Methods for identifying dogs at higher risk of developing IBD and treatments through nutritional intervention

Abstract

Methods of identifying a canine subject susceptible to inflammatory bowel disease, methods of treating or preventing inflammatory bowel disease in a canine subject, and compositions useful for treating or preventing inflammatory bowel disease in a canine subject are described herein.

Description

METHODS FOR IDENTIFYING DOGS AT HIGHER RISK OF DEVELOPING IBD AND TREATMENTS THROUGH NUTRITIONAL INTERVENTION CROSS REFERENCE TO RELATED APPLICTION

[0001] This application claims the benefit of U.S. Provisional Application No. 63 / 565,363, which was filed March 14, 2024, is titled “Methods for Identifying Dogs at Higher Risk of Developing IBD and Treatments Through Nutritional Intervention,” and is incorporated herein by reference as if fully set forth. REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0002] The contents of the electronic sequence listing with the filename 14142-00-WO-01-HL - Sequence Listing.xml, having a size of 1,899 bytes, and a date of creation of March 6, 2025 is incorporated herein by reference in its entirety as if fully set forth. BACKGROUND

[0003] Inflammatory bowel disease (IBD) is a common gastrointestinal condition in dogs. IBD is a chronic condition with the dog experiencing recurrent episodes of diarrhea and / or vomiting. The cause of IBD is unknown, and there are likely multiple etiologies. Regardless of the cause, all IBD cases exhibit a characteristic invasion of inflammatory cells into the lining of the GI tract resulting in an inflammatory state. Recent evidence suggests that the gut microbiome plays a significant role in most if not all cases of IBD. One of the more prevalent reasons may be a perturbation of the normal commensal microbiota causing a gut microbiome dysbiosis, resulting in the initiation of an inflammatory response in the gut leading to IBD. Commensal microbiota are a collection of microbes that have evolved to function synergistically with one another and the host to perform a multitude of functions including digestion, the production of vitamins and other nutrients, maintaining the integrity of the gut mucosa and immunomodulation. BRIEF SUMMARY

[0004] This summary is intended merely to introduce a simplified summary of some aspects of one or more implementations of the present disclosure. Further areas of applicability of the present disclosure will become apparent from the detailed description provided hereinafter. Thissummary is not an extensive overview, nor is it intended to identify key or critical elements of the present teachings, nor to delineate the scope of the disclosure. Rather, its purpose is merely to present one or more concepts in simplified form as a prelude to the detailed description below.

[0005] The invention relates to identifying dogs having or not having a risk for inflammatory bowel disease. The invention also relates to treating dogs having inflammatory bowel disease. The invention also relates to preventing inflammatory bowel disease in dogs having at risk of developing inflammatory bowel disease.

[0006] In accordance with a first aspect of the invention, provided is a method of identifying susceptibility to inflammatory bowel disease in a canine subject. The method comprises determining an allele identity of the canine subject for an SNP at canine chromosome 19, position 19:22083678, which corresponds to position 51 in CACACATTTCCTTAAACTCAGATTTATTCATGTGAGTCCCAGTATTGGAT[G / A]GCTCA GTGATTCTCCTGAACAATACCAGACCACACAATTAACAGTTAAAT (SEQ ID NO: 1). An A at position 51 indicates susceptibility to inflammatory bowel disease.

[0007] In accordance with a second aspect of the invention, provided is a method of treating or preventing inflammatory bowel disease in a canine subject. The method comprises identifying susceptibility to inflammatory bowel disease in a canine subject. The method may comprise feeding the canine subject a quinoa supplemented diet in the event that it is identified as susceptible inflammatory bowel disease. The method may also comprise feeding the canine subject a quinoa supplemented diet during symptomatic inflammatory bowel disease. In some embodiments, the identifying step comprises determining an allele identity in a canine subject for an SNP at canine chromosome 19, position 19:22083678, which corresponds to position 51 in CACACATTTCCTTAAACTCAGATTTATTCATGTGAGTCCCAGTATTGGAT[G / A]GCTCA GTGATTCTCCTGAACAATACCAGACCACACAATTAACAGTTAAAT (SEQ ID NO: 1), wherein an A at position 51 indicates susceptibility to inflammatory bowel disease. In some embodiments, the feeding step comprises feeding the canine subject a quinoa supplemented diet when position 51 is identified as an A.

[0008] In accordance with a third aspect of the invention, provided is a method of identifying susceptibility to inflammatory bowel disease in a canine subject. The method comprises identifying a test abundance of Collinsellia intestinalis commensal to the canine relative to a control abundance of Collinsellia intestinalis commensal to a canine lacking inflammatory boweldisease. The canine subject is identified as susceptible to inflammatory bowel disease when the test abundance is less than the control abundance.

[0009] In accordance with a fourth aspect of the invention, provided is a method of treating or preventing inflammatory bowel disease in a canine. The method may comprise feeding the canine subject a quinoa supplemented diet in the event that it is identified as susceptible inflammatory bowel disease. The method may also comprise feeding the canine subject a quinoa supplemented diet during symptomatic inflammatory bowel disease. In some embodiments, the identifying step comprises identifying a test abundance of Collinsellia intestinalis commensal to the canine relative to a control abundance of Collinsellia intestinalis commensal to a canine lacking inflammatory bowel disease. The canine subject is identified as susceptible to inflammatory bowel disease when the test abundance is less than the control abundance. In some embodiments, the feeding step comprises feeding the canine subject a quinoa supplemented diet when the test abundance is less than the control abundance.

[0010] In accordance with a fifth aspect of the invention, provided is a composition comprising a canine feed and at least about 2.5% quinoa.

[0011] In accordance with a sixth aspect of the invention, provided is a composition comprising a canine feed and quinoa in an amount effective to increase a Collinsellia intestinalis population in a canine subject when the canine subject consumes the composition.

[0012] In accordance with a seventh aspect of the invention, provided is a method for making a pet food composition. The method comprises the following steps: (a) preconditioning by mixing wet and dry ingredients at elevated temperature to form a dough; (b) extruding the dough at a high temperature, and pressure to form an extruded kibble; (c) drying the extruded kibble; and (d) enrobing the dried kibble with topical liquid and / or dry ingredients. The method further comprises applying quinoa to the kibble at step (a) and / or (d), in an amount effective to increase a Collinsellia intestinalis population in a canine subject when the canine subject consumes the composition. BRIEF DESCRIPTION OF DRAWINGS

[0013] The features, and advantages of the invention will be apparent from the following more detailed description of certain embodiments of the invention and as illustrated in the accompanying drawings in which:

[0014] FIG. 1 illustrates a box plot graph of the levels of C. intestinalis in control and IBD dogs. The button of the box is the 25th percentile and top of the box the 75th percentile and the red bar the median value. Values are plotted on a log scale.

