Composition for promoting proliferation of immune cells

Abstract

[Problem] To provide a means for promoting the proliferation of at least one type of cells that are included in effector T cells and are selected from CD4+ T cells having an expression pattern of cell surface markers of CXCR3+ / CCR4low / CCR6high, MAIT cells, and NKT cells. [Solution] Provided is: a composition for promoting the proliferation of (i) CD4+ T cells having an expression pattern of cell surface markers of CXCR3+ / CCR4low / CCR6high and (ii) MAIT cells and / or NKT cells; or a composition for treating a disease or condition that is ameliorated by the proliferation of at least one type of cells selected from CD4+ T cells having an expression pattern of a cell surface marker of CXCR3+ / CCR4low / CCR6high, MAIT cells, and NKT cells. Each of the compositions contains an exopolysaccharide from lactic acid bacteria.

Description

Composition for promoting immune cell proliferation

[0001] The present invention relates to a composition for promoting the proliferation of immune cells.

[0002] T cells play an important role in the immune system. In response to various extracellular stimuli, they differentiate from immature states into various effector T cells with various functions, contributing to the elimination of pathogenic microorganisms, virus-infected cells, cancer cells, and other pathogens.

[0003] CXCR3, a type of effector T cell + / CCR4 low / CCR6 high CD4 with the cell surface marker expression pattern of + T cells (Th7R cells) can be used as a biomarker to predict the response rate of immune checkpoint inhibitors against cancer (Non-Patent Document 1). + CXCR3 in T cell populations - selecting a cell subpopulation; and - In a subpopulation of cells, CCR4 - Cell subpopulations and CCR4 + establishing boundaries between cell subpopulations and determining CD4 + CCR4 in T cell populations - CCR6 + and measuring the relative amounts of CD4 cell subpopulations in a sample from the subject. + A method for determining the relative abundance of Th7R cell subpopulations in a T cell population has been described. Th7R cells are also known to contribute to the suppression of cancer recurrence after surgical removal (Non-Patent Document 2).

[0004] MAIT cells and NKT cells, which are types of effector T cells, are cells that contribute to adaptive immunity, but also have rapid effector activity and are known to contribute to innate immunity. MAIT cells and NKT cells are known to contribute to cancer prevention and suppression of cancer metastasis (Non-Patent Documents 3 and 4).

[0005] On the other hand, lactic acid bacteria, their fermentation products, and exopolysaccharides (EPS) derived from lactic acid bacteria are known to have several physiological activities, such as prevention of autoimmune diseases (Patent Document 2), activation of NK cells (Patent Document 3), antiviral activity (Patent Document 4), prevention of pneumococcal infection (Patent Document 5), suppression of acquired immunity decline (Patent Document 6), prevention and / or treatment of influenza (Patent Document 7), suppression of cytokine production (Patent Document 8), activation of cellular immunity (Patent Document 9), suppression of cancer cachexia (Patent Document 10), promotion of immune checkpoint inhibitor therapy (Patent Document 11), prevention of secondary infections after viral infection or reduction of the risk of onset (Patent Document 12), anti-human coronavirus activity (Patent Document 13), suppression of viral proliferation (Patent Document 14), regulation of immune balance (Patent Document 15), promotion of interferon-γ production (Patent Document 16), activation of T cells (Patent Document 17), increase in antibody titer (Patent Document 18), and retinoic acid production (Patent Document 19).

[0006] Japanese Patent No. 7368678, Japanese Patent Application Laid-Open No. 2000-247895, Japanese Patent Application Laid-Open No. 2005-194259, International Publication WO2011 / 065300, International Publication WO2015 / 133638, Japanese Patent Application Laid-Open No. 2018-27904, Japanese Patent Application Laid-Open No. 2018-74940, Japanese Patent Application Laid-Open No. 2018-177740, Japanese Patent Application Laid-Open No. 2018-203698, Japanese Patent Application Laid-Open No. 2019-81733 International Publication No. WO2019 / 240218 International Publication No. WO2023 / 120547 International Publication No. WO2023 / 204234 JP 2021-80187 A JP 2021-101645 A International Publication No. WO2019 / 111904 International Publication No. WO2020 / 067422 International Publication No. WO2015 / 029967 International Publication No. WO2015 / 137501

