Non-coding srna in corynebacterium glutamicum and use thereof

Abstract

A non-coding sRNA in Corynebacterium glutamicum and the use thereof. The non-coding sRNA has an RNA sequence having at least 90% or more sequence homology to a transcription product of the DNA sequence as shown in SEQ ID NO: 1. It is verified by means of experiments that the over-expression of the non-coding sRNA in a recombinant bacterium can significantly improve the yield of branched-chain amino acids, such as L-leucine, L-isoleucine and L-histidine, and the sugar-acid conversion rate, and also reduce the generation of by-product acid impurities. In terms of materials, relatively inexpensive molasses is selected, which provides rich carbon and nitrogen sources, to replace corn syrup which has more impurities. Moreover, the molasses is converted by means of enzymolysis into a nutrient substance containing more carbon and nitrogen sources that can be utilized by the strain. In addition, in order to control the carbon-to-nitrogen source ratio in a fermentation broth, a more accurate feeding process is selected, which can not only ensure the fermentation requirements of the strain, but can also effectively prevent excessively high or low nitrogen source levels in the fermentation broth, thereby achieving the aims of increasing the yield and the sugar-acid conversion rate, and reducing the by-product acid impurities.

Description

Non-coding sRNA in Corynebacterium glutamicum and its application Cross-references This application claims priority to Chinese application No. 202410335441.0, filed on March 22, 2024, the entire contents of which are incorporated herein by reference. Technical Field This specification relates to the field of genetic engineering technology, and in particular to a non-coding sRNA in Corynebacterium glutamicum and its application. Background Art Branched-chain amino acids have multiple physiological functions and are widely used in industries such as food, animal feed, cosmetics, and medicine. In the early days, they were mainly produced by chemical synthesis. However, due to the low yield and large environmental pollution of chemical synthesis, they were gradually eliminated. Subsequently, microbial fermentation has received widespread attention. At present, the strains used for branched-chain amino acid production mainly include Brevibacterium flavum, Escherichia coli, and Corynebacterium glutamicum. The biosynthetic pathway of branched-chain amino acids is long and has a complex and precise self-regulatory mechanism. The biosynthetic pathway of amino acids in natural strains is subject to strict metabolic control to ensure that amino acids are produced only for the inherent needs of the cell. Therefore, the production of branched-chain amino acids by strain modification has attracted more and more attention. With technological advancements, metabolic modification has gradually become the main way to obtain high-yield amino acid strains, but the industrial stability of strains that have undergone a large number of metabolic modifications is not ideal. Although metabolic engineering can increase amino acid production to a certain extent, as primary metabolites, on the one hand, the weakening of the synthesis pathway of byproducts and the metabolic burden brought by the increase in synthesis modules have a weakening effect on strain growth. On the other hand, key enzymes in the synthesis pathway are often subject to feedback inhibition by intermediate metabolites and end products. The balance between ensuring sufficient precursors and easing feedback inhibition cannot be stably achieved in industrial production. In short, the lack of in-depth understanding and application of the fine-tuning mechanisms of microbial regulation has led to limitations in optimizing strain performance, enhancing stability, and further improving the yield of target products. Bacterial small non-coding RNA (sRNA) is a type of RNA regulator discovered in bacteria and other prokaryotes in recent years. They do not encode proteins, are between 50 and 500 nucleotides in length, and are widely involved in the regulation of various life activities in the body. Bacterial sRNA is an important regulatory factor in bacterial metabolism, virulence, and adaptation to environmental pressures, and plays an important role in regulating gene expression in response to environmental changes. However, the mechanism of action of non-coding sRNA in regulating amino acid biosynthesis pathways is still unclear, and there is a lack of targeted design and technology for efficient and precise regulation of sRNA. Therefore, it is necessary to provide a non-coding sRNA in Corynebacterium glutamicum and its application to efficiently, low-cost, and continuously separate and purify branched-chain amino acids for fermentation, improve product purity, reduce impurity content, and achieve recycling of key raw materials. Summary of the Invention One or more embodiments of the present specification provide a non-coding sRNA in Corynebacterium glutamicum, wherein the RNA sequence of the non-coding sRNA has at least 90% sequence homology with the transcription product of the DNA sequence shown in SEQ ID NO.1. In some embodiments, the DNA sequence encoding the non-coding sRNA is shown as SEQ ID NO.1. One or more embodiments of this specification provide a vector containing the DNA sequence of the non-coding sRNA according to claim 2. One or more embodiments of this specification provide a recombinant bacterium expressing the DNA sequence of the non-coding sRNA as described in any one of the above embodiments, wherein the recombinant bacterium is selected from Corynebacterium glutamicum. In some embodiments, the Corynebacterium glutamicum is selected from one of Corynebacterium glutamicum IBBH-15, Corynebacterium glutamicum IBCL-1, Corynebacterium glutamicum IBCVQ, Corynebacterium glutamicum CICC21756, and Corynebacterium glutamicum ATCC13002, or any combination thereof. One or more embodiments of this specification provide a method for constructing a recombinant bacterium, the method comprising: transferring a recombinant vector containing a target DNA fragment into a host strain to obtain a recombinant strain, wherein the target DNA fragment has at least 90% sequence homology with the DNA sequence shown in SEQ ID NO.1. In some embodiments, the DNA sequence of the target DNA fragment is shown as SEQ ID NO.1. One or more embodiments of the present specification provide a fermentation method of recombinant bacteria, the method comprising: inoculating at least one recombinant strain into a seed culture medium for culturing to obtain a seed liquid; inoculating the seed liquid into a fermentation culture medium for fermentation culture; during the fermentation culture, increasing the production of branched-chain amino acids by regulating at least one of the amount of inducer added, dissolved oxygen level, pH and nutrient supply. In some embodiments, the at least one recombinant bacterium comprises a DNA sequence of a non-coding sRNA, and the DNA sequence has at least 90% sequence homology with the DNA sequence shown in SEQ ID NO.1. In some embodiments, the recombinant bacteria are L-leucine-producing bacteria, and the L-leucine-producing bacteria include at least one of the Corynebacterium glutamicum mutant strains IBBH-15, IBCLQ-257, and IBCLQ-257e. In some embodiments, the method further includes: controlling the dissolved oxygen level to 10-20% during the first 22-26 hours of fermentation culture, and controlling the dissolved oxygen level to 5-15% after 22-26 hours of fermentation culture; and controlling the initial pH value to 6.65-6.75, increasing the pH to 6.85-6.95 after the bacterial OD562 grows to 19-21, increasing the pH to 6.95-7.05 after the bacterial OD562 grows to 24-26, and increasing the pH to 7.15-7.25 after the bacterial OD562 grows to 35-37, and controlling the residual sugar concentration to 20-30 g / L during the fermentation process. In some embodiments, the seed culture medium includes glucose with an initial concentration of 2.5-3.5wt% and molasses hydrolyzate with an initial concentration of 1-2wt%, and the fermentation medium includes glucose with an initial concentration of 3.5-4.5wt% and molasses hydrolyzate with a concentration of 0.5-1.1wt%, and the molasses hydrolyzate is selected from at least one of beet molasses hydrolyzate and sucrose molasses hydrolyzate. In some embodiments, the dissolved oxygen level in the fermentation culture is 5-10%; the method further includes: in the fermentation culture stage, after the bacterial OD562 grows to 19-21, the pH is increased to 6.85-6.95, and when the residual sugar drops to 1.5-2.5wt%, starting to supplement with a glucose solution with a concentration of 40-50wt% and a molasses hydrolyzate with a concentration of 40-50wt%, controlling the flow rate ratio of the glucose solution to the molasses hydrolyzate to be 5:1-10:1, and the proportion of the molasses hydrolyzate to the fermentation medium is 2.5-3.5wt%; and, after the bacterial OD562 grows to 29-31, the pH is increased to 7.05-7.15, and after the bacterial OD562 grows to 39-41, the pH is increased to 7.15-7.25, and controlling the residual sugar concentration to be 1.5-2.5wt% during the fermentation process. In some embodiments, the recombinant bacteria is an L-isoleucine-producing bacteria, and the L-isoleucine-producing bacteria includes at least one of the mutant strains of Corynebacterium glutamicum IBCIL-253, IBCL-1 and IBCIL-253k. In some embodiments, the method further comprises: when the residual sugar is lower than 0.8-1.2 wt%, feeding sugar solution to control the residual sugar in the fermentation broth to 0.8-1.2 wt%, while continuing to feed inorganic salt solution to control the osmotic pressure of the fermentation broth to 890-910 mosm / L. In some embodiments, the seed culture medium includes glucose with an initial concentration of 4.5-5.5wt% and molasses hydrolyzate with an initial concentration of 2.5-3.5wt%, the fermentation medium includes glucose with an initial concentration of 9.5-10.5wt% and molasses hydrolyzate with a concentration of 1.5-2.5wt%, and the molasses hydrolyzate is selected from at least one of beet molasses hydrolyzate and sucrose molasses hydrolyzate. In some embodiments, the dissolved oxygen level in the fermentation culture is 8-12%; the method further comprises: during the fermentation culture stage, after the bacterial OD562 grows to 39-41, raising the pH to 6.85-6.95; when the residual sugar drops to 5.5-6.5wt%, starting to feed an inorganic salt feed solution, controlling the osmotic pressure of the fermentation liquid at 690-710mosm / L; and when the residual sugar drops to 1.5-2.5wt%, starting to feed supplements A and B, wherein the A solution comprises a concentration of The method comprises a 40-50wt% glucose solution, a 0.1wt% potassium dihydrogen phosphate solution, and a 0.05wt% magnesium sulfate solution. Liquid B comprises a 40-50wt% molasses hydrolyzate. The flow rate ratio of the liquid A to the liquid B is controlled to be 4:1-7:1. The proportion of the molasses hydrolyzate to the fermentation medium is 3.5-4.5wt%. At the same time, an inorganic salt feed solution is continuously added to control the osmotic pressure of the fermentation liquid to be 890-910mosm / L. One or more embodiments of the present specification provide a method for separating and purifying a fermentation product, the method comprising: redissolving the fermentation product based on p-toluenesulfonic acid, wherein the molar ratio of the fermentation product to the p-toluenesulfonic acid is 1:1-1:2; reconstructing the hydrogen bond network of the redissolved fermentation product based on 0.5-1.5M inorganic acid; decolorizing the fermentation product after cooling and crystallization for 30-50 minutes based on 1-2% malic acid, 0.1-0.2% tartaric acid, and 0.5-1.5‰ activated carbon; and subjecting the decolorized fermentation product to ion exchange resin and evaporative crystallization to obtain a purified fermentation product. In some embodiments, after passing through the ion exchange resin and before evaporative crystallization, the method further comprises: The p-toluenesulfonic acid was recovered by elution with 0.3-0.8 M hydrochloric acid and the resin was regenerated with 2.5-3.5 M hydrochloric acid. In some embodiments, after the hydrogen bond network is reconstructed and before decolorization, the method further comprises: cooling the fermented product after the hydrogen bond network is reconstructed to 9-11°C at a cooling rate of 8-12°C / h, and incubating the product for 0.5-1.5h. In some embodiments, before re-dissolving, the method further comprises: performing complex precipitation on the fermentation broth containing the fermentation product based on the composition of the polypeptide and the metal ion to precipitate the fermentation product. In some embodiments, the fermentation product is a Corynebacterium glutamicum fermentation product. In some embodiments, the Corynebacterium glutamicum comprises the DNA sequence shown in SEQ ID NO.1. Compared with other non-coding sRNA regulation methods, the non-coding sRNA obtained in this invention does not require the expression of additional RNA chaperone proteins. The overexpression strain IBCLQ-257 achieved L-leucine production of 60.2 g / L, an increase of approximately 20.5% compared to the original strain, and the sugar-to-acid conversion rate increased by 14.2%. After overexpressing the beneficial non-coding sRNA, total miscellaneous acids decreased by 62.8%. The L-isoleucine production of the strain overexpressing IBCIL-253 reached 66.4 g / L, an increase of 7.62% compared with the original strain, the sugar-acid conversion rate increased by 5.23%, and the total miscellaneous acids decreased by 51.7%. The L-valine production of strain IBCVQ-256 reached 106.87±5.80 g / L, an increase of about 23.8% compared with the original strain, and the sugar-acid conversion rate increased by 17.9%; the production of secondary acids decreased by about 3.54 g / L, and the total miscellaneous acids decreased by 40.8%. This shows that suitable non-coding sRNA can indeed effectively increase the fermentation concentration of branched-chain amino acids while reducing the content of miscellaneous acids. The present invention not only broadens the strategy of microbial metabolic engineering transformation by designing and introducing novel non-coding sRNA regulatory elements, but also provides a new technical means for efficiently and sustainably improving the fermentation production level of branched-chain amino acid products. The present invention not only broadens the strategy of microbial metabolic engineering transformation by designing and introducing non-coding sRNA regulatory elements, but also provides a new technical means for efficiently and sustainably improving the fermentation production level of branched-chain amino acid products. BRIEF DESCRIPTION OF THE DRAWINGS This specification will be further described in the form of exemplary embodiments, which will be described in detail with reference to the accompanying drawings. These embodiments are not limiting, and in these embodiments, like numbers represent like structures, wherein: FIG1 shows the accumulation of amino acid production by overexpressing different non-coding sRNAs in Corynebacterium glutamicum according to some embodiments of the present specification. DETAILED DESCRIPTION To more clearly illustrate the technical solutions of the embodiments of this specification, the following briefly describes the drawings required for describing the embodiments. Obviously, the drawings described below are merely examples or embodiments of this specification. Those skilled in the art can apply this specification to other similar scenarios based on these drawings without inventive effort. Unless otherwise apparent from the context or otherwise noted, the same reference numerals in the figures represent the same structure or operation. As used in this specification and claims, unless the context clearly indicates otherwise, the words "a," "an," "an," and / or "the" do not refer to the singular but also include the plural. Generally speaking, the terms "comprises" and "include" only indicate the inclusion of the steps and elements specifically identified, and these steps and elements do not constitute an exclusive list. A method or apparatus may also include other steps or elements. Branched-chain amino acids (BCAAs, including leucine, isoleucine, and valine), as important ingredients in sports nutrition and health, have developed rapidly in recent years, and their application scenarios have continued to expand, but their market and technology also face some challenges. With the continuous expansion of the global market, the global BCAAs market size will exceed US$1 billion in 2023, with a compound annual growth rate (CAGR) of approximately 8%-10%, mainly driven by sports nutrition, health foods, and medical applications. As anti-fatigue and recovery-promoting supplements, BCAAs are widely used by fitness enthusiasts and athletes, especially in strength training and endurance sports. In addition, studies have shown the potential of BCAAs in improving insulin resistance (diabetes) and as an auxiliary treatment for liver disease. BCAAs beverages, functional snacks and other products are gradually being recognized by the general public and used in daily exercise. Currently, the fermentation production strains of BCAAs are mainly Corynebacterium glutamicum, Brevibacterium flavum and engineered Escherichia coli. Traditional strains have low acid production, high impurity acid production, and low efficiency, and are gradually being replaced by metabolically engineered strains. With the continuous improvement of strains, the process also needs to be continuously optimized. However, most of the current invention directions in the BCAAs fermentation process are still mainly concentrated on the front end, mainly focusing on strain design, and less on the process. In addition, the matching degree between the materials and processes used in fermentation in related technologies is not perfect, which leads to the phenomenon that most excellent strains have low acid production due to the lack of matching processes. In light of this, some embodiments of this specification disclose the use of Corynebacterium glutamicum in L-leucine fermentation; the Corynebacterium glutamicum exhibits high L-leucine production and low levels of impurity acids. During the fermentation process, sugar and beet molasses are added to the feed stream according to the bacterial cell concentration (OD562) and the fermentation cycle. By controlling the ratio of sugar and beet molasses, as well as residual sugar, L-leucine fermentation is achieved, resulting in high L-leucine production and sugar-to-acid conversion, while reducing impurity acids. Through process optimization, the advantages of the improved strain are amplified, thereby obtaining a process with high yield, high sugar-acid conversion rate, and low miscellaneous acid. In some embodiments of this specification, relatively cheap molasses is selected as the material, which has a rich carbon and nitrogen source, and corn pulp with more impurities is discarded. The molasses is converted into a nutrient containing more carbon and nitrogen sources that can be utilized by the strain through enzymatic hydrolysis. In addition, in order to control the carbon and nitrogen source ratio in the fermentation liquid, a more precise feeding process is selected, which can not only ensure the fermentation needs of the strain, but also effectively avoid excessive or low nitrogen sources in the fermentation