Lymphocytes with increased expression of oxygen-binding proteins

Abstract

The present invention relates to T cells or NK cells comprising an exogenous nucleic acid molecule having a nucleotide sequence coding for an oxygen-binding protein, pharmaceutical compositions comprising such T cells or NK cells, the T cells or NK cells and the pharmaceutical compositions for use as a medicament and in a method of treating cancer in a subject, and methods for preparing such T cells or NK cells.

Description

[0001] LYMPHOCYTES WITH INCREASED EXPRESSION OF OXYGEN -BINDING PROTEINS

[0002] Technical Field

[0003] The present invention relates to T cells or NK cells comprising an exogenous nucleic acid molecule having a nucleotide sequence coding for an oxygen-binding protein, pharmaceutical compositions comprising such T cells or NK cells, the T cells or NK cells and the pharmaceutical compositions for use as a medicament and in a method of treating cancer in a subject, and methods for preparing such T cells or NK cells.

[0004] Technological Background

[0005] For successfully initiating antigen-specific immunity, T cells require clonal expansion, differentiation into effector cells, and homing into target tissue to eliminate cells presenting antigen. In contrast, natural killer (NK) cells are capable of recognizing and killing target cells without prior exposure to antigen. Upon activation, NK cells can quickly exert their cytotoxic functions. Metabolic pathways in both T cells and NK cells including glycolysis, fatty acid oxidation, fatty acid synthesis or amino acid metabolism are constantly being processed after activation in order to adjust to expansion and effector differentiation, and to meet the increased energy demands of maintaining an antigen-specific response and cytotoxic function.

[0006] In T cells, this is usually associated with switching to aerobic glycolysis, an observation termed 'Warburg effect' \n orderto support cell division (M. G. Vander Heiden, L. C. Cantley, C. B. Thompson, Understanding the Warburg effect: the metabolic requirements of cell proliferation. Science 324, 1029-1033 (2009)). When T cells and NK cells are in quiescence, energy is primarily generated through glucose-derived pyruvate, which is transported for the tricarboxylic acid (TCA) cycle to the mitochondria to support oxidative phosphorylation (OXPHOS) for ATP generation (R. I. K. Geltink, R. L. Kyle, E. L. Pearce, Unraveling the Complex Interplay Between T Cell Metabolism and Function. Annu Rev Immunol 36, 461-488 (2018); Cong J. Metabolism of Natural Killer Cells and Other Innate Lymphoid Cells. Front Immunol. 2020 Aug 28). Hence, naive T cells use glucose metabolism and OXPHOS, but upon antigen recognition and differentiating into effector cells, they increase amino acid and glucose uptake, at the same time limiting the dependence on fatty acid oxidation (ibid). Metabolic changes are not only observed in response to T cell activation but can drive their function and regulate the progression to exhaustion. The switch towards aerobic glycolysis is important for effector functions of T cells, while it is dispensable for proliferation and survival (C. H. Chang et al., Posttranscriptional control of T cell effector function by aerobic glycolysis. Cell 153, 1239- 1251 (2013)). Specifically, short-lived effector cells (SLECs) require aerobic glycolysis to facilitate effector functions (ibid).

[0007] Moreover, mitochondrial dynamics play a critical role in modulation of memory and effector T cell fate (M. D. Buck et al., Mitochondrial Dynamics Controls T Cell Fate through Metabolic Programming. Cell 166, 63-76 (2016); B. Bengsch et al., Bioenergetic Insufficiencies Due to Metabolic Alterations Regulated by the Inhibitory Receptor PD-1 Are an Early Driver of CD8(+) T Cell Exhaustion. Immunity 45, 358-373 (2016); N. E. Scharping et al., Mitochondrial stress induced by continuous stimulation under hypoxia rapidly drives T cell exhaustion. Nat Immunol 22, 205-215 (2021)).

[0008] Specifically, low mitochondrial function caused by PD-1 signaling in CD8+ T cells is linked to T cell exhaustion and antigen persistence (ibid). Moreover, limited mitochondrial OXPHOS and increased reactive oxygen species (ROS) production are associated with limited T cell proliferation, T cell dysfunction, and exhaustion (ibid). Likewise, increased production or defective elimination of reactive oxygen species (ROS) can result in T cell dysfunction and prolonged antigen persistence (T. W. Mak et al., Glutathione Primes T Cell Metabolism for Inflammation. Immunity 46, 675-689 (2017); P. A. Lang et al., Reactive oxygen species delay control of lymphocytic choriomeningitis virus. Cell death and differentiation, (2013)).

[0009] Consistently, disturbed mitochondrial dynamics of anti-tumor T cells in cancer tissue can drive exhaustion (Y. R. Yu et al., Disturbed mitochondrial dynamics in CD8(+) TILs reinforce T cell exhaustion. Nat Immunol 21 , 1540-1551 (2020)). Furthermore, impaired OXPHOS during antigen persistence can trigger T cell dysfunction, which can be restored following prevention of mitochondrial ROS (S. A. Vardhana et al., Impaired mitochondrial oxidative phosphorylation limits the self-renewal of T cells exposed to persistent antigen. Nat Immunol 21 , 1022-1033 (2020)).

[0010] The tumor microenvironment exhibits an immunosuppressive state contributing to immune dysfunction during anti-cancer defense and T cell and NK-based therapies. Specifically, cancer cells themselves exhibit aerobic glycolysis thus limiting access to glucose and oxygen (M. G. Vander Heiden, L. C. Cantley, C. B. Thompson, Understanding the Warburg effect: the metabolic requirements of cell proliferation. Science 324, 1029-1033 (2009), K. C. Kao, S. Vilbois, C. H. Tsai, P. C. Ho, Metabolic communication in the tumor-immune microenvironment. Nat Cell Biol 24, 1574- 1583 (2022)).

[0011] Accordingly, T cells and NK cells responsible for anti-tumor responses often exhibit a dysregulated metabolic profile. The increased glucose metabolism in cancer tissue results in an increase in pyruvate and lactate production (ibid). In turn, the uptake of glucose is required for T cell and NK cell growth, proliferation, and acquisition of effector functions. This creates a competition for glucose between the tumor and T cells and NK cells, which can influence cancer progression (C. H. Chang et al., Metabolic Competition in the Tumor Microenvironment Is a Driver of Cancer Progression. Cell 162, 1229-1241 (2015), Portale F, Di Mitri D. NK Cells in Cancer: Mechanisms of Dysfunction and Therapeutic Potential. Int J Mol Sci. 2023 May 30; 24(11 ):9521 ).

[0012] Moreover, hypoxia-induced mitochondrial stress can mimic exposure to the tumor microenvironment and drive T cells and NK cells into an exhausted state (N. E. Scharping et al., Mitochondrial stress induced by continuous stimulation under hypoxia rapidly drives T cell exhaustion. Nat Immunol 22, 205-215 (2021); Portale F, Di Mitri D. NK Cells in Cancer: Mechanisms of Dysfunction and Therapeutic Potential. Int J Mol Sci. 2023 May 30; 24(11 ):9521 ). Notably, hypoxia-conditioned T cells show increased effectivity against cancer cells (Y. Gropper et al., Culturing CTLs under Hypoxic Conditions Enhances Their Cytolysis and Improves Their Anti-tumor Function. Cell Rep 20, 2547-2555 (2017)).

[0013] Sickle cell hemoglobin polymerizes in low oxygen conditions causing cell rigidity. Making use of the hypoxic tumor microenvironment, sickle cell hemoglobin (SS) was introduced into erythrocytes and other cells as a means to cause cell rigidity in tumor tissue, thus blocking vasculature in tumor tissue (Terman, D.S., US 8,431 ,1 17 B2).

[0014] Consistently, hypoxia-inducible factors (HIF) enhance effector T cell functions and can limit tumor growth in mice (A. L. Doedens et al., Hypoxia-inducible factors enhance the effector responses of CD8(+) T cells to persistent antigen. Nat Immunol 14, 1173-1182 (2013)). In turn, pharmacological inhibition of HIF-1a can promote susceptibility towards checkpoint inhibition and reduce tumor growth (S. Ma et al., Hypoxia induces HIF-1a-dependent epigenetic vulnerability in triple-negative breast cancer to confer immune effector dysfunction and resistance to anti-PD-1 immunotherapy. Nat Commun 13, 4118 (2022)).

[0015] Notably, a metabolic boost of exhausted T cells can improve effector function against tumors (Y. Guo et al., Metabolic reprogramming of terminally exhausted CD8(+) T cells by IL-10 enhances anti-tumor immunity. Nat Immunol 22, 746-756 (2021)). Likewise, inhibition of glycolysis can prevent terminal differentiation and can improve anti-cancer immunity (M. Sukumar et al., Inhibiting glycolytic metabolism enhances CD8+ T cell memory and antitumor function. J Clin Invest 123, 4479-4488 (2013)). Collectively, these data indicate that metabolic functions widely affect the fate and anticancer effector function of T cells and NK cells.

[0016] Therefore, in view of the immunosuppressive state with severely limited glucose and oxygen access observed in the tumor microenvironment, there is a need for T cells and NK cells usable for tumor therapies having improved function and anti-cancer immunity in general and in tumor microenvironment in particular.

[0017] Different approaches for gene therapy have been developed to reconstitute gene activity in cell populations in patients lacking or carrying a defective gene (Jolly, D.J., US 2003 / 0157070 A1). Similarly, methods for transfecting cells with DNA or RNA using electroporation, in particular high throughput microfluidic electroporation, for treating different diseases have been described (University of Texas, WO 2008 / 131445).

[0018] However, these methods do not intend to improve anti-tumor T cell or NK cell function, in particular in the tumor microenvironment.

[0019] Furthermore, CAR-T cell immunotherapy of cancer based on the generation of CAR-T cells in combination with siRNA-mediated downregulation of PD-1 has been reported (Simon, B. et al. 2018; Exp. Dermatol., 2018; 27:769-778). The siRNA-mediated downregulation of PD-1 alone or simultaneously with CTLA-4 shows enhanced in vitro CAR-T-cell functionality for further clinical development towards the potential use in immunotherapy of melanoma.

[0020] However, there is no indication in any document of the prior art related to a potential improvement of metabolic functions of T cells or NK cells.

[0021] Thus, it is an object of the present invention to provide a novel T cell and NK cell less susceptible to exhaustion and exhibiting increased proliferation as well as increased effector functions against tumor cells. It is a further object of the present invention to provide T cells, NK cells, and pharmaceutical compositions comprising such T cells and NK cells which can be used in the treatment of cancer in a subject, and methods for preparing such T cells and NK cells. Summary of the Invention

[0022] These objects have been solved by the aspects of the present invention as specified hereinafter.

[0023] According to the first aspect of the invention, a T cell or NK cell is provided comprising an exogenous nucleic acid molecule having a nucleotide sequence coding for an oxygen-binding protein.

[0024] Therefore, according to the first aspect of the invention, a genetically modified T cell or NK cell transduced with an exogenous nucleic acid encoding an oxygen-binding protein is provided.

[0025] The exogenous nucleic acid is introduced to drive overexpression beyond endogenous levels in the cell and is functionally linked to an expression control sequence to ensure robust transcription and translation.

[0026] Upon transduction, the oxygen-binding protein is actively expressed and accumulated intracellularly. Expression and overexpression can be confirmed using mRNA and protein assays or functional oxygen-binding analysis. The modified T cell or NK cell thus exhibits detectable and functional levels of the transduced oxygen-binding protein, thus providing and contributing to its biological and therapeutic use according to the present invention.

[0027] In an embodiment of the first aspect, the oxygen binding protein is selected from a group consisting of Myoglobin, Neuroglobin, Cytoglobin, Hemoglobin A (HbA), HbA2, HbE Gower 1 , HbE Gower 2, HbE Portland I, HbE Portland II, HbH, Hb Barts, HbS, HbC, HbO, Hb Bassett, Hb Kansas, Hb D- Punjab, Hb O-Arab, Hb G-Philadelphia, Hb Hasharon, Hb Lepore, Hb M, Hb Hope, Hb Pisa, Hb J, Hb N-Baltimore, Hb Chesapeake, Hb Louisville, Hb Vanvitelli, fetal hemoglobin or Globin Y, Globin X, Globin E, Globin CTT (l-X), Globin-CTT-VIIB (3-10), Hemocyanin, Androglobin, Globin C, Erythrocruorin, Chlorocruorin, Extracellular Globin (1 -4), Hemerythrin, Giant Hexagonal Bilayer Hemoglobin, Globin-like proteins (1-26), Globin (1 -3, and 5), Globin D, Phytoglobin, Leghemoglobin (1-3, A), Flavohemoglobin, Flavohemoprotein 1 , and Flavohemoprotein 2, preferably Myoglobin, Cytoglobin, Hemoglobin A, and Globin E, particularly preferably Myoglobin, Cytoglobin, and Globin E. In a preferred embodiment of the first aspect, the oxygen-binding protein is Myoglobin.

[0028] In another embodiment of the first aspect, the T cell is a conventional T cell, an NKT cell, or NKT-like cell, preferably a CD8+T cell, CD8+NKT cell, or CD8+NKT-like cell, particularly preferably a naive CD8+T cell, CD8+NKT cell, or CD8+NKT-like cell. In yet another embodiment of the first aspect, the T cell or NK cell is a human T cell or NK cell.

[0029] In yet another embodiment of the first aspect, the T cell or NK cell is genetically engineered to express a chimeric antigen-specific receptors (CAR), preferably wherein the T cell or NK cell is a CAR T cell or CAR NK cell suitable for an autologous or allogeneic immunotherapy treatment of pre-malignant or malignant cancer.

[0030] According to a second aspect of the invention, a pharmaceutical composition is provided comprising the T cell or NK cell of the first aspect and a pharmaceutically acceptable excipient.

[0031] According to a third aspect of the invention, the T cell or NK cell of the first aspect or the pharmaceutical composition of the second aspect is provided for use as a medicament.