[0007] Hiroshi Kagamu et al, Single-Cell Analysis Reveals a CD4+ T-cell Cluster That Correlates with PD-1 Blockade Efficacy. Cancer Res. 2022 Dec 16;82(24):4641-4653. doi: 10.1158 / 0008-5472.CAN-22-0112.Akitoshi Yanagihara et al, A Th1-like CD4+ T-cell Cluster That Predicts Disease-free Survival in Early-stage Lung Cancer. Cancer Res Commun. 2023 Jul 19;3(7):1277-1285. doi: 10.1158 / 2767-9764.CRC-23-0167. Benjamin Ruf et al, Activating Mucosal-Associated Invariant T Cells Induces a Broad Antitumor Response. Cancer Immunol Res. 2021 Sep;9(9):1024-1034. doi: 10.1158 / 2326-6066.CIR-20-0925.Chi Ma et al, Gut microbiome-mediated bile acid metabolism regulates liver cancer via NKT cells. Science. 2018 May 25;360(6391):eaan5931. doi: 10.1126 / science.aan5931.

[0008] The present invention relates to a method for treating CXCR3, a type of effector T cell. + / CCR4 low / CCR6 high CD4 with the cell surface marker expression pattern of + The object is to provide a means for promoting the proliferation of one or more of T cells, MAIT cells, and NKT cells.

[0009] The following inventions are provided: [1] A composition for promoting the growth of either or both of (i) and (ii), comprising exopolysaccharides of lactic acid bacteria. (i) CXCR3 + / CCR4 low / CCR6 high CD4 with the cell surface marker expression pattern of + (i) T cells (ii) MAIT cells and NKT cells [2] A composition for either or both of improving sensitivity to immune checkpoint inhibitor therapy and suppressing cancer recurrence after surgical removal, comprising exopolysaccharides of lactic acid bacteria. [3] The composition according to [2], wherein the improvement in sensitivity to immune checkpoint inhibitor therapy is achieved by changing a subject who is resistant to immune checkpoint inhibitor therapy into a subject who is resistant to immune checkpoint inhibitor therapy, or by enabling a subject who has become resistant to immune checkpoint inhibitor therapy over time to regain the effect. [4] A composition for CXCR3, comprising exopolysaccharides of lactic acid bacteria. + / CCR4 low / CCR6 high CD4 with the cell surface marker expression pattern of + A composition for treating a disease or condition that is improved by promoting the proliferation of T cells. [5] CXCR3 + / CCR4 low / CCR6 high CD4 with the cell surface marker expression pattern of +The composition according to [4], wherein the treatment of a disease or condition that is improved by promoting the proliferation of T cells is improving sensitivity to immune checkpoint inhibitor therapy, and the composition is intended to be ingested by a subject who is not undergoing immune checkpoint inhibitor therapy. [6] A composition for treating a disease or condition that is improved by promoting the proliferation of MAIT cells and NKT cells, comprising exopolysaccharides of lactic acid bacteria. [7] The composition according to [6], wherein the treatment of a disease or condition that is improved by promoting the proliferation of MAIT cells and NKT cells is either or both of suppressing cancer metastasis and preventing cancer, and the composition is intended to be ingested by a subject who is not undergoing cancer treatment. [8] The composition according to any one of [1] to [7], wherein the lactic acid bacteria are bacteria belonging to the genus Lactobacillus. [9] The composition according to any one of [1] to [8], wherein the lactic acid bacteria are bacteria belonging to Lactobacillus delbrueckii.

[10] The composition according to any one of [1] to [9], wherein the lactic acid bacterium is Lactobacillus delbrueckii subsp. bulgaricus FERM BP-10741.

[11] The composition according to any one of [1] to

[10] , wherein the exopolysaccharide of the lactic acid bacterium is contained as a fermentation product of the lactic acid bacterium.

[12] The composition according to any one of [1] to

[11] , which is a pharmaceutical composition.

[13] The composition according to any one of [1] to

[11] , which is a food composition.

[0010] The following inventions are also provided.