liquid, thereby achieving the purpose of increasing yield, sugar-acid conversion rate, and reducing miscellaneous acid by-products. One of the embodiments of the present specification provides a non-coding sRNA in Corynebacterium glutamicum, wherein the RNA sequence of the non-coding sRNA in Corynebacterium glutamicum has at least 90% sequence homology with the transcription product of the DNA sequence shown in SEQ ID NO.1. Corynebacterium glutamicum (Corynebacterium glutamicum) is initially the Gram-positive bacteria isolated from soil, is widely used in amino acid whose industrialized production because of its characteristic of high-yield glutamic acid.Corynebacterium glutamicum makes it have important value in the fields such as food, medicine, feed additives due to its stable metabolic regulation characteristic, for example, for the preparation of nutritional supplements or pharmaceutical raw materials etc.Illustratively, Corynebacterium glutamicum can be used for amino acid production, for example, by metabolic engineering, Corynebacterium glutamicum is optimized for efficient production of branched-chain amino acids (such as L-leucine, L-isoleucine, L-valine). In some embodiments, the application of the non-coding sRNA in Corynebacterium glutamicum includes application in improving amino acid production efficiency, optimizing amino acid composition ratio, and reducing by-products. In some embodiments, applications of the non-coding sRNA in Corynebacterium glutamicum include applications in the fields of food industry, medicine, daily chemicals, or feed additives. In some embodiments, the application of the non-coding sRNA in Corynebacterium glutamicum includes application in the preparation of an amino acid supplement for enhancing human nutrient absorption and promoting muscle growth, wherein the amino acid is selected from one of L-leucine, L-isoleucine, and L-valine. In some embodiments, the RNA sequence of the non-coding sRNA in Corynebacterium glutamicum has at least 95% or greater sequence homology to the transcription product of the DNA sequence shown in SEQ ID NO. 1. In some embodiments, the RNA sequence of the non-coding sRNA in Corynebacterium glutamicum has at least 98% or greater sequence homology to the transcription product of the DNA sequence shown in SEQ ID NO. 1. In one aspect of the embodiments of this specification, the DNA sequence encoding the non-coding sRNA is shown as SEQ ID NO.1. One of the embodiments of this specification provides a vector containing a DNA sequence encoding the non-coding sRNA provided in the above embodiments. A vector is a tool used in genetic engineering to carry exogenous DNA sequence fragments (such as target genes or regulatory sequences) into host cells. Vectors include functional elements such as replication origins, selectable markers (such as antibiotic resistance genes), and multiple cloning sites. Vectors can be DNA molecules such as plasmids and viruses that contain the DNA sequence encoding the non-coding sRNA. In some embodiments, the vector containing the DNA sequence encoding the non-coding sRNA comprises at least one of plasmid pXMJ19 and plasmid pXMJ. Plasmid pXMJ19, plasmid pXMJ, etc., can be used as vectors to regulate host metabolism by carrying the non-coding sRNA gene (SEQ ID NO. 1), thereby ultimately increasing branched-chain amino acid production. In some embodiments, the construction of the vector may include the following steps: Plasmid amplification: Use high-fidelity enzymes and primers (Plsmid-F / R) to amplify the backbone of pXMJ19; Target fragment mutation: Using SEQ ID NO. 2 as a template, random mutations were introduced by error-prone PCR (primers Errp-F / R) to generate the s25 fragment (SEQ ID NO. 1); Homologous recombination ligation: the pXMJ19 backbone and the mutated s25 fragment were purified and ligated to form the recombinant plasmid pXMJ19-s25; Transformation of host bacteria: The recombinant plasmid is transferred into Corynebacterium glutamicum (such as ATCC13002), and the recombinant strain (such as Cg-pXMJ19-s25) is obtained by screening. One embodiment of this specification provides a recombinant bacterium expressing the DNA sequence of the non-coding sRNA described in the previous embodiment. The recombinant bacterium is selected from Corynebacterium glutamicum. In some embodiments, the Corynebacterium glutamicum is selected from one of Corynebacterium glutamicum IBBH-15, Corynebacterium glutamicum IBCL-1, Corynebacterium glutamicum IBCVQ, Corynebacterium glutamicum CICC21756, and Corynebacterium glutamicum ATCC13002, or any combination thereof. [Corrected on 16.04.2025 according to Rule 26] Corynebacterium glutamicum IBBH-15 is a mutant strain of Corynebacterium glutamicum, deposited with the China General Culture Collection Center (CGMCC) in Beijing, China, with the deposit number CGMCC No.15720 and the deposit date of May 2, 2018. The depositor is the China General Culture Collection Center, and the address of the depositor is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, China 100101. [Corrected on 16.04.2025 according to Rule 26] Corynebacterium glutamicum IBCL-1 (IBCL-01) (Corynebacterium glutamicum), deposited in the China Center for Type Culture Collection (CCTCC), School of Life Sciences, Wuhan University, Wuhan, Hubei, China, with the deposit number CCTCC NO: M 2022764, deposited on May 30, 2022, with the depository being the China Center for Type Culture Collection, and the depository address being No. 299, Bayi Road, Luojiashan Street, Wuchang District, Wuhan, Hubei 430072. Corynebacterium glutamicum ATCC13002 is a model strain, and its competent cell products can be purchased from many biological reagent companies. Corynebacterium glutamicum IBCVQ can be obtained by performing the following genetic modification on the model strain Corynebacterium glutamicum ATCC13002 according to a conventional genetic modification scheme, namely: knocking out the ldh and brnQ genes on the model strain genome, replacing ilvE with NADH-dependent leucine dehydrogenase (LeuDH) from lysinibacillus sphaeroides; synthesizing the ilvN mutant ilvNM (G20E, I21E, I22F, G156E) and the ilvC mutant ilvCM (S34G, L48E and R49F), and expressing ilvBNMCM at the alaT site using the PgapA promoter; expressing the pfkA gene at the ppc site using the Ptac promoter; and expressing the pyk gene at the pta site using the Ptac promoter. Corynebacterium glutamicum CICC21756 is an industrial strain that can be obtained through traditional mutagenesis or metabolic engineering. One embodiment of this specification provides a method for constructing a recombinant bacterium, comprising: transferring a recombinant vector containing a target DNA fragment into a host strain to obtain a recombinant strain. For example, a recombinant vector containing a target DNA fragment can be transferred into a host strain to obtain a recombinant strain. The target DNA fragment has at least 90% sequence homology with the DNA sequence shown in SEQ ID NO.1. DNA Sequence In some embodiments, the target DNA fragment has at least 95% sequence homology with the DNA sequence shown in SEQ ID NO.1. In some embodiments, the target DNA fragment has at least 98% sequence homology with the DNA sequence shown in SEQ ID NO. 1. In some embodiments, the DNA sequence of the target DNA fragment is shown as SEQ ID NO.1. In some embodiments of the present specification, the recombinant bacteria expressing the non-coding sRNA DNA sequence can effectively increase the fermentation concentration of branched-chain amino acids while reducing the content of miscellaneous acids. One of the embodiments of this specification provides a fermentation method of recombinant bacteria, comprising: inoculating at least one recombinant strain into a seed culture medium for cultivation to obtain a seed liquid; inoculating the seed liquid into a fermentation culture medium for fermentation culture; during the fermentation culture, increasing the production of branched-chain amino acids by regulating at least one of the amount of inducer added, dissolved oxygen level, pH and nutrient supply. Recombinant bacteria are genetically modified strains that acquire new functions or enhance specific metabolic capabilities by introducing exogenous DNA (such as plasmids, gene fragments, or regulatory elements) into host microorganisms through genetic engineering techniques. Recombinant strains can carry selective markers (such as antibiotic resistance genes) and regulatory elements for expressing exogenous genes. Recombinant bacteria may include Escherichia coli, Corynebacterium glutamicum, and L-leucine-producing bacteria. In some embodiments, the at least one recombinant bacterium comprises a DNA sequence of the non-coding sRNA, and the DNA sequence has at least 90% sequence homology with the DNA sequence shown in SEQ ID NO.1. In some embodiments, the recombinant bacteria are L-leucine-producing bacteria, and the L-leucine-producing bacteria include at least one of the Corynebacterium glutamicum mutant strains IBBH-15, IBCLQ-257, and IBCLQ-257e. The acquisition method and preservation information of the Corynebacterium glutamicum mutant strain IBBH-15 can be found in the above description. The non-coding sRNA s25 described in the above example was expressed in the Corynebacterium glutamicum mutant strain IBBH-15 to obtain strain IBBH-pXMJ19-s257, designated as IBCLQ-257. The non-coding sRNA s25 in the above example was expressed using the Ptac promoter at the pta site of IBBH-15, and the resulting strain IBBH-s257e was designated as IBCLQ-257e. Seed liquid is the starting culture for microbial fermentation. By inoculating a small amount of bacterial strain into a seed culture medium, the bacteria are expanded to a high density and high activity, providing "seeds" for subsequent large-scale fermentation. In some embodiments, the recombinant strain IBBH-15 can be inoculated into a seed culture medium containing 3% glucose and 1.5% molasses hydrolyzate and cultured at 30°C until OD562 = 15 to obtain a seed liquid. An inducer is a chemical or physical signal used to activate the expression of a foreign gene in a host bacterium. Its mechanism of action is to release the repressed state of gene expression by binding to regulatory proteins (such as repressors in the promoter region). Inducers can include lactose, temperature, IPTG (isopropyl-β-D-thiogalactopyranoside), arabinose, and others. Nutrients are compounds required for microbial growth and product synthesis, including carbon sources, nitrogen sources, inorganic salts, and growth factors. They provide the cells with energy, structural materials, and elements necessary for metabolic regulation. Examples of nutrients include glucose, molasses hydrolyzate, ammonium sulfate, corn steep liquor, potassium dihydrogen phosphate, magnesium sulfate, biotin, vitamin B1, and other substances such as yeast extract, peptone, urea, sodium chloride, and nucleotides. The following examples provide specific methods for regulating one or more of the amount of feed added, dissolved oxygen level, pH, and nutrient supply during fermentation culture of recombinant bacteria. In some embodiments, the fermentation method of the recombinant bacteria provided in the above embodiments further includes: controlling the dissolved oxygen level to 10-20% in the first 22-26 hours of fermentation culture, and controlling the dissolved oxygen level to 5-15% after 22-26 hours of fermentation culture; and controlling the initial pH value to 6.65-6.75, and increasing the pH to 6.85-6.95 after the bacterial OD562 grows to 19-21, and increasing the pH to 6.95-7.05 after the bacterial OD562 grows to 24-26, and increasing the pH to 7.15-7.25 after the bacterial OD562 grows to 35-37, and controlling the residual sugar concentration to 20-30 g / L during the fermentation process. In some embodiments, the fermentation method of the recombinant bacteria provided in the above embodiments further includes: the seed culture medium includes glucose with an initial concentration of 2.5-3.5wt% and molasses hydrolyzate with an initial concentration of 1-2wt%, the fermentation medium includes glucose with an initial concentration of 3.5-4.5wt% and molasses hydrolyzate with a concentration of 0.5-1.1wt%, and the molasses hydrolyzate is selected from at least one of beet molasses hydrolyzate and sucrose molasses hydrolyzate. In some embodiments, the fermentation method of the recombinant bacteria provided in the above embodiments further includes: the dissolved oxygen level in the fermentation culture is 5-10%; in the fermentation culture stage, after the bacterial OD562 grows to 19-21, the pH is increased to 6.85-6.95, and when the residual sugar drops to 1.5-2.5wt%, a glucose solution with a concentration of 40-50wt% and a molasses hydrolyzate with a concentration of 40-50wt% are added, and the flow rate ratio of the glucose solution and the molasses hydrolyzate is controlled to be 5:1-10:1, and the proportion of the molasses hydrolyzate to the fermentation medium is 2.5-3.5wt%; and, after the bacterial OD562 grows to 29-31, the pH is increased to 7.05-7.15, and after the bacterial OD562 grows to 39-41, the pH is increased to 7.15-7.25, and the residual sugar concentration is controlled to be 1.5-2.5wt% during the fermentation process. Based on the same inventive concept, one of the embodiments of this specification also provides a fermentation method of a recombinant bacterium, wherein the recombinant bacterium is an L-isoleucine-producing bacterium, and the L-isoleucine-producing bacterium includes at least one of the mutant strains of Corynebacterium glutamicum IBCIL-253, IBCL-1 and IBCIL-253k. The non-coding sRNA s25 provided in the examples of this specification was expressed in L-isoleucine-producing bacteria (Corynebacterium glutamicum IBCL-1 (Corynebacterium glutamicum), deposited on May 30, 2022, with a deposit number of CCTCCNO: M 2022764) to obtain strain IBCL-pXMJ19-s253, designated as IBCIL-253. The non-coding sRNA s25 in the above example is expressed using the Ptac promoter at the pta site of IBCL-1 to obtain the strain IBCL-s253k, which is designated as IBCIL-253k. The fermentation method of the recombinant bacteria provided in this embodiment further includes: when the residual sugar is lower than 0.8-1.2wt%, by feeding a sugar solution to control the residual sugar in the fermentation liquid to 0.8-1.2wt%, and simultaneously continuing to feed an inorganic salt feed solution to control the osmotic pressure of the fermentation liquid to 890-910mosm / L. In some embodiments, the fermentation method of the recombinant bacteria provided in the above embodiments further includes: the seed culture medium includes glucose with an initial concentration of 4.5-5.5wt% and molasses hydrolyzate with an initial concentration of 2.5-3.5wt%, the fermentation medium includes glucose with an initial concentration of 9.5-10.5wt% and molasses hydrolyzate with a concentration of 1.5-2.5wt%, and the molasses hydrolyzate is selected from at least one of beet molasses hydrolyzate and sucrose molasses hydrolyzate. In some embodiments, the fermentation method of the recombinant bacteria provided in the above embodiments further comprises: the dissolved oxygen level in the fermentation culture is 8-12%; during the fermentation culture stage, after the bacterial OD562 grows to 39-41, the pH is raised to 6.85-6.95; when the residual sugar drops to 5.5-6.5wt%, the inorganic salt feed solution is started to be fed, and the osmotic pressure of the fermentation liquid is controlled at 690-710mosm / L; and when the residual sugar drops to 1.5-2.5wt%, the supplementary solution A and solution B are started to be fed, and the solution A is added. The A solution comprises a glucose solution with a concentration of 40-50wt%, a potassium dihydrogen phosphate solution with a concentration of 0.1wt%, and a magnesium sulfate solution with a concentration of 0.05wt%. The B solution comprises a molasses hydrolyzate with a concentration of 40-50wt%. The flow rate ratio of the A solution and the B solution is controlled to be 4:1-7:1. The proportion of the molasses hydrolyzate to the fermentation medium is 3.5-4.5wt%. At the same time, an inorganic salt feed solution is continuously added to control the osmotic pressure of the fermentation liquid to be 890-910mosm / L. According to some of the above embodiments, this specification not only broadens the strategy of microbial metabolic engineering modification by designing and introducing novel non-coding sRNA regulatory elements, but also provides a new technical means for efficiently and sustainably improving the fermentation production level of branched-chain amino acid products. Branched-chain amino acids (BCAAs) are important functional substances with wide application value in food, medicine, cosmetics and feed. Branched-chain amino acids include leucine, isoleucine and valine. Their industrial production has undergone a technological iteration from chemical synthesis to microbial fermentation. The early chemical synthesis method has been gradually replaced by microbial fermentation technology due to its low yield and serious pollution. The production of branched-chain amino acids by fermentation is an efficient and environmentally friendly industrial production method, but the fermentation broth contains a large amount of impurities, and a complex separation and purification process is required to obtain a high-purity product. However, existing separation and purification processes face the following challenges: 1. Difficulty separating impurities: Impurities with similar isoelectric points (such as L-α-aminobutyric acid and norvaline) are present in the fermentation broth. Traditional ion exchange methods suffer from poor selectivity, resulting in insufficient purity (<99%). 2. Cost and environmental pressures: Chromatographic equipment is expensive and has a low throughput; activated carbon decolorization requires large amounts of activated carbon, leading to high costs for waste acid treatment. 