[0015] FIG. 2 illustrates a representative histogram showing the distribution of log transformed relative levels of C. intestinalis across the cohort of dogs in the study.

[0016] FIG. 3 illustrates a Manhattan plot showing the genome-wide significant association between C. intestinalis levels and a locus containing the HS6ST1 gene on Chromosome 19 in the dog. An additive model using linear regression was used in the analysis.

[0017] FIG. 4 illustrates a Manhattan plot showing the genome-wide significant association between C. intestinalis levels and a locus containing the HS6ST1 gene on Chromosome 19 in the dog. A single locus mixed model using identity by similarity as a co-variant was used in the analysis.

[0018] FIG. 5 illustrates a box plot showing the 25th percentile (bottom of box), median (line within the box), and 75th percentile (top of box) for the levels of C. intestinalis for each genotype at SNP Affx-205540987. Values are plotted on a log scale.

[0019] FIGS. 6A–6E illustrate abundance of beneficial bacteria, Collinsella in the feces of animals fed with control and treatment diets, respectively. Significant p values derived from paired t-test. FIG.6A) Control vs Quinoa 2.5 wt.%; FIG.6B) Control vs Quinoa 5 wt.%; FIG.6C) Control vs Quinoa 10 wt.%; FIG. 6D) Control vs Quinoa 20 wt.%; FIG. 6E) Control (pre-feed) vs Control (treatment).

[0020] FIG.7A illustrates diet compositions. Each panel shows, from left to right: Control diet, Test diet Quinoa 2.5 wt.%, Test diet Quinoa 5%, Test diet Quinoa 10 wt.%, Test diet Quinoa 20 wt.%.

[0021] FIG.7B illustrates diet compositions. Each panel shows, from left to right: Control diet, Test diet Quinoa 2.5 wt.%, Test diet Quinoa 5 wt.%, Test diet Quinoa 10 wt.%, Test diet Quinoa 20 wt.%. DETAILED DESCRIPTION

[0022] For illustrative purposes, the principles of the present invention are described by referencing various exemplary embodiments thereof. Although certain embodiments of the invention are specifically described herein, one of ordinary skill in the art will readily recognizethat the same principles are equally applicable to and can be employed in other compositions and methods. Before explaining the disclosed embodiments of the present invention in detail, it is to be understood that the invention is not necessarily limited in its application to the details of any particular embodiment disclosed. The terminology used herein is for the purpose of description and not of limitation.

[0023] As used herein and in the appended claims, the singular forms “a”, “an”, and “the” include plural references unless the context dictates otherwise. The singular form of any class of the ingredients refers not only to one ingredient within that class, but also to a mixture of those ingredients. The terms “a” (or “an”), “one or more” and “at least one” may be used interchangeably herein. The terms “comprising”, “including”, and “having” may be used interchangeably. The term “include” should be interpreted as “include but are not limited to”. The term “including” should be interpreted as “including but are not limited to”.

[0024] As used throughout, ranges are used as shorthand for describing each and every value that is within the range. Any value within the range can be selected as the terminus of the range. Thus, a range from 1–5, includes specifically 1, 2, 3, 4 and 5, as well as subranges such as 2–5, 3– 5, 2–3, 2–4, 1–4, etc. The term “about” when referring to a number means any number within a range of 15% of the number. Embodiments include embodiments described herein with “about” modifying one or more numerical value. Further embodiments herein include removing one or more, or all, instances of “about” from embodiments herein described with “about” modifying one or more numerical value.

[0025] The abbreviations and symbols as used herein, unless indicated otherwise, take their ordinary meaning. The abbreviation “wt.%” means percent by weight with respect to the composition. The symbol “°” refers to a degree, such as a temperature degree or a degree of an angle. The symbols “h”, “min”, “mL”,” nm”, “µm” means hour, minute, milliliter, nanometer, and micrometer, respectively.

[0026] All references cited herein are hereby incorporated herein by reference in their entireties as of fully set forth. In the event of a conflict in a definition in the present disclosure and that of a cited reference, the present disclosure controls.

[0027] In accordance with a first aspect, provided is a method of identifying susceptibility to inflammatory bowel disease in a canine subject. The method comprises determining an allele identity of the canine subject for an SNP at canine chromosome 19, position 19:22083678. Thisposition corresponds to position 51 in CACACATTTCCTTAAACTCAGATTTATTCATGTGAGTCCCAGTATTGGAT[G / A]GCTCA GTGATTCTCCTGAACAATACCAGACCACACAATTAACAGTTAAAT (SEQ ID NO: 1). Hence, the SNP at canine chromosome 19, position 19:22083678 is referred to herein as position 51 of SEQ ID NO: 1, or position 51. An A at position 51 indicates susceptibility to inflammatory bowel disease.

[0028] In some embodiments, the determining step comprises identifying a genotype for the canine subject at the SNP. A determination of homozygous GG indicates lower susceptibility to inflammatory bowel disease for the canine subject relative to susceptibility for heterozygous GA or homozygous AA canines. A determination of heterozygous GA indicates an intermediate susceptibility to inflammatory bowel disease for the canine subject between susceptibility for homozygous GG and homozygous AA canines. A determination of homozygous AA indicates increased susceptibility to inflammatory bowel disease for the canine subject, above the susceptibility for either the homozygous GG or heterozygous GA canines.

[0029] In some embodiments, the determining step comprises obtaining a sample from the canine subject. In some embodiments, obtaining the sample comprises obtaining a buccal sample. In some embodiments, the step of obtaining a buccal sample comprises placing a collecting sponge between the canine subject cheek and gum. In some embodiments, the step of obtaining a buccal sample further comprises placing cells obtained from the collecting sponge in a stabilizing lysis solution. In some embodiments, the step of obtaining a sample comprises collecting a blood sample from the canine subject. In some embodiments, the step of obtaining a sample comprises collecting a tissue sample from the canine subject.