[14] A method or non-therapeutic method for promoting the growth of either or both of (i) and (ii), comprising ingesting an exopolysaccharide of lactic acid bacteria or a composition comprising exopolysaccharide of lactic acid bacteria to a subject. An exopolysaccharide of lactic acid bacteria or a composition comprising exopolysaccharide of lactic acid bacteria for use in a method for promoting the growth of either or both of (i) and (ii). Use of an exopolysaccharide of lactic acid bacteria, or use of a composition comprising exopolysaccharide of lactic acid bacteria, in the manufacture of a composition for promoting the growth of either or both of (i) and (ii). Use or non-therapeutic use of an exopolysaccharide of lactic acid bacteria, or use or non-therapeutic use of a composition comprising exopolysaccharide of lactic acid bacteria, for promoting the growth of either or both of (i) and (ii). (i) CXCR3+ / CCR4 low / CCR6 high CD4 with the cell surface marker expression pattern of + (ii) T cells (ii) MAIT cells and NKT cells

[15] A method or non-therapeutic method for improving sensitivity to immune checkpoint inhibitor therapy, or a method for suppressing cancer recurrence after excision surgery, comprising administering to a subject exocytosaccharids of lactic acid bacteria or a composition comprising exocytosaccharids of lactic acid bacteria. A lactic acid bacterial exocytosaccharid or a composition comprising exocytosaccharids of lactic acid bacteria for use in a method for improving sensitivity to immune checkpoint inhibitor therapy or a method for suppressing cancer recurrence after excision surgery. Use of a lactic acid bacterial exocytosaccharid or a composition comprising a lactic acid bacterial exocytosaccharid in the manufacture of a composition for either or both of improving sensitivity to immune checkpoint inhibitor therapy and suppressing cancer recurrence after excision surgery. Use or non-therapeutic use of a lactic acid bacterial exocytosaccharid or a composition comprising a lactic acid bacterial exocytosaccharid for improving sensitivity to immune checkpoint inhibitor therapy or suppressing cancer recurrence after excision surgery.

[16] A method for detecting CXCR3, comprising administering to a subject exopolysaccharides of lactic acid bacteria or a composition containing exopolysaccharides of lactic acid bacteria. + / CCR4 low / CCR6 high CD4 with the cell surface marker expression pattern of + A method of treating or non-therapeutic treatment of a disease or condition that is ameliorated by promoting the proliferation of CXCR3 T cells. + / CCR4 low / CCR6 high CD4 with the cell surface marker expression pattern of + CXCR3 exopolysaccharide or a composition comprising lactic acid bacteria exopolysaccharide for use in a method for treating a disease or condition that is ameliorated by promoting the proliferation of T cells. + / CCR4 low / CCR6 high CD4 with the cell surface marker expression pattern of +Use of an exopolysaccharide of a lactic acid bacterium, or use of a composition comprising an exopolysaccharide of a lactic acid bacterium, in the manufacture of a composition for the treatment of a disease or condition that is ameliorated by promoting the proliferation of CXCR3 T cells. + / CCR4 low / CCR6 high CD4 with the cell surface marker expression pattern of + Use or non-therapeutic use of an exopolysaccharide of a lactic acid bacterium, or use or non-therapeutic use of a composition comprising an exopolysaccharide of a lactic acid bacterium, for treating a disease or condition that is ameliorated by promoting the proliferation of T cells.

[17] CXCR3 + / CCR4 low / CCR6 high CD4 with the cell surface marker expression pattern of + The method or non-therapeutic method according to

[16] , wherein the treatment of a disease or condition that is improved by promoting T cell proliferation is an improvement in sensitivity to immune checkpoint inhibitor therapy, and the subject is a subject who has not been treated with immune checkpoint inhibitor therapy. + / CCR4 low / CCR6 high CD4 with the cell surface marker expression pattern of + The lactic acid bacterial exopolysaccharide or the composition comprising the lactic acid bacterial exopolysaccharide according to

[16] , wherein the treatment of a disease or condition that can be improved by promoting T cell proliferation is to improve sensitivity to immune checkpoint inhibitor therapy, and the composition is intended to be ingested by a subject who is not undergoing immune checkpoint inhibitor therapy. + / CCR4 low / CCR6 high CD4 with the cell surface marker expression pattern of +The use or non-therapeutic use according to

[16] , wherein the treatment of a disease or condition that is ameliorated by promoting T cell proliferation is improving sensitivity to immune checkpoint inhibitor therapy, and the composition or lactic acid bacterial exopolysaccharide is administered to a subject who is not undergoing immune checkpoint inhibitor therapy.

[18] A method or non-therapeutic method for treating a disease or condition that is ameliorated by promoting the proliferation of either or both of MAIT cells and NKT cells, comprising administering to a subject an exopolysaccharide of lactic acid bacteria or a composition comprising an exopolysaccharide of lactic acid bacteria. A lactic acid bacterial exopolysaccharide or a composition comprising an exopolysaccharide of lactic acid bacteria for use in a method for treating a disease or condition that is ameliorated by promoting the proliferation of either or both of MAIT cells and NKT cells. Use of lactic acid bacterial exopolysaccharide, or use of a composition comprising lactic acid bacterial exopolysaccharide, in the manufacture of a composition for treating a disease or condition that is ameliorated by promoting the proliferation of either or both of MAIT cells and NKT cells.