3. Poor process continuity: Existing technologies struggle to achieve continuous production, resulting in low efficiency. In view of this, one of the embodiments of this specification provides a method for separating and purifying a fermentation product, the separation and purification method comprising: redissolving the fermentation product based on p-toluenesulfonic acid, wherein the molar ratio of the fermentation product to the p-toluenesulfonic acid is 1:1-1:2; reconstructing the hydrogen bond network of the redissolved fermentation product based on 0.5-1.5M inorganic acid; decolorizing the fermentation product after cooling and crystallization for 30-50 minutes based on 1-2% malic acid, 0.1-0.2% tartaric acid, and 0.5-1.5‰ activated carbon; and obtaining a purified fermentation product by passing the decolorized fermentation product through ion exchange resin and evaporative crystallization. In some embodiments, the fermentation product is a fermentation product of Corynebacterium glutamicum. In some embodiments, the Corynebacterium glutamicum comprises a DNA sequence as shown in SEQ ID NO.1, and the separation and purification method comprises the following steps. Step S1, redissolving the fermentation product based on p-toluenesulfonic acid, wherein the molar ratio of the fermentation product to the p-toluenesulfonic acid is 1:1-1:2. In some embodiments, before re-dissolution, metal-MPN complex precipitation can be performed, comprising: performing complex precipitation on a fermentation broth containing a fermentation product based on a composition of a polypeptide and a metal ion to precipitate the fermentation product. The following are the specific steps for metal-MPN complex precipitation. (1) Preparation of MPN reagent: Polypeptide (such as polyglutamic acid) and Fe 3+ / Zn 2+ Self-assemble at a molar ratio of 1:2-3 at pH 4.0-5.0 to form a soluble metal-MPN network solution (concentration 5-10% w / v); (2) Complexation addition: Add MPN reagent (0.5-2.0% v / v) to the clear solution after ceramic membrane filtration and stir for 30-60 min. The target amino acids (leucine, isoleucine, valine) coordinate with the metal ions through the amino group to form an insoluble MPN-amino acid complex. Impurities are retained in the liquid phase due to charge repulsion. (3) Separation: Separate the precipitated complex by centrifugation (3000-5000 rpm, 10-20 min) or membrane filtration, and collect the precipitate for subsequent reconstitution. In some embodiments of this specification, by adding a soluble MPN reagent, dynamic coordination complexation is used to selectively precipitate the target amino acid, replacing traditional fixed-bed adsorption, which can simplify the equipment and adapt to high-impurity systems. Redissolution is the process of re-dissolving the precipitated complex with an acidic reagent (such as p-toluenesulfonic acid, hydrochloric acid, citric acid, etc.) to release the target product and form a stable salt. The steps of re-dissolution include: mixing the MPN-amino acid complex precipitate with p-toluenesulfonic acid in proportion, releasing the target amino acid through acid dissociation, and at the same time, the MPN skeleton is decomposed into polypeptides and metal ions (recoverable) under strong acid conditions. Mix the precipitate with p-toluenesulfonic acid at a ratio of 1:0.8-2.0 (molar ratio), adjust the solid content to 40%-60%, and fully dissolve at 50-60°C. p-Toluenesulfonic acid forms a stable salt with the amino group of the target amino acid through the sulfonic acid group, significantly improving the solubility and inhibiting the formation of mixed acid crystals. Step S2: reconstructing the hydrogen bond network of the re-dissolved fermentation product based on 0.5-1.5M inorganic acid. Hydrogen bond network reconstruction refers to the destruction of the original intermolecular hydrogen bonds by adjusting the solution pH and ionic strength, and the reorganization of the solubility state of the target product to create conditions for subsequent crystallization. During hydrogen bond network reconstruction, 0.5-2.0M hydrochloric acid is added in stages to adjust the system pH to 1.0-1.5. This fully protonates the amino acids and impurity amino acid molecules, disrupting the original hydrogen bond network. Chloride ions (Cl-) act as an ionic shield in the solution, weakening the electrostatic attraction between molecules and facilitating subsequent separation. In some embodiments, after the hydrogen bond network is reconstructed and before decolorization, the separation and purification method further comprises: cooling the fermentation product after the hydrogen bond network is reconstructed to 9-11°C at a cooling rate of 8-12°C / h, and incubating the product for 0.5-1.5h. Step S3, decolorizing the fermentation product after cooling and crystallization for 30-50 minutes based on 1-2% malic acid, 0.1-0.2% tartaric acid, and 0.5-1.5‰ activated carbon. Specifically, it includes gradient cooling crystallization and weak acid complexation combined with activated carbon adsorption operations. Gradient cooling crystallization: cool from 55°C to 10°C at a rate of 10-15°C / h, combined with crystal growth at 200 rpm for 0.5-1h to inhibit the formation of mixed crystals. After filtering and rinsing the crystal cake, redissolve it at a solid content of 40-50%. Weak acid complexation is coordinated with activated carbon adsorption. 1%-3% malic acid and 0.5%-1.5% tartaric acid are added to the complex solution to form a complex with metal ions, pigment molecules, and impurity amino acids. 0.5‰-1‰ activated carbon is added, decolorized for 30-40min at 50-55°C, and filtered to obtain a decolorized solution. In some embodiments of the present specification, composite acid precipitation synergy (toluenesulfonic acid salification+hydrochloric acid destruction of hydrogen bonds+organic acid complex impurities) is used, not only can the trace control of impurity amino acids be achieved, the single category impurity amino acids are controlled to less than 0.10%, 50% activated carbon usage can also be reduced, the cost of three wastes treatment in the later stage is reduced, and environmental protection treatment pressure is reduced. In addition, the composite acid system is adopted to cooperate with the method for gradient crystallization, the formation of mixed crystals can be further avoided, the purity of the target amino acid in the crystallization cake is improved, the residual of impurity amino acids is controlled, and yield can be improved simultaneously. Step S4, the decolorized fermentation product is subjected to ion exchange resin and evaporation crystallization to obtain a purified fermentation product. Ion exchange resin refers to the use of the charge characteristics of ion exchange resin to adsorb impurities or target products. Ion exchange resin includes ion exchange separation and recycling of p-toluenesulfonic acid: the decolorized liquid is passed through anion exchange resins YN201, YN269, and YN296 at 1-2BV / h to adsorb p-toluenesulfonic acid and other organic acid complexes. Monitor the p-toluenesulfonic acid content and stop feeding when the effluent content is greater than 100ppm. Rinse with water until the solid content is 0, and regenerate the resin column with a 1-3M hydrochloric acid gradient elution to achieve the recovery and reuse of p-toluenesulfonic acid. In some embodiments of the present specification, the recycling of p-toluenesulfonic acid is achieved after gradient elution with hydrochloric acid of different concentrations, further reducing the wastewater treatment cost and environmental pressure. Evaporation crystallization: The effluent is evaporated and crystallized, and high-purity amino acid crystal cakes are obtained after filtration. In certain embodiments, after passing through ion exchange resin, before evaporative crystallization, the separation and purification method also includes: based on 0.3-0.8M hydrochloric acid elution to reclaim p-toluenesulfonic acid, based on 2.5-3.5M hydrochloric acid regeneration resin, it is possible to reduce costs and environmental burden. The separation and purification method of the fermented product described in the present specification embodiment, under the premise of not changing equipment, resin, and processing mode, can be applicable to the separation and purification of three kinds of branched-chain amino acids, and equipment investment is small, and process applicability is strong, continuousization is high, and is suitable for industrialized amplification production. It should be noted that the separation and purification method of the fermented product described in the present specification embodiment is not only applicable to the fermented product of aforementioned Corynebacterium glutamicum, but also applicable to the separation and purification of the fermented product of other strains, and this specification embodiment is not limited. The fermentation method described above will be described in detail below through a number of examples and comparative examples. It should be noted that the reaction conditions, reaction materials, and amounts of reaction materials in the examples are for illustration only and do not limit the scope of protection of this specification. The comparative examples are the control groups of the examples. In this specification, unless otherwise specified, percentages and contents are all by mass. Unless otherwise specified, the experimental methods used are conventional methods, and the materials and reagents used can be purchased from commercial sources. Example 1 Construction of an engineered Corynebacterium sRNA regulatory system The plasmid pXMJ19 was amplified using plasmid primers Plsmid-F / R with a high-fidelity enzyme, and the DNA fragment s25 (SEQ ID NO.1) was amplified using error-prone PCR primers Errp-F / R with a high-fidelity enzyme. The two fragments were purified and ligated by homologous recombination. The resulting vector was transformed into the Corynebacterium glutamicum model strain ATCC13002 to obtain strain Cg-pXMJ19-s25, recorded as s25. In some embodiments, SEQ ID NO. 1 (s25) is obtained based on SEQ ID NO. 2 by error-prone PCR mutagenesis and sequence screening optimization. For example, the DNA fragment s25 (SEQ ID NO. 1) can be obtained by the following means: (1) Plasmid pXMJ19 was amplified using plasmid primers Plsmid-F / R with a high-fidelity enzyme, and DNA fragment bn (SEQ ID NO. 2) was amplified using error-prone PCR primers Errp-F / R with a high-fidelity enzyme. The two fragments were purified and ligated by homologous recombination to obtain the vector pXMJ19-bn. (2) Using the pXMJ-bn plasmid as a template, the sRNA-specific portion was amplified using an error-prone PCR enzyme. The reaction system and reaction procedure are shown in Table 2. To increase the mutation rate, after the first round of error-prone PCR, the plasmid template was digested and the purified product was used as a template for another round of error-prone PCR, with three cycles. After the PCR, agarose gel electrophoresis was performed to determine whether the target gene fragment size was correct under a blue light real-time observation instrument. If the band size was correct, 5 μL of DMTase was added to the system and incubated at 37°C for 15 minutes. After the digestion, the product was purified and recovered. (3) Using the pXMJ-sRNAbn plasmid as a template, the remaining fragments were amplified with a high-fidelity enzyme. The reaction system is shown in Table 3, and the reaction procedure is shown in Table 2. The two fragments were purified and then homologously recombined to obtain mutant plasmids that were transferred into the starting strain (i.e., the host strain) described later. The mutants with improved fermentation effects were sequenced, and only one group (selected from the six groups) had a relatively obvious effect, as shown in SEQ ID NO.1, and were named s25. In addition, the plasmid pXMJ19-bn was transferred into Corynebacterium glutamicum ATCC13002 to obtain strain Cg-pXMJ-bn, denoted as Cg-bn, as a control for subsequent experiments. The pXMJ19 plasmid was transferred into Corynebacterium glutamicum using the same transformation method, denoted as Cg-p, as a control for subsequent experiments. Table 1 Error-prone PCR reaction system Table 2 Error-prone PCR reaction procedures Table 3 PCR reaction system for amplifying other fragments of pXMJ19-sRNAbn Plasmid primer Plsmid-F: ggctgttttggcggatgagag; SEQ ID NO. 3. Plasmid primer Plsmid-R: ttgttatccgctcacaattccac; SEQ ID NO.4. Error-prone PCR primer Errp-F: gtggaattgtgagcggataacaa; SEQ ID NO.5. Error-prone PCR primer Errp-R: ctctcatccgccaaaacagcc; SEQ ID NO.6. Example 2 Determination of acid production performance of sRNA overexpression strains in Corynebacterium glutamicum The model strain of Corynebacterium glutamicum ATCC13002 (Cg), an empty vector-overexpressing strain Cg-p, and strains Cg-bn and S21-S25 overexpressing different noncoding RNAs were inoculated into shake flasks and cultured at 37°C and 100 rpm for 16 hours, at which point the OD562 reached approximately 15 and was set aside. The culture fluid was then inoculated into shake flasks at a 9% (v / v) dilution and cultured at 37°C and 120 rpm for 68 hours. At 48 hours, 1 mM lactose was added to induce plasmid expression. Fermentation was completed after 68 hours. Fig. 1 is a spider web diagram of the accumulation of different non-coding sRNA amino acid outputs of the Corynebacterium glutamicum overexpressed according to some embodiments of this specification sheets. In the spider web diagram, Asp is aspartic acid, Lys is lysine, Thr is tyrosine, Leu is leucine, Ile is isoleucine, and Val is valine. As can be seen from the output results of the spider web diagram, the overall output of the bacterial strain expressing empty load and template sRNA decreases, and the reduction of empty load may be due to the overall acid production capacity decline caused by the burden of vector replication, while template sRNA has a negative impact on acid production, thereby causing the decline in acid production capacity. For the non-coding sRNA obtained for other 5 others, different impacts were produced on amino acid production capacity. Compared with the empty vector, the expression of non-coding sRNAs21 increased the accumulation of threonine and lysine, while reducing the accumulation of aspartic acid and branched-chain amino acids (BCAA) L-valine, L-leucine, and L-isoleucine in the fermentation broth; the expression of non-coding sRNAs22 significantly increased aspartic acid, while the production of threonine, L-valine, L-leucine, and L-isoleucine was significantly reduced; the expression of non-coding sRNAs23 slightly fluctuated the accumulation of aspartic acid and threonine, while the production of L-valine, L-leucine, and L-isoleucine was significantly reduced. The accumulation of L-valine, L-leucine and L-isoleucine in the strain expressing non-coding sRNAs25 was significantly improved, and the accumulation of lysine also increased; non-coding sRNAs24 had no obvious benefit in increasing the production of the tested amino acids; the accumulation of aspartic acid and threonine was reduced, the production of L-valine, L-leucine and L-isoleucine was significantly improved, and the accumulation of lysine also decreased. In particular, this beneficial effect also exceeded the adverse effects of the plasmid burden. The production of L-valine, L-isoleucine and L-leucine increased by 1.32 times, 1.17 times and 1.24 times that of the model strain, respectively. Example 3 Effect of sRNAs25 Expression on Acid Production in L-Leucine-Producing Strain The non-coding sRNAs25 described in the above examples was expressed in the Corynebacterium glutamicum mutant strain IBBH-15 (deposited with the China General Microbiological Culture Collection (CGMCC) in Beijing, China, with the deposit number CGMCC No. 15720 and the deposit date May 2, 2018), resulting in strain IBBH-pXMJ19-s257, designated IBCLQ-257. This producer strain was then expressed with either the empty pXMJ19 vector, designated IBBH-15-p; or with pXMJ-sRNAbn, designated IBBH-15-bn. Four rings of the one-ring L-leucine-producing bacteria IBBH-15, the bacteria loaded with an empty plasmid IBBH-15-p, the overexpressing bacteria IBBH-15-bn and the overexpressing bacteria IBCLQ-257 slant lawn were inoculated into a 3 L shake flask, and cultured at 80 rpm and 30°C until OD562 = 15 to obtain the shake flask seed solution for later use. The shake flask seed solution was inoculated into the fermentation medium of a 30L fermenter at a 10% (V / V) inoculation rate. At 48 hours, 1mM lactose was added to induce plasmid expression. The initial temperature was 30°C, the initial ventilation rate was 0.8L / min, and the agitator speed and air volume were controlled to maintain a dissolved oxygen level of 10-20% for the first 24 hours of fermentation and 5-15% thereafter. The pH of the fermentation process was controlled by automatically adding ammonia water, initially at 6.7. After the bacterial OD562 reached 20, the pH increased to 6.9, after the bacterial OD562 reached 25, the pH increased to 7.0, and after the bacterial OD562 reached 36, the pH increased to 7.2. The residual sugar concentration was controlled at 20-30g / L during the fermentation process. Table 4 Main results of Example 3 As shown in Table 4, strain IBCLQ-257, which overexpresses sRNAs25, increased L-leucine production by approximately 20.5% and significantly reduced secondary acid production compared to the control strain IBBH-15. In contrast, strain IBBH-15-bn also showed noticeable decreases in both acid production and secondary acid production compared to the original starting strain and the empty vector control strain IBBH-15-p. This suggests that the influence of non-coding sRNAs on the regulation of metabolic acid production is sequence-dependent. Fermenter initial culture medium: Glucose 100g / L, ammonium sulfate 5g / L, corn steep liquor 10mL / L, potassium dihydrogen phosphate 5g / L, magnesium sulfate 2.5g / L, ferrous sulfate 0.01g / L, manganese sulfate 0.01g / L, biotin 100μg / L, vitamin B1 300μg / L, L-methionine 0.1g / L, L-isoleucine 0.1g / L, L-glutamic acid 0.1g / L, vegetable oil 1mL / L, pH 7.0-7.2. Feed sugar solution: 400g / L glucose, 0.5g / L magnesium sulfate. Example 4 Effect of sRNAs25 Expression on Acid Production in L-Isoleucine-Producing Strain The non-coding sRNAs25 described in Example 2 was expressed in an L-isoleucine-producing bacterium (Corynebacterium glutamicum IBCL-1, deposited on May 30, 2022, with a CCTCCNO: M 2022764) to obtain strain IBCL-pXMJ19-s253, designated IBCIL-253. Empty pXMJ19 was expressed in this producer strain, designated IBCL-1-p; pXMJ-sRNAbn was expressed, designated IBCL-1-bn. Two loops of L-isoleucine-producing strain IBCL-1, strains loaded with an empty plasmid IBCL-1-p, overexpressing strain IBCL-1-bn, and overexpressing strain IBCIL-253 were inoculated into 3L shake flasks and cultured at 30°C, 90 rpm, and shaken for 16 hours until the OD562 reached approximately 15. This produced a shake flask seed solution, which was then used for standby. The shake flask seed solution was inoculated into a 30L fermentation tank at a 10% (v / v) inoculum. At 18 hours, 1mM lactose was added to each of the fermentation mediums to induce plasmid expression. The initial temperature was 30°C, pH 6.8. During fermentation, ventilation and rotational speed were continuously adjusted to maintain dissolved oxygen at approximately 10%. At 48 hours, 1mM lactose was added to each of the fermentation mediums to induce plasmid expression. The OD562 of the bacterial strain in the fermentation broth grew to approximately 40, and the pH was adjusted to approximately 7.0. When the residual sugar content of the fermentation broth dropped to 6%, an inorganic salt feed solution was added to control the osmotic pressure of the fermentation broth at approximately 700 mosm / L. When the residual sugar content dropped below 1%, the residual sugar content of the fermentation broth was controlled at approximately 1% by adding a sugar feed solution, while the inorganic salt feed solution was continued to control the osmotic pressure of the fermentation broth at approximately 900 mosm / L. The fermentation was completed after approximately 30 hours of sugar consumption. The fermentation yield is shown in Table 5. Table 5 Main results of Example 4 As shown in Table 5, the L-isoleucine production of the strain IBCIL-253 overexpressing sRNAs25 increased by about 7.6% and the secondary acid decreased by 51.7% compared with the control strain IBCL-1. Conversely, the acid production and secondary acid production of the strain IBCL-1-bn were significantly reduced compared with the original starting strain IBCL-1, indicating that the influence of non-coding sRNA in the regulation of metabolic acid production is related to its sequence. Seed culture medium: Glucose 30g / L, corn steep liquor powder 10g / L, ammonium sulfate 5g / L, potassium dihydrogen phosphate 1g / L, magnesium sulfate 0.5g / L, calcium carbonate 10g / L, pH 6.7-7.2; divided into 500ml / 5000ml portions; sterilization conditions: 121℃ / 20min; Fermentation medium: Glucose 100g / L, corn steep liquor powder 8g / L, ammonium sulfate 5g / L, potassium dihydrogen phosphate 1g / L, magnesium sulfate 0.5g / L;