[0032] According to a fourth aspect of the invention, the T cell or NK cell of the first aspect or the pharmaceutical composition of the second aspect is provided for use in a method of treating cancer in a subject.

[0033] In an embodiment of the fourth aspect, the cancer is a solid tumor, preferably malignant melanoma.

[0034] In another embodiment of the fourth aspect, the use further comprises simultaneous treatment with anti-PD-1 and / or anti-PD-L1 therapy.

[0035] According to a fifth aspect of the invention, a method for preparing an engineered T cell or NK cell is provided comprising introducing into a T cell or NK cell an exogenous nucleic acid molecule having a nucleotide sequence coding for an oxygen-binding protein.

[0036] In an embodiment of the fifth aspect, the T cell is a conventional T cell, an NKT cell, or NKT-like cell, preferably a CD8+T cell, CD8+NKT cell, or CD8+NKT-like cell, particularly preferably a naive CD8+T cell, CD8+NKT cell, or CD8+NKT-like cell, and / or wherein the T cell or NK cell is a human T cell or NK cell.

[0037] In another embodiment of the fifth aspect, the method further comprises a step of introducing into the T cell or NK cell an exogenous nucleic acid molecule comprising a nucleotide sequence coding for a Chimeric Antigen Receptor (CAR) directed against at least one antigen expressed at the surface of a malignant or infected cell. In yet another embodiment of the fifth aspect, the oxygen-binding protein is selected from a group consisting of Myoglobin, Neuroglobin, Cytoglobin, Hemoglobin A (HbA), HbA2, HbE Gower 1 , HbE Gower 2, HbE Portland I, HbE Portland II, HbH, Hb Barts, HbS, HbC, HbO, Hb Bassett, Hb Kansas, Hb D-Punjab, Hb O-Arab, Hb G-Philadelphia, Hb Hasharon, Hb Lepore, Hb M, Hb Hope, Hb Pisa, Hb J, Hb N-Baltimore, Hb Chesapeake, Hb Louisville, Hb Vanvitelli, fetal hemoglobin or Globin Y, Globin X, Globin E, Globin CTT (l-X), Globin-CTT-VIIB (3-10), Hemocyanin, Androglobin, Globin C, Erythrocruorin, Chlorocruorin, Extracellular Globin (1 -4), Hemerythrin, Giant Hexagonal Bilayer Hemoglobin, Globin-like proteins (1-26), Globin (1 -3, and 5), Globin D, Phytoglobin, Leghemoglobin (1-3, A), Flavohemoglobin, Flavohemoprotein 1 , and Flavohemoprotein 2, preferably Myoglobin, Cytoglobin, Hemoglobin A, and Globin E, more preferably Myoglobin, Cytoglobin, and Globin E, most preferably wherein the oxygen-binding protein is Myoglobin.

[0038] Brief description of the drawings

[0039] The present disclosure will be more readily appreciated by reference to the following data when being considered in connection with the accompanying drawings in which:

[0040] Figure 1 : Myoglobin was determined in Myoglobin-expressing T cells. Western Blot analysis for murine Myoglobin (Mb) and Tubulin was performed on Control and Myoglobin-expressing T cells.

[0041] Figure 2: Reduced hypoxia factor was measured in Myoglobin-expressing T cells in comparison to control T cells. Control and Myoglobin expression T cells were treated with (A) 0 pM and (B) 200 pM C0CI2. Hifla expression was determined via Flow Cytometry gated on CD8+Thy1.1+T cells (n=6).

[0042] Figure 3: Myoglobin-expressing T cells have a higher ratio of effector T cells in comparison to control T cells. The Percentage of effector cells (CD44+and CD62L ) of Control and Myoglobin expression T cells was determined via Flow Cytometry gated on CD8+Thy1 ,1+T cells (n=6).

[0043] Figure 4: Downregulation of tumor-specific T cell differentiation regulator was determined in Myoglobin-expressing T cells in comparison to control T cells. TOXhigh und TOXdim population of Control and Myoglobin expression T cells was determined via Flow Cytometry gated on CD8+Thy1 ,1+T cells (n=6). Figure 5: Reduced expression of exhaustion markers was measured in Myoglobin-expressing T cells in comparison to control T cells. (A) PD-1 and (B) Tim-3 expression of Control and Myoglobin expression T cells was determined via Flow Cytometry gated on CD8+Thy1.1+T cells (n=6).

[0044] Figure 6: Myoglobin-expressing T cells have an improved aerobic metabolism in comparison to control T cells. Seahorse analysis of Oxygen Consumption rate (OCR) of Control and Myoglobinexpressing T cells by (A) time-dependent drug treatment with Oligomycin (left vertical dashed line between 0 and 20 mins), FCCP (middle vertical dashed line between 20 and 40 mins) and Antimycin A + Rotenone (right vertical dashed line between 40 and 60 mins). (B) ATP-linked Respiration was determined by subtracting the basal from the Oligomycin treated values. (C) Basal Respiration was determined by subtracting the basal from the Rotenone & Antimycin A treated values. (D) The Maximal Respiration was determined by subtracting the values after FCCP treatment with the values after Rotenone & Antimycin A treatment (n=11 -12).

[0045] Figure 7: Reduced ROS levels were detected in Myoglobin-expressing T cells in comparison to the control. (A) MitoSox expression of Control and Myoglobin expression T cells was determined via Flow Cytometry gated on CD8+Thy1.1+T cells to detect mitochondrial ROS (n=6). (B) Control and Myoglobin expression T cells were treated with 2.5mM H2O2. Afterwards, DHE was added for the detection of cellular ROS by time-dependent measuring of Fluorescence. The Half Maximal Time was calculated and plotted (n=4).

[0046] Figure 8: Myoglobin expression T cells have increased effector functions in comparison to control T cells. Co-culture of Control or Myoglobin-expressing P14+T cells with B16-gp33 cells in indicated Target: Effector ratios. Frequency of (A) IFN-y+(B) TNF-a+of Thy1.1+va2+CD8+T cells determined via Flow Cytometry (n=8-9).

[0047] Figure 9: More Myoglobin-expressing T cells were determined in Tumor-bearing mice in comparison to control T cells. Splenocytes containing 0.5M Control and Myoglobin-retroviral transduced P14+T cells were injected in tumor-bearing mice. The frequency of Thy1.1+of CD8+T cells was determined in Tumor tissue via Flow Cytometry at day 4 after T cell transfer (n=4).

[0048] Figure 10: Myoglobin-expressing T cells have reduced Hypoxia factor in Tumor-bearing mice in comparison to control T cells. Splenocytes containing 0.5M Control and Myoglobin- retroviral transduced P14+T cells were injected in tumor-bearing mice. Hifl a expression in Tumor tissue was determined via Flow Cytometry gated on CD8+Thy1.1+T cells at day 4 after T cell transfer (n=4) Figure 11 : Myoglobin-expressing T cells are showing a better effector function in tumorbearing mice in comparison to control T cells. Splenocytes containing 0.5M Control and Myoglobin- retroviral transduced P14+T cells were injected in tumor-bearing mice. IFN-y expression of Control and Myoglobin expression T cells was determined in the spleen via Flow Cytometry gated on CD8+Thy1 ,1+T cells at day 4 after T cell transfer (n=4).

[0049] Figure 12: Decreased Tumor growth was shown in Tumor-bearing mice treated with Myoglobin-expressing T cells in comparison to Control T cells. Splenocytes containing 2M Control and Myoglobin- retroviral transduced P14+T cells were injected in tumor-bearing mice. The tumor growth was measured over time (n=3-4).

[0050] Figure 13: More Myoglobin-expressing T cells were determined in Tumor-bearing mice in comparison to control T cells. Splenocytes containing 2M Control and Myoglobin- retroviral transduced P14+T cells were injected in tumor-bearing mice. (A) Frequency of Thy1.1+of CD8+T cells in tumor tissue and (B) the Thy1 ,1+CD8+T cells per mg tumor was measured via flow Cytometry at day 20 after T cell transfer (n=3-4).

[0051] Figure 14: Increased amounts of Myoglobin-expressing T cells were determined in the dLN in Tumor-bearing mice in comparison to control T cells. Splenocytes containing 2M Control and Myoglobin- retroviral transduced P14+T cells were injected in tumor-bearing mice. The absolute Count of Thy1.1+CD8+T cells measured in dLN via flow Cytometry at day 20 after T cell transfer (n=3-4).

[0052] Figure 15: Tumor-bearing mice with transferred Myoglobin expression T cells show decreased Tumor growth in comparison to Control T cells. Splenocytes containing 0.5M Control and Myoglobin- retroviral transduced P14+T cells were injected in tumor-bearing mice. The tumor growth was measured over time (n=7-8).

[0053] Figure 16: Tumor-bearing mice with transferred Myoglobin expression T cells show decreased Tumor weight in comparison to Control T cells. Splenocytes containing 0.5M Control and Myoglobin- retroviral transduced P14+T cells were injected in tumor-bearing mice. The finale Tumor weight is shown 20 days after t cell transfer (n=7).

[0054] Figure 17: More Myoglobin-expressing T cells were determined in Tumor-bearing mice in comparison to control T cells. Splenocytes containing 0.5M Control and Myoglobin- retroviral transduced P14+T cells were injected in tumor-bearing mice. (A) Frequency of Thy1.1+of CD8+T cells in tumor tissue and (B) the Thy1 ,1+CD8+T cells per mg tumor was measured via flow Cytometry at day 20 after T cell transfer (n=7).

[0055] Figure 18: Increased effector function was measured in Myoglobin-expressing T cells in tumor-bearing mice in comparison to control T cells. Splenocytes containing 0.5M Control and Myoglobin- retroviral transduced P14+T cells were injected in tumor-bearing mice. (A) IFN-y, (B) GzmB and (C) IL-2 expression of Control and Myoglobin expression T cells was determined in tumor tissue via Flow Cytometry gated on CD8+Thy1 ,1+T cells at day 20 after T cell transfer (n=4).

[0056] Figure 19: Tumor-bearing mice with transferred Myoglobin expression T cells and treated with Checkpoint-Inhibitors show decreased Tumor growth in comparison to Control T cells. Splenocytes containing 0.5M Control and Myoglobin- retroviral transduced P14+T cells were injected in tumor-bearing mice. Every second day the mice were treated with a-PD-1 Checkpoint Inhibitor. The tumor growth was measured overtime (n=9).

[0057] Figure 20: Globin-expressing T cells have increased effector functions in comparison to control T cells. Co-culture of Control, Myoglobin, Cytoglobin, and Globin E expressing P14+T cells with B16-gp33 cells in 1 :1 Target: Effector ratio. Frequency of (A) IFN-y+and (B) GzmB+of Thy1.1+va2+CD8+T cells determined via Flow Cytometry (n=3).

[0058] Figure 21 : Myoglobin-expressing T cells showing higher threshold in comparison to control T cells. Myoglobin expression of Myoglobin and Control T cells were determined by RT PCR. The results were normalized to TBP (n=4).

[0059] Figure 22: H2O2 and Glutathione levels were determined in Myoglobin-expressing T cells. (A) H2O2 levels by Peroxy Orange 1 (PO1) and (B) Glutathione (GSH) levels were measured in control and Myoglobin expressing T cells (n=6; n=8).

[0060] Figure 23: Metabolomic analysis of Myoglobin-expressing and control T cells. Control and Myoglobin expression T cells stimulated with 10mM glucose medium were metabolomic analysed for (A) glycolysis (B) TCA and (C) adenosine phosphates (n=5-6).

[0061] Figure 24: Myoglobin-expressing T cells show higher Tumor infiltration than control cells. Splenocytes containing 0.5M control and Myoglobin- retroviral transduced P14+ T cells were injected in B16-F10-gp33 tumor-bearing mice. Area coverage of CD8+ T cells taken from tumor tissue histology pictures is shown (n=16). Figure 25: Myoglobin-expressing T cells show higher cleaved caspase3 than control cells. Splenocytes containing 0.5M control and Myoglobin- retroviral transduced P14+ T cells were injected in B16-F10-gp33 tumor-bearing mice. Area coverage of cleaved caspase3 taken from tumor tissue histology pictures is shown (n=8).

[0062] Figure 26: Tumor-bearing mice with transferred Myoglobin expression T cells show decreased Tumor growth compared to control T cells. Splenocytes containing 0.5M control and Myoglobin- retroviral transduced OT-I+ T cells were injected in MC-38-OVA tumor-bearing mice. The tumor growth was measured over time (n=1 1).

[0063] These results will be interpreted in detail below.

[0064] Detailed description of preferred embodiments

[0065] In the following, the invention will be explained in more detail with reference to the accompanying figures. In the Figures, like elements are denoted by identical reference numerals and repeated description thereof may be omitted in order to avoid redundancies.

[0066] It will be obvious to a person skilled in the art that these embodiments and items only depict examples of a plurality of possibilities. Hence, the embodiments shown here should not be understood to form a limitation of these features and configurations. Any possible combination and configuration of the described features can be chosen according to the scope of the invention.

[0067] In order that the present description can be more readily understood, certain terms are first defined. Additional definitions are set forth throughout the detailed description.

[0068] It is to be noted that the term "a" or "an" entity refers to one or more of that entity; for example, "a nucleotide sequence," is understood to represent one or more nucleotide sequences. As such, the terms "a" (or "an"), "one or more," and "at least one" can be used interchangeably herein.

[0069] Furthermore, "and / or" where used herein is to be taken as specific disclosure of each of the two specified features or components with or without the other. Thus, the term "and / or" as used in a phrase such as "A and / or B" herein is intended to include "A and B," "A or B," "A" (alone), and "B" (alone). Likewise, the term "and / or" as used in a phrase such as "A, B, and / or C" is intended to encompass each of the following aspects: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone). It is understood that wherever aspects are described herein with the language "comprising," otherwise analogous aspects described in terms of "consisting of and / or "consisting essentially of" are also provided.