[0030] In some embodiments, the method further comprises extracting the sample to obtain a nucleic acid sample. In some embodiments, the nucleic acid is an RNA. In some embodiments, the method further comprises synthesizing DNA from the RNA via catalysis with a reverse transcriptase. In some embodiments, the nucleic acid is a DNA. In some embodiments, the method further comprises performing a polymerase chain reaction utilizing primers capable of amplifying a nucleic acid sequence including canine chromosome 19, position 19:22083678 to produce an amplified DNA. In some embodiments, the method further comprises sequencing the amplified DNA. In some embodiments, the method further comprises sequencing the nucleic acid. In someembodiments, the determining step further comprises sequencing a region of the canine subject DNA, or an RNA copy thereof, comprising position 19:22083678.

[0031] In accordance with a second aspect, provided is a method of treating or preventing inflammatory bowel disease in a canine. The method comprises identifying susceptibility to inflammatory bowel disease in a canine subject. In some embodiments, the identifying step comprises determining an allele identity in a canine subject for an SNP at canine chromosome 19, position 19:22083678. This position corresponds to position 51 in CACACATTTCCTTAAACTCAGATTTATTCATGTGAGTCCCAGTATTGGAT[G / A]GCTCA GTGATTCTCCTGAACAATACCAGACCACACAATTAACAGTTAAAT (SEQ ID NO: 1). Hence, the SNP at canine chromosome 19, position 19:22083678 is referred to herein as position 51 of SEQ ID NO: 1, or position 51. An A at position 51 indicates susceptibility to inflammatory bowel disease.

[0032] In some embodiments, the method of treating or preventing inflammatory bowel disease comprises feeding the canine subject a quinoa supplemented diet when position 51 is identified as an A.

[0033] In some embodiments, the feeding step comprises feeding the canine subject a feed comprising at least about 2.5 wt.% quinoa.

[0034] In some embodiments, the determining step comprises identifying a genotype for the canine subject at the SNP. A determination of homozygous GG indicates lower susceptibility to inflammatory bowel disease for the canine subject relative to susceptibility for heterozygous GA or homozygous AA canines. A determination of heterozygous GA indicates an intermediate susceptibility to inflammatory bowel disease for the canine subject between susceptibility for homozygous GG and homozygous AA canines. A determination of homozygous AA indicates increased susceptibility to inflammatory bowel disease for the canine subject, above the susceptibility for either the homozygous GG or heterozygous GA canines. A level of susceptibility refers to the risk of developing inflammatory bowel disease.

[0035] In some embodiments, the determining step comprises obtaining a sample from the canine subject. In some embodiments, the step of obtaining a sample comprises obtaining a buccal sample, a blood sample, or a tissue sample. In some embodiments, the method further comprises extracting the buccal sample, the blood sample, or the tissue sample to obtain a nucleic acid sample. In some embodiments, the determining comprises sequencing the nucleic acid sample.

[0036] In some embodiments, the determining step comprises performing a polymerase chain reaction on the sample or nucleic acid sample utilizing primers capable of amplifying a nucleic acid sequence including canine chromosome 19, position 19:22083678 to produce an amplified DNA. In some embodiments, the determining step further comprises sequencing the amplified DNA.

[0037] In some embodiments, the determining step comprises sequencing a region of the canine subject DNA, or an RNA copy thereof, comprising position 19:22083678.

[0038] In accordance with a third aspect, provided is a method of identifying susceptibility to inflammatory bowel disease in a canine subject. In some embodiments, the method comprises identifying a test abundance of Collinsellia intestinalis commensal to the canine relative to a control abundance of Collinsellia intestinalis commensal to a canine lacking inflammatory bowel disease. In some embodiments, the canine subject is identified as susceptible to inflammatory bowel disease when the test abundance is less than the control abundance.

[0039] In some embodiments, the control abundance is obtained from a table of Collinsellia intestinalis abundance. See Table 2, below, as a non-limiting example of table from which Collinsellia intestinalis abundance may be obtained.

[0040] In some embodiments, the Collinsellia intestinalis abundance control abundance is obtained for a canine of the same species as the canine subject.

[0041] In some embodiments, the Collinsellia intestinalis test abundance is determined by directly determining the number of Collinsellia intestinalis in the canine subject. In some embodiments, the Collinsellia intestinalis test abundance is determined by culturing and / or dilution plating bacterial samples from fecal samples from the canine subject. In some embodiments, the culturing and / or dilution plating further comprises selecting for or assaying for Collinsellia intestinalis over other bacterial species.

[0042] In some embodiments, the control abundance is determined by culturing and / or dilution plating a fecal sample from a canine lacking inflammatory bowel disease. In some embodiments, the culturing and / or dilution plating further comprises selecting for or assaying for Collinsellia intestinalis over other bacterial species.

[0043] In some embodiments, the test abundance is determined by short read shotgun sequencing of DNA in a fecal sample from the canine subject to obtain reads matching Collinsellia intestinalis and a total number of identifiable reads. In some embodiments, the test abundance isthe percentage of reads matching Collinsellia intestinalis relative to the total number of identifiable reads.

[0044] In some embodiments, the test abundance less than the control abundance is at least about five-fold less than the control abundance.

[0045] In some embodiments, the method comprising identifying a test abundance of Collinsellia intestinalis commensal to the canine relative to a control abundance of Collinsellia intestinalis commensal to a canine lacking inflammatory bowel disease further comprises determining an SNP at canine chromosome 19 at position 19:22083678, as listed at position 51 in SEQ ID NO: 1 in the canine subject. In some embodiments, the determining an SNP comprises determining a genotype of the canine subject for the SNP. In some embodiments, a determination of homozygous GG indicates lower susceptibility to inflammatory bowel disease for the canine subject relative to susceptibility for heterozygous GA or homozygous AA canines. In some embodiments, a determination of heterozygous GA indicates an intermediate susceptibility to inflammatory bowel disease for the canine subject between susceptibility for homozygous GG and homozygous AA canines. In some embodiments, a determination of homozygous AA indicates increased susceptibility to inflammatory bowel disease for the canine subject, above the susceptibility for either the homozygous GG or heterozygous GA canines.

[0046] In accordance with a fourth aspect, provided is a method of treating or preventing inflammatory bowel disease in a canine subject. In some embodiments, the method comprises identifying susceptibility to inflammatory bowel disease in a canine subject. In some embodiment, the step of identifying comprises identifying a test abundance of Collinsellia intestinalis commensal to the canine relative to a control abundance of Collinsellia intestinalis commensal to a canine lacking inflammatory bowel disease. In some embodiments, the canine subject is identified as susceptible to inflammatory bowel disease when the test abundance is less than the control abundance.