[0065] Feed sugar solution: 400 g / L glucose, 1 g / L potassium dihydrogen phosphate, 0.5 g / L magnesium sulfate; Inorganic salt feed solution: ammonium sulfate 100g / L. Example 5 Effect of sRNAs25 Expression on Acid Production in L-Valine-Producing Strain Based on the model strain Corynebacterium glutamicum ATCC13002 (competent cell products of which can be purchased from multiple biological reagent companies), the following modifications were performed according to conventional genetic modification protocols to obtain Corynebacterium glutamicum IBCVQ, namely: knocking out the ldh and brnQ genes on the model strain genome, replacing ilvE with the NADH-dependent leucine dehydrogenase (LeuDH) from lysinobacillus sphaeroides; synthesizing the ilvN mutant ilvNM (G20E, I21E, I22F, G156E) and the ilvC mutant ilvCM (S34G, L48E and R49F), and expressing ilvBNMCM at the alaT site using the PgapA promoter; expressing the pfkA gene at the ppc site using the Ptac promoter; and expressing the pyk gene at the pta site using the Ptac promoter. The noncoding sRNAs25 described in Example 4 was expressed in the L-valine-producing strain IBCVQ to generate strain IBCVQ-pXMJ19-s256, designated IBCLQ-256. This strain also expressed the empty pXMJ19 vector, designated IBCVQ-p, and the pXMJ-sRNAbn vector, designated IBCVQ-bn. Two rings of L-valine-producing strains (IBCVQ), empty plasmid-loaded strains (IBCVQ-p), overexpressing strains (IBCVQ-bn), and overexpressing strains (IBCVQ-256) were inoculated into 3L shake flasks and cultured at 120 rpm and 30°C for 16-18 hours until the OD562 reached approximately 15. This produced a shake flask seed solution, which was then used for standby. The shake flask seed solution was inoculated into a 30L fermentation tank at a 10% (v / v) inoculum. For 0-20 hours, the culture conditions were: 30°C, tank pressure 0.02-0.03 MPa. After the dissolved oxygen naturally dropped to approximately 20%, the fermentation speed and ventilation were adjusted to maintain the dissolved oxygen level at no less than 20%. For 20-48 hours, the culture conditions were: 31°C, tank pressure 0.04-0.08 MPa, and the fermentation speed and ventilation were adjusted to maintain the dissolved oxygen level at 1%±0.1%. During the fermentation process, the residual sugar concentration was maintained at 20-30 g / L. After 48 h of fermentation, the L-valine yield, conversion rate and miscellaneous acid content are shown in Table 6. Table 6 Main results of Example 5 As shown in Table 6, the strain IBCVQ-256 overexpressing sRNAs25 increased its L-valine production by 23.8% and decreased its total miscellaneous acids by 40.8% compared with the control strain IBCVQ. The strain IBCVQ-bn also produced less acid and secondary acids than the original starting strain IBCVQ, indicating that the influence of non-coding sRNAs on the regulation of metabolic acid production is related to its sequence. Slant culture medium: 2.5 g / L urea, 5 g / L (NH4)2SO4, 0.5 g / L KH2PO4, 0.5 g / L K2HPO4, 0.5 g / LMgSO4·7H2O, 1.8 g / L yeast extract powder, 5 g / L peptone, 6 mg / LFeSO4·7H2O, 4 mg / LMnSO4·H2O, 0.2 mg / L biotin, 0.2 mg / L vitamin B1, 40 g / L glucose, 15 g / L agar powder. Fermentation medium: 8g / L(NH4)2SO4, 1g / LKH2PO4, 1g / LK2HPO4, 0.5g / LMgSO4·7H2O, 3.5g / L yeast powder, 10mg / LFeSO4·7H2O, 4mg / LMnSO4·H2O, 0.02mg / L biotin, 2mg / L vitamin B1, 30mg / L vitamin B3, 8mg / L vitamin B6, 90g / L glucose, vegetable oil 40mL / L. Feed medium: 400 g / L glucose. Example 6 Preferred embodiment of leucine fermentation 1. The composition of the seed culture medium is as follows: Primary seed culture medium: 3 wt% glucose, 1.5 wt% enzymatically hydrolyzed beet molasses, 0.5 wt% ammonium sulfate, 0.1 wt% potassium dihydrogen phosphate, 0.05 wt% magnesium sulfate, 1 wt% calcium carbonate, pH 6.7-7.2; aliquots of 500 ml / 5000 ml; sterilization conditions: 121°C / 20 min. Secondary seed tank culture medium: glucose 3wt%, enzymatically hydrolyzed beet molasses 1.5wt%, ammonium sulfate 0.5wt%, potassium dihydrogen phosphate 0.1wt%, magnesium sulfate 0.05wt%, pH 6.8-7.2, sterilization condition 121℃ / 20min. 2. The fermentation medium is as follows: Standard fermentation tank initial culture medium: glucose 4wt%, beet molasses hydrolysate 0.8wt%, ammonium sulfate 0.4wt%, potassium dihydrogen phosphate 0.11wt%, magnesium sulfate 0.05wt%, ferrous sulfate 0.001wt%, manganese sulfate 0.001wt%, biotin 0.00001wt%, vitamin B1 0.00003wt%, L-methionine 0.01wt%, L-isoleucine 0.01wt%; natural pH, 121℃*20min; Feed solution: Solution A: 40-50wt% glucose; Solution B: 40-50wt% beet molasses enzymatic hydrolyzate; when used, the concentrations of the two need to be kept consistent. 3. Fermentation tank process (500L): Corynebacterium glutamicum IBCLQ-257, IBCLQ-257e and IBBH-15 were inoculated into the primary seed culture medium of the shake flask respectively. After culturing at 30°C and 85 rpm for 16 h, 500 mL of the shake flask seed solution was obtained. The maturity indicator of the primary seed solution was OD 562 8-12; The shake flask seed solution was added to 50L secondary seed tank culture medium at a ratio of 0.2% (V / V), 30℃, pH 6.8, dissolved oxygen not less than 10%, and cultured for 16 hours. The maturity indicator of the secondary seed solution was OD 562 is 8-10, and the secondary seed solution is obtained; 10% of the secondary seed solution was inoculated into a 500L fermenter, the fermentation volume was 300L, the fermentation temperature was 30°C, the pH was 6.7, the speed was 200RPM, the ventilation volume was 60LPM, and the tank pressure was 0.05Mpa. The speed and ventilation were adjusted alternately to keep the dissolved oxygen at 5-10%. The bacterial OD 562 After the growth reached 20, the pH increased to 6.9, and the residual sugar dropped to 2wt% before feeding. At this time, the flow rate ratio of feed A and feed B was 8 / 1; the bacterial OD 562 After the cell OD reached 30, the pH was raised to 7.1 and 1 mM lactose was added once (no addition is required for IBBH-15 strain); 562 After increasing to 40, the pH value was raised to 7.2; the residual sugar was controlled at 2 wt%, and the feed sugar was exhausted before the tank was removed. Table 7 Main results of Example 6 As shown in Example 6, the core of the present invention is to obtain a beet molasses hydrolyzate by enzymatic hydrolysis of beet molasses using sucrase and papain, and then control the residual sugar by adding glucose solution and beet molasses hydrolyzate in a certain ratio during the leucine fermentation process. This method can not only control the residual sugar, but also control the total amount of nitrogen source by adding an organic nitrogen source, thereby preventing the bacteria from growing too fast; in the beet molasses after enzymatic hydrolysis, sucrose is completely hydrolyzed into glucose and fructose, which are easier to be utilized by the bacteria, and papain can enzymatically hydrolyze large molecular proteins so that the nitrogen source is fully utilized, thereby achieving the purpose of fully utilizing the carbon and nitrogen sources of the molasses. In the fermentation process, acid production refers to the actual concentration of L-leucine in the fermentation broth. The formula for calculating the sugar-acid conversion rate is as follows: Sugar-acid conversion rate = (actual L-leucine concentration × actual fermentation volume) / (actual total glucose consumption × 100%) Meanwhile, miscellaneous acids refer to the sum of valine, lysine, alanine, and glutamic acid in the fermentation broth. These two parameters are used together to evaluate the efficiency of the fermentation process and the composition of the product. In summary, Corynebacterium glutamicum IBCLQ-257, IBCLQ-257e, and IBBH-15 have obvious advantages in L-leucine production, sugar-acid conversion rate, and miscellaneous acids in the process of Example 6. Example 7 Confirmation of the initial addition amount range 1. The seed formula and culture process are consistent with those in Example 6. 2. The fermentation medium is as follows: Standard fermentation tank initial culture medium: glucose 4wt%, beet molasses hydrolyzate 0.5-1.1wt%, ammonium sulfate 0.4wt%, potassium dihydrogen phosphate 0.11wt%, magnesium sulfate 0.05wt%, ferrous sulfate 0.001wt%, manganese sulfate 0.001wt%, biotin 0.00001wt%, vitamin B1 0.00003wt%, L-methionine 0.01wt%, L-isoleucine 0.01wt%; natural pH, 121℃*20min; Feed solution: Solution A: 40-50wt% glucose; Solution B: 40-50wt% beet molasses enzymatic hydrolyzate; when used, the concentrations of the two need to be kept consistent. 3. Fermentation tank process (500L): Corynebacterium glutamicum IBCLQ-257, IBCLQ-257e and IBBH-15 were inoculated into the primary seed culture medium of the shake flask respectively. After culturing at 30°C and 85 rpm for 16 h, 500 mL of the shake flask seed solution was obtained. The maturity indicator of the primary seed solution was OD 562 8-12; The shake flask seed solution was added to 50L secondary seed tank culture medium at a ratio of 0.2% (V / V), 30℃, pH 6.8, dissolved oxygen not less than 10%, and cultured for 16 hours. The maturity indicator of the secondary seed solution was OD 562 8-10, to obtain the secondary seed liquid; 10% of the secondary seed liquid was inoculated into a 500L fermenter, the initial fermentation liquid volume was 60%, the fermentation temperature was 30°C, the pH was 6.7, the speed was 200RPM, the ventilation volume was 60LPM, the tank pressure was 0.05Mpa, and the speed and ventilation were alternately adjusted to maintain the dissolved oxygen at 5-10%; the bacterial OD 562 After the growth reached 20, the pH increased to 6.9, and the residual sugar dropped to 2wt% before feeding. At this time, the flow rate ratio of feed A and feed B was 8 / 1; the bacterial OD 562 After the cell OD reached 30, the pH was raised to 7.1 and 1 mM lactose was added once (no addition is required for IBBH-15 strain); 562 After increasing to 40, the pH value was raised to 7.2; the residual sugar was controlled at 2 wt%, and the feed sugar was exhausted before the tank was removed. Table 8 Main results of Example 7 Feed A / B is the volume ratio of the two feed liquids. Since the concentrations of feed sugar and feed molasses are basically the same, it can also be regarded as the mass ratio of the two when they are added. As shown in Example 7, this example optimizes the initial concentration of beet molasses enzymatic hydrolysate, and verifies that under different initial concentration conditions, the results show that the initial addition amount is within the range of 0.5-1.1 wt%. Example 8 Determining the Ratio of Glucose and Molasses During Feed 1. The seed formula and culture process are consistent with those in Example 6. 2. The fermentation medium is as follows: Standard fermentation tank initial culture medium: glucose 4wt%, molasses hydrolyzate 0.8wt%, ammonium sulfate 0.4wt%, potassium dihydrogen phosphate 0.11wt%, magnesium sulfate 0.05wt%, ferrous sulfate 0.001wt%, manganese sulfate 0.001wt%, biotin 0.00001wt%, vitamin B1 0.00003wt%, L-methionine 0.01wt%, L-isoleucine 0.01wt%; natural pH, 121℃*20min; Feed solution: Solution A: 40-50wt% glucose; Solution B: 40-50wt% beet molasses enzymatic hydrolyzate; when used, the concentrations of the two need to be kept consistent. 3. Fermentation tank process (500L): Corynebacterium glutamicum IBCLQ-257, IBCLQ-257e and IBBH-15 were inoculated into the primary seed culture medium of the shake flask respectively. After culturing at 30°C and 85 rpm for 16 h, 500 mL of the shake flask seed solution was obtained. The maturity indicator of the primary seed solution was OD 562 8-12; The shake flask seed solution was added to 50L secondary seed tank culture medium at a ratio of 0.2% (V / V), 30℃, pH 6.8, dissolved oxygen not less than 10%, and cultured for 16 hours. The maturity indicator of the secondary seed solution was OD 562 8-10, to obtain the secondary seed liquid; 10% of the secondary seed liquid was inoculated into a 500L fermenter, the initial fermentation liquid volume was 60%, the fermentation temperature was 30°C, the pH was 6.7, the speed was 200RPM, the ventilation volume was 60LPM, the tank pressure was 0.05Mpa, and the speed and ventilation were alternately adjusted to maintain the dissolved oxygen at 5-10%; the bacterial OD 562 After the growth reaches 20, the pH is raised to 6.9, and the residual sugar is reduced to 2wt% before feeding. At this time, the flow rate ratio of feed A and feed B is 6 / 1 to 10 / 1; the bacterial OD 562 After the cell OD reached 30, the pH was raised to 7.1 and 1 mM lactose was added once (no addition is required for IBBH-15 strain); 562 After increasing to 40, the pH is increased to 7.2; if the molasses is exhausted first, continue to add feed sugar; if the feed sugar is exhausted first, stop adding beet molasses; control the residual sugar to 2wt%, and remove the tank after the feed sugar is exhausted. Table 9 Main results of Example 8 As shown in Example 8, this example optimizes the AB feeding ratio. The results show that ideal effects can be achieved within the range of 6 / 1 to 10 / 1, which also indicates that the ratio between sugar and molasses during feeding needs to be strictly controlled within the range. Example 9: Determination of the sugarcane hydrolysate as a process 1. The seed formula and culture process are consistent with those in Example 6. 2. The fermentation medium is as follows: Standard fermentation tank initial culture medium: glucose 4wt%, (beet / sugarcane) molasses hydrolysate 0.8wt%, ammonium sulfate 0.4wt%, potassium dihydrogen phosphate 0.11wt%, magnesium sulfate 0.05wt%, ferrous sulfate 0.001wt%, manganese sulfate 0.001wt%, biotin 0.00001wt%, vitamin B1 0.00003wt%, L-methionine 0.01wt%, L-isoleucine 0.01wt%; natural pH, 121°C*20min; Feed solution: Solution A: 40-50wt% glucose; Solution B: 40-50wt% beet molasses enzymatic hydrolyzate; when used, the concentrations of the two need to be kept consistent. 3. Fermentation tank process (500L): Corynebacterium glutamicum IBCLQ-257, IBCLQ-257e and IBBH-15 were inoculated into the primary seed culture medium of the shake flask respectively. After culturing at 30°C and 85 rpm for 16 h, 500 mL of the shake flask seed solution was obtained. The maturity indicator of the primary seed solution was OD 562 8-12; The shake flask seed solution was added to 50L secondary seed tank culture medium at a ratio of 0.2% (V / V), 30℃, pH 6.8, dissolved oxygen not less than 10%, and cultured for 16 hours. The maturity indicator of the secondary seed solution was OD 562 8-10, to obtain the secondary seed liquid; 10% of the secondary seed liquid was inoculated into a 500L fermenter, the initial fermentation liquid volume was 60%, the fermentation temperature was 30°C, the pH was 6.7, the speed was 200RPM, the ventilation volume was 60LPM, the tank pressure was 0.05Mpa, and the speed and ventilation were alternately adjusted to maintain the dissolved oxygen at 5-10%; the bacterial OD 562 After the growth reached 20, the pH increased to 6.9, and the residual sugar dropped to 2wt% before feeding. At this time, the flow rate ratio of feed A and feed B was 8 / 1; the bacterial OD 562 After the cell OD reached 30, the pH was raised to 7.1 and 1 mM lactose was added once (no addition is required for IBBH-15 strain); 562 After increasing to 40, the pH value was raised to 7.2; the residual sugar was controlled at 2 wt%, and the feed sugar was exhausted before the tank was removed. Table 10 Main results of Example 9 As shown in Example 9, this example uses sugarcane molasses and beet molasses enzymatic hydrolysate together. Sugarcane molasses enzymatic hydrolysate can replace beet molasses, but the effect is slightly different from that of beet molasses. This example demonstrates that the enzymatic hydrolysis method and the feeding mode are suitable for leucine fermentation using sugarcane molasses. Example 10 confirmed that partially enzymatically hydrolyzed molasses can also be used for fermentation 1. The seed formula and culture process are consistent with those in Example 6. 2. The fermentation medium is as follows: Standard fermentation tank initial culture medium: glucose 4wt%, partially enzymatically hydrolyzed molasses hydrolysate 0.7wt%, ammonium sulfate 0.4wt%, potassium dihydrogen phosphate 0.11wt%, magnesium sulfate 0.05wt%, ferrous sulfate 0.001wt%, manganese sulfate 0.001wt%, biotin 0.00001wt%, vitamin B1 0.00003wt%, L-methionine 0.01wt%, L-isoleucine 0.01wt%; natural pH, 121℃*20min; Feed solution: Solution A: 40-50wt% glucose; Solution B: 40-50wt% beet molasses enzymatic hydrolyzate; when used, the concentrations of the two need to be kept consistent. 3. Fermentation tank process (500L): Corynebacterium glutamicum IBCLQ-257, IBCLQ-257e and IBBH-15 were inoculated into the primary seed culture medium of the shake flask respectively. After culturing at 30°C and 85 rpm for 16 h, 500 mL of the shake flask seed solution was obtained. The maturity indicator of the primary seed solution was OD 562 8-12; The shake flask seed solution was added to 50L secondary seed tank culture medium at a ratio of 0.2% (V / V), 30℃, pH 6.8, dissolved oxygen not less than 10%, and cultured for 16 hours. The maturity indicator of the secondary seed solution was OD 562 8-10, to obtain the secondary seed liquid; 10% of the secondary seed liquid was inoculated into a 500L fermenter, the initial fermentation liquid volume was 60%, the fermentation temperature was 30°C, the pH was 6.7, the speed was 200RPM, the ventilation volume was 60LPM, the tank pressure was 0.05Mpa, and the speed and ventilation were alternately adjusted to maintain the dissolved oxygen at 5-10%; the bacterial OD 562 After the growth reached 20, the pH increased to 6.9, and the residual sugar dropped to 2wt% before feeding. At this time, the flow rate ratio of feed A and feed B was 8 / 1; the bacterial OD 562 After the cell OD reached 30, the pH was raised to 7.1 and 1 mM lactose was added once (no addition is required for IBBH-15 strain); 562 After increasing to 40, the pH value was raised to 7.2; the residual sugar was controlled at 2 wt%, and the feed sugar was exhausted before the tank was removed. Table 11 Main results of Example 10 As shown in Example 10, in this example, beet / sugarcane molasses was enzymatically hydrolyzed using only sucrase or protease, and then the corresponding molasses was added through the feed stream. The results showed that the leucine yield and sugar-acid ratio of the partially hydrolyzed molasses decreased compared to Example 6, and the miscellaneous acids in the fermentation broth corresponding to the molasses that was not hydrolyzed by protease increased. This example demonstrates that partially enzymatically hydrolyzed molasses can still improve the effect of leucine, but the improvement ability is limited compared to Example 6. Comparative Example 1: One-time addition of molasses process versus fed-batch process 1. The seed formula and culture process are consistent with those in Example 6. 2. The fermentation medium is as follows: Standard fermentation tank initial culture medium: glucose 4wt%, beet molasses hydrolysate 0.5-3.0wt%, ammonium sulfate 0.4wt%, potassium dihydrogen phosphate 0.11wt%, magnesium sulfate 0.05wt%, ferrous sulfate 0.001wt%, manganese sulfate 0.001wt%, biotin 0.00001wt%, vitamin B1 0.00003wt%, L-methionine 0.01wt%, L-isoleucine 0.01wt%; natural pH, 121℃*20min; Feed solution: Solution A 40-50wt% glucose. 3. Fermentation tank process (500L): Corynebacterium glutamicum IBCLQ-257, IBCLQ-257e and IBBH-15 were inoculated into the primary seed culture medium of the shake flask respectively. After culturing at 30°C and 85 rpm for 16 h, 500 mL of the shake flask seed solution was obtained. The maturity indicator of the primary seed solution was OD 562 8-12; The shake flask seed solution was added to 50L secondary seed tank culture medium at a ratio of 0.2% (V / V), 30℃, pH 6.8, dissolved oxygen not less than 10%, and cultured for 16 hours. The maturity indicator of the secondary seed solution was OD 562 8-10, to obtain the secondary seed liquid; 10% of the secondary seed liquid was inoculated into a 500L fermenter, the initial fermentation liquid volume was 60%, the fermentation temperature was 30°C, the pH was 6.7, the speed was 200RPM, the ventilation volume was 60LPM, the tank pressure was 0.05Mpa, and the speed and ventilation were alternately adjusted to maintain the dissolved oxygen at 5-10%; the bacterial OD 562 After the cell growth reached 20, the pH value was raised to 6.9, and sugar was added when the residual sugar dropped to 2wt%, and the residual sugar was controlled at 2wt%. 