[0070] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure is related. For example, the Concise Dictionary of Biomedicine and Molecular Biology, Juo, Pei-Show, 2nd ed., 2002, CRC Press; The Dictionary of Cell and Molecular Biology, 3rd ed., 1999, Academic Press; and the Oxford Dictionary Of Biochemistry And Molecular Biology, Revised, 2000, Oxford University Press, provide one of skill with a general dictionary of many of the terms used in this disclosure.

[0071] Units, prefixes, and symbols are denoted in their Systeme International d’Unites (SI) accepted form. Numeric ranges are inclusive of the numbers defining the range. Unless otherwise indicated, nucleotide sequences are written left to right in 5' to 3' orientation. Amino acid sequences are written left to right in amino to carboxy orientation. The headings provided herein are not limitations of the various aspects of the disclosure, which can be had by reference to the specification as a whole. Accordingly, the terms defined immediately below are more fully defined by reference to the specification in its entirety.

[0072] The term "about" is used herein to mean approximately, roughly, around, or in the regions of. When the term "about" is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the numerical values set forth. In general, the term "about" can modify a numerical value above and below the stated value by a variance of, e.g., 10 percent, up or down (higher or lower).

[0073] The terms "affinity" and "binding affinity" are used interchangeably and refer to the strength of attraction between a protein and its binding molecule (ligand). In the context of oxygen-binding proteins, where oxygen serves as the ligand, a higher affinity signifies a stronger attraction, leading to tighter binding of oxygen to the protein. Affinity to oxygen (O2) as a ligand is usually measured in terms of a p50 value. For globin proteins, a diverse family adept at binding oxygen, p50 values typically range from 2.5-3 mmHg for Myoglobin (facilitating efficient storage) to around 26-27 mmHg for hemoglobin A (enabling efficient delivery and release) (Wyman & Allen, 1951 ; Wittenberg, 1966).

[0074] The term "p50 value" refers to the partial pressure of a gas required to achieve 50% saturation of the binding sites of a particular protein. The values of p50 are negatively correlated with substrate affinity; lower values correspond to higher affinity and vice versa. In the literature, methods for determining the p50 value for oxygen are well-known in the art. The p50 for oxygen is typically determined by oxygen-protein dissociation curve, in which the relationship between the partial pressure of oxygen and the oxygen-binding protein saturation is plotted on an oxygen-protein dissociation curve. P50 is determined from this curve at the point where 50% of the oxygen-binding protein is saturated with oxygen ("John B. West and Andrew M. Luks “West's Respiratory Physiology: The Essentials" (10th edition, 2015)). Standard p50 measurements are generally performed at physiological pH of about 7.4, with physiological pCC>2 of about 40 mmHg (5.3 kPa), at a temperature of 37 °C, and with carboxyhemoglobin of less than 2 % as the p50 value is strongly dependent on pH (Bohr Effect), CO2 concentration, the temperature, and carboxyhemoglobin.

[0075] The term “Bohr effect” as used herein refers to the change in affinity of oxygen-binding proteins for oxygen with regard to the concentration of carbon dioxide (CO2) and acidity (pH) (Bohr, C., Hasselbalch, K., & Krogh, A. (1904). Uber den Einfluss der Sauren auf die Sauerstoffbindung des Haemoglobins. Skandinavisches Archiv fur Physiologie, 16, 402-412). For example, in the case of hemoglobin A, as CO2 and acidity increase, its affinity for oxygen decreases, facilitating oxygen release in tissues where cellular respiration produces both. Conversely, in the lungs with lower CO2 and higher pH, hemoglobin binds oxygen efficiently for transport. This adaptation ensures optimal oxygen delivery and utilization throughout the body.

[0076] The terms “oxygen-binding protein”, “oxygen-carrying protein”, “oxygen transport proteins” or “OBP” are used herein interchangeably and refer to biomolecules that are capable of reversibly binding and storing oxygen. These molecules can be found in various organisms, ranging from bacteria to mammals, and play a critical role in respiration, providing the fundamental element for cellular metabolism. Examples of OBPs include mammalian oxygen binding proteins like Myoglobin, Neuroglobin, Cytoglobin, Hemoglobin A (HbA), HbA2, HbE Gower 1 , HbE Gower 2, HbE Portland I, HbE Portland II, HbH, Hb Barts, HbS, HbC, HbO, Hb Bassett, Hb Kansas, Hb D-Punjab, Hb O-Arab, Hb G-Philadelphia, Hb Hasharon, Hb Lepore, Hb M, Hb Hope, Hb Pisa, Hb J, Hb N-Baltimore, Hb Chesapeake, Hb Louisville, Hb Vanvitelli, fetal hemoglobin or Globin Y. Further examples of oxygenbinding proteins include known vertebrates OBPs like Globin X and Globin E, arthropod OBPs like consisting Globin CTT (l-X), Globin-CTT-VIIB (3-10), decapods OBPs like Hemocyanin, metazoan OBPs like Androglobin, Globin C, Erythrocruorin, Chlorocruorin, Extracellular Globin (1 -4), Hemerythrin, Giant Hexagonal Bilayer Hemoglobin, Globin-like proteins (1 -26), Globin (1 -3, and 5) and Globin D, eukaryotic OBPs like Phytoglobin, Leghemoglobin (1 -3, A), and eukaryotic or bacterial OBPs like Flavohemoglobin, Flavohemoprotein 1 and Flavohemoprotein 2. The oxygen-binding proteins used herein can be of different origins. For example, the oxygen-binding proteins used in the present invention may be human, murine, bovine, porcine, primate, or avian OBPs. Preferably, the oxygen-binding proteins used in the present invention are human, murine, or avian.

[0077] In the literature, there are many known methods for identifying oxygen-binding proteins and determining their affinity, for instance, by their structural similarity to one of six main different oxygen sub-classes Ery, Hey, Heme, Hemo, Leg and Myo (Muthukrishnan, S. and M. Puri., Harnessing the evolutionary information on oxygen binding proteins through Support Vector Machines based modules. BMC Research Notes 11(1): 1-8 (2018)), by determining the p50 value (Patel, Mira P et al. “Development and validation of an oxygen dissociation assay, a screening platform for discovering, and characterizing hemoglobin-oxygen affinity modifiers.” Drug design, development and therapy vol. 12 1599-1607. 1 Jun. 2018), or by determining the thermodynamic and kinetic oxygen affinities K and KM to oxygen (Sanyal, Ria, and Ambika Bhagi-Damodaran. “An enzymatic method for precise oxygen affinity measurements over nanomolar-to-millimolar concentration regime.” Journal of biological inorganic chemistry : JBIC : a publication of the Society of Biological Inorganic Chemistry vol. 25,2 (2020): 181-186). Therefore, the skilled person can readily determine the oxygen-binding capacity of oxygen-binding proteins and select the appropriate oxygen-binding proteins for the intended use.

[0078] The term "Globin" refers to a protein family characterized by a specific folding pattern and the ability to bind heme, an iron-containing molecule that binds oxygen. Globins are found in various organisms and play essential roles in oxygen transport and storage. Examples include hemoglobin, Myoglobin, Cytoglobin, and Neuroglobin (Weber, R. E. (2009). Ligand binding and molecular mechanism in the substrate cycle of hemoglobin. Annual review of biophysics and biomolecular structure, 38, 149-179).

[0079] The terms "Myoglobin" and “Mb” referto a globin protein primarily located in muscle tissue. Myoglobin functions as an oxygen reservoir, binding oxygen tightly (low p50) to ensure a readily available supply during periods of high energy demand. This tight binding also prevents premature oxygen release under resting conditions (Wittenberg, J. B. (1966). Myoglobin and muscle function. Physiological reviews, 46(4), 724-758). For Myoglobin, p50-values of about 1-3 mmHg are reported in the literature.

[0080] The terms "Cytoglobin" and “Cygb” refer to a relatively newly discovered globin protein found in various tissues, including the brain and heart. Its exact function remains under investigation, but it is thought to be involved in oxygen storage and scavenging, potentially influencing nitric oxide signaling. For Cytoglobin, a similar p50 as for Myoglobin of about 1 mmHg is reported in the literature (Fago, Angela et al. “Allosteric regulation and temperature dependence of oxygen binding in human Neuroglobin and Cytoglobin. Molecular mechanisms and physiological significance.” The Journal of biological chemistry vol. 279,43 (2004))

[0081] The terms "Hemoglobin A”, “HbA”, “Hemoglobin A1 ” or “a2p2” as used herein refer to the most abundant human hemoglobin tetramer comprising two alpha subunits and two beta subunits (a2p2) and accounts for over 97% of all red blood cell hemoglobin. Hemoglobin A is an oxygen-binding protein found in erythrocytes that transports oxygen from the lungs to the tissues. According to the literature, Hemoglobin A exhibits a lower oxygen affinity (higher p50) compared to Myoglobin, allowing for efficient oxygen uptake in the lungs and release in tissues with lower oxygen tension. For Hemoglobin A, p50-values of about 26-27 mmHg are reported in the literature (Aoki, K., & Riggs, A. (1954). The oxygen equilibrium of hemoglobin in dilute solution. The Journal of general physiology, 37(6), 717-736).

[0082] The terms "Globin E" and “GbE” refer to a globin that was originally identified as an eye-specific protein of birds that is distantly related to Myoglobin. GbE is also present in some vertebrates like turtles, lungfish, and the coelacanth but appeares to be lost in other vertebrates. For Globin E, a p50-value of about 1.2 mmHg is reported in the literature (Ludemann, J., Verissimo, K.M., Dreger, K. et al. Globin E is a Myoglobin-related, respiratory protein highly expressed in lungfish oocytes. Sci Rep 9, 280 (2019)).

[0083] The terms “peptide”, “polypeptide” and “protein” as used herein refer to an organic chemical compound resulting from a combination of several amino acids linked to each other via an amide bond in a defined order (sequence) forming a chain. Peptides and proteins, the latter used herein interchangeably with "polypeptides", are distinguished by the length of the amino acid chain. While peptides generally comprise an amino acid chain of no more than around 100 amino acids, proteins generally comprise anything above around 100 amino acids, even though the distinction between peptides and proteins is not completely clear-cut. In the context of the application, the terms “peptide” and “protein” include conservative variations of those peptides and proteins specifically exemplified herein.

[0084] The term "conservative variations" and "conservative amino acid substitutions" as used herein denotes the replacement of an amino acid residue by another, biologically similar residue. Examples of conservative variations include, but are not limited to, the substitution of one hydrophobic residue such as isoleucine, valine, leucine, alanine, cysteine, glycine, phenylalanine, proline, tryptophan, tyrosine, norleucine or methionine for another, or the substitution of one polar residue for another, such as the substitution of arginine for lysine, glutamic for aspartic acids, or glutamine for asparagine, and the like. Neutral hydrophilic amino acids that can be substituted for one another include asparagine, glutamine, serine, and threonine.

[0085] The term "lymphocyte" is used herein in the broadest sense to refer to a type of white blood cell found in the lymphatic system which are principal players in the adaptive immune response and the source of immune memory. Lymphocytes are broadly subdivided on the basis of functional and phenotypic differences into B lymphocytes (B cells), T lymphocytes (T cells), Natural Killer T cells (NKT cells), Natural Killer cells (NK cells), and innate lymphoid cells (ILCs).

[0086] The term “cytotoxic lymphocyte” as used herein refers to a subset of lymphocytes that specialize in directly killing infected or abnormal cells including induction of cell death such as apoptosis, necrosis, other forms of cell death or a combination. They play a crucial role in the body's immune response against pathogens and cancerous cells. Cytotoxic lymphocytes include cytotoxic T cells, NKT cells, and NK cells.

[0087] The terms “T lymphocyte” or “T cell” as used herein refer to a lymphocyte that expresses an antigenbinding T cell receptor (TCR), which recognizes processed pieces of antigen bound to cell membrane proteins called major histocompatibility complex (MHC) molecules. T cells include conventional adaptive T cells like helper T (TH) cells and cytotoxic T (Tc) cells that are distinguished from one another by the presence of either CD4 (CD4+cells) or CD8 (CD8+cells) membrane glycoproteins on their surfaces. T cells further include “unconventional” T cells such as NKT cells and NKT-like cells.

[0088] NKT cells express both semi-invariant TCR composed of a limited set of TCR a-chains (Va14-Ja18 in mice, Va24-Ja18 in humans) paired with a limited set of TCR p-chains, and NK cell surface markers (NKR), mostly D161 . NKT cells are divided into type I and type II subsets. Type I NKT cells recognize glycolipid antigens presented by CD1d and have a rapid cytokine response, impacting both innate and adaptive immunity. Type II NKT cells have a more diverse TCR repertoire and still not well understood. NKT-like cells are distinguished from the classical NKT family, although there is some overlap. NKT-like cells express a diverse TCR repertoire and a subset of NKRs (such as CD16, CD56, CD57, CD161 , CD94, and NKG2A). NKT-like cells recognize lipid antigens presented by CD1d, but may also recognize antigens in a “CD1d-independent” manner. In the context of the application, the terms “T lymphocyte” or “T cell” encompass both conventional T cells such as CD4+cells and CD8+cells, and “unconventional” T cells such as NKT cells and NKT-like cells. The terms “natural killer cell” or “NK cells” as used herein refer to a subset of cytotoxic lymphocytes that are able to recognize and eliminate virally infected cells and tumor cells without prior sensitization. NK cells express cell surface receptors that allow them to distinguish between healthy and abnormal cells, leading to their activation. NK cells exert their cytotoxic effects through the release of perforin and granzymes, inducing cell death in target cells. Additionally, they produce cytokines such as interferon-gamma (IFN-y) and tumor necrosis factor-alpha (TNF-a), contributing to immune regulation and modulation of adaptive immune responses.

[0089] The term “major histocompatibility complex molecules” or “MHC” as used herein refers to genetically diverse glycoproteins found on cell membranes that can form complexes with antigen and include MHC class I molecules, which are expressed by all nucleated cells of vertebrate species, and MHC class II molecules, which are expressed primarily by professional antigen-presenting cells (pAPCs) such as dendritic cells (DC), macrophages, and B cells. CD4+TH cells recognize antigen in complex with MHC class II and CD8+Tc cells recognize antigen in complex with MHC class I.