[0047] In some embodiments, the test abundance less than the control abundance is at least about five-fold less than the control abundance.

[0048] In some embodiments, the method of treating or preventing inflammatory bowel disease further comprises feeding the canine subject a quinoa supplemented diet when the test abundance is less than the control abundance.

[0049] In some embodiments, feeding the canine subject a quinoa supplemented diet comprises feeding the canine subject a feed comprising at least about 2.5 wt.% quinoa.

[0050] In some embodiments, the method comprises repeating the identifying step at least once or periodically. In some embodiments, the method comprises ceasing the step of feeding the canine subject a quinoa supplemented diet if the test abundance is equal to or greater than the control abundance upon repeating the identifying step. In some embodiments, the method comprises re- starting the feeding step if the test abundance is less than the control abundance upon a subsequent repeating step.

[0051] In some embodiments, the control abundance is obtained from a table of Collinsellia intestinalis abundance. See Table 2, below, for a non-limiting example of a table from which Collinsellia intestinalis control abundance values may be obtained. In some embodiments, the control abundance is obtained for a canine of the same species as the canine subject.

[0052] In some embodiments, the test abundance is determined by directly determining the number Collinsellia intestinalis in the canine subject. In some embodiments, the Collinsellia intestinalis test abundance is determined by culturing and / or dilution plating bacterial samples from fecal samples from the canine subject. In some embodiments, the culturing and / or dilution plating further comprises selecting for or assaying for Collinsellia intestinalis over other bacterial species.

[0053] In some embodiments, the control abundance is determined by culturing and / or dilution plating a fecal sample from a canine lacking inflammatory bowel disease. In some embodiments, the culturing and / or dilution plating further comprises selecting for or assaying for Collinsellia intestinalis over other bacterial species.

[0054] In some embodiments, the test abundance is determined by short read shotgun sequencing of DNA in a fecal sample from the canine subject to obtain reads matching Collinsellia intestinalis and a total number of identifiable reads. In some embodiments, the test abundance is the percentage of reads matching Collinsellia intestinalis relative to the total number of identifiable reads.

[0055] In some embodiments of the method of treating or preventing inflammatory bowel disease in a canine subject comprising identifying susceptibility to inflammatory bowel disease in a canine subject by identifying a test abundance of Collinsellia intestinalis commensal to the canine relative to a control abundance of Collinsellia intestinalis commensal to a canine lackinginflammatory bowel disease further comprises determining an SNP at chromosome 19 at position 19:22083678 as listed at position 51 of SEQ ID NO: 1. In some embodiments, a determination of homozygous GG indicates lower susceptibility to inflammatory bowel disease for the canine subject relative to susceptibility for heterozygous GA or homozygous AA canines. In some embodiments, a determination of heterozygous GA indicates an intermediate susceptibility to inflammatory bowel disease for the canine subject between susceptibility for homozygous GG and homozygous AA canines. In some embodiments, a determination of homozygous AA indicates increased susceptibility to inflammatory bowel disease for the canine subject, above the susceptibility for either the homozygous GG or heterozygous GA canines.

[0056] In accordance with a fifth aspect, provided is a composition comprising a canine feed and at least about 2.5 wt.% quinoa. The composition may comprise at least about 5 wt.% quinoa. The composition may comprise at least about 10 wt.% quinoa. The composition may comprise at least about 15 wt.% quinoa. The composition may comprise at least about 20 wt.% quinoa. The composition may comprise about 0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 wt.% quinoa, or an amount between any two of the foregoing. In some embodiments, the composition comprises quinoa in an amount as described above and at least one of from about 10 to about 20 wt.% fat crude, about 1 to about 5 wt.% fiber crude, from about 20 to about 30 wt.% protein crude, from about 2 to about 6 wt.% ash, and from about 45 to about 55 wt.% carbohydrate. In some embodiments, the composition comprises about 13 wt.% to about 14 wt.% crude fat, about 1.6 wt.% to about 1.7 wt.% fiber crude, about 22 wt.% to about 23.5 wt.% protein crude; about 4.6% to about 4.9% ash, about 6.8 wt.% to about 7.15 wt.% moisture, and about 48.6 wt.% to about 49.5 wt.% carbohydrate. In some embodiments, the composition comprises 13 wt.% to 14 wt.% crude fat, 1.6 wt.% to 1.7 wt.% fiber crude, 22 wt.% to 23.5 wt.% protein crude; 4.6% to 4.9% ash, 6.8 wt.% to 7.15 wt.% moisture, and 48.6 wt.% to 49.5 wt.% carbohydrate. In some embodiments, the composition comprises an amino acid content of at least one of alanine at about 1.5 to 1.7 wt.%, arginine at about 1 to about 1.4 wt.%, glycine at about 1.25 to about 1.6 wt.%, histidine at about 0.4 to about 0.6 wt.%, isoleucine at about 0.75 to about 1 wt.%, leucine at about 2.25 to about 2.5 wt.%, lysine at about 0.75 to about 1.1 wt.%, phenylalanine at about 1 to about 1.25 wt.%, proline at about 1.6 to about 2.0 wt.%, serine at about 0.9 to about 1.2 wt.%, threonine at about 0.3 to about 0.85 wt.%, tyrosine at about 0.6 to about 0.8 wt.%, valine at about 1 to about 1.2 wt.%, cystine at about 0.3 to about 0.6 wt.%, and methionine at about 0.3 to about 0.5 wt.%.In some embodiments, the amino acid content may be adjusted depending on the amount of quinoa. See for example, FIG. 7B, which outlines varying amino acid content for 2.5, 5, 10, and 20 wt.% quinoa. In some embodiments, the composition comprises the components of one of the 2.5, 5, 10, or 20 wt.% quinoa diets listed Table 6A. In some embodiments, the composition comprises the components of one of the 2.5, 5, 10, or 20 wt.% quinoa diets listed in Table 6A at the amounts listed therein. In some embodiments, the composition comprises the components of one of the 2.5, 5, 10, or 20 wt.% quinoa diets listed in Table 6A at amounts within 15% of the amounts listed therein. In some embodiments, the composition comprises the amino acid content of one of the 2.5, 5, 10, or 20 wt.% quinoa diets listed in Table 6B at amounts listed therein. In some embodiments, the composition comprises the amino acid content of one of the 2.5, 5, 10, or 20 wt.% quinoa diets listed in Table 6B at amounts within 15% of the amounts listed therein. In some embodiments, the composition comprises the components of one of the 2.5, 5, 10, or 20 wt.% quinoa diets listed in Table 6A at the amounts listed therein and the amino acid content of Table 6B at the amounts listed therein. In some embodiments, the composition comprises the components of one of the 2.5, 5, 10, or 20 wt.% quinoa diets listed in Table 6A at amounts within 15% of the amounts listed therein and the amino acid content of Table 6B at amounts within 15% of the amounts listed therein. EXAMPLES