562 After the cell OD reached 30, the pH was raised to 7.1 and 1 mM lactose was added once (no addition is required for IBBH-15 strain); 562 After growing to 40, the pH increased to 7.2. Table 12 Main results of comparative example 1 The above-mentioned one-time added molasses concentration is the total amount of added molasses divided by the initial fermentation volume. As shown in Comparative Example 1, the one-time addition of molasses will lead to a decrease in acid production and sugar-acid conversion rate. Compared with the fed-batch process, the one-time addition of molasses will result in too much or too little organic nitrogen source in the fermentation liquid, which will lead to abnormal acid production by the bacteria. This comparative example proves that the fed-batch process of molasses has obvious advantages over the one-time addition. Comparative Example 2 confirmed that the initial addition amount should not be too high or too low 1. The seed formula and culture process are consistent with those in Example 6. 2. The fermentation medium is as follows: Standard fermentation tank initial culture medium: glucose 4wt%, beet molasses enzymatic hydrolyzate 0.3-0.6 or 1.1-1.2wt%, ammonium sulfate 0.4wt%, potassium dihydrogen phosphate 0.11wt%, magnesium sulfate 0.05wt%, ferrous sulfate 0.001wt%, manganese sulfate 0.001wt%, biotin 0.00001wt%, vitamin B1 0.00003wt%, L-methionine 0.01wt%, L-isoleucine 0.01wt%; natural pH, 121℃*20min; Feed solution: Solution A: 40-50wt% glucose; Solution B: 40-50wt% beet molasses enzymatic hydrolyzate; when used, the concentrations of the two need to be kept consistent. 3. Fermentation tank process (500L): Corynebacterium glutamicum IBCLQ-257, IBCLQ-257e and IBBH-15 were inoculated into the primary seed culture medium of the shake flask respectively. After culturing at 30°C and 85 rpm for 16 h, 500 mL of the shake flask seed solution was obtained. The maturity indicator of the primary seed solution was OD 562 8-12; The shake flask seed solution was added to 50L secondary seed tank culture medium at a ratio of 0.2% (V / V), 30℃, pH 6.8, dissolved oxygen not less than 10%, and cultured for 16 hours. The maturity indicator of the secondary seed solution was OD 562 8-10, to obtain the secondary seed liquid; 10% of the secondary seed liquid was inoculated into a 500L fermenter, the initial fermentation liquid volume was 60%, the fermentation temperature was 30°C, the pH was 6.7, the speed was 200RPM, the ventilation volume was 60LPM, the tank pressure was 0.05Mpa, and the speed and ventilation were alternately adjusted to maintain the dissolved oxygen at 5-10%; the bacterial OD 562 After the cell growth reached 20, the pH value was raised to 6.9, and sugar was added when the residual sugar dropped to 2wt%, and the residual sugar was controlled at 2wt%. 562 After the cell OD reached 30, the pH was raised to 7.1 and 1 mM lactose was added once (no addition is required for IBBH-15 strain); 562 After growing to 40, the pH increased to 7.2; Table 13 Main results of comparative example 2 The above initial concentration is the actual concentration of molasses in the initial culture medium; the above total molasses concentration is the total amount of molasses divided by the volume of the tank below. As shown in Comparative Example 2, too high or too low initial molasses content, too high or too low molasses feed rate, or too high or too low total molasses content will all result in decreased acid production and sugar-acid conversion. Compared with Example 1.2, this comparative example illustrates several extreme addition conditions of several molasses, demonstrating the importance of controlling the initial molasses addition amount, the feed ratio rate, and the total amount of molasses in the examples. Comparative Example 3 confirmed that molasses must be enzymatically hydrolyzed to achieve the effect of increasing acid production. 1. The seed formula and culture process are consistent with those in Example 6. 2. The fermentation medium is as follows: Standard fermentation tank initial culture medium: glucose 4wt%, beet / cane molasses 0.8wt%, ammonium sulfate 0.4wt%, potassium dihydrogen phosphate 0.11wt%, magnesium sulfate 0.05wt%, ferrous sulfate 0.001wt%, manganese sulfate 0.001wt%, biotin 0.00001wt%, vitamin B1 0.00003wt%, L-methionine 0.01wt%, L-isoleucine 0.01wt%; natural pH, 121°C*20min; Feed solution: Solution A: 40-50wt% glucose; Solution B: 40-50wt% molasses enzymatic hydrolyzate; when used, the concentrations of the two need to be kept consistent. 3. Fermentation tank process (500L): Corynebacterium glutamicum IBCLQ-257, IBCLQ-257e and IBBH-15 were inoculated into the primary seed culture medium of the shake flask respectively. After culturing at 30°C and 85 rpm for 16 h, 500 mL of the shake flask seed solution was obtained. The maturity indicator of the primary seed solution was OD 562 8-12; 10% of the secondary seed solution was inoculated into a 500L fermenter, the fermentation volume was 300L, the fermentation temperature was 30°C, the pH was 6.7, the speed was 200RPM, the ventilation volume was 60LPM, and the tank pressure was 0.05Mpa. The speed and ventilation were adjusted alternately to keep the dissolved oxygen at 5-10%. The bacterial OD 562 After the growth reached 20, the pH increased to 6.9, and the residual sugar dropped to 2wt% before feeding. At this time, the flow rate ratio of feed A and feed B was 8 / 1; the bacterial OD 562 After the cell OD reached 30, the pH was raised to 7.1 and 1 mM lactose was added once (no addition is required for IBBH-15 strain); 562 After increasing to 40, the pH value was raised to 7.2; the residual sugar was controlled at 2 wt%, and the feed sugar was exhausted before the tank was removed. Table 14 Main results of comparative example 3 As shown in Comparative Example 3, when molasses that has not been enzymatically hydrolyzed is subjected to L-leucine fermentation, its acid production and sugar-acid conversion rate do not reach the effect of enzymatic hydrolysis molasses. This comparative example shows that enzymatic hydrolysis of molasses is beneficial to L-leucine fermentation. After enzymatic hydrolysis, the sucrose in the molasses is enzymatically hydrolyzed into glucose and fructose, and the crude protein is decomposed, which is more beneficial to the metabolism of the bacteria. Molasses that has not been enzymatically hydrolyzed cannot achieve this effect. Comparative Example 4 confirms the process advantages provided by the examples of this specification 1. The composition of the seed culture medium is as follows: Primary seed culture medium: 3wt% glucose, 4wt% corn slurry, 0.5wt% ammonium sulfate, 0.1wt% potassium dihydrogen phosphate, 0.05wt% magnesium sulfate, 1wt% calcium carbonate, pH 6.7-7.2; aliquot into 500ml / 5000ml portions; sterilize at 121°C / 20min. Secondary seed tank culture medium: glucose 3wt%, corn slurry 4wt%, ammonium sulfate 0.5wt%, potassium dihydrogen phosphate 0.1wt%, magnesium sulfate 0.05wt%, pH 6.8-7.2, sterilization condition 121℃ / 20min. 2. The fermentation medium is as follows: Standard fermentation tank initial culture medium: glucose 10wt%, corn slurry 1wt%, ammonium sulfate 0.5wt%, potassium dihydrogen phosphate 0.11wt%, magnesium sulfate 0.25wt%, ferrous sulfate 0.001wt%, manganese sulfate 0.001wt%, biotin 0.00001wt%, vitamin B1 0.00003wt%, L-methionine 0.01wt%, L-isoleucine 0.01wt%, natural pH, 121℃*20min; Feed solution: Solution A, 40-50wt% glucose, 0.05wt% magnesium sulfate. 3. Fermentation tank process (500L): Corynebacterium glutamicum IBCLQ-257, IBCLQ-257e and IBBH-15 were inoculated into the primary seed culture medium of the shake flask respectively. After culturing at 30°C and 85 rpm for 16 h, 500 mL of the shake flask seed solution was obtained. The maturity indicator of the primary seed solution was OD 562 8-12; 10% of the secondary seed solution was inoculated into a 500L fermenter, the fermentation volume was 300L, the fermentation temperature was 30°C, the pH was 6.7, the speed was 200RPM, the ventilation volume was 60LPM, and the tank pressure was 0.05Mpa. The speed and ventilation were adjusted alternately to keep the dissolved oxygen at 5-10%. The bacterial OD 562 After the growth reached 20, the pH increased to 6.9, and the feed was started when the residual sugar dropped to 2wt%; 562After the cell OD reached 30, the pH was raised to 7.1 and 1 mM lactose was added once (no addition is required for IBBH-15 strain); 562 After the pH increases to 40, it is raised to 7.2; after 48 hours, 1 mM is added to control the residual sugar to 2-3 wt%, and the tank is removed after the feed sugar is exhausted. Table 15 Main results of comparative example 4 As shown in Comparative Example 4, which uses corn steep liquor for L-leucine fermentation, compared with Example 1, it can be seen that the use of enzymatic molasses for L-leucine fermentation results in higher acid production and sugar-acid conversion rates, and less miscellaneous acids. In addition, molasses has fewer impurities and a lighter color than corn steep liquor, making it more conducive to subsequent separation and purification. Example 11 Effect of sRNAs25 Expression on Acid Production in L-Leucine-Producing Strain Genome Four rings of L-leucine production strain IBBH-15, genetically engineered strain IBCLQ-257e, and IBCLQ-257 slant were inoculated into 3 L shake flasks and cultured at 80 rpm and 30 °C until the OD 562 =15, and obtain the shake flask seed liquid for standby use. The shake flask seed liquid was inoculated into the fermentation medium of 30L fermenter according to the inoculation amount of 10% (V / V), and 1mM lactose was added at 48h to induce plasmid expression. The initial temperature was 30℃, the initial ventilation volume was 0.8L / min, and then the stirring speed and air volume were controlled to make the dissolved oxygen in the first 24h of the fermentation process 10-20%, and the dissolved oxygen after 24h was 5-15%; the pH of the fermentation process was controlled by automatic flow addition of ammonia water, and the initial pH value was controlled to 6.7, and the bacterial OD 562 After growing to 20, the pH increased to 6.9, and the bacterial OD 562 After the growth reached 25, the pH was raised to 7.0, and the bacterial OD 562 After increasing to 36, the pH is increased to 7.2; during the fermentation process, the residual sugar concentration is controlled at 20-30 g / L. Table 16 Main results of Example 11 As shown in Table 16, the genetically engineered strain IBCLQ-257e expressing the non-coding sRNA s25 in its genome had similar acid production capacity and mixed acid ratio to the strain IBCLQ-257 overexpressing sRNA s25 in the previous example. However, the fermentation cycle was shortened by 15.3% compared to the original strain, significantly reducing labor and energy consumption. Furthermore, the genome lacked antibiotic hazards, resulting in a significant overall advantage. Fermentation tank initial culture medium: glucose 100 g / L, ammonium sulfate 5 g / L, corn steep liquor 10 mL / L, potassium dihydrogen phosphate 5 g / L, magnesium sulfate 2.5 g / L, ferrous sulfate 0.01 g / L, manganese sulfate 0.01 g / L, biotin 100 μg / L, vitamin B1 300 μg / L, L-methionine 0.1 g / L, LL-isoleucine 0.1 g / L, L-glutamic acid 0.1 g / L, vegetable oil 1 mL / L, pH 7.0-7.2. Feed sugar solution: 400g / L glucose, 0.5g / L magnesium sulfate. Example 12 Preferred embodiment, beet molasses enzymatic hydrolysate, fed-batch, optimal feed AB ratio 5 / 1 1. The composition of the seed culture medium is as follows: Primary seed culture medium: glucose 3wt%, corn steep liquor powder 1.0wt%, ammonium sulfate 0.5wt%, KH2PO4 0.1wt%, MgSO4·7H2O 0.05wt%, calcium carbonate 1.0wt%, pH 6.7-7.2; aliquot into 500ml / 5000ml portions; sterilize at 121°C / 20min. Secondary seed tank culture medium: glucose 5wt%, beet molasses enzymatic hydrolyzate 3.0wt%, ammonium sulfate 0.5wt%, KH2PO4 0.1wt%, MgSO4·7H2O 0.05wt%, pH 6.8-7.2; sterilization condition 121°C / 20min. 2. The fermentation medium is as follows: Standard fermentation tank initial culture medium: glucose 10wt%, beet molasses enzymatic hydrolysate 2wt%, ammonium sulfate 1.0wt%, potassium dihydrogen phosphate 0.1wt%, magnesium sulfate 0.1wt%; Feed solution: Solution A: 40-50wt% glucose, 0.1wt% potassium dihydrogen phosphate, 0.05wt% magnesium sulfate; Solution B: 40-50wt% beet molasses enzymatic hydrolyzate; Solution C: 10-12% ammonium sulfate solution; when used, the concentrations of glucose and molasses need to be kept consistent. 3. Fermentation tank process (500L): Step 1: Inoculate the one-ring L-isoleucine producing bacteria IBCIL-253, IBCIL-253k, and IBCL-1 into the primary seed culture medium of the shake flask respectively. After shaking culture at 30°C and 90 rpm for 16 h, 500 mL of shake flask seed solution was obtained. The primary maturity indicator is OD 562 0.6-0.7*25; Step 2: The shake flask seed liquid was inoculated into a 50L secondary seed tank culture medium at a ratio of 1% (V / V), and fermented at 30°C, 200rpm, aeration ratio of 0.3VVM, pH 6.8, and dissolved oxygen not less than 10%. After 16 hours of seed tank culture, the secondary maturity indicator: OD 562 is 0.7-0.8*25; obtain secondary seed liquid; Step 3: (1) 10% of the secondary seed liquid was inoculated into the standard fermentation medium of a 500L fermentation tank. The initial fermentation temperature was 30°C and the pH was 6.8. During the fermentation process, the ventilation and speed were continuously adjusted to control the dissolved oxygen at about 10%. The OD value of the bacteria in the fermentation liquid was 0. 562 When the cell size is about 40, the pH is adjusted to about 7.0, and 1 mM lactose is added at one time (no addition is required for IBCL-1 strain); when the residual sugar content of the fermentation broth drops to 6 wt%, the osmotic pressure of the fermentation broth is controlled at about 700 mosm / L by feeding ammonium sulfate; (2) when the residual sugar content is lower than 2 wt%, the residual sugar content is controlled at about 2.0 wt% by feeding, and the feeding ratio of feed A and feed B is controlled to 5 / 1. At the same time, the inorganic salt feeding solution is continued to be fed to control the osmotic pressure of the fermentation broth at about 900 mosm / L. The fermentation ends when the sugar is consumed. Table 17 Main results of Example 12 As shown in Example 12, the core of the present invention is to obtain beet molasses hydrolyzate by enzymatic hydrolysis of beet molasses using sucrase and protease, and then control the residual sugar by adding glucose solution and beet molasses hydrolyzate in a certain ratio during the isoleucine fermentation process. This method can not only control the residual sugar, but also prevent the bacteria from growing too fast by adding an organic nitrogen source. After the enzymatic hydrolysis, the sucrose in the beet molasses is completely hydrolyzed into glucose and fructose, which are easier to be utilized by the bacteria. The protease can enzymatically hydrolyze large molecular proteins to make full use of the nitrogen source, thereby achieving the purpose of complete utilization of the carbon and nitrogen sources of the molasses. In the fermentation process, acid production refers to the actual concentration of L-isoleucine in the fermentation broth. The calculation formula of sugar-acid conversion rate is as follows: Sugar-acid conversion rate = (actual L-isoleucine concentration × actual fermentation volume) / (actual total glucose consumption × 100%) Meanwhile, miscellaneous acids refer to the sum of valine, lysine, alanine, and glutamic acid in the fermentation broth. These two parameters are used together to evaluate the efficiency of the fermentation process and the composition of the product. In summary, Corynebacterium glutamicum IBCIL-253, IBCL-1, and IBCIL-253k have obvious advantages in L-isoleucine production, sugar-acid conversion rate, and miscellaneous acids in the process of Example 1. Example 13 Confirm the initial addition amount range and determine the feed AB ratio 1. The seed process is consistent with Example 12. 2. The fermentation medium is as follows: Standard fermentation tank initial culture medium: glucose 10wt%, beet molasses enzymatic hydrolysate 1.5-2.5wt%, ammonium sulfate 1.0wt%, potassium dihydrogen phosphate 0.1wt%, magnesium sulfate 0.1wt%; Feed solution: Solution A: 40-50wt% glucose, 0.1wt% potassium dihydrogen phosphate, 0.05wt% magnesium sulfate; Solution B: 40-50wt% beet molasses enzymatic hydrolyzate; Solution C: 10-12% ammonium sulfate solution; when used, the concentrations of glucose and molasses need to be kept consistent. 3. Fermentation tank process (500L): Step 1: Inoculate the one-ring L-isoleucine producing bacteria IBCIL-253, IBCIL-253k, and IBCL-1 into the primary seed culture medium of the shake flask respectively. After shaking culture at 30°C and 90 rpm for 16 h, 500 mL of shake flask seed solution was obtained. The primary maturity indicator is OD 562 0.6-0.7*25; Step 2: The shake flask seed liquid was inoculated into a 50L secondary seed tank culture medium at a ratio of 1% (V / V), and fermented at 30°C, 200rpm, aeration ratio of 0.3VVM, pH 6.8, and dissolved oxygen not less than 10%. After 16 hours of seed tank culture, the secondary maturity indicator: OD 562 is 0.7-0.8*25; obtain secondary seed liquid; Step 3: (1) 10% of the secondary seed liquid was inoculated into the standard fermentation medium of a 500L fermentation tank. The initial fermentation temperature was 30°C and the pH was 6.8. During the fermentation process, the ventilation and speed were continuously adjusted to control the dissolved oxygen at about 10%. The OD value of the bacteria in the fermentation liquid was 0. 562 When the cell size is about 40, the pH is adjusted to about 7.0, and 1 mM lactose is added at one time (IBCL-1 strain does not need to be added); when the residual sugar content of the fermentation broth drops to 6 wt%, the osmotic pressure of the fermentation broth is controlled at about 700 mosm / L by feeding ammonium sulfate; (2) when the residual sugar content is lower than 2 wt%, the residual sugar content is controlled at about 2.0 wt% by feeding, and the feeding ratio of feeds A and B is controlled to 4 / 1-7 / 1. At the same time, the inorganic salt feeding solution is continued to be fed to control the osmotic pressure of the fermentation broth at about 900 mosm / L. The fermentation ends when the sugar is consumed. Table 18 Main results of Example 13 As shown in Example 13, the initial addition amount of beet molasses hydrolysate was controlled at 1.5-2.5 wt %, and the A / B ratio was in the range of 4 / 1-7 / 1, which was slightly lower than that in Example 1. This example demonstrates that the initial addition amount of molasses hydrolysate and the ratio of A to B during feeding are very important for increasing the acid production of L-isoleucine fermentation and controlling the miscellaneous acids. Example 14 Determining the suitability of molasses enzymatic hydrolysate process for beet molasses and sugarcane molasses 1. The seed process is consistent with Example 12. 2. The fermentation medium is as follows: The initial culture medium for standard fermentation tank fermentation is as follows: 10 wt% glucose, 2 wt% of a mixture of beet and sugarcane molasses hydrolysates in a certain proportion, 1.0 wt% ammonium sulfate, 0.1 wt% potassium dihydrogen phosphate, and 0.1 wt% magnesium sulfate; Feed solution: Solution A: 40-50wt% glucose, 0.1wt% potassium dihydrogen phosphate, 0.05wt% magnesium sulfate; Solution B: 40-50wt% beet and sugarcane molasses enzymatic hydrolyzate; Solution C: 10-12% ammonium sulfate solution; when used, the concentrations of glucose and molasses need to be kept consistent. 3. Fermentation tank process (500L): Step 1: Inoculate the one-ring L-isoleucine producing bacteria IBCIL-253, IBCIL-253k, and IBCL-1 into the primary seed culture medium of the shake flask respectively. After shaking culture at 30°C and 90 rpm for 16 h, 500 mL of shake flask seed solution was obtained. The primary maturity indicator is OD 562 0.6-0.7*25; Step 2: The shake flask seed liquid was inoculated into a 50L secondary seed tank culture medium at a ratio of 1% (V / V), and fermented at 30°C, 200rpm, aeration ratio of 0.3VVM, pH 6.8, and dissolved oxygen not less than 10%. After 16 hours of seed tank culture, the secondary maturity indicator: OD 562 is 0.7-0.8*25; obtain secondary seed liquid; Step 3: (1) 10% of the secondary seed liquid was inoculated into the standard fermentation medium of a 500L fermentation tank. The initial fermentation temperature was 30°C and the pH was 6.8. During the fermentation process, the ventilation and speed were continuously adjusted to control the dissolved oxygen at about 10%. The OD value of the bacteria in the fermentation liquid was 0. 