[0090] The term “naive T cell” as used herein refers to a T cell which has not encountered its cognate antigen and acts as a precursor for an effector and memory T cell (mature T cell). Naive T cells include T cells which express surface markers, such as CD45RA, CCR7, CD62L, CD127, and do not express markers of previous activation, such as CD25, CD44, CD69, or CD45RO.

[0091] The terms “chimeric antigen receptor”, “chimeric T cell receptor”, “artificial T cell receptor”, or “CAR” are used interchangeably herein and refer in their broadest sense to a receptor that combines both antigen-binding and T cell activating functions into a single receptor. Generally, CARs comprise four domains: antigen recognition domain, hinge region, transmembrane domain, and intracellular T cell signaling domain. Approaches or sources used in CARs as antigen recognition domain comprise single chains of variable antibody fragments (ScFv) having light (VL) and heavy (VH) chains of immunoglobulins, TNF receptors, innate immune receptors, cytokines, structure proteins, and / or growth factors. A T cell, NKT cell, NKT-like cell, and NK cell can be engineered to express CARs. Preparation methods of CAR cells suitable for CAR cell therapy are known in the art. In general, the methods involve isolating T cells, NKT cells, NKT-like cells, or NK cells from a donor, stimulating the cells (encompassing proliferation and expansion of the cells), purifying and transducing the stimulated cells via a vector with a gene encoding the genetically modified CAR, and then reintroducing the cells back to the donor for autologous CAR cell therapy or transplanting the cells into another host for allogeneic CAR cell therapy. The term "antibody" is used herein in the broadest sense to refer to molecules with an immunoglobulin-like domain (for example IgG, IgM, IgA, IgD, or IgE) and includes monoclonal, recombinant, polyclonal, chimeric, human, humanized, multispecific antibodies, including bispecific antibodies, and hetero-conjugate antibodies; a single variable domain (e.g., VH, VHH, VL, domain antibody), antigen binding antibody fragments, Fab, F(ab')2, Fv, disulfide-linked Fv, single chain Fv, disulfide-linked scFv, diabodies, etc. and modified versions of any of the foregoing.

[0092] By the terms "treat," "treating," or "treatment of" (or grammatically equivalent terms) it is meant that the severity of the subject's condition is reduced or at least partially improved or ameliorated and / or that some alleviation, mitigation or decrease in at least one clinical symptom is achieved and / or there is a delay in the progression of the condition.

[0093] As used herein, the terms "prevent," "prevents," or "prevention" and "inhibit," "inhibits," or "inhibition" (and grammatical equivalents thereof) are not meant to imply complete abolition of disease and include any type of prophylactic treatment that reduces the incidence of the condition, delays the onset of the condition, and / or reduces the symptoms associated with the condition after onset.

[0094] An "effective," "prophylactically effective," or "therapeutically effective" amount as used herein is an amount that is sufficient to provide some improvement or benefit to the subject. Alternatively stated, an "effective," "prophylactically effective," or "therapeutically effective" amount is an amount that will provide some delay, alleviation, mitigation, ordecrease in at least one clinical symptom in the subject. Those skilled in the art will appreciate that the effects need not be complete or curative, as long as some benefit is provided to the subject.

[0095] The term "subject" includes human and other mammalian subjects that receive either prophylactic or therapeutic treatment. As used herein, the term "subject" includes any human or non-human animal. The term "non-human animal" includes all vertebrates, e.g., mammals and non-mammals, such as non-human primates, sheep, dogs, cows, chickens, amphibians, reptiles, etc.

[0096] As used herein, the terms "ug" and "uM" may be used interchangeably with "pg" and "pM," respectively.

[0097] As used herein, "administering" refers to the physical introduction of a composition comprising a therapeutic agent to a subject and encompasses any of the various methods and delivery systems known to those skilled in the art. Different routes of administration include intravenous, intraperitoneal, intramuscular, subcutaneous, spinal, or other parenteral routes of administration, for example by injection or infusion. Parenteral administration encompasses modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intraperitoneal, intramuscular, intraarterial, intrathecal, intralymphatic, intralesional, intracapsular, intraorbital, intracardiac, intradermal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, epidural and intrasternal injection and infusion, as well as in vivo electroporation.

[0098] The present inventors have dedicated themselves to solving the problem of the present invention by addressing whether enforced oxygen metabolism can improve the function and anti-cancer immunity of T cells and NK cells.

[0099] Myoglobin (Mb) was exemplarily used as the oxygen-binding protein, which is well-known for its function in muscle fibers, supporting the storage, transport and diffusion of oxygen to improve oxygen metabolism in T cells (J. B. Wittenberg, B. A. Wittenberg, Myoglobin function reassessed. J Exp Biol 206, 2011-2020 (2003)).

[0100] The inventors identified successfully that enforced expression of an oxygen-binding protein, for instance, Myoglobin, increases OXPHOS and glycolysis in T cells after activation, which was associated with altered mitochondrial morphology, typically observed in effector T cells. Consequently, T cells exhibited increased proliferation and increased effector functions against tumor cells. Specifically, enforced expression of Myoglobin in T cells resulted in increased T cell infiltration into tumor tissue and increased effector function with reduced tumor growth in combination with checkpoint inhibition in comparison to T cells known in the art. This resulted in increased immunotherapeutic efficacy and delayed cancer growth.

[0101] The invention provides a T cell or NK cell comprising an exogenous nucleic acid molecule having a nucleotide sequence coding for an oxygen-binding protein.

[0102] Specifically, the present invention provides a genetically modified T cell or NK cell that has been transduced with an exogenous nucleic acid molecule, such as DNA or mRNA, comprising a nucleotide sequence encoding an oxygen-binding protein.

[0103] The exogenous nucleic acid molecule is introduced into the T cell or NK cell to drive overexpression of the oxygen-binding protein, thereby increasing its intracellular expression beyond endogenous levels, if present at all. The transduced exogenous nucleic acid molecule is functionally associated with an expression control sequence, such as a promoter, enhancer, or other regulatory element, which facilitates and enables robust and sustained transcription and / or translation and / or expression of the encoded protein or the respective exogenous nucleic acid molecule encoding said oxygenbinding protein.

[0104] In some embodiments, utilizing mRNA molecules, the exogenous mRNA is introduced directly into the cell, enabling immediate translation of the oxygen-binding protein without the need for genomic integration or transcription.

[0105] To identify or detect a cell containing exogenous mRNA, one can rely on RNA enhancement and modification strategies that improve mRNA stability, translation efficiency, and cellular retention. Various RNA enhancement methods include the incorporation of strong ribosome-binding sites, such as the Kozak sequence (e.g., GCCACCAUGG), codon optimization to match host-preferred codon usage, and removal of inhibitory elements, including upstream open reading frames (uORFs), cryptic splice sites, and miRNA-binding sites.

[0106] Additionally, GC content tuning (40-60%) helps minimize secondary structures while maintaining RNA stability. The 5' and 3' untranslated regions (UTRs) play a crucial role in mRNA efficiency, with highly translated 5' UTRs (e.g., from p-globin or HSPA5) promoting ribosome recruitment and stability elements in the 3' UTR (e.g., p-globin 3' UTR or WPRE) prolonging mRNA half-life. Further enhancement can be achieved by extending the poly-A tail (>100 nucleotides) to support ribosome recycling and using synthetic nucleic acids like locked nucleic acids (LNA) or 2'-O-methylated nucleotides (OME) for added stability.

[0107] Therefore, in some embodiments, one or more mRNA enhancement methods may be utilized to improve the stability, translation efficiency, and retention of exogenous mRNA within a cell. Such one or more methods include:

[0108] (i) incorporation of strong ribosome-binding sites, such as the Kozak sequence (e.g., GCCACCAUGG);

[0109] (ii) codon optimization;

[0110] (iii) elimination of inhibitory elements such as upstream open reading frames (uORFs), cryptic splice sites, and miRNA-binding sites;

[0111] (iv) GC content tuning (40-60%);

[0112] (v) selection of 5' and 3' untranslated regions (UTRs) to maximize translation and stability, wherein highly translated 5' UTRs (e.g., from p-globin or HSPA5) facilitate ribosome recruitment, and stability elements in the 3' UTR (e.g., p-globin 3' UTR or WPRE) extend mRNA half-life;

[0113] (vi) poly-A tail (>100 nucleotides) extension, and

[0114] (vii) use of synthetic nucleic acids, such as locked nucleic acids (LNA) or 2'-O-methylated nucleotides (OME).

[0115] In terms of RNA modifications, 5' capping methods such as Cap1 or CleanCap analogs (e.g., m7GpppN) enhance ribosome recognition while reducing immune system activation. Nucleotide substitutions, such as replacing uridine with N1 -methylpseudouridine (rnl MJ) or pseudouridine (1), help evade Toll-like receptor (TLR) sensing and enhance RNA stability. Additionally, 2'-0-methylation of nucleotides serves to protect mRNA from RNase degradation, further improving its persistence and translation efficiency. These enhancements and modifications collectively improve the detectability of exogenous mRNA, as their distinctive presence can serve as markers for successful transfection.

[0116] Therefore, in some embodiments, one or more mRNA modification methods may be utilized to enhance the stability, translation efficiency, and persistence of exogenous mRNA within a cell. Such one or more modifications include (i) 5' capping using Cap1 or CleanCap analogs (e.g., m7GpppN); (ii) nucleotide substitutions, such as the replacement of uridine with N1-methylpseudouridine (rnl MJ) or pseudouridine (1); and (iii) 2'-0-methylation of nucleotides. These modifications collectively contribute to the effective expression of exogenous mRNA while also serving as identifiable markers for successful transfection.

[0117] In some embodiments, when DNA-based nucleic acid molecules are used, they are functionally associated with an expression control sequence, such as a promoter, enhancer, or other regulatory element, which facilitates robust and sustained transcription and / or translation of the encoded protein, preferably wherein said expression control sequence differs from the endogenous expression control sequence associated with the corresponding endogenous nucleic acid molecule having a nucleotide sequence coding for the same oxygen-binding protein.

[0118] The promoter is an exogenous promoter that is not naturally present in the T cell or NK cell genome in the proximity of the endogenously encoded corresponding oxygen binding proteins, and is distinct from any endogenous promoter that would naturally regulate the expression of the respective oxygenbinding protein. This exogenous promoter facilitates robust and sustained transcription of the exogenous nucleotide sequence coding for the oxygen-binding protein, ensuring controlled expression independent of the cell’s native regulatory mechanisms. To drive robust and sustained transcription of the oxygen-binding protein, a variety of exogenous promoters and enhancers can be utilized in gene expression vectors. These regulatory elements are carefully selected to ensure strong, controlled, and reliable gene expression, independent of the cell’s native regulatory mechanisms. The choice of promoter and enhancer influences transcriptional strength, duration of expression, tissue specificity, and inducibility, making them critical components for optimizing gene expression in T cells or NK cells.

[0119] Table 1 provides a list of exogenous promoters and enhancers used in gene expression vectors, along with their origin. The listed promoters include constitutive, inducible, and tissue-specific promoters, while the enhancers are selected based on their ability to amplify transcriptional activity. Understanding the source and function of these elements enables the design of expression systems tailored for research and therapeutic applications and will be apparent and straightforward to a person skilled in the art.

[0120] Table 1 : Promoters and Enhancers for Gene Expression Vectors

[0121]

[0122]

[0123] According to the present invention, some promoters represent particular embodiments, fortheir ability to drive robust and sustained gene expression in gene expression vectors. In some embodiments, constitutive promoters such as CMV, EF1a, SV40, PGK, CAG, UbC, viral promoter such as RSV, and Prokaryotic / IVT promoter T7 provide continuous transcriptional activity, ensuring reliable expression of the exogenous nucleic acid molecule. In one embodiment, the promoter is CMV. In another embodiment, the promoter is EF1 a. In another embodiment the promoter is SV40. In another embodiment the promoter is PGK. In another embodiment the promoter is CAG. In yet another embodiment the promoter is UbC. In another embodiment the promoter is RSV. In another embodiment the promoter is T7.

[0124] In certain embodiments, enhancers may be incorporated to further increase transcriptional efficiency and / or to enhance gene expression levels. For example, in one embodiment the CMV enhancer is often paired with the CMV promoter. In another embodiment, the CMV enhancer is paired with the CAG promoter. In another embodiment, the SV40 enhancer is often paired with the SV40 promoter. In another embodiment, the UbC Enhancer is often paired with the UbC promoter.

[0125] Table 2 below provides a list of exemplary promoter-enhancer pairings, demonstrating how these regulatory elements may be utilized within the scope of the invention. To further optimize gene expression, specific promoter-enhancer combinations are commonly used in gene expression vectors to achieve enhanced transcriptional activity and cell-type-specific regulation. Table 3 provides a list of commonly used promoter-enhancer combinations, highlighting how these regulatory elements work together to drive robust and sustained gene expression in various applications.

[0126] Table 3: Common Promoter-Enhancer Pairings

[0127] According to the present invention, the promoters-enhancer combinations of Table 3 represent particular embodiments. Each promoter-enhancer combination is tailored to different applications to optimize gene expression efficiency, specificity, and control in gene expression vectors:

[0128] • CMV Promoter - CMV Enhancer + WPRE (High Ubiquitous Expression): The Cytomegalovirus (CMV) promoter is paired with the CMV enhancer and the Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element (WPRE) to achieve high levels of gene expression across a wide range of cell types.

[0129] • EF1a Promoter- WPRE (Stable Expression in Stem Cells): The Human Elongation Factor 1a (EF1a) promoter ensures long-term, stable expression, particularly in stem cells, where it is further enhanced by the WPRE sequence, which improves mRNA stability and translation efficiency.

[0130] • Albumin Promoter - ApoE Enhancer (Liver-Specific Expression): For liver-specific gene expression, the albumin promoter, naturally active in hepatocytes, is combined with the Apolipoprotein E (ApoE) enhancer to strengthen transcriptional activity specifically in liver cells.