[0057] Collinsellia intestinalis has been identified as one of the commensal bacteria in dogs, and it has been herein demonstrated that C. intestinalis is reduced over five-fold in a cohort of dogs clinically diagnosed with IBD. Furthermore, a genetic locus in dogs is herein identified that significantly reduced the presence of C. intestinalis in the dog gut, putting dogs with this allele at higher risk for developing IBD. Finally, a formula has been identified for a food that significantly increases the level of C. intestinalis in the dog gut. Taken together, the data herein identify methods to identify dogs at higher risk of developing IBD by evaluating the composition of their gut microbiome and / or genotyping for a variant associated with reduced levels of C. intestinalis, and a method for reducing the risk of, preventing, and / or treatment of IBD through feeding a nutritional intervention which increases the abundance of the genus Collinsella. METHODS

[0058] Dog Cohort

[0059] A cohort of 922 dogs were enrolled for this study. The subjects were client owned animals identified by approximately 20 veterinarian clinics across the United States. Inclusion criteria included being greater than 7 years of age and being of purebred status. No specific breeds were selected for. The cohort consisted of over 100 different dog breeds roughly representative of the breed demographics across the United States.

[0060] DNA extraction and metagenomic analysis

[0061] DNA was extracted from the fecal samples collected from the 1000 dog cohort using QIAamp PowerFecal Pro DNA kit (Qiagen) followed by manufacturer instructions. Metagenomic analysis was performed at ComosID Inc., (Rockville, MD, USA) by using Illumina sequencing technology followed by their proprietary bioinformatics workflow for taxonomic profiling and abundance data. Each sample was sequenced at a depth of 6M reads. For taxonomic profiling, unassembled sequence reads are directly analyzed by CosmosID metagenomics software to reveal associated microbial composition. Briefly, the software utilizes a high performance data mining k- mer algorithm and highly curated dynamic comparator databases (composed of 155,000 microbial genomes) that rapidly disambiguate millions of short reads into the discrete genomes or gene sequences. The pipeline has two phases: first phase consists of pre-computation phase for the reference database and per-sample computation to produce an output of phylogeny tree with sets of variable k-mer fingerprints (biomarkers) which are uniquely identified with distinct nodes, branches and leaves of the tree. The second phase consists of per-sample computational phase searches the millions of short read sequences or contigs from draft assembly against the k-mer fingerprint sets and the resulting statistics used to analyze composition and relative abundance estimates.

[0062] DNA extraction for Genotyping

[0063] DNA samples were collected from 922 dogs using the DNAGenotek saliva collection Kit. The collection sponge was placed inside the dog’s mouth in the pocket between the cheek and gum for 30 seconds to absorb saliva and cells then placed in the stabilizing lysis solution and stored at -80 degree C until DNA extraction. DNA was extracted by thawing the lysis solution and using a Qiagen DNA extraction kit as per manufacturer’s directions.

[0064] Genotyping

[0065] Genome wide genotyping was performed using the Affymetrix Axiom Canine HD genotype array consisting of approximately 730,000 SNPs. Genotyping was filtered using Plink(https: / / www.cog-genomics.org / plink2) for minor allele frequency greater than 5 percent (--maf 0.05), dropping individuals missing more than 10% of genotyping calls (--mind 0.1), and dropping genotypes missing more than 10% of calls (--geno 0.1). 157,498 SNPs were removed by filtering leaving 571,678, SNPs for downstream analysis.

[0066] Phenotyping

[0067] Animals in the cohort were thoroughly examined by a qualified veterinarian. Based on client interviews and clinical examination dogs with any clinical signs of inflammatory bowel disease were identified and diagnosed as such.

[0068] Microbiome analysis

[0069] Total fecal DNA was extracted from frozen fecal samples by using MoBio PowerFecal DNA extraction kit followed by 16s rDNA amplicon sequencing using V3 and V4 hypervariable regions by employing MiSeq (Illumina) sequencing technology. The resulting sequences were demultiplexed by using MiSeq’s in-built “metagenomics” workflow to obtain FASTQ files. FASTQ files were processed by employing Mothur software to classify the sequence reads using Greengenes database followed by custom modifications. Those with less than 95% ubiquity were removed from the data analysis. The remaining 106 OTUs were included for analysis. First, the zero counts were imputed, and then all the counts were converted to relative abundances by dividing the individual counts by the total number of counts in the sample. The relative abundances were transformed to centered log ratios (CLRs) for further statistical analysis. The R package, ALDEx2, was used for the imputation and transformation and statistical analysis was performed by using JMP (version 12). RESULTS

[0070] Metagenomic analysis of the gut microbiome assumes that the microbiota present in fecal matter is representative of its presence in the gut therefore total DNA extracted from fecal matter can be used to characterize the gut microbiome. Recent advances in short read shotgun sequencing technologies allow one to sequence millions of fragments in parallel from a single DNA sample. These sequences can be matched to a database of all known genome sequences for microbes and the number of sequence reads matching a given organism quantified. By comparing the number of matched reads for one organism to the total number of identifiable reads one can calculate the relative level of that organism to the relative level of the other organisms in the database. The value for any given organism is expressed as a percentage of the total number ofidentifiable reads. Using this approach we have characterized the bacteria species in the gut microbiome of a cohort of 922 dogs consisting of over 100 breeds and collected at multiple geographical locations across the United States. We detected and determined the relative level of approximately 300 species of bacteria present in the gut microbiome of each member of this cohort of dogs. We next ranked each species of bacteria by the percent of individual dogs that the species was detectable in. The ten most prevalent species across the cohort of dogs is presented in Table 1. Of interest to this invention, Collinsella intestinalis is the sixth most prevalent bacterial species detectable in over 96% of all dogs tested. C. intestinalis is also one of the most abundant species of bacteria with an average abundance of 4.71 percent and a median abundance of 3.89 percent (Table 1). This can be compared to the most abundant species, Prevotella copri, with an average abundance of 15.15 percent although the median level of P. copri is only 0.40 percent. In contrast the average and median values for C. intestinalis are close together indicating that its level is more consistent across the population. Given the high level of prevalence and abundance of C. intestinalis in a large cohort of dogs roughly representative of the US dog population indicates that this species is an important commensal bacteria in the dog gut microbiome. Table 1 Percent of Dogs The Species Was Median S i In D G t M n Ab nd nrepresentative of the general dog population of the United States. The mean and median values for each species across the cohort is given.