562When the cell size is about 40, the pH is adjusted to about 7.0, and 1 mM lactose is added at one time (no addition is required for IBCL-1 strain); when the residual sugar content of the fermentation broth drops to 6 wt%, the osmotic pressure of the fermentation broth is controlled at about 700 mosm / L by feeding ammonium sulfate; (2) when the residual sugar content is lower than 2 wt%, the residual sugar content is controlled at about 2.0 wt% by feeding, and the feeding ratio of feed A and feed B is controlled to 5 / 1. At the same time, the inorganic salt feeding solution is continued to be fed to control the osmotic pressure of the fermentation broth at about 900 mosm / L. The fermentation ends when the sugar is consumed. Table 19 Main results of Example 14 As shown in Example 14, after sugarcane molasses is enzymatically hydrolyzed by sucrase and protease, it can be mixed with beet molasses enzymatic hydrolyzate in a certain ratio to achieve the desired effect. However, the sugarcane molasses enzymatic hydrolyzate alone is slightly lower than the beet molasses in Example 12. This example demonstrates that sugarcane molasses enzymatic hydrolysate can be used as an organic nitrogen source in the L-isoleucine production process. Example 15 confirmed that partially enzymatically hydrolyzed molasses can also be used for fermentation 1. The seed process is consistent with Example 12. 2. The fermentation medium is as follows: Standard fermentation tank fermentation initial medium: glucose 10wt%, partially enzymatically hydrolyzed beet / sugarcane molasses 2wt%, ammonium sulfate 1.0wt%, potassium dihydrogen phosphate 0.1wt%, magnesium sulfate 0.1wt%; Feed solution: Solution A: 40-50wt% glucose, 0.1wt% potassium dihydrogen phosphate, 0.05wt% magnesium sulfate; Solution B: 40-50wt% partially enzymatically hydrolyzed beet or sugarcane molasses solution; Solution C: 10-12% ammonium sulfate solution; when used, the concentrations of glucose and molasses need to be kept consistent. 3. Fermentation tank process (500L): Step 1: Inoculate the one-ring L-isoleucine producing bacteria IBCIL-253, IBCIL-253k, and IBCL-1 into the primary seed culture medium of the shake flask respectively. After shaking culture at 30°C and 90 rpm for 16 h, 500 mL of shake flask seed solution was obtained. The primary maturity indicator is OD 562 0.6-0.7*25; Step 2: The shake flask seed liquid was inoculated into a 50L secondary seed tank culture medium at a ratio of 1% (V / V), and fermented at 30°C, 200rpm, aeration ratio of 0.3VVM, pH 6.8, and dissolved oxygen not less than 10%. After 16 hours of seed tank culture, the secondary maturity indicator: OD 562 is 0.7-0.8*25; obtain secondary seed liquid; Step 3: (1) 10% of the secondary seed liquid was inoculated into the standard fermentation medium of a 500L fermentation tank. The initial fermentation temperature was 30°C and the pH was 6.8. During the fermentation process, the ventilation and speed were continuously adjusted to control the dissolved oxygen at about 10%. The OD value of the bacteria in the fermentation liquid was 0. 562 When the cell size is about 40, the pH is adjusted to about 7.0, and 1 mM lactose is added at one time (no addition is required for IBCL-1 strain); when the residual sugar content of the fermentation broth drops to 6 wt%, the osmotic pressure of the fermentation broth is controlled at about 700 mosm / L by feeding ammonium sulfate; (2) when the residual sugar content is lower than 2 wt%, the residual sugar content is controlled at about 2.0 wt% by feeding, and the feeding ratio of feed A and feed B is controlled to 5 / 1. At the same time, the inorganic salt feeding solution is continued to be fed to control the osmotic pressure of the fermentation broth at about 900 mosm / L. The fermentation ends when the sugar is consumed. Table 20 Main results of Example 15 As shown in Example 15, two types of molasses were subjected to sucrase enzymolysis and protease enzymolysis, respectively. After obtaining the enzymatic hydrolysates, L-isoleucine fermentation verification was performed. This example shows that partially enzymatically hydrolyzed molasses can still be used in fermentation, but the results are lower than those of complete enzymatic hydrolysis. Example 16 determines the range of total molasses usage 1. The seed process is consistent with Example 12. 2. The fermentation medium is as follows: Standard fermentation tank initial culture medium: glucose 10wt%, beet molasses enzymatic hydrolysate 2wt%, ammonium sulfate 1.0wt%, potassium dihydrogen phosphate 0.1wt%, magnesium sulfate 0.1wt%; Feed solution: Solution A: 40-50wt% glucose, 0.1wt% potassium dihydrogen phosphate, 0.05wt% magnesium sulfate; Solution B: 40-50wt% beet molasses enzymatic hydrolyzate; Solution C: 10-12% ammonium sulfate solution; when used, the concentrations of glucose and molasses need to be kept consistent. 3. Fermentation tank process (500L): Step 1: Inoculate the one-ring L-isoleucine producing bacteria IBCIL-253, IBCIL-253k, and IBCL-1 into the primary seed culture medium of the shake flask respectively. After shaking culture at 30°C and 90 rpm for 16 h, 500 mL of shake flask seed solution was obtained. The primary maturity indicator is OD 562 0.6-0.7*25; Step 2: The shake flask seed liquid was inoculated into a 50L secondary seed tank culture medium at a ratio of 1% (V / V), and fermented at 30°C, 200rpm, aeration ratio of 0.3VVM, pH 6.8, and dissolved oxygen not less than 10%. After 16 hours of seed tank culture, the secondary maturity indicator: OD 562is 0.7-0.8*25; obtain secondary seed liquid; Step 3: (1) 10% of the secondary seed liquid was inoculated into the standard fermentation medium of a 500L fermentation tank. The initial fermentation temperature was 30°C and the pH was 6.8. During the fermentation process, the ventilation and speed were continuously adjusted to control the dissolved oxygen at about 10%. The OD value of the bacteria in the fermentation liquid was 0. 562 When the cell size is about 40, the pH is adjusted to about 7.0, and 1 mM lactose is added at one time (no addition is required for IBCL-1 strain); when the residual sugar content of the fermentation broth drops to 6 wt%, the osmotic pressure of the fermentation broth is controlled at about 700 mosm / L by feeding ammonium sulfate; (2) when the residual sugar content is lower than 2 wt%, the residual sugar content is controlled at about 2.0 wt% by feeding, and the feeding ratio of feed A and feed B is controlled to 4 / 1. At the same time, the inorganic salt feeding solution is continued to be fed to control the osmotic pressure of the fermentation broth at about 900 mosm / L. The fermentation ends when the sugar is consumed. Table 21 Main results of Example 16 The total concentration of molasses is the total amount of molasses divided by the volume of the fermentation tank. As shown in Example 16, the optimization verification of the total amount of molasses was carried out respectively. The results showed that the ideal result could be achieved when the total concentration of molasses hydrolysate was 3.5-4.5wt%. This result shows that there is a certain requirement for the amount of molasses hydrolysate, which cannot be too low or too high. Example 17 Effect of sRNAs25 Expression on Acid Production in L-Isoleucine-Producing Strain Two rings of L-isoleucine producing bacteria IBCL-1 and genetically engineered bacteria IBCIL-253k and IBCIL-253 slant lawn were inoculated into 3 L shake flasks, which were placed at 30 ° C, 90 rpm, and shaken for 16 h until the OD 562 =15, obtain the shake flask seed solution and set aside. Inoculate the shake flask seed solution into the fermentation medium of 30L fermenter at a 10% (V / V) inoculation volume, and add 1mM lactose at 18h to induce plasmid expression. The initial temperature is 30℃, pH 6.8, and the ventilation and speed are constantly adjusted during the fermentation process to control the dissolved oxygen at around 10%. At 48h, add 1mM lactose to induce plasmid expression. The OD value of the strain in the fermentation liquid is 0. 562 After the fermentation reached approximately 40°C, the pH was adjusted to approximately 7.0. When the residual sugar content of the fermentation broth dropped to 6%, an inorganic salt feed solution was added to control the osmotic pressure of the fermentation broth at approximately 700 mosm / L. When the residual sugar content dropped below 1%, the residual sugar content of the fermentation broth was controlled at approximately 1% by adding a sugar feed solution, while the inorganic salt feed solution was continued to control the osmotic pressure of the fermentation broth at approximately 900 mosm / L. The fermentation was completed after approximately 30 hours of sugar consumption. The fermentation yield is shown in Table 22. Table 22 Main results of Example 17 As can be seen from Table 22, the genetically engineered bacterium IBCIL-253k expressing the non-coding sRNA s25 in its genome has similar acid production capacity and mixed acid ratio to the strain IBCIL-253 overexpressing sRNA s25 in the previous example, but the fermentation cycle is 10% shorter than that of the original strain, greatly reducing labor energy consumption, and there is no antibiotic risk in the genome, which has obvious advantages overall. Seed culture medium: glucose 30 g / L, corn steep liquor powder 10 g / L, ammonium sulfate 5 g / L, potassium dihydrogen phosphate 1 g / L, magnesium sulfate 0.5 g / L, calcium carbonate 10 g / L, pH 6.7-7.2; aliquot into 500 ml / 5000 ml portions; sterilize at 121°C / 20 min. Fermentation medium: glucose 100 g / L, corn steep liquor powder 8 g / L, ammonium sulfate 5 g / L, potassium dihydrogen phosphate 1 g / L, magnesium sulfate 0.5 g / L; Feed sugar solution: 400 g / L glucose, 1 g / L potassium dihydrogen phosphate, 0.5 g / L magnesium sulfate; Inorganic salt feed solution: ammonium sulfate 100g / L. Comparative Example 5: One-time addition of molasses process versus fed-batch process 1. The seed process is consistent with Example 12. 2. The fermentation medium is as follows: Standard fermentation tank initial culture medium: glucose 10wt%, beet molasses enzymatic hydrolysate 2.5-4.5wt%, ammonium sulfate 1.0wt%, potassium dihydrogen phosphate 0.1wt%, magnesium sulfate 0.1wt%; Feed solution: Solution A: 40-50wt% glucose, 0.1wt% potassium dihydrogen phosphate, 0.05wt% magnesium sulfate; Solution C: 10-12% ammonium sulfate solution; when used, the concentrations of glucose and molasses need to be kept consistent. 3. Fermentation tank process (500L): Step 1: Inoculate the one-ring L-isoleucine producing bacteria IBCIL-253, IBCIL-253k, and IBCL-1 into the primary seed culture medium of the shake flask respectively. After shaking culture at 30°C and 90 rpm for 16 h, 500 mL of shake flask seed solution was obtained. The primary maturity indicator is OD 562 0.6-0.7*25; Step 2: The shake flask seed liquid was inoculated into a 50L secondary seed tank culture medium at a ratio of 1% (V / V), and fermented at 30°C, 200rpm, aeration ratio of 0.3VVM, pH 6.8, and dissolved oxygen not less than 10%. After 16 hours of seed tank culture, the secondary maturity indicator: OD 562 is 0.7-0.8*25; obtain secondary seed liquid; Step 3: (1) 10% of the secondary seed liquid was inoculated into the standard fermentation medium of a 500L fermentation tank. The initial fermentation temperature was 30°C and the pH was 6.8. During the fermentation process, the ventilation and speed were continuously adjusted to control the dissolved oxygen at about 10%. The OD value of the bacteria in the fermentation liquid was 0. 562 When the cell size is about 40, the pH is adjusted to about 7.0, and 1 mM lactose is added at one time (no addition is required for IBCL-1 strain); when the residual sugar content of the fermentation broth drops to 6 wt%, the osmotic pressure of the fermentation broth is controlled at about 700 mosm / L by adding ammonium sulfate feed solution; (2) when the residual sugar content is lower than 2 wt%, the residual sugar content is controlled at about 2.0 wt% by feeding, and the osmotic pressure of the fermentation broth is controlled at about 900 mosm / L by continuing to add inorganic salt feed solution, and the fermentation ends when the sugar is consumed. Table 23 Main results of comparative example 5 The concentration of the one-time added molasses enzymatic hydrolysate is the amount of molasses enzymatic hydrolysate added according to the initial fermentation volume. As shown in Comparative Example 5, the acid production results of the comparative examples are lower when molasses is added at one time. This is mainly because the one-time addition of too much organic nitrogen source will cause the bacteria to grow too fast and waste more sugar for bacteria reproduction, which in turn leads to acid production failing to achieve the expected effect. Therefore, the fed-batch method is more suitable for L-isoleucine fermentation. Comparative Example 6 confirmed that the initial addition amount should not be too high or too low 1. The seed process is consistent with that in Example 11. 2. The fermentation medium is as follows: Standard fermentation tank initial culture medium: glucose 10wt%, beet molasses hydrolyzate 1 or 3wt%, ammonium sulfate 1.0wt%, potassium dihydrogen phosphate 0.1wt%, magnesium sulfate 0.1wt%; Feed solution: Solution A: 40-50wt% glucose, 0.1wt% potassium dihydrogen phosphate, 0.05wt% magnesium sulfate; Solution B: 40-50wt% beet molasses enzymatic hydrolyzate; Solution C: 10-12% ammonium sulfate solution; when used, the concentrations of glucose and molasses need to be kept consistent. 3. Fermentation tank process (500L): Step 1: Inoculate the one-ring L-isoleucine producing bacteria IBCIL-253, IBCIL-253k, and IBCL-1 into the primary seed culture medium of the shake flask respectively. After shaking culture at 30°C and 90 rpm for 16 h, 500 mL of shake flask seed solution was obtained. The primary maturity indicator is OD 562 0.6-0.7*25; Step 2: The shake flask seed liquid was inoculated into a 50L secondary seed tank culture medium at a ratio of 1% (V / V), and fermented at 30°C, 200rpm, aeration ratio of 0.3VVM, pH 6.8, and dissolved oxygen not less than 10%. After 16 hours of seed tank culture, the secondary maturity indicator: OD 562 is 0.7-0.8*25; obtain secondary seed liquid; Step 3: (1) 10% of the secondary seed liquid was inoculated into the standard fermentation medium of a 500L fermentation tank. The initial fermentation temperature was 30°C and the pH was 6.8. During the fermentation process, the ventilation and speed were continuously adjusted to control the dissolved oxygen at about 10%. The OD value of the bacteria in the fermentation liquid was 0. 562 When the cell size is about 40, the pH is adjusted to about 7.0, and 1 mM lactose is added at one time (no addition is required for IBCL-1 strain); when the residual sugar content of the fermentation broth drops to 6 wt%, the osmotic pressure of the fermentation broth is controlled at about 700 mosm / L by feeding ammonium sulfate; (2) when the residual sugar content is lower than 2 wt%, the residual sugar content is controlled at about 2.0 wt% by feeding, and the feeding ratio of feed A and feed B is controlled to 5 / 1. At the same time, the inorganic salt feeding solution is continued to be fed to control the osmotic pressure of the fermentation broth at about 900 mosm / L. The fermentation ends when the sugar is consumed. Table 24 Main results of comparative example 6 As shown in Comparative Example 6, different initial addition amounts of molasses hydrolysate were verified. This comparative example shows that the initial addition amount is particularly important during the addition of molasses hydrolysate, and as described in the example, it needs to be controlled within the range of 1.5-2.5 wt%. Comparative Example 7 confirmed that the ratio of feed AB should not be too high or too low 1. The seed process is consistent with that in Example 11. 2. The fermentation medium is as follows: Standard fermentation tank initial culture medium: glucose 10wt%, beet molasses hydrolyzate 1.8-2.2wt%, ammonium sulfate 1.0wt%, potassium dihydrogen phosphate 0.1wt%, magnesium sulfate 0.1wt%; Feed solution: Solution A: 40-50wt% glucose, 0.1wt% potassium dihydrogen phosphate, 0.05wt% magnesium sulfate; Solution B: 40-50wt% beet molasses enzymatic hydrolyzate; Solution C: 10-12% ammonium sulfate solution; when used, the concentrations of glucose and molasses need to be kept consistent. 3. Fermentation tank process (500L): Step 1: Inoculate the one-ring L-isoleucine producing bacteria IBCIL-253, IBCIL-253k, and IBCL-1 into the primary seed culture medium of the shake flask respectively. After shaking culture at 30°C and 90 rpm for 16 h, 500 mL of shake flask seed solution was obtained. The primary maturity indicator is OD 562 0.6-0.7*25; Step 2: The shake flask seed liquid was inoculated into a 50L secondary seed tank culture medium at a ratio of 1% (V / V), and fermented at 30°C, 200rpm, aeration ratio of 0.3VVM, pH 6.8, and dissolved oxygen not less than 10%. After 16 hours of seed tank culture, the secondary maturity indicator: OD 562 is 0.7-0.8*25; obtain secondary seed liquid; Step 3: (1) 10% of the secondary seed liquid was inoculated into the standard fermentation medium of a 500L fermentation tank. The initial fermentation temperature was 30°C and the pH was 6.8. During the fermentation process, the ventilation and speed were continuously adjusted to control the dissolved oxygen at about 10%. The OD value of the bacteria in the fermentation liquid was 0. 562 When the cell size is about 40, the pH is adjusted to about 7.0, and 1 mM lactose is added at one time (no addition is required for IBCL-1 strain); when the residual sugar content of the fermentation broth drops to 6 wt%, the osmotic pressure of the fermentation broth is controlled at about 700 mosm / L by feeding ammonium sulfate; (2) when the residual sugar content is lower than 2 wt%, the residual sugar content is controlled at about 2.0 wt% by feeding, and the feeding ratio of feeds A and B is controlled to 3 / 1 or 8 / 1, while inorganic salt feeding is continued to be fed to control the osmotic pressure of the fermentation broth at about 900 mosm / L, and the fermentation ends when the sugar is consumed. Table 25 Main results of comparative example 7 As shown in Comparative Example 7, the ratio of feed A and feed B was verified respectively. The results showed that the ratio of feed AB needed to be in the range of 4 / 1-7 / 1 according to the embodiment. Too high or too low would not meet the requirements. Comparative Example 8 confirmed that molasses must be enzymatically hydrolyzed to achieve the effect of increasing acid production. 1. The seed process is consistent with that in Example 11. 2. The fermentation medium is as follows: Standard fermentation tank fermentation initial medium: glucose 10wt%, beet / cane molasses 2wt%, ammonium sulfate 1.0wt%, potassium dihydrogen phosphate 0.1wt%, magnesium sulfate 0.1wt%; Feed solution: Solution A: 40-50wt% glucose, 0.1wt% potassium dihydrogen phosphate, 0.05wt% magnesium sulfate; Solution B: 40-50wt% beet / sugarcane molasses; Solution C: 10-12% ammonium sulfate solution; when used, the concentrations of glucose and molasses need to be kept consistent. 3. Fermentation tank process (500L): Step 1: Inoculate the one-ring L-isoleucine producing bacteria IBCIL-253, IBCIL-253k, and IBCL-1 into the primary seed culture medium of the shake flask respectively. After shaking culture at 30°C and 90 rpm for 16 h, 500 mL of shake flask seed solution was obtained. The primary maturity indicator is OD 562 0.6-0.7*25; Step 2: The shake flask seed liquid was inoculated into a 50L secondary seed tank culture medium at a ratio of 1% (V / V), and fermented at 30°C, 200rpm, aeration ratio of 0.3VVM, pH 6.8, and dissolved oxygen not less than 10%. After 16 hours of seed tank culture, the secondary maturity indicator: OD 562 is 0.7-0.8*25; obtain secondary seed liquid; Step 3: (1) 10% of the secondary seed liquid was inoculated into the standard fermentation medium of a 500L fermentation tank. The initial fermentation temperature was 30°C and the pH was 6.8. During the fermentation process, the ventilation and speed were continuously adjusted to control the dissolved oxygen at about 10%. The OD value of the bacteria in the fermentation liquid was 0. 