[0131] • Synapsin Promoter - CNS-Specific Enhancer (Neuron-Specific Expression): To achieve specific gene expression in neuronal cells, the synapsin promoter, which is naturally active in neurons, is paired with a CNS-specific enhancer, ensuring targeted transcription in the central nervous system.

[0132] • Tet-On Promoter - Minimal CMV Enhancer (Inducible Expression): The Tet-On system, which allows for tightly controlled, doxycycline-inducible gene expression, utilizes the Minimal CMV Enhancer to provide low basal activity while enabling strong, tunable expression upon induction.

[0133] • -Globin Promoter - -Globin HS2 / HS Enhancer (Erythroid-Specific Expression): For erythroid-specific gene expression, the p-globin promoter is paired with the p-globin HS2 / HS enhancer, ensuring high transcriptional activity in red blood cell precursors.

[0134] • CMV Promoter - IRES (Overexpression of Two Proteins): In cases where the simultaneous expression of two proteins is required, the CMV promoter is combined with an Internal Ribosome Entry Site (IRES), allowing for the translation of two distinct proteins from a single mRNA transcript.

[0135] The detection of the presence of such exogenous nucleic acid in a T cell or NK cell can be carried out by a person of average skill in the art without an undue burden. Thus, T cells or NK cells according to the present invention can easily and clearly be discriminated from T cells or NK cells which do not comprise an exogenous nucleic acid molecule having a nucleotide sequence coding for an oxygenbinding protein.

[0136] For example, since the complete sequences of endogenous (i.e. genomic) nucleic acid molecules having a nucleotide sequence coding for an oxygen-binding protein are entirely known and available to a skilled person, the skilled person is able to identify and sequence such endogenous sequence derived from a given T or NK cell.

[0137] Moreover, the absence of introns in exogenous nucleic acid molecules provides a precise and reliable method for identifying or detecting cells that have been transfected with such molecules. Endogenous nucleic acid molecules, particularly those encoding oxygen-binding proteins, typically contain introns, which are non-coding sequences interspersed within the coding regions of genes. In contrast, exogenous nucleic acid molecules, such as exogenous mRNA or cDNA constructs derived from processed mRNA, are typically designed without introns to enable direct translation without the need for splicing.

[0138] For example, several endogenous genes coding for oxygen-binding proteins contain introns, including myoglobin (2 introns, Intron 1 : 5.8 kb, Intron 2: 3.6 kb), neuroglobin (3 introns), cytoglobin (2 introns), and various hemoglobins (e.g., HbA, HbB, HbS, HbG, HbE, HbC, HbO, all containing 2 introns). Additionally, endogenous genes coding for Globin Y, Globin X, and Globin E each contain 2 introns, while Globin CTT, found in Chironomus thummi thummi, contains 1 intron. The endogenous gene for Hemocyanin, present in various mollusks and arthropods, has an even greater number of introns, ranging from 9 to 53 introns depending on the species. Furthermore, the endogenous gene for androglobin contains 35 introns, and leghemoglobin has 3 introns, further demonstrating the complexity and specific characteristics of endogenous gene structures.

[0139] In contrast, exogenous nucleic acid molecules, such as synthetic mRNA, lack introns entirely, allowing for immediate translation upon entry into the cell. Similarly, cDNA-based constructs, which are often used for transfection, also do not contain introns, as they are typically derived from processed mRNA. The skilled person can effectively detect and confirm the presence of exogenous nucleic acid molecules within a cell using well-established techniques such as sequencing or PCR- based approaches, which distinguish between intron-containing endogenous transcripts and intronless exogenous transcripts.

[0140] Other nucleic acids which comprise a nucleotide sequence coding for an oxygen-binding protein but deviate from the endogenous (i.e. genomic) sequence, in particular with respect to surrounding sequences including potential promoter sequences, must clearly be exogenous sequences according to the present invention.

[0141] Clearly, the skilled person will be able to identify the presence of such an exogenous sequence in a cell in addition to the endogenous (i.e. genomic) nucleotide sequence coding for the oxygen-binding protein in context of the sequences surrounding the coding sequence by using conventional and established methods known in the prior art.

[0142] Upon transduction, the exogenous nucleic acid molecule (DNA or mRNA) is expressed within the T cell or NK cell, leading to the production and accumulation of the oxygen-binding protein. Expression and overexpression of the transduced nucleic acid may be confirmed through one or more assays, including but not limited to, mRNA detection (e.g., RT-PCR, qPCR), protein analysis (e.g., Western blot, flow cytometry, immunohistochemistry), or functional assays assessing oxygen-binding capability of the expressed protein.

[0143] The genetically modified T cell or NK cell, therefore, possesses an active and detectable level of the oxygen-binding protein which is higher than the level of the oxygen-binding protein in a reference T cell or NK cell not comprising an exogenous nucleic acid molecule having a nucleotide sequence coding for an oxygen-binding protein according to the present invention, whether through direct translation of exogenous mRNA or transcription from an exogenous promoter-driven DNA-based construct, contributing to its biological function and therapeutic application.

[0144] Therefore, a person skilled in the art would readily be able to identify a T cell or NK cell that has been transfected with an exogenous nucleic acid molecule using, for example, publicly known sequencing techniques. Specifically, given that the complete sequences of endogenous nucleic acid molecules encoding oxygen-binding proteins are well-documented, a skilled person could distinguish exogenous sequences based on deviations from the endogenous sequence, particularly in surrounding regulatory elements such as promoters.

[0145] Conventional methods, including RT-PCR or qPCR, allow for the detection of overexpression of the transfected nucleic acid molecule, for example more than 1.5-fold, 2-fold, 3-fold, 4-fold or more in direct comparison to a reference T cell or NK cell not comprising an exogenous nucleic acid molecule having a nucleotide sequence coding for an oxygen-binding protein, thus providing clear evidence of successful transfection. Moreover, standard sequencing approaches, such as next-generation sequencing (NGS) or the Sanger sequencing method, enable direct identification of exogenous nucleic acid molecules within the modified cell. These established techniques facilitate the clear and reliable discrimination of genetically modified T or NK cells from their unmodified counterparts.

[0146] In an embodiment of the invention, the oxygen-binding protein has a p50 value for O2 of at most about 35, 34, 33, 32, 31 , 30, 29, 28, 27, 26, 25, 24, 23, 22, 21 , 20, 19, 18, 17, 16, 15, 14, 13, 12, 1 1 , 10, 9, 8, 7, 6, 5, 4, 3, 2, 1 .5, or 1 mmHg, wherein the p50 value is measured at pH of 7.4, pCC>2 of about 40 mmHg, at a temperature of 37 °C, and with carboxyhemoglobin of less than 2 %. In a preferred embodiment of the invention, the oxygen-binding protein has a p50 value for O2 of at most about 27 mmHg, even more preferably at most about 22 mmHg, even more preferably at most about 17 mmHg, even more preferably at most about 12 mmHg, even more preferably at most about 7 mmHg, even more preferably at most about 2 mmHg, particularly preferably at most about 1.5 mmHg, most particularly preferably of about 1 mmHg, wherein the p50 value is measured at pH of 7.4, pCC>2 of about 40 mmHg, at a temperature of 37 °C, and with carboxyhemoglobin of less than 2 %.

[0147] In an embodiment of the invention, the oxygen-binding protein is selected from a group consisting of Myoglobin, Neuroglobin, Cytoglobin, Hemoglobin A (HbA), HbA2, HbE Gower 1 , HbE Gower 2, HbE Portland I, HbE Portland II, HbH, Hb Barts, HbS, HbC, HbO, Hb Bassett, Hb Kansas, Hb D-Punjab, Hb O-Arab, Hb G-Philadelphia, Hb Hasharon, Hb Lepore, Hb M, Hb Hope, Hb Pisa, Hb J, Hb N- Baltimore, Hb Chesapeake, Hb Louisville, Hb Vanvitelli, fetal hemoglobin or Globin Y, Globin X, Globin E, Globin CTT (l-X), Globin-CTT-VIIB (3-10), Hemocyanin, Androglobin, Globin C, Erythrocruorin, Chlorocruorin, Extracellular Globin (1 -4), Hemerythrin, Giant Hexagonal Bilayer Hemoglobin, Globin-like proteins (1-26), Globin (1 -3, and 5), Globin D, Phytoglobin, Leghemoglobin (1-3, A), Flavohemoglobin, Flavohemoprotein 1 , and Flavohemoprotein 2. In a preferred embodiment, the oxygen-binding protein is selected from the group consisting of Myoglobin, Cytoglobin, Hemoglobin A, and Globin E. In a further preferred embodiment, the oxygen-binding protein is selected from the group consisting of Myoglobin, Cytoglobin, and Globin E. In a particularly preferred embodiment, the oxygen-binding protein is Myoglobin.

[0148] In a preferred embodiment of the invention, the oxygen-binding protein encoded by the nucleotide sequence of the exogenous nucleic acid molecule is human Myoglobin comprising an amino acid sequence as set forth in SEQ ID NO: 1 or a sequence with at least 80% sequence identity to said sequence. In another embodiment of the invention, the oxygen-binding protein encoded by the nucleotide sequence of the exogenous nucleic acid molecule is a variant of human Myoglobin comprising an amino acid sequence as set forth in SEQ ID NO: 2, 3, 4, 5, or 6 or a sequence with at least 80% sequence identity to said sequence.

[0149] In another embodiment of the invention, the oxygen-binding protein encoded by the nucleotide sequence of the exogenous nucleic acid molecule is human Cytoglobin comprising an amino acid sequence as set forth in SEQ ID NO: 7 or a sequence with at least 80% sequence identity to said sequence. In another embodiment of the invention, the oxygen-binding protein encoded by the nucleotide sequence of the exogenous nucleic acid molecule is a natural variant of human Cytoglobin comprising an amino acid sequence as set forth in SEQ ID NO: 8 or 9 or a sequence with at least 80% sequence identity to said sequence.

[0150] In another embodiment of the invention, the oxygen-binding protein encoded by the nucleotide sequence of the exogenous nucleic acid molecule is human Hemoglobin A comprising two a-subunits and two p-subunits (a2p2), wherein the a-subunit comprises an amino acid sequence as set forth in SEQ ID NO: 10 or 11 or a sequence with at least 80% sequence identity to said sequence and the p-subunit comprises an amino acid sequence as set forth in SEQ ID NO: 12, 13, 14, or 15 or a sequence with at least 80% sequence identity to said sequence. In another embodiment of the invention, the oxygen-binding protein encoded by the nucleotide sequence of the exogenous nucleic acid molecule is avian Globin E comprising an amino acid sequence as set forth in SEQ ID NO: 16 or a sequence with at least 80% sequence identity to said sequence.

[0151] According to one preferred embodiment of the present invention, the amino acid sequences of Myoglobin, Cytoglobin, Hemoglobin A, and Globin E described herein are as follows:

[0152] In another embodiment of the invention, the T cell is a conventional T cell, NKT cell, or NKT-like cell, preferably a CD8+T cell, CD8+NKT cell, or CD8+NKT-like cell, particularly preferably a naive CD8+T cell, CD8+NKT cell, or CD8+NKT-like cell. Methods for obtaining, isolating, and culturing T cells and NK cells from donors (e.g., human donors) are known in the art and comprise inter alia blood draw or bone marrow removal.

[0153] In one embodiment of the invention, the T cell or NK cell is a human T cell or NK cell.

[0154] In yet another embodiment of the invention, the T cell or NK cell is genetically engineered to express a chimeric antigen-specific receptor (CAR), preferably wherein the T cell or NK cell is a CAR T cell or CAR NK cell suitable for an autologous or allogeneic immunotherapy treatment of pre-malignant or malignant cancer.

[0155] The invention further provides a pharmaceutical composition comprising the T cell or NK cell of the invention and a pharmaceutically acceptable excipient. It is understood that the skilled person will readily select an excipient that is suitable for the intended dosage form of the medicinal product, has suitable pharmacokinetic and organoleptic properties, and complies with pharmacopeial regulations. Deciding factors may include the intended use of the compound, the amount required, the environmental conditions that may affect the excipient, potential toxicity, the origin of the chemicals, and other specific factors.

[0156] The invention further provides the T cell or NK cell of any embodiment of the invention, or the pharmaceutical composition of the invention for use as a medicament.

[0157] The invention further provides the T cell or NK cell of any embodiment of the invention, or the pharmaceutical composition of the invention for use in a method of treating cancer in a subject. The T cell or NK cell, or the pharmaceutical composition of the invention may be administered to the subject in ways known in the art, preferably by intravenous infusion. The subject is preferably a human patient, preferably the donor of the T cell or NK cell.

[0158] In an embodiment of the invention, the cancer is a solid tumor, preferably malignant melanoma. The cancer may be adult tumors / cancers and pediatric tumors / cancers. Other and additional diseases and disorders which may be treated using the present invention are apparent to the skilled person and comprise particularly (but not limited to) different types of cancer such as lung cancer, gastric cancer, renal cell cancer, colon cancer, breast cancer, ovarian cancer, urothelial cancer, pancreatic cancer, myeloma, Hodgkin's lymphoma, retinoblastoma, leukemia, cervical cancer, esophageal cancer, glioma, non-Hodgkin's lymphoma, hepatocellular cancer, oral cancer, and others.

