the protein ZmULT1 or the inhibiting or reducing of the expression of the gene encoding the protein ZmULT1 is achieved by knocking out the gene encoding the ZmULT1 through CRISPR-Cas9; the reagent used for the CRISPR-Cas9 contains the following F1), F2) or F3): F1) sgRNA targeting the gene encoding ZmULT1; F2) generating a DNA molecule targeting the sgRNA encoding gene of ZmULT1; F3) Producing an expression vector for sgRNA targeting the gene encoding ZmULT1.

6. The use according to claim 5, characterized in that: The target sequence of the sgRNA is positions 514-536 of SEQ ID No.

3.

7. A method for increasing corn kernel size, characterized by: The method comprises the steps of inhibiting the expression of the gene encoding the protein ZmULT1 according to claim 1 in a recipient corn to obtain corn kernels larger in size than the recipient corn; the recipient corn is corn containing the encoding gene.

8. A method for improving the heat tolerance of corn, characterized by: The method comprises the steps of inhibiting the expression of the gene encoding the protein ZmULT1 in the recipient corn to obtain corn having a higher heat resistance than the recipient corn; the recipient corn is corn containing the encoding gene.

9. A method for improving lodging resistance of corn, characterized by: The method comprises the steps of inhibiting the expression of the gene encoding the protein ZmULT1 in the recipient corn to obtain corn with higher lodging resistance than the recipient corn; the recipient corn is corn containing the encoding gene.

10. A gene encoding the protein ZmULT1 according to any one of claims 1 to 2 or the protein ZmULT1 according to any one of claims 1 to 4.

Citation Information

Patent Citations

  • Application of protein GmULT1 in regulating and controlling weight of plant seeds

    CN111850030A

  • Application of tomato SlULT1 gene in improvement of drought resistance of tomato

    CN114940996A

  • Application of ULT1 gene in controlling branching and silique angles of plants

    CN115927391A

  • Epigenetic regulatory factor ZmULT1 related to corn grain size regulation and heat stress response and application of epigenetic regulatory factor ZmULT1

    CN118085047A

Cited By

  • Epigenetic regulatory factor ZmULT1 related to corn grain size regulation and heat stress response and application of epigenetic regulatory factor ZmULT1

    CN118085047A

  • Method for regulating and controlling heat resistance of corn and application of method

    CN122189080A