562 When the cell size is about 40, the pH is adjusted to about 7.0, and 1 mM lactose is added at one time (no addition is required for IBCL-1 strain); when the residual sugar content of the fermentation broth drops to 6 wt%, the osmotic pressure of the fermentation broth is controlled at about 700 mosm / L by feeding ammonium sulfate; (2) when the residual sugar content is lower than 2 wt%, the residual sugar content is controlled at about 2.0 wt% by feeding, and the feeding ratio of feed A and feed B is controlled to 5 / 1. At the same time, the inorganic salt feeding solution is continued to be fed to control the osmotic pressure of the fermentation broth at about 900 mosm / L. The fermentation ends when the sugar is consumed. Table 26 Main results of comparative example 8 As shown in Comparative Example 8, the L-isoleucine fermentation verification was carried out using non-enzymatically hydrolyzed molasses, and the result was not ideal, and the fermentation effect of enzymatically hydrolyzed molasses was not achieved. Therefore, it can be concluded from this comparative example that enzymatic hydrolysis of molasses is more conducive to L-isoleucine fermentation. Comparative Example 9 confirms the advantages of the new process provided by the examples of this specification 1. The composition of the seed culture medium is as follows: Primary seed culture medium: glucose 3wt%, corn steep liquor powder 1.0wt%, ammonium sulfate 0.5wt%, KH2PO4 0.1wt%, MgSO4·7H2O 0.05wt%, calcium carbonate 1.0wt%, pH 6.7-7.2; aliquot into 500ml / 5000ml portions; sterilize at 121°C / 20min. Secondary seed tank culture medium: glucose 5wt%, corn steep liquor powder 1.0wt%, ammonium sulfate 0.5wt%, KH2PO4 0.1wt%, MgSO4·7H2O 0.05wt%, pH 6.8-7.2; sterilization condition 121°C / 20min. 2. The fermentation medium is as follows: Standard fermentation tank fermentation initial culture medium: glucose 12wt%, corn steep liquor dry powder 0.8wt%, ammonium sulfate 0.5wt%, potassium dihydrogen phosphate 0.1wt%, magnesium sulfate 0.05wt%; Feed sugar solution: 40wt% glucose, 0.1wt% potassium dihydrogen phosphate, 0.05wt% magnesium sulfate; Inorganic salt feeding solution: ammonium sulfate 10wt%; Fermentation waste liquid: The separated waste liquid obtained from fermentation separation is rich in ammonium sulfate, about 10-12 wt%; 3. Fermentation tank process: Step 1: Inoculate the one-ring L-isoleucine producing bacteria IBCIL-253, IBCIL-253k, and IBCL-1 into the primary seed culture medium of the shake flask respectively. After shaking culture at 30°C and 90 rpm for 16 h, 500 mL of shake flask seed solution was obtained. The primary maturity indicator is OD 562 0.6-0.7*25; Step 2: The shake flask seed solution was added to 50L of secondary seed tank culture medium at a ratio of 1% (V / V), and fermented at 30℃, 90rpm, pH 6.8, and dissolved oxygen not less than 10%. After 16 hours of seed tank culture, the secondary maturity indicator: OD 562 is 0.7-0.8*25; obtain secondary seed liquid; Step 3: (1) 10% of the secondary seed liquid was inoculated into the standard fermentation medium of a 500L fermentation tank. The initial fermentation temperature was 30°C and the pH was 6.8. During the fermentation process, the ventilation and speed were continuously adjusted to control the dissolved oxygen at about 10%. The OD value of the bacteria in the fermentation liquid was 0. 562 When the cell size is about 40, the pH is adjusted to about 7.0, and 1 mM lactose is added at one time (IBCL-1 strain does not need to be added); when the residual sugar content of the fermentation liquid drops to 6 wt%, the osmotic pressure of the fermentation liquid is controlled at about 700 mosm / L by adding inorganic salt feed solution; (2) when the residual sugar content is lower than 1 wt%, the residual sugar content of the fermentation liquid is controlled at about 1.0 wt% by adding feed sugar solution, and the osmotic pressure of the fermentation liquid is controlled at about 900 mosm / L by continuing to add inorganic salt feed solution, and the fermentation ends when the sugar is consumed. Table 27 Main results of comparative example 9 As shown in Comparative Example 9, which used corn steep liquor for L-isoleucine fermentation, compared with Example 12, it can be seen that the use of enzymatic molasses for L-isoleucine fermentation resulted in higher acid production and sugar-acid conversion rates, and less miscellaneous acids. In addition, molasses had fewer impurities and a lighter color than corn steep liquor, making it more conducive to subsequent separation and purification. The above separation and purification methods are described in detail below through a number of examples and comparative examples. It should be noted that the reaction conditions, reaction materials, and amounts of reaction materials in the examples are for illustration only and do not limit the scope of protection of this specification. The comparative examples are the control groups of the examples. Example 18: MPN Reagent Precipitation Method Combined with a Composite Acid System to Suppress Mixed Crystals (Purification of L-Isoleucine) Example 18 Steps: Preparation of MPN reagent: polyglutamic acid (10 kDa) and Fe 3+ Mix at a ratio of 1:2.5 to form a 5% w / v solution at pH 4.5. Complex precipitation: add 1.5% MPN reagent to the filtrate (100 L), stir for 40 min, and centrifuge (4000 rpm, 15 min) to collect the precipitate. Salt re-dissolution: 100 kg of the complex precipitate was mixed with p-toluenesulfonic acid (molar ratio 1:1.5) to a solid content of 50%, and dissolved at 60°C. Hydrogen bond reconstruction: 1 M hydrochloric acid was added in stages to adjust the pH to 1.2 and stirred for 30 min. Gradient crystallization: cool to 10°C at a rate of 10°C / h, incubate the crystals for 1 hour, and filter to obtain the crystal cake. Decolorization: Add 1.5% malic acid, 0.15% tartaric acid, and 1‰ activated carbon for decolorization for 40 minutes. Ion exchange: Use YN201 resin for adsorption and gradient hydrochloric acid regeneration (0.5M to recover p-toluenesulfonic acid → 3M to completely regenerate the resin). Crystallization: The finished product is obtained after evaporation and crystallization. The main results of Example 18 are: Purity: 99.6% (L-isoleucine), impurities L-α-aminobutyric acid: 0.03%; L-norvaline: 0.04%. Recovery rate of p-toluenesulfonic acid: 85%. Comparative Example 10 Single hydrochloric acid system Comparative Example 10: Steps: Omit the precipitant and the composite acid, and only use 1 M hydrochloric acid for redissolution, with other conditions being the same. Main results of Comparative Example 10: Purity 92.5% (impurities L-α-aminobutyric acid 0.54%; L-norvaline: 0.63%). Conclusion: The composite acid system significantly reduced the impurity content (L-α-aminobutyric acid was reduced by 94%, and L-norvaline was reduced by 94%). Example 19 Gradient Cooling Crystallization to Improve Purity and Yield (Purification of L-Leucine) Example 19 Steps: Salt reconstitution: 100 kg of crude L-leucine (purity 82%), p-toluenesulfonic acid molar ratio 1:2, solid content 45%, dissolved at 55°C. Hydrogen bond reconstruction: add 1.5 M hydrochloric acid to adjust the pH to 1.5. Gradient crystallization: cool down to 15°C at 12°C / h and incubate the crystals for 45 min. Decolorization: 1% malic acid, 1% tartaric acid, 0.8‰ activated carbon decolorization. Ion exchange: Gradient hydrochloric acid regeneration (0.5M→3M). Example 19 Results: Yield: 93% Purity: 99.5% (impurity L-norvaline 0.04%). Comparative Example 11 Rapid Cooling Gradient crystallization: cooling rate 20℃ / h, no crystal growth step. Results of Comparative Example 11: Purity 97.5% (impurity L-norvaline 0.32%), yield 83%. Conclusion: Gradient cooling combined with crystal growth can increase the yield by 10% and the purity by 87.5%. Example 20: Recycling of p-toluenesulfonic acid (purification of L-valine) Example 20 Steps: Salt re-dissolution: 100 kg of crude L-valine (purity 80%), p-toluenesulfonic acid molar ratio 1:1.8, solid content 55%. Ion exchange: adsorption with YN269 resin, elution with 0.5 M hydrochloric acid to recover p-toluenesulfonic acid. Recycling: The recovered p-toluenesulfonic acid is directly used in the next batch. Example 20 Results: Recycling rate: 85% (purity ≥ 95% after 5 consecutive batches). Cost comparison: Raw material costs are reduced by 40% (the traditional process requires new precipitant for each batch). Comparative Example 12 No Circulation Comparative Example 12 Step: New p-toluenesulfonic acid was used in each batch without recycling. Results of Comparative Example 12: Raw material cost increased by 45%, and waste liquid COD was ≥800 mg / L. Conclusion: Closed-loop regeneration technology reduces raw material costs and reduces waste liquid COD to below 200 mg / L. Example 21 Optimization of Activated Carbon Dosage (Mixed Amino Acid Decolorization) Example 21 Steps: Salt reconstitution: Mix crude amino acids (leucine + isoleucine + valine) and p-toluenesulfonic acid at a molar ratio of 1:1.2. Decolorization: Add 2% malic acid, 1% tartaric acid, and 0.5‰ activated carbon for decolorization for 30 minutes. Example 21 Results: Decolorization efficiency: 98% (absorbance ≤ 0.05). Activated carbon dosage: 0.5kg / ton of product. Comparative Example 13 contains no organic acid. Comparative Example 13: Omit malic acid and tartaric acid, and use only activated carbon for decolorization (requires 3‰). Results of Comparative Example 13: Decolorization efficiency 85% (absorbance ≥ 0.2), activated carbon dosage 3 kg / ton product. Conclusion: Organic acids synergistically reduce the amount of activated carbon used by 83% and improve the decolorization efficiency by 13%. Example 22 Preferred Example Comprehensive Process Parameters (L-Isoleucine) Example 22 Specific process parameters: Preparation of MPN reagent: polyglutamic acid (10 kDa) and Fe 3+ Mix at a ratio of 1:2.5 to form a 5% w / v solution at pH 4.5. Complex precipitation: add 1.5% MPN reagent to the filtrate (100 L), stir for 40 min, and centrifuge (4000 rpm, 15 min) to collect the precipitate. Salt re-dissolution: molar ratio 1:1.5, solid content 50%, dissolution at 60℃. Hydrogen bond reconstruction: Adjust the pH to 1.2 with 1 M hydrochloric acid. Gradient crystallization: cool down to 10°C at 10°C / h and incubate the crystals for 1 hour. Decolorization: 1.5% malic acid + 0.15% tartaric acid, 1‰ activated carbon decolorization for 40 minutes. Ion exchange: YN201 resin, 0.5M hydrochloric acid elution to recover p-toluenesulfonic acid → 3M hydrochloric acid to regenerate the resin. Evaporation crystallization: vacuum concentration temperature 55 ° C, vacuum degree 0.09 MPa. Example 22 Results: Purity: 99.7% (L-isoleucine). Impurity content: L-α-aminobutyric acid 0.02%, L-norvaline 0.03%. Total yield: 95%. By comparing the above embodiments with the comparative examples, the dynamic complexation precipitation technology, composite acid synergistic system, gradient crystallization control, and closed-loop regeneration technology of the metal-polypeptide network (MPN) provided in this specification significantly improve the purity and yield of branched-chain amino acids, while reducing the amount of activated carbon used and the cost of three wastes treatment, verifying its high efficiency and environmental advantages in industrial production. The method for separating and purifying fermentation products provided in the embodiments of this specification has at least the following characteristics: 1. Soluble metal-MPN complex precipitation technology: The existing technology does not use a precipitant or uses a single precipitant. In the examples of this specification, a soluble MPN reagent is added to selectively precipitate the target amino acid using dynamic coordination complexation, replacing traditional fixed bed adsorption, simplifying the equipment and adapting to high-impurity systems. 2. Composite acid impurity removal system: The synergistic effect of composite acid precipitation (p-toluenesulfonic acid salt formation + hydrochloric acid destruction of hydrogen bonds + organic acid complexation of impurities) is used in the embodiments of this specification to achieve two beneficial effects: 1) trace control of impurity amino acids is achieved, and the impurity amino acids of a single category can be controlled to below 0.10%; 2) the use of activated carbon is reduced by 50%, reducing the cost of subsequent three waste treatment and reducing the pressure of environmental protection treatment. 3. Recycling of p-toluenesulfonic acid: The existing technology does not involve the recycling of key materials and requires multiple water or solvent activation or regeneration of resins. In the examples of this specification, the recycling of p-toluenesulfonic acid is achieved by gradient elution with hydrochloric acid of different concentrations, which further reduces the wastewater treatment cost and environmental pressure. 4. Gradient cooling crystallization: The existing technology mostly uses evaporation concentration crystallization. In the embodiment of this specification, a composite acid system is combined with gradient crystallization, which can further avoid the formation of mixed crystals, improve the purity of the target amino acid in the crystallization cake, control the residual impurity amino acid, and at the same time improve the yield. 5. Wide applicability of the process flow: The existing process flow is mostly targeted at a single amino acid product. The embodiments in this specification can be applied to the separation and purification of three branched-chain amino acids without changing the equipment, resin, and processing methods. The equipment investment is small, the process applicability is strong, and the continuity is high, making it suitable for industrial scale-up production. The method for separating and purifying fermentation products provided in the embodiments of this specification has at least the following advantages. 1. Further reduce the residual impurity amino acids and further improve the purity of the main amino acids: (1) The metal-MPN network acts as a new adsorbent and precipitant to efficiently adsorb and precipitate the target amino acids. (2) p-Toluenesulfonic acid forms a stable salt with the amino group of the target amino acid through the sulfonic acid group, significantly improving the solubility; (3) The addition of hydrochloric acid fully protonates the amino acid and impurity amino acid molecules, destroying the original hydrogen bond network. The chloride ion (Cl-) acts as an ion shield in the solution to inhibit the formation of mixed acid crystals; (4) The carboxylic acid group of the organic weak acid forms a complex with the metal ions, pigment molecules, and impurity amino acids, further removing the content of impurity amino acids. 2. Reduce the amount of activated carbon used: The carboxylic acid group of the organic weak acid forms a complex with metal ions, pigment molecules, and impurity amino acids, which improves the decolorization effect of the activated carbon and reduces the amount of activated carbon used. 3. Reduce the cost of three wastes treatment: After the p-toluenesulfonic acid is adsorbed by ion exchange resin and then eluted with hydrochloric acid gradient, the key materials can be recycled, thereby reducing the post-processing cost of the precipitant. 4. The equipment and process are highly applicable, with flexible conversion and low investment cost: Without changing the equipment, resin and processing methods, it can be applied to the separation and purification of three branched-chain amino acids, with low equipment investment. While the basic concepts have been described above, it will be apparent to those skilled in the art that the detailed disclosure is merely illustrative and does not limit this specification. Although not explicitly stated herein, various modifications, improvements, and revisions to this specification may be made by those skilled in the art. Such modifications, improvements, and revisions are suggested in this specification and remain within the spirit and scope of the exemplary embodiments of this specification. This specification also uses specific terms to describe the embodiments of this specification. For example, "one embodiment," "an embodiment," and / or "some embodiments" refer to a feature, structure, or characteristic associated with at least one embodiment of this specification. Therefore, it should be emphasized and noted that references to "one embodiment," "an embodiment," or "an alternative embodiment" two or more times in different locations in this specification do not necessarily refer to the same embodiment. Furthermore, certain features, structures, or characteristics of one or more embodiments of this specification may be appropriately combined. In addition, unless expressly stated in the claims, the order of the processing elements and sequences, the use of alphanumeric characters, or the use of other names described in this specification are not intended to limit the order of the processes and methods of this specification. Although the above disclosure discusses some of the invention embodiments currently considered useful through various examples, it should be understood that such details are for illustrative purposes only, and the appended claims are not limited to the disclosed embodiments. On the contrary, the claims are intended to cover all modifications and equivalent combinations that are consistent with the spirit and scope of the embodiments of this specification. For example, although the system components described above can be implemented by hardware devices, they can also be implemented only by software solutions, such as installing the described system on an existing server or mobile device. Similarly, it should be noted that, in order to simplify the presentation of this specification and thus facilitate understanding of one or more embodiments of the invention, the foregoing descriptions of the embodiments of this specification sometimes combine multiple features into a single embodiment, figure, or description thereof. However, this disclosure method does not imply that the subject matter of this specification requires more features than those recited in the claims. In fact, an embodiment may have fewer features than all of the features of a single disclosed embodiment. In some embodiments, numbers are used to describe the quantity of components and attributes. It should be understood that such numbers used in the description of the embodiments are modified by the modifiers "about", "approximately" or "substantially" in some examples. Unless otherwise stated, "about", "approximately" or "substantially" indicate that the numbers are allowed to vary by ±20%. Accordingly, in some embodiments, the numerical parameters used in the description and claims are approximate values, which may change according to the required characteristics of individual embodiments. In some embodiments, the numerical parameters should take into account the specified significant digits and adopt the general method of retaining digits. Although the numerical domains and parameters used to confirm the breadth of their range in some embodiments of this specification are approximate values, in specific embodiments, the settings of such numerical values ​​are as accurate as possible within the feasible range. Each patent, patent application, patent application publication, and other materials, such as articles, books, specifications, publications, and documents, cited in this specification is hereby incorporated by reference in its entirety. This includes application history documents that are inconsistent with or conflict with the content of this specification, as well as documents (currently or subsequently attached to this specification) that limit the broadest scope of the claims of this specification. It should be noted that if the descriptions, definitions, and / or terminology used in the accompanying materials are inconsistent or conflicting with the content of this specification, the descriptions, definitions, and / or terminology used in this specification will control. Finally, it should be understood that the embodiments described in this specification are intended only to illustrate the principles of the embodiments of this specification. Other variations may also fall within the scope of this specification. Therefore, by way of example and not limitation, alternative configurations of the embodiments of this specification may be considered consistent with the teachings of this specification. Accordingly, the embodiments of this specification are not limited to the embodiments explicitly described and illustrated in this specification.