[0159] For instance, the cancer may be selected from the non-exhaustive list comprising acute myeloid leukemia (AML), breast carcinoma, cholangiocarcinoma, colorectal adenocarcinoma, extrahepatic bile duct adenocarcinoma, female genital tract malignancy, gastric adenocarcinoma, gastroesophageal adenocarcinoma, gastrointestinal stromal tumors (GIST), glioblastoma, head and neck squamous carcinoma, leukemia, liver hepatocellular carcinoma, low grade glioma, lung bronchoalveolar carcinoma (BAC), lung non-small cell lung cancer (NSCLC), lung small cell cancer (SCLC), lymphoma, male genital tract malignancy, malignant solitary fibrous tumor of the pleura (MSFT), multiple myeloma, neuroendocrine tumor, nodal diffuse large B-cell lymphoma, non-epithelial ovarian cancer (non-EOC), ovarian surface epithelial carcinoma, pancreatic adenocarcinoma, pituitary carcinomas, oligodendroglioma, prostatic adenocarcinoma, retroperitoneal or peritoneal carcinoma, retroperitoneal or peritoneal sarcoma, small intestinal malignancy, soft tissue tumor, thymic carcinoma, thyroid carcinoma, uveal melanoma, or any combination thereof. The T cell or NK cell, or pharmaceutical composition of the invention may also be used in combination with immunosuppressive treatment and / or one or more other therapies against cancer selected from the non-exhaustive list comprising antibody therapy, chemotherapy, cytokine therapy, dendritic cell therapy, gene therapy, hormone therapy, laser light therapy, and radiation therapy. The subject may be treated with immunosuppressive treatment and / or one or more other therapies against cancer prior to, after, and / or concurrently to the treatment with the T cell, the NK cell, or the pharmaceutical composition of the invention. In a preferred embodiment of the invention, the use further comprises simultaneous treatment with anti-PD-1 and / or anti-PD-L1 therapy. In the context of the present invention, simultaneous treatment may preferably be interpreted to mean that the pharmacological effects of the administered drugs occur simultaneously, more preferably simultaneous treatment is achieved by simultaneous administration of the administered drugs.

[0160] The invention further provides a method for preparing a T cell or NK cell as outlined above, i.e. a method for preparing an engineered T cell or NK cell comprising introducing into a T cell or NK cell an exogenous nucleic acid molecule having a nucleotide sequence coding for an oxygen-binding protein.

[0161] Therefore, the invention provides a genetically modified T cell or NK cell transduced with an exogenous nucleic acid encoding an oxygen-binding protein. It will be apparent to a skilled person in view of the whole of the present disclosure that the exogenous nucleic acid is introduced to drive overexpression beyond endogenous levels and is functionally linked to an expression control sequence to ensure robust transcription and translation.

[0162] Thus, it is already implicit to the present disclosure and, only in case of any doubt, furthermore preferred that the exogenous nucleic acid encoding an oxygen-binding protein is functionally linked to an expression control sequence

[0163] Upon transduction, the oxygen-binding protein is actively expressed and accumulates intracellularly. Expression and overexpression can be confirmed using mRNA and protein assays or functional oxygen-binding analysis. The modified T cell or NK cell thus exhibits detectable and functional levels of the transduced oxygen-binding protein, contributing to its biological and therapeutic use.

[0164] In an embodiment of the invention, the T cell is a conventional T cell, an NKT cell, or NKT-like cell, preferably a CD8+T cell, CD8+NKT cell, or CD8+NKT-like cell, particularly preferably a naive CD8+T cell, CD8+NKT cell, or CD8+NKT-like cell, and preferably wherein the T cell or NK cell is a human T cell or NK cell. In another embodiment of the invention, the method further comprises a step of introducing into the T cell or NK cell an exogenous nucleic acid molecule comprising a nucleotide sequence coding for a Chimeric Antigen Receptor (CAR) directed against at least one antigen expressed at the surface of a malignant or infected cell.

[0165] In yet another embodiment of the invention, the oxygen-binding protein is selected from a group consisting of Myoglobin, Neuroglobin, Cytoglobin, Hemoglobin A (HbA), HbA2, HbE Gower 1 , HbE Gower 2, HbE Portland I, HbE Portland II, HbH, Hb Barts, HbS, HbC, HbO, Hb Bassett, Hb Kansas, Hb D-Punjab, Hb O-Arab, Hb G-Philadelphia, Hb Hasharon, Hb Lepore, Hb M, Hb Hope, Hb Pisa, Hb J, Hb N-Baltimore, Hb Chesapeake, Hb Louisville, Hb Vanvitelli, fetal hemoglobin or Globin Y, Globin X, Globin E, Globin CTT (l-X), Globin-CTT-VIIB (3-10), Hemocyanin, Androglobin, Globin C, Erythrocruorin, Chlorocruorin, Extracellular Globin (1 -4), Hemerythrin, Giant Hexagonal Bilayer Hemoglobin, Globin-like proteins (1-26), Globin (1 -3, and 5), Globin D, Phytoglobin, Leghemoglobin (1-3, A), Flavohemoglobin, Flavohemoprotein 1 , and Flavohemoprotein 2. In a preferred embodiment, the oxygen-binding protein is selected from the group consisting of Myoglobin, Cytoglobin, Hemoglobin A, and Globin E. In a more preferred embodiment, the oxygen-binding protein is selected from the group consisting of Myoglobin, Cytoglobin, and Globin E. In a particularly preferred embodiment, the oxygen-binding protein is Myoglobin.

[0166] All embodiments of the present invention as disclosed and described herein are deemed to be combinable in any combination, unless the skilled person considers such a combination to not make any technical sense. The invention is now further explained by individual examples which are intended to illustrate but not to limit the present invention.

[0167] EXAMPLES

[0168] Experiment Overview

[0169] Murine T cells were isolated, activated and genetically modified with a Retroviral System to overexpress Thy1 .1 empty vector (control) and Thy1 .1 murine Myoglobin (Myoglobin). Subsequently, these cells were analyzed and the effector function was further studied in vitro.

[0170] Myoglobin could be detected in T cells treated with Myoglobin-expressing vectors in sharp contrast to Control T cells (Figure 1). HIF-1a expression was detected in activated control T cells, but this was highly reduced in the presence of Myoglobin (Figure 2A). Consistently, the hypoxia-inducing drug C0CI2 showed HIF-1 a expression in control T cells in contrast to Myoglobin-expressing T cells (Figure 2B).

[0171] Furthermore, a higher proportion of effector T cells was determined in Myoglobin-expressing T cells when compared to controls (Figure 3). This was consistent with reduced expression levels of TOX, a transcription factor, which correlates with T cell dysfunction in exhausted T cells when highly expressed (Figure 4). Accordingly, PD-1 and Tim-3 expression, markers for exhausted T cells were increased in control T cells when compared to Myoglobin-expressing T cells (Figure 5).

[0172] Activated T cells shift their metabolism to aerobic glycolysis facilitating the metabolic need for rapid proliferation. Hence, Myoglobin-expressing T cells exhibited increased metabolic capacity and ATP production (Figure 6). Metabolic activity can mediate reactive oxygen species (ROS) production in cells thus limiting T cell effector functions. However, ROS levels were highly reduced in Myoglobinexpressing T cells when compared to control cells (Figure 7).

[0173] Furthermore, the effector function against tumor cells was assessed. Control and Myoglobin constructs were also expressed in P14+T cells, which express a transgenic T cell receptor recognizing the lymphocytic choriomeningitis virus glycoprotein peptide GP33 as a transgene, utilizing retroviral strategies. The response was measured towards tumor cells (B16-F10) expressing the corresponding oligopeptide gp33-41. Myoglobin-expressing T cells exhibited a highly induced effector cytokine production in response to tumor cells when compared to control T cells (Figure 7 and 8).

[0174] Next, splenocytes including 5x105Myoglobin or control P14+T cells were injected into T umor-bearing mice. 4 days afterT cell transfer, spleen and tumortissue was collected and further analyzed to check the early immune response. An increased frequency of Myoglobin-expressing T cells was observed in the tumor tissue in comparison to control T cells (Figure 9). Moreover, Myoglobin-expressing T cells within the tumor tissue showed reduced expression of HIF-1 a compared to control T cell (Figure 10). When the effector cytokine production was analyzed, increased IFN-y production was measured in Myoglobin-expressing T cells (Figure 11).

[0175] In addition, later effects of Myoglobin-expressing T cells were investigated. Therefore, splenocytes containing 2x106Control or Myoglobin-expressing T cells were transferred in Tumor-bearing mice. 20 days after T cell transfer, draining lymph node (dLN) and tumor tissue samples were collected and analyzed. Tumor growth was reduced following transfer of Myoglobin-expressing T cells when compared to control T cells (Figure 12). Also, at later time points an increased frequency and amount of T cells were detected in the tumor tissue, when expressing Myoglobin (Figure 13). This observation extrapolated to the draining lymph node (dLN), indicating that increased T cell frequency can be detected beyond the tumor following Myoglobin expression (Figure 14).

[0176] Further, a lower amount of T cells was applied to investigate whether also fewer Myoglobinexpressing T cells could affect tumor growth. Thus, splenocytes containing 5x105Control or Myoglobin-expressing T cells were transferred in Tumor-bearing mice. 20 days after T cell transfer, Spleen and tumortissue were collected and analyzed. Likewise, reduced tumorgrowth was observed following transfer of Myoglobin-expressing T cells when compared to control T cells (Figure 15). Consistently, the tumor weight was reduced in mice that received Myoglobin-expressing T cells (Figure 16). This reduction in tumor size and weight was associated with increased frequency and amount per mg tumor tissue of Myoglobin-expressing T cells when compared to control cells (Figure 17). Furthermore, T cell effector function of Myoglobin-expressing T cells in the tumor tissue was increased when compared to control T cells (Figure 18).

[0177] Next, the combination of transfer of Myoglobin-expressing T cells with anti-PD-1 therapy was determined to further improve T cell function. Application of Myoglobin-expressing T cells could reduce tumor growth further in combination of anti-PD-1 antibodies (Figure 19).

[0178] Lastly, murine T cells were isolated, activated and genetically modified with a Retroviral System to overexpress Thy1.1 empty vector (control), Thy1 .1 murine Myoglobin (Myoglobin), Thy1.1 murine Cytoglobin (Cytoglobin) and Thy1.1 chicken Globin E (Globin E). IFN-y and GzmB cytokine production in response to tumor cells compared to control T cells was determined (Figure 20).

[0179] Increased production of IFN-y and GzmB cytokines was also measured in Cytoglobin and Globin E expressing T cells compared to control T cells. Further, the Myoglobin expression of Myoglobin and Control T cells, normalized to TBP is shown (Figure 21). Taken together these data show that other oxygen transport proteins than Myoglobin also exhibit an enhanced effector function.

[0180] Results

[0181] Myoglobin expression can prevent HIF-1a expression in activated T cells.

[0182] The tumor microenvironment in solid tumors is frequently associated with hypoxia and , consequently, expression of HIF-1a, since cancer cells exhibit an aerobic glycosylation metabolism, thus consuming glucose and oxygen at a high pace (T. W. Mak et al., Glutathione Primes T Cell Metabolism for Inflammation. Immunity 46, 675- 689 (2017), E. E. Wicks, G. L. Semenza, Hypoxia-inducible factors: cancer progression and clinical translation. J Clin Invest 132, (2022)). When B16F10-gp33 cells were implanted into the flank of C57BI / 6 mice (A. Prevost-Blondel et al., Tumor-infiltrating lymphocytes exhibiting high ex vivo cytolytic activity fail to prevent murine melanoma tumor growth in vivo. J Immunol 161 , 2187-2194 (1998), W. Liu et al., BAFF Attenuates Immunosuppressive Monocytes in the Melanoma Tumor Microenvironment. Cancer Res 82, 264-277 (2022)), expression levels of transcripts encoding for genes frequently observed in hypoxic conditions including HIF-1a were increased in tumor tissue when compared to spleen tissue (data not shown).

[0183] Consistently, T cells infiltrating the tumor microenvironment showed high expression levels of HIF-1a when compared to T cells analyzed in spleen tissue. Notably, HIF-1a can promote the switch from OXPHOS towards aerobic glycolysis during T cell activation, which indicates that infiltrating T cells in the tumor tissue are activated when compared to naive T cells in the spleen. However, even when gated on activated T cells, more HIF-1a expression in T cells could be observed in the tumor microenvironment than in the spleen tissue. These data suggest, that activated T cells infiltrating the tumor express hypoxia markers and are exposed to low oxygen conditions. To investigate whether increased oxygen supply in T cells can affect T cell immunity, the inventors expressed the oxygenbinding protein Myoglobin in T cells.

[0184] As expected, the inventors did not observe Myoglobin expression in control T cells, while transduced cells showed highly increased presence of Myoglobin, and that expression was specific for T cells (Figure 1). When the inventors measured expression of HIF-1a, the inventors observed increased levels in activated T cells, which is consistent with the literature (A. Paiazon et al., An HIF- lalpha / VEGF-A Axis in Cytotoxic T Cells Regulates Tumor Progression. Cancer Cell 32, 669-683 e665 (2017)). Interestingly, in presence of Myoglobin, expression levels of HIF-1a were highly reduced (Figure 2A and B). These data indicate that tumor-infiltrating lymphocytes and activated T cells express HIF-1a and that expression of HIF-1a can be reduced following presence of Myoglobin in T cells.

[0185] Myoqlobin-expressinq T cells show increased metabolic functions.

[0186] Myoglobin can facilitate oxygen trafficking to the mitochondria and accordingly, the inventors hypothesized that expression of Myoglobin might affect mitochondrial metabolism (J. B. Wittenberg, B. A. Wittenberg, Myoglobin function reassessed. J Exp Biol 206, 2011-2020 (2003)).

[0187] Accordingly, when the inventors analyzed the shape of mitochondria, the inventors observed increased mitochondrial mass in T cells expressing Myoglobin. Furthermore, the cristae structure appeared changed in mitochondria of Myoglobin expressing T cells when compared to controls. Specifically, the cristae appeared elongated, but with a reduced width, which has been associated with increased metabolic functions as the complex facilitating the OXPHOS-mediated ATP production is located at the cristae junction (A. Meister, Selective modification of glutathione metabolism. Science 220, 472-477 (1983)).