[0071] Collinsella intestinalis is a lactic acid producing gram positive anaerobic bacterium.1Recently C. intestinalis has been shown to play an important role in the breakdown of fructoselysine, a byproduct of Mallard reactions during the processing of food.2Fructoselysine is an intermediate in the production of advanced glycation end products (AGEs), which have been associated with inflammation and the development of chronic disease such as Crohn's disease, a form of IBD in humans.3Within the cohort of 922 dogs, 23 have been clinically diagnosed with chronic inflammatory bowel disease. To determine if there is an association between C. intestinalis and IBD, we compared the IBD dogs to an age, sex, weight, and breed matched control group (Table 2). IBD dogs have an approximate five-fold reduction in the level of C. intestinalis compared to their matched controls (FIG. 1). Furthermore, eight of the IBD dogs had levels of C. intestinalis below the limit of detection while only one dog in the control group had an undetectable level (Table 2). To determine the significance of the difference in the means between controls and IBD cases we ran a two tailed t test. Control cases had a mean level of 0.05 C. intestinalis while the mean level of cases was 0.01 p=0.0001 (Table 3). Table 2 Weight CollinsellaFemale LB041 CHINESE SHAR-PEI 11.67 56.7 Spayed 1 0.0083Female SG155 MIXED 5.58 46.8 Spayed 1 0.02703YORKSHIRE Female MP040 TERRIER 7 11.4 Spayed 0 0.07431designated by a 0 and cases with a 1. The relative level of C. intestinalis for each dog in the cohort is listed. Table 3 Average Average Species (Cases) (Controls) p value FDR alis

[0072] Independent of IBD, there is a significant amount of variation in C. intestinalis levels in normal healthy dogs (FIG. 2). Recent studies have shown that host genetic loci in humans can impact the composition of the gut microbiome.4,5To understand this variation better a genetic approach was taken using the relative levels of C. intestinalis as a continuous variable and performing a quantitative trait loci analysis using genotypes across the entire dog genome. The analysis was done using two different statistical models, first, using an additive model with linear regression adjusted by principal components to account for population structure of the cohort of dogs, and second, a single locus mixed model using identity by similarity to account for population structure. Both models identified a single locus on Canine Chromosome 19 that exceeds genome wide significance (FIGS. 3 and 4). A single nucleotide polymorphism designated as Affx- 205540987 on the Affymetrix Canine HD Genotyping array, located at position 19:22083678 (SEQ ID NO: 1) in the dog reference genome CanFam3.1, is the most significant SNP in the locus (Table 4). The reference allele, Guanine (G), is the major allele and the minor allele is an Adenine (A) with a frequency of 0.14 across this cohort of dogs. Dogs homozygous for the major allele (GG) have an average level of 5% C. intestinalis present in the microbiome, heterozygotes (GA) have a level of 3%, and homozygous for the minor allele (AA) has a level of 2% or 2.5 fold lower level compared to the GG genotype (Table 5). The difference in median levels of composition is even greater than the average values with GG dogs having a median of 4.1%, GA dogs 2.6%, and AA dogs with only 0.1% (FIG. 5).Table 4 Model SNP Location p Value Affx- chr19:2208366 Table 4 nificant SNP using both anTable 5 Mean % of Median % of Genotype Composition Composition Table 5. The m e 922 dog cohort with the genotype GG (hd AA, homozygous for the minor allele at SNP Affx-205540987.

[0073] SNP Affx-205540987 is approximately 250 kilobases upstream of the heparan sulphate 6-O-sluphotranspherase 1 gene (HS6ST1). This gene has previously been associated with the gut microbiome composition of humans.6A variant in this gene is associated with a reduction in the level of a Lactobacillales, another lactic acid producing species. HS6ST1 plays a role in the biosynthesis of heparan sulphate, a glycosaminoglycan (GAG), which is an important carbohydrate source for a number of bacteria. This suggests that a variation in heparan sulphate metabolism can either directly or indirectly impact the level of C. intestinalis present in the dog’s gut. Overall, it was proposed that dogs with one or two copies of the A allele at SNP Affx- 205540987 are at a higher risk of developing IBD throughout their lifetime due to the likelihood that they have reduced levels of the protective commensal bacterium Collinsella intestinalis. Feeding Studies

[0074] The test diets were formulated based on Science Diet Canine Adult with inclusion of quinoa at different titers, 2.5 wt.%, 5 wt.%, 10 wt.% and 20 wt.% by reducing the levels of other grains in the control diet accordingly (Table 6A). However, the values of nutrient contents (macronutrients and amino acids levels) were corrected and equivalent with control diet (ScienceDiet Canine Adult). See FIGS. 7A and 7B and Tables 6A and 6B. Control diet values are: 15.3 wt.% fat crude, 1.7 wt.% fiber crude, 6.7 wt.% moisture, 23.5 wt.% protein crude, 4.5 wt.% ash, and 48.13 wt.% carbohydrate. A comparison of the Control diet and the Test diet with 2.5% quinoa is provided in Table 6C. Table 6ATable 6B Control Test diet Test diet Test diet Test diet diet Quinoa Quinoa 5 Quinoa QuinoaTable 6C

[0075] An Ad Hoc feeding study was performed on a total of 100 healthy dogs with age ranges from 2 years to 14 years. Body weight ranged from 7.74 to 22.95 kg. All animals were mixed gender and included neutered, spayed and intact animals. This study design comprised a selectionof five diets which included four test diets and one control diet. This feeding study was performed by the following parallel experiment design. All 100 dogs were pre-feed with a control diet for 14 days and divided into five groups (each group had 20 dogs) by matching age and gender parameters. Further, each group was fed with four test diets (the test diets included quinoa at 2.5 wt.%, 5 wt.%, 10 wt.% and 20 wt.%) for another 14 days without a washout period. Similarly, the last group was fed with a control diet for another 14 days to measure the effect of the control diet over the study period as well as to check the feeding time effect. Fecal samples were collected at the end of the pre-feeding period (14thday) and at the end of the treatment period (28thday).