Claims

1. A non-coding sRNA in Corynebacterium glutamicum, wherein the RNA sequence of the non-coding sRNA has at least 90% sequence homology with the transcription product of the DNA sequence shown in SEQ ID NO.

1.

2. The non-coding sRNA according to claim 1, wherein the DNA sequence encoding the non-coding sRNA is shown in SEQ ID NO.

1.

3. A vector comprising the DNA sequence of the non-coding sRNA according to claim 2.

4. A recombinant bacterium expressing the DNA sequence of the non-coding sRNA according to claim 2, wherein the bacterium of the recombinant bacterium is selected from Corynebacterium glutamicum.

5. The recombinant bacterium according to claim 4, wherein the Corynebacterium glutamicum is selected from one of Corynebacterium glutamicum IBBH-15, Corynebacterium glutamicum IBCL-1, Corynebacterium glutamicum IBCVQ, Corynebacterium glutamicum CICC21756, and Corynebacterium glutamicum ATCC13002, or any combination thereof.

6. A method for constructing a recombinant bacterium, comprising: The recombinant vector containing the target DNA fragment is transformed into a host strain to obtain a recombinant strain, wherein the target DNA fragment has a sequence homology of at least 90% or more with the DNA sequence shown in SEQ ID NO.

1.

7. The method according to claim 6, wherein the DNA sequence of the target DNA fragment is shown as SEQ ID NO.

1.

8. A fermentation method of a recombinant bacterium, comprising: inoculating at least one recombinant strain into a seed culture medium for cultivation to obtain a seed solution; inoculating the seed liquid into a fermentation medium for fermentation culture; In the fermentation culture, the production of branched-chain amino acids is increased by regulating at least one of the amount of inducer added, dissolved oxygen level, pH and nutrient supply.

9. The method according to claim 8, wherein the at least one recombinant bacterium comprises a DNA sequence of a non-coding sRNA, and the DNA sequence has at least 90% sequence homology with the DNA sequence shown in SEQ ID NO.

1.

10. The method according to claim 8 or 9, wherein the recombinant bacterium is an L-leucine-producing bacterium, and the L-leucine-producing bacterium comprises at least one of the Corynebacterium glutamicum mutant strains IBBH-15, IBCLQ-257, and IBCLQ-257e.

11. The method according to claim 8 or 9, wherein the seed culture medium comprises glucose with an initial concentration of 2.5-3.5 wt% and molasses hydrolyzate with an initial concentration of 1-2 wt%, the fermentation medium comprises glucose with an initial concentration of 3.5-4.5 wt% and molasses hydrolyzate with a concentration of 0.5-1.1 wt%, and the molasses hydrolyzate is selected from at least one of beet molasses hydrolyzate and sucrose molasses hydrolyzate.

12. The method according to any one of claims 8 to 11, wherein the dissolved oxygen level in the fermentation culture is 5-10%; the method further comprising: During the fermentation culture stage, after the bacterial OD562 grows to 19-21, the pH is increased to 6.85-6.95, and when the residual sugar drops to 1.5-2.5 wt%, a glucose solution with a concentration of 40-50 wt% and a molasses hydrolyzate with a concentration of 40-50 wt% are added, and the flow rate ratio of the glucose solution to the molasses hydrolyzate is controlled to be 5:1-10:1, and the proportion of the molasses hydrolyzate to the fermentation medium is 2.5-3.5 wt%; and After the bacterial OD562 grows to 29-31, the pH is increased to 7.05-7.

15. After the bacterial OD562 grows to 39-41, the pH is increased to 7.15-7.

25. During the fermentation process, the residual sugar concentration is controlled at 1.5-2.5 wt%.

13. The method according to claim 8, wherein the recombinant bacterium is an L-isoleucine-producing bacterium, and the L-isoleucine-producing bacterium comprises at least one of the mutant strains of Corynebacterium glutamicum IBCIL-253, IBCL-1 and IBCIL-253k.

14. The method according to claim 8 or 13, wherein the seed culture medium comprises glucose with an initial concentration of 4.5-5.5 wt% and molasses hydrolyzate with an initial concentration of 2.5-3.5 wt%, and the fermentation medium comprises glucose with an initial concentration of 9.5-10.5 wt% and molasses hydrolyzate with a concentration of 1.5-2.5 wt%, and the molasses hydrolyzate is selected from at least one of beet molasses hydrolyzate and sucrose molasses hydrolyzate.

15. The method according to any one of claims 8, 13 or 14, wherein the dissolved oxygen level in the fermentation culture is 8-12%; the method further comprising: During the fermentation stage, the pH is raised to 6.85-6.95 after the bacterial OD562 grows to 39-41; When the residual sugar content drops to 5.5-6.5 wt%, the inorganic salt feed solution is added to control the osmotic pressure of the fermentation liquid at 690-710 mosm / L; and When the residual sugar drops to 1.5-2.5wt%, liquid A and liquid B are added, wherein the liquid A comprises a glucose solution with a concentration of 40-50wt%, a potassium dihydrogen phosphate solution with a concentration of 0.1wt%, and a magnesium sulfate solution with a concentration of 0.05wt%. The liquid B comprises a molasses hydrolyzate with a concentration of 40-50wt%. The flow rate ratio of the liquid A to the liquid B is controlled to be 4:1-7:1, the proportion of the molasses hydrolyzate to the fermentation medium is 3.5-4.5wt%. At the same time, the inorganic salt feed solution is continued to be added to control the osmotic pressure of the fermentation liquid to be 890-910mosm / L.

16. A method for separating and purifying a fermentation product, the method comprising: Redissolving the fermentation product based on p-toluenesulfonic acid, wherein the molar ratio of the fermentation product to the p-toluenesulfonic acid is 1:1-1:2; Reconstruct the hydrogen bond network of the reconstituted fermentation product based on 0.5-1.5M inorganic acid; Decolorize the fermentation product after cooling and crystallization for 30-50 minutes based on 1-2% malic acid, 0.1-0.2% tartaric acid, and 0.5-1.5‰ activated carbon; The decolorized fermentation product is subjected to ion exchange resin and evaporation crystallization to obtain a purified fermentation product.

17. The method according to claim 16, further comprising: after passing through the ion exchange resin and before evaporation and crystallization; The p-toluenesulfonic acid was recovered by elution with 0.3-0.8 M hydrochloric acid and the resin was regenerated with 2.5-3.5 M hydrochloric acid.

18. The method according to claim 16 or 17, after the hydrogen bond network is reconstructed and before decolorization, the method further comprises: The fermentation product after hydrogen bond network reconstruction is cooled to 9-11°C at a cooling rate of 8-12°C / h and crystallized for 0.5-1.5h.

19. The method according to any one of claims 16 to 18, further comprising, before reconstitution: The fermentation broth containing the fermentation product is subjected to complex precipitation based on the composition of the polypeptide and the metal ion to precipitate the fermentation product.

20. The method according to any one of claims 16 to 19, wherein the fermentation product is a fermentation product of Corynebacterium glutamicum.

21. The method according to claim 20, wherein the Corynebacterium glutamicum comprises the DNA sequence shown in SEQ ID NO. 1.

Images