[0188] ATP production is based on a proton gradient across the inner mitochondrial membrane, which is generated by complex l-IV of the respiratory transport chain by consuming NADH and oxygen (R. I. K. Geltink, R. L. Kyle, E. L. Pearce, Unraveling the Complex Interplay Between T Cell Metabolism and Function. Annu Rev Immunol 36, 461-488 (2018)). The mitochondrial membrane potential was increased in Myoglobin-expressing T cells when compared to controls, indicating an increased activity of the respiratory transport chain. Consistently, the mitochondrial metabolic capacity was increased in Myoglobin-expressing T cells when compared to controls (Figure 6 A-D). Specifically, increased ATP levels were observed in Myoglobin-expressing cells when compared to controls (Figure 6 B). Furthermore, basal respiratory capacity was elevated in T cells expressing Myoglobin compared to control cells (Figure 6C).

[0189] Following treatment with FCCP and uncoupling of the proton gradient, the inventors observed highly increased maximal respiratory capacity (Figure 6 D). Furthermore, the spare respiratory capacity was increased following Myoglobin expression. Notably, non-mitochondrial respiration and the proton leak were also significantly increased following activation of Myoglobin-expressing T cells.

[0190] Mitochondrial ROS can be generated by the respiratory transport chain by producing oxygen radicals (G. S.Shadel, T. L. Horvath, Mitochondrial ROS signaling in organismal homeostasis. Cell 163, 60- 569 (2015)). In T cells, this is important because increased mitochondrial ROS can trigger T cell dysfunction (d). Accordingly, the inventors speculated that ROS levels might be elevated following Myoglobin expression. However, the inventors observed highly reduced presence of mitochondrial ROS in activated T cells following expression of Myoglobin (Figure 7A). Mitochondrial ROS can be scavenged by the superoxide dismutase 2 into H2O2, which can be further metabolized by the Glutathione peroxidase into H2O and GSSG (G. S.Shadel, T. L. Horvath, Mitochondrial ROS signaling in organismal homeostasis. Ce / / 163, 60-569 (2015), A. Meister, Selective modification of glutathione metabolism. Science 220, 472-477 (1983)). Consistently, the cellular impact of H2O2 could be delayed in presence of myoglobin when compared to controls (Figure 7B). Myoglobin can improve effector T cell differentiation.

[0191] Myoglobin can facilitate mitochondrial and glycolytic metabolism in T cells. The inventors investigated whether T cell differentiation was affected by expression of Myoglobin. Notably, proliferation following expression of Myoglobin was similar to control T cells overtime.

[0192] However, the inventors observed increased differentiation into effector T cells following Myoglobin expression (Figure 3). Differentiation into memory cells was similar in Myoglobin and control T cells. Interestingly, short-lived effector cells were reduced while memory effector precursor cells were also similar in Myoglobin and control T cells.

[0193] These data suggest that Myoglobin expression trigger increased effector functions. Exhaustion of T cells can be triggered by the transcription factor TOX, which can be detected in tumor-infiltrating lymphocytes. Accordingly, the inventors observed reduced TOXhigh Myoglobin-expressing T cells when compared to control T cells (Figure 4). Consistently, the proportion of TOXdim T cells was increased following Myoglobin expression. Accordingly, the inventors determined that expression of exhaustion markers including PD- 1 and Tim-3 were reduced following Myoglobin expression (Figure 5 A+B). These data indicate that Myoglobin expression shifts metabolic function to prevent an exhaustive state.

[0194] Next, the inventors investigated whether Myoglobin expression could increase effector functions of tumor specific T cells. Accordingly, the inventors co-incubated B16F10-gp33 melanoma cells with the corresponding Myoglobin or control T cells, expressing a TCR recognizing the gp33 epitope on H2- Dbas a transgene (H. Pircher, K. Burki, R. Lang,H. Hengartner, R. M. Zinkernagel, Tolerance induction in double specific T cell receptor transgenic mice varies with antigen. Nature 342, 559- 561 (1989)).

[0195] Cytokine production by Myoglobin-expressing T cells was highly increased in response to cancer cells, when compared to control T cells (Figure 8A+B). Hence, Myoglobin-expressing T cells mediated killing of tumor cells was increased compared to control T cells. Taken together, these data indicate that Myoglobin expression can increase effector T cell differentiation and that Myoglobin-expressing T cells exhibit increased effector function against cancer cells. Myoglobin drives increased intra-tumoral T cell infiltration.

[0196] In addition, the inventors investigated whether Myoglobin could improve anti-tumoral T cell immunity in vivo. Specifically, the inventors implanted 5x105B16F10-gp33 melanoma cells into the flank of C57BI / 6J mice. Following 7 days of tumor growth, Myoglobin-expressing and control T cells were adoptively transferred into tumor-bearing animals. To increase the number of viable cells for adoptive transfers the inventors used an established protocol to transduce and transfer activated T cells from splenocyte cultures (S. Xu et al., Uptake of oxidized lipids by the scavenger receptor CD36promotes lipid peroxidation and dysfunction in CD8(+) T cells in tumors. Immunity 54, 1561-1577 el567 (2021)).

[0197] The inventors found an increased proportion of Myoglobin-expressing T cells in the tumor tissue when compared to control T cells (Figure 9). Moreover, the inventors detected a similar number of Myoglobin and control T cells in spleen tissue (Figure 24). Consistent with the in vitro findings, expression levels of HIF-1a were reduced in T cells expressing Myoglobin compared to controls in tumor and spleen tissue (Figure 10). Moreover, the proportion of effector T cells was increased following Myoglobin expression, while memory T cells were comparable between both groups.

[0198] Furthermore, IFN-y production was increased in Myoglobin-expressing cells when compared to control T cells following restimulation with the epitope gp33 (Figure 11). Notably, the inventors identified increased expression of exhaustion markers in Myoglobin-expressing T cells suggesting that in vivo these cells are also susceptible towards exhaustion. Taken together, these data indicate that Myoglobin expression can increase T cell infiltration into tumor tissue with increased effector functions.

[0199] Myoqlobin-expressinq T cells can reduce tumor growth and improve checkpoint inhibition.

[0200] Next, the inventors investigated whether adoptive transfer of Myoglobin-expressing T cells can reduce tumor growth in the B16F10-gp33 model system. Consistently, circulating tumor specific Myoglobinexpressing T cells were increased compared to controls. When the inventors monitored tumor growth over time, the inventors observed a significant reduction in tumor growth in mice that received Myoglobin-expressing T cells when compared to mice that received control T cells (Figures 12 and 15).

[0201] To characterize the T cells at a later stage, the inventors sacrificed the animals and found reduced tumor burden in mice hosting Myoglobin-expressing T cells (Figure 16). Consistently, an increased T cell infiltration was found also in these larger tumors (Figure 13 and 17). Furthermore, increased effector function could be identified in T cells expressing Myoglobin when compared to control counterparts (Figure 18).

[0202] Also, the inventors detected increased levels of cleaved caspase 3 in the immunofluorescence analysis of tumor tissue sections harvested from B16-gp33 tumor-bearing mice that received Myoglobin expressing T cells compared to control T cells (Figure 25). These results suggest a higher killing of tumor cells due to the transfer of Myoglobin expressing T cells, which matches the increased effector function of Myoglobin expressing T cells compared to control T cells in vivo (Figure 18).

[0203] Using the immunogenic MC38-OVA model, which is derived from colon cancer after transferring Myoglobin-expressing T cells, the inventors also detected a significant reduction of tumor growth compared to the control (Figure 26). With the introduction of a second tumor model, the inventors suggest a broad therapeutic potential across various cancers.

[0204] Notably, the inventors observed similar expression of PD-1 and Tim-3 on Myoglobin or control T cells. Accordingly, the inventors speculated that T cells are still prone to exhaustion in an in vivo setting. Hence, the inventors combined the adoptive transfer of Myoglobin-expressing T cells with application of anti-PD-1 antibodies.

[0205] Combination of checkpoint inhibition via anti-PD-1 antibodies with Myoglobin-expressing T cells highly reduced cancer growth in this model system compared to control T cells (Figure 19). Taken together these data indicate that Myoglobin expression in T cells can increase anti-tumor effector function and reduce tumor growth in a syngeneic model system.

[0206] Summary of experimental results

[0207] As part of the present invention, the inventors investigated whether increased oxygen metabolism may influence anti-tumor effector function of T cells. The inventors recognized that expression of Myoglobin increases mitochondrial metabolism resulting in increased ATP, but reduced ROS levels. Accordingly, effector T cell differentiation was increased following expression of Myoglobin in vitro and in vivo. Consistently, adoptive transfer of Myoglobin-expressing T cells was able to cause reduced tumor growth and improved checkpoint therapy in a syngeneic mouse model system.

[0208] Antigen-specific T cells shift their metabolism following activation from OXPHOS towards aerobic glycolysis to support cell division and uptake in nutrition (R.l. K. Geltink, R. L. Kyle, E. L. Pearce, Unraveling the Complex Interplay Between T Cell Metabolism and Function. Annu Rev Immunol 36, 461-488 (2018)).

[0209] Specifically, effector T cells exhibit punctate mitochondria, while memory T cells exhibit networks, depending on remodelling of the inner mitochondrial membrane through OPA-1 (M. D. Buck et al., Mitochondrial Dynamics Controls T Cell Fate through Metabolic Programming. Cell 166, 63-76 (2016)). These data suggest that mitochondrial metabolic function is important for prolonged T cell effector function.

[0210] The rate of oxyMyoglobin (MbC>2) promotes mitochondrial oxygen uptake, indicating that Myoglobin is a potent oxygen buffer capable of releasing oxygen for mitochondrial metabolism when required (J. B. Wittenberg, B. A. Wittenberg, Myoglobin function reassessed. J Exp Biol 206, 2011-2020 (2003)).

[0211] Accordingly, Myoglobin can facilitate intracellular oxygen diffusion causing increased access of the mitochondria to oxygen and thus promoting OXPHOS (G. A. Ordway, D. J. Garry, Myoglobin: an essential hemoprotein in striated muscle. J Exp Biol07, 3441-3446 (2004)). Consistently, elongated cristae and smaller cristae junctions are observed in Myoglobin-expressing T cells, which correlated with increased mitochondrial metabolism. Consequently, effector function of antigen-specific T cells carrying Myoglobin was increased.

[0212] Metabolic functions can cause increases in the production of reactive oxygen species, which might limit T cell function. Specifically, 02" can be produced by the electron transport chain, which is transformed to H2O2 by superoxide dismutase 2 in mitochondria (G. S.Shadel.T. L. Horvath, Mitochondrial ROS signaling in organismal homeostasis. Cell 163,60-569 (2015)). Next, H2O2 along with 2 GSH can be reduced to H2O and GSSG by the glutathione peroxidase (G. S.Shadel.T. L. Horvath, Mitochondrial ROS signaling in organismal homeostasis. Cell 163,60-569 (2015), A. Meister, Selective modification of glutathione metabolism. Science 220, 472-477 (1983)).

[0213] GSSG can be recycled by the GSSG reductase under consumption of NADPH (A. Meister, Selective modification of glutathione metabolism. Science 220, 472-477 (1983)). Notably, exposure of antigenspecific T cells to H2O2 curbs effector functions (P. A. Langef al., Reactive oxygen species delay control of lymphocytic choriomeningitis virus. Cell death and differentiation, (2013)).

[0214] Furthermore, reduced levels of GSH by deletion of the glutamate cysteine ligase trigger T cell dysfunction and chronic antigen persistence (T. W. Mak etal., Glutathione Primes T Cell Metabolism for Inflammation. Immunity 46, 675- 689 (2017)). Moreover, increased mitochondrial stress is associated with increased ROS levels and decreased T cell function (N. E. Scharping et al., Mitochondrial stress induced by continuous stimulation under hypoxia rapidly drives T cell exhaustion. Nat Immunol 22, 205-215 (2021)).

[0215] Considering this data, one could expect increased mitochondrial ROS production, since OXPHOS was remarkably increased following Myoglobin expression. However, the inventors determined highly decreased presence of ROS along with elevated ATP levels, likely resulting in increased levels of GSH (Figures 22 and 23).

[0216] Myoglobin can improve T cell metabolism in a hostile tumor microenvironment. Like activated T cells, cancer cells utilize aerobic glycolysis to facilitate proliferation and growth (M. G. Vander Heiden, L. C.Cantley, C. B. Thompson, Understanding the Warburg effect: the metabolic requirements of cell proliferation. Science 324, 1029-1033 (2009)). Hence, the tumor microenvironment is associated with low glucose and oxygen along with expression of immunosuppressive molecules.

[0217] Accordingly, it is challenging for tumor specific T cells in some tumors to create efficient anti-cancer defense. Specifically, T cells compete within the tumor microenvironment for nutrition including glucose to promote effector functions (C. H. Changef al., Metabolic Competition in the Tumor Microenvironment Is a Driver of Cancer Progression. Cell 162, 1229-1241 (2015)).

[0218] Consistent with previous reports showing HIF-1a expression in T cells following hypoxia (A. L. Doedens et al., Hypoxia-inducible factors enhance the effector responses of CD8(+) T cells to persistent antigen. Nat Immunol 14, 1173-1182 (2013), 22), HIF-1 a expression is observed in tumorinfiltrating T cells. However, when Myoglobin was expressed in antigen-specific T cells, reduced expression levels of HIF-1a as well as increased infiltration into the tumor tissue was observed.

[0219] Interestingly, in the in vivo experimental setting, expression of PD-1 was observed on tumor specific T cells, which was not affected by Myoglobin expression. Accordingly, combination of Myoglobin expression with checkpoint therapy highly enhanced the anti-tumor efficacy of anti-PD-1 treatment.

[0220] Taken together, Myoglobin expression could be shown to increase metabolic functions of antigenspecific T cells, anti-tumor effector functions, and efficacy of checkpoint inhibition therapy. MATERIALS AND METHODS

[0221] Mice: All mice were bred in house in the Central Institution for Animal Research and Scientific Animal Welfare (ZETT) at the Heinrich-Heine-University in Duesseldorf, Germany. The mice were maintained under specific pathogen-free conditions. Experiments were performed under the authorization of LANUV in accordance with the German law for animal protection.