[0076] The test diets (inclusion of quinoa at different titers) showed prebiotic effect by consistently inducing the abundance of beneficial bacteria Collinsella (FIGS.6 A, 6B, 6C, 6D) but not the control diet fed in the pre-feed and treatment phase (FIG.6E). The differences in the levels of beneficial bacteria Collinsella were significant (p < 0.05) between the control diet and test diet (quinoa at different titers) but not significant between the control diet fed in the pre-feed and treatment phase. Further, the Collinsella abundance was compared between the treatments (quinoa at 2.5% wt., 5% wt., 10 wt.% and 20 wt.%) and this showed no significant differences. These data suggest that quinoa at higher titers (5, 10 & 20%) shows no enhanced prebiotic effect compared with the lower titer 2.5 wt.%. Together, this data suggests that quinoa at 2.5 wt.% in the diet has a significant prebiotic effect by increasing the levels of beneficial bacteria Collinsella. REFERENCES

[0077] References cited, both below or anywhere herein, are incorporated herein by reference as if fully set forth.1"Emendation of genus Collinsella and proposal of ... - PubMed." https: / / pubmed.ncbi.nlm.nih.gov / 11034485 / . Accessed 10 Sep. 2021.2"Bioremediation of a Common Product of Food Processing by a ...." 1 Oct. 2019, https: / / www.cell.com / cell-host-microbe / pdfExtended / S1931-3128(19)30468-8. Accessed 10 Sep. 2021.3"Role of the advanced glycation end products receptor in Crohn's ...." https: / / www.ncbi.nlm.nih.gov / pmc / articles / PMC3857450 / . Accessed 10 Sep. 2021.4"Genome-wide associations of human gut microbiome variation and ...." 22 Jun. 2020, https: / / www.nature.com / articles / s41564-020-0743-8?proof=t. Accessed 8 Sep. 2021.5"The interplay between host genetics and the gut microbiome reveals ...." 8 Oct. 2020, https: / / microbiomejournal.biomedcentral.com / articles / 10.1186 / s40168-020-00923-9. Accessed 8 Sep. 2021.6"Genome-wide association analysis identifies variation in ... - PubMed." https: / / pubmed.ncbi.nlm.nih.gov / 27723756 / . Accessed 10 Sep. 2021.with respect to specific examples including presently preferred modes of carrying out the invention, those skilled in the art will appreciate that there are numerous variations and permutations of the above-described method and system. It is to be understood that other embodiments may be utilized and structural and functional modifications may be made without departing from the scope of the present invention. Thus, the spirit and scope of the invention should be construed broadly as set forth in the appended claims.

Claims

CLAIMS What Is Claimed Is:

1. A method of treating or preventing inflammatory bowel disease in a canine comprising identifying susceptibility to inflammatory bowel disease in a canine subject comprising: determining an allele identity in a canine subject for an SNP at canine chromosome 19, position 19:22083678, which corresponds to position 51 in CACACATTTCCTTAAACTCAGATTTATTCATGTGAGTCCCAGTATTGGAT[G / A]GCTCA GTGATTCTCCTGAACAATACCAGACCACACAATTAACAGTTAAAT (SEQ ID NO: 1), wherein an A at position 51 indicates susceptibility to inflammatory bowel disease; and feeding the canine subject a quinoa supplemented diet when position 51 is identified as an A.

2. The method of claim 1, wherein the feeding the canine subject a quinoa supplemented diet comprises feeding the canine subject a feed comprising at least about 2.5 wt.% quinoa.

3. The method of claim 1 or 2, wherein the determining comprises identifying a genotype for the canine subject at the SNP, and wherein a determination of homozygous GG indicates lower susceptibility to inflammatory bowel disease for the canine subject relative to susceptibility for heterozygous GA or homozygous AA canines; a determination of heterozygous GA indicates an intermediate susceptibility to inflammatory bowel disease for the canine subject between susceptibility for homozygous GG and homozygous AA canines; and a determination of homozygous AA indicates increased susceptibility to inflammatory bowel disease for the canine subject, above the susceptibility for homozygous GG and heterozygous GA canines.

4. The method of any one of claims 1–3, wherein the determining step comprises obtaining a sample from the canine subject.

5. The method of claim 4, wherein obtaining a sample comprises obtaining a buccal sample, a blood sample, or a tissue sample.

6. The method of claim 5, further comprising extracting the buccal sample, the blood sample, or the tissue sample to obtain a nucleic acid sample.

7. The method of claim any one of claims 4–6, wherein the determining step comprises performing a polymerase chain reaction on the sample or nucleic acid sample utilizing primers capable of amplifying a nucleic acid sequence including canine chromosome 19, position 19:22083678 to produce an amplified DNA.

8. The method of claim 7, wherein the determining step further comprises sequencing the amplified DNA.

9. The method of any of claims 1–6, wherein the determining step comprises sequencing a region of the canine subject DNA, or an RNA copy thereof, comprising position 19:22083678.

10. A method of treating or preventing inflammatory bowel disease in a canine comprising identifying susceptibility to inflammatory bowel disease in a canine subject comprising: identifying a test abundance of Collinsellia intestinalis commensal to the canine relative to a control abundance of Collinsellia intestinalis commensal to a canine lacking inflammatory bowel disease, wherein the canine subject is identified as susceptible to inflammatory bowel disease when the test abundance less than the control abundance; and feeding the canine subject a quinoa supplemented diet when the test abundance less than the control abundance.

11. The method of claim 10, wherein the feeding the canine subject a quinoa supplemented diet comprises feeding the canine subject a feed comprising at least about 2.5 wt.% quinoa.

12. The method of claim 10 or 11 comprising repeating the identifying step periodically.

13. The method of claim 12 comprising ceasing the step of feeding the canine subject a quinoa supplemented diet if the test abundance is equal to or greater than the control abundance.

14. The method of any one of claims 10–13, wherein the control abundance is obtained from a table of Collinsellia intestinalis abundance.

15. The method of any one of claims 10–14, wherein the control abundance is obtained for a canine of the same species as the canine subject.

16. The method of any one of claims 10–15, wherein the test abundance is determined by culturing and / or dilution plating bacterial samples from fecal samples from the canine subject.

17. The method of claim 16, wherein the control abundance is determined by culturing and / or dilution plating a fecal sample from a canine lacking inflammatory bowel disease.

18. The method of any one of claims 10–15, wherein the test abundance is determined by short read shotgun sequencing of DNA in a fecal sample from the canine subject to obtain reads matching Collinsellia intestinalis and a total number of identifiable reads, and the test abundance is the percentage of reads matching Collinsellia intestinalis relative to the total number of identifiable reads.