[0222] C57BL / 6J mice were obtained and used in this experimental setup. For adoptive transfer experiments, further P14 mice, which recognize the LCMV glycoprotein gp33 presented by MHC class l-Db were used (H. Pircher, K. Burki, R. Lang,H. Hengartner, R. M. Zinkernagel, Tolerance induction in double specific T cell receptor transgenic mice varies with antigen. Nature 342, 559- 561 (1989)).

[0223] Additionally, OT-1+ mice, which recognize SIINFEKL peptide of ovalbumin (OVA) presented by MHC class l-Kb via a transgenic TCR, were also used for an adoptive transfer experiment (K. A. Hogquist et al., T cell receptor antagonist peptides induce positive selection. Cell 76, 17-27 (1994).

[0224] Cell line: The cancer cell lines B16-gp33 and MC-38 were used (Prevost-Blondel A, Zimmermann C, Stemmer C, Kulmburg P, Rosenthal FM, Pircher H. Tumor-infiltrating lymphocytes exhibiting high ex vivo cytolytic activity fail to prevent murine melanoma tumor growth in vivo. J Immunol. 1998 Sep 1 ;161 (5):2187-94). B16-gp33 is derived from C57BL / 6 murine B16- F10 skin melanoma and expresses the LCMV glycoprotein peptide gp33, while MC-38 is a murine colon cancer line, expressing the OVA peptide, respectively. B16-gp33 and MC-38-OVA were cultured in DMEM containing 10% fetal calf serum 1 % penicillin and streptomycin, 1 % L-glutamine, and 0.4 mg / mL of G-418 selective antibiotic.

[0225] RNA purification and RT-PCR: RNA was isolated from spleen and tumor tissues by homogenizing the samples in Trizol. Chloroform is added and the middle layer is collected and mixed with isopropanol for precipitation. After washing with Ethanol and drying the sample the RT-PCR was set up. Therefore, SYBR Green, a cyanine dye, was used to detect the double-stranded DNA. Primers were customized for the usage (Mb-f: CTGTTTAAGACTCACCCTGAGAC (SEQ ID NO:17); Mb-r: GGTGCAACCATGCTTCTTCA (SEQ ID NO: 18)).

[0226] Retrovirus production: 293T cells were transfected at 70% confluence with jetPRIME (Polyplus), containing the Retrovirus Packaging Vector pCL-Eco (Novus Biologicals) and the target gene Myoglobin cloned in pMSCV-IRES-Thy1.1 Dest (Addgene #17442) or empty vector as Thy1 .1 control. Retrovirus containing supernatant was collected. Purification and transduction of T Cells: Following the manufacturer's recommendations, single cell suspended splenocytes were enriched with the mouse CD8 purification kit (Miltenyi). They were activated over night with IL-2, anti-CD3 and anti-CD28, before being transduced by spin inoccultation with Thy1.1 or Thy 1 .1 -Myoglobin packaging retrovirus to induce overexpression in T cells. T cells were sorted for Thy 1.1 + population using CD90.1 purification kit (Miltenyi). For adoptive transfer P14+splenocytes were activated with IL-2 and gp33 peptide, before being transduced by spin inocculation with Thy1.1 or Thy 1 .1 -Myoglobin packaging retrovirus to induce overexpression in T cells.

[0227] Adoptive transfer: B16-gp33 or MC-38-OVA cells were injected s.c. in the flank of C57BL / 6J mice. Splenocytes containing retrovius-transduced P14+or OT-l+ T cells were injected i.v. in tumor-bearing mice and the tumor growth was monitored.

[0228] Flow cytometric analysis: Experiments were performed using a FACS Fortessa and analyzed using FlowJo software. For T cells staining, singly suspended cells were incubated with antibodies (anti- CD8a, Thy1 .1 , PD-1 , Tim-3, CD44, CD62L, KLRG1 , IL7R) for 20min at 4°C orfor 10min at 37°C (anti- MitoSox, Peroxy Orange 1). Transcription factor and intracellular cytokine staining were performed as described previously (H. C. Xu et al., Type I interferon protects antiviral CD8+T cells from NK cell cytotoxicity. Immunity 40, 949-960 (2014)).

[0229] For transcription factor staining, singly suspended cells were incubated with surface antibodies (anti- CD8, Thy 1.1) and were added for 20 minutes at 4°C and after fixation and permeabilization with transcription antibodies (anti- HIF-1a, TOX). For intracellular cytokine re-stimulation, singly suspended cells, or isolated T cells were stimulated with LCMV-specific peptides gp33 or B16-gp33 cells for 1 hour. Brefeldin A (Thermofisher Scientific) was added for another 5 hours’ incubation at 37°C followed by staining (anti-CD8, Thy 1.1 , IFN-y, TNF-a, GzmB, IL-2). Splenocytes from adoptively transferred P14 T cells were stained with anti-CD45.1 , anti-CD8, and anti-va2 antibodies.

[0230] Detection of GSH: The Luminescent GSH-Glo™ Glutathione Assay (Promega) was used according to the manufacturer’s instructions.

[0231] Histology and immunofluorescence: Histological analysis of snap frozen tissue was performed as previously described (H. C. Xu et al., High-Affinity-Mediated Viral Entry Triggers Innate Affinity Escape Resulting in Type I IFN Resistance and Impaired T Cell Immunity. Journal of immunology 212, 1457-1466 (2024)). Sections were stained with antibodies against cleaved caspase-3 (Cell Signaling), CD8a conjugated with PerCP-eFluor™ 710 (Invitrogen) and dapi for counterstaining nuclei. Secondary antibodies such as donkey anti-rabbit IgG Alexa Fluor™ 555 or donkey anti-rabbit IgG Alexa Fluor™ 488 (Invitrogen) were used. Images were acquired with the ZEISS Axio Observer Z1 microscope and for quantifications, the images were analyzed with Imaged software.

[0232] Analysis of targeted metabolites by LC-MS / MS: T cells were stimulated with 10mM glucose medium and snap frozen. Cells were further extracted using precellys lysing kit and further isotopically labelled with corresponding standards. The targeted compounds were analysed by UPLC-MS / MS for determining glycolysis, TCA and adenosine phosphates components as previously described (C. G. Campos et al., New protocol based on UHPLC-MS / MS for quantitation of metabolites in xylose- fermenting yeasts. Journal of The American Society for Mass Spectrometry 28, 2646-2657 (2017); B. J. Marquis, H. P. Louks, C. Bose, R. R. Wolfe, S. P. Singh, A new derivatization reagent for HPLC- MS analysis of biological organic acids. Chromatographia 80, 1723-1732 (2017); A. S. Law, P. S. Hafen, J. J. Brault, Liquid chromatography method for simultaneous quantification of ATP and its degradation products compatible with both UV-Vis and mass spectrometry. Journal of Chromatography B 1206, 123351 (2022); A. E. Jones et al., A single LC-MS / MS analysis to quantify CoA biosynthetic intermediates and short-chain acyl CoAs. Metabolites 11 , 468 (2021)). Quantitative analysis was performed by TagetLynx XS software (Waters, UK).

[0233] Western Blot: Proteins were separated by performing SDS-PAGE and transferred on nitrocellulose membrane. The membrane was blocked afterwards and probed with Myoglobin or a-Tubulin primary antibody. After washing a secondary peroxidase-conjugated antibody was added. The Odyssey Fc Imaging System (Li-COR) was used for signal detection.

[0234] Cellular ROS detection assay: T cells were treated with 2,5mM H2O2 for 1 h. DHE, for the detection of cellular ROS was added, before performing a kinetic measurement on plate reader (Tecan Spark). The half maximal time is calculated over the slope.

[0235] Seahorse: The Seahorse XF Cell Mito Stress Test Kit (Agilent) was used according to the manufacturer’s instructions.

[0236] Statistical analysis: Data are expressed as mean ± S.E.M. For analysis of statistical significance between two groups, a Student t-test was used. For analysis of multiple time point experiments, two- way ANOVA was used. *p<0.05, **p<0.01 , ***p<0.001 and ****p<0.0001 was considered statistically significant.

Claims

Claims1. T cell or NK cell comprising an exogenous nucleic acid molecule having a nucleotide sequence coding for an oxygen-binding protein.

2. T cell or NK cell according to claim 1 , wherein the oxygen-binding protein is selected from a group consisting of Myoglobin, Neuroglobin, Cytoglobin, Hemoglobin A (HbA), HbA2, HbE Gower 1 , HbE Gower 2, HbE Portland I, HbE Portland II, HbH, Hb Barts, HbS, HbC, HbO, Hb Bassett, Hb Kansas, Hb D-Punjab, Hb O-Arab, Hb G-Philadelphia, Hb Hasharon, Hb Lepore, Hb M, Hb Hope, Hb Pisa, Hb J, Hb N-Baltimore, Hb Chesapeake, Hb Louisville, Hb Vanvitelli, fetal hemoglobin or Globin Y, Globin X, Globin E, Globin CTT (l-X), Globin-CTT- VIIB (3-10), Hemocyanin, Androglobin, Globin C, Erythrocruorin, Chlorocruorin, Extracellular Globin (1-4), Hemerythrin, Giant Hexagonal Bilayer Hemoglobin, Globin-like proteins (1 -26), Globin (1-3, and 5), Globin D, Phytoglobin, Leghemoglobin (1 -3, A), Flavohemoglobin, Flavohemoprotein 1 , and Flavohemoprotein 2, preferably Myoglobin, Cytoglobin, Hemoglobin A, and Globin E, particularly preferably Myoglobin, Cytoglobin, and Globin E.

3. T cell or NK cell according to claims 1 or 2, wherein the oxygen-binding protein is Myoglobin.

4. T cell or NK cell according to any one of claims 1 to 3, wherein the exogenous nucleic acid molecule causes increased expression in T or NK cells in comparison to a reference T or NK cell without such exogenous nucleic acid molecule.

5. T cell or NK cell according to any one of claims 1 to 4, wherein the exogenous nucleic acid molecule is selected from DNA or mRNA.

6. T cell or NK cell according to claim 5, wherein the exogenous nucleic acid is DNA.

7. T cell or NK cell according to claim 6, wherein said DNA molecule comprises a nucleotide sequence encoding an oxygen-binding protein, said DNA being functionally linked to a promoter that drives transcription within the cell.

8. T cell or NK cell according to any one of claims 1 to 7, wherein the T cell is a conventional T cell, an NKT cell, or NKT-like cell, preferably a CD8+T cell, CD8+NKT cell, or CD8+NKT-like cell, particularly preferably a naive CD8+T cell, CD8+NKT cell, or CD8+NKT-like cell.

9. T cell or NK cell according to any one of claims 1 to 8, wherein the T cell or NK cell is a human T cell or NK cell.

10. T cell or NK cell according to any one of claims 1 to 9, wherein the T cell or NK cell is genetically engineered to express a chimeric antigen-specific receptor (CAR), preferably wherein the T cell or NK cell is a CAR T cell or CAR NK cell suitable for autologous or allogeneic immunotherapy treatment of pre-malignant or malignant cancer.11 . Pharmaceutical composition comprising the T cell or NK cell according to any one of claims 1 to 10 and a pharmaceutically acceptable excipient.

12. T cell or NK cell according to any one of claims 1 to 10 or pharmaceutical composition according to claim 7 for use as a medicament.

13. T cell or NK cell according to any one of claims 1 to 10 or pharmaceutical composition according to claim 7 for use in a method of treating cancer in a subject.

14. T cell or NK cell or pharmaceutical composition for use according to claim 13, wherein the cancer is a solid tumor, preferably malignant melanoma.

15. T cell or NK cell or pharmaceutical composition for use according to any one of claims 13 or 14, wherein the use further comprises simultaneous treatment with anti-PD-1 and / or anti-PD- L1 therapy.

16. Method for preparing an engineered T cell or NK cell comprising introducing into a T cell orNK cell an exogenous nucleic acid molecule having a nucleotide sequence coding for an oxygen-binding protein.

17. Method according to claim 16, wherein the T cell is a conventional T cell, an NKT cell, or NKT- like cell, preferably a CD8+T cell, CD8+NKT cell, or CD8+NKT-like cell, particularly preferably a naive CD8+T cell, CD8+NKT cell, or CD8+NKT-like cell, and / or wherein the T cell or NK cell is a human T cell or NK cell.

18. Method according to any one of claims 16 or 17, further comprising a step of introducing into the T cell or NK cell an exogenous nucleic acid molecule comprising a nucleotide sequencecoding for a Chimeric Antigen Receptor (CAR) directed against at least one antigen expressed at the surface of a malignant or infected cell.

19. Method according to any one of claims 16 to 18, wherein the oxygen-binding protein is selected from a group consisting of Myoglobin, Neuroglobin, Cytoglobin, Hemoglobin A (HbA), HbA2, HbE Gower 1 , HbE Gower 2, HbE Portland I, HbE Portland II, HbH, Hb Barts, HbS, HbC, HbO, Hb Bassett, Hb Kansas, Hb D-Punjab, Hb O-Arab, Hb G-Philadelphia, Hb Hasharon, Hb Lepore, Hb M, Hb Hope, Hb Pisa, Hb J, Hb N-Baltimore, Hb Chesapeake, Hb Louisville, Hb Vanvitelli, fetal hemoglobin or Globin Y, Globin X, Globin E, Globin CTT (l-X), Globin-CTT-VIIB (3-10), Hemocyanin, Androglobin, Globin C, Erythrocruorin, Chlorocruorin, Extracellular Globin (1-4), Hemerythrin, Giant Hexagonal Bilayer Hemoglobin, Globin-like proteins (1-26), Globin (1-3, and 5), Globin D, Phytoglobin, Leghemoglobin (1 -3, A), Flavohemoglobin, Flavohemoprotein 1 , and Flavohemoprotein 2, preferably Myoglobin, Cytoglobin, Hemoglobin A, and Globin E, more preferably Myoglobin, Cytoglobin, and Globin E, most preferably wherein the oxygen-binding protein is Myoglobin.

Images