19. The method of any one of claims 10–18 further comprising determining a genotype of the canine subject for an SNP at canine chromosome 19 at position 19:22083678 as listed in SEQ ID NO:

1.

20. The method of claim 19, wherein a determination of homozygous GG indicates lower susceptibility to inflammatory bowel disease for the canine subject relative to susceptibility for heterozygous GA or homozygous AA canines; a determination of heterozygous GA indicates an intermediate susceptibility to inflammatory bowel disease for the canine subject between susceptibility for homozygous GG and homozygous AA canines; and a determination of homozygous AA indicates increased susceptibility to inflammatory bowel disease for the canine subject, above the susceptibility for homozygous GG heterozygous GA canines.

21. The method of any of claims 10–20, wherein the test abundance less than the control abundance is at least about five-fold less than the control abundance.

22. A method of identifying susceptibility to inflammatory bowel disease in a canine subject comprising determining an allele identity of the canine subject for an SNP at canine chromosome 19, position 19:22083678, which corresponds to position 51 in CACACATTTCCTTAAACTCAGATTTATTCATGTGAGTCCCAGTATTGGAT[G / A]GCTCA GTGATTCTCCTGAACAATACCAGACCACACAATTAACAGTTAAAT (SEQ ID NO: 1), wherein an A at position 51 indicates susceptibility to inflammatory bowel disease.

23. The method of claim 22, wherein the determining comprises identifying a genotype for the canine subject at the SNP, and wherein a determination of homozygous GG indicates lower susceptibility to inflammatory bowel disease for the canine subject relative to susceptibility for heterozygous GA or homozygous AA canines; a determination of heterozygous GA indicates an intermediate susceptibility to inflammatory bowel disease for the canine subject between susceptibility for homozygous GG and homozygous AA canines; and a determination of homozygous AA indicates increased susceptibility to inflammatory bowel disease for the canine subject, above the susceptibility for homozygous GG and heterozygous GA canines.

24. The method of claim 22 or 23, wherein the determining step comprises obtaining a sample from the canine subject.

25. The method of claim 24, wherein obtaining a sample comprises obtaining a buccal sample.

26. The method of claim 25, wherein the step of obtaining a buccal sample comprises placing a collecting sponge between the canine subject cheek and gum.

27. The method of claim 26, wherein the step of obtaining a buccal sample further comprises placing cells obtained from the collecting sponge in a stabilizing lysis solution.

28. The method of claim 24, wherein the step of obtaining a sample comprises collecting a blood sample from the canine subject.

29. The method of claim 24, wherein the step of obtaining a sample comprises collecting a tissue sample from the canine subject.

30. The method of any one of claims 24–29 further comprising extracting the sample to obtain a nucleic acid sample.

31. The method of claim 30, wherein the nucleic acid is an RNA.

32. The method of claim 31 further comprising synthesizing DNA from the RNA via catalysis with a reverse transcriptase.

33. The method of claim 30, wherein the nucleic acid is a DNA.

34. The method of any one of claims 24–33 further comprising performing a polymerase chain reaction utilizing primers capable of amplifying a nucleic acid sequence including canine chromosome 19, position 19:22083678 to produce an amplified DNA.

35. The method of claim 34 further comprising sequencing the amplified DNA.

36. The method of any one of claims 22–33, wherein the determining step further comprises sequencing a region of the canine subject DNA, or an RNA copy thereof, comprising position 19:22083678.

37. A method of identifying susceptibility to inflammatory bowel disease in a canine subject comprising identifying a test abundance of Collinsellia intestinalis commensal to the canine relative to a control abundance of Collinsellia intestinalis commensal to a canine lacking inflammatory bowel disease, wherein the canine subject is identified as susceptible to inflammatory bowel disease when the test abundance less than the control abundance.

38. The method of claim 37, wherein the control abundance is obtained from a table of Collinsellia intestinalis abundance.

39. The method of claim 37 or 38, wherein the control abundance is obtained for a canine of the same species as the canine subject.

40. The method of any one of claims 37–39, wherein the test abundance is determined by culturing and / or dilution plating bacterial samples from fecal samples from the canine subject.

41. The method of claim 40, wherein the control abundance is determined by culturing and / or dilution plating a fecal sample from a canine lacking inflammatory bowel disease.

42. The method of any one of claims 37–39, wherein the test abundance is determined by short read shotgun sequencing of DNA in a fecal sample from the canine subject to obtain reads matching Collinsellia intestinalis and a total number of identifiable reads, and the test abundance is the percentage of reads matching Collinsellia intestinalis relative to the total number of identifiable reads.

43. The method of claim any one of claims 37–42 further comprising determining a genotype of the canine subject for an SNP at canine chromosome 19 at position 19:22083678 as listed in SEQ ID NO:

1.

44. The method of claim 43, wherein a determination of homozygous GG indicates lower susceptibility to inflammatory bowel disease for the canine subject relative to susceptibility for heterozygous GA or homozygous AA canines; a determination of heterozygous GA indicates an intermediate susceptibility to inflammatory bowel disease for the canine subject between susceptibility for homozygous GG and homozygous AA canines; and a determination of homozygous AA indicates increased susceptibility to inflammatory bowel disease for the canine subject, above the susceptibility for homozygous GG and heterozygous GA canines.

45. The method of any one of claims 37–44, wherein the test abundance is less than the control abundance is at least about five-fold less than the control abundance.

46. A composition comprising a canine feed and quinoa in an amount effective to increase a Collinsellia intestinalis population in a canine subject when the canine subject consumes the composition.

47. The composition of claim 46, wherein the quinoa is at an amount of at least about 2.5 wt.%.

48. A method for making a pet food composition, comprising the following steps: (a) preconditioning by mixing wet and dry ingredients at elevated temperature to form a dough; (b) extruding the dough at a high temperature, and pressure to form an extruded kibble; (c) drying the extruded kibble; and (d) enrobing the dried kibble with topical liquid and / or dry ingredients; wherein quinoa is applied to the kibble at step (a) and / or (d), in an amount effective to increase a Collinsellia intestinalis population in a canine subject when the canine subject consumes the composition.

49. The method of claim 48, wherein the quinoa is applied at step (a) as a dry ingredient.

50. The method of claim 48 or 49, wherein the quinoa is applied at an amount sufficient to result in a final quinoa amount of at least 2.5 wt.% in the composition.

Images