[19] The method or non-therapeutic method according to

[18] , wherein the treatment for a disease or condition that can be improved by promoting the proliferation of either or both of MAIT cells and NKT cells is either or both of suppressing cancer metastasis and preventing cancer, and the subject is not currently being treated for cancer.

[20] The method or non-therapeutic method according to

[20] , wherein the treatment for a disease or condition that can be improved by promoting the proliferation of either or both of MAIT cells and NKT cells is either or both of suppressing cancer metastasis and preventing cancer, and the subject is not currently being treated for cancer.

[21] The method or non-therapeutic method according to

[20] , wherein the treatment for a disease or condition that can be improved by promoting the proliferation of either or both of MAIT cells and NKT cells is either or both of suppressing cancer metastasis and preventing cancer, and the subject is not currently being treated for cancer.

[22] The method or non-therapeutic method according to

[20] , wherein the treatment for a disease or condition that can be improved by promoting the proliferation of either or both of MAIT cells and NKT cells is either or both of suppressing cancer metastasis and preventing cancer, and the subject is not currently being treated for cancer. The use or non-therapeutic use according to

[18] for treating a disease or condition that can be improved by promoting the proliferation of either or both of MAIT cells and NKT cells in a subject who has not yet undergone cancer treatment, wherein the treatment of the disease or condition that can be improved by promoting the proliferation of either or both of MAIT cells and NKT cells is either or both of suppressing cancer metastasis and preventing cancer.

[20] The method or non-therapeutic method, the exopolysaccharide of lactic acid bacteria or the composition comprising the exopolysaccharide of lactic acid bacteria, or the use or non-therapeutic use thereof according to any one of

[14] to

[19] , wherein the lactic acid bacteria are bacteria belonging to the genus Lactobacillus.

[21] The method or non-therapeutic method, the exopolysaccharide of lactic acid bacteria or the composition comprising the exopolysaccharide of lactic acid bacteria, or the use or non-therapeutic use thereof according to any one of

[14] to

[20] , wherein the lactic acid bacteria are bacteria belonging to the genus Lactobacillus.

[22] The method or non-therapeutic method, the exopolysaccharide of lactic acid bacteria or the composition comprising the exopolysaccharide of lactic acid bacteria, or the use or non-therapeutic use thereof according to any one of

[14] to

[21] , wherein the lactic acid bacteria are Lactobacillus delbrueckii subsp. bulgaricus FERM BP-10741.

[23] The method or non-therapeutic method according to any one of

[14] to

[22] , in which exopolysaccharides of lactic acid bacteria are ingested as a fermentation product of lactic acid bacteria. The composition, use or non-therapeutic use according to any one of

[14] to

[22] , in which the exopolysaccharides of lactic acid bacteria are contained in the composition as a fermentation product of lactic acid bacteria.

[24] The method or non-therapeutic method according to any one of

[14] to

[23] , in which a pharmaceutical composition containing exopolysaccharides of lactic acid bacteria is ingested. The composition, use or non-therapeutic use according to any one of

[14] to

[23] , in which the composition is a pharmaceutical composition.

[25] The method or non-therapeutic method according to any one of

[14] to

[23] , in which a food composition containing exopolysaccharides of lactic acid bacteria is ingested. The composition, use or non-therapeutic use according to any one of

[14] to

[23] , in which the composition is a food composition.

[0011] According to the present invention, CXCR3 + / CCR4 low / CCR6 high CD4 with the cell surface marker expression pattern of + The proliferation of one or more of T cells (Th7R cells), MAIT cells, and NKT cells is promoted.

[0012] Figure 1 shows the change in the composition ratio of MAIT / NKT cells in the PBMCs of subjects before and after taking the test product. Figure 2 shows the change in the composition ratio of CD4+ Figure 3 shows the respective constituent ratios of clusters #44347, #44352, and #44360 in T cells. + The cluster lineages and CCR6 expression intensity of each cluster in T cells are shown. The bar values ​​indicate the relative expression levels, and the bar colors correspond to the colors of the circles.

[0013] The present invention will be described below. The features of the present invention described below can be combined in any combination.

[0014] <Composition> The present invention relates to a composition containing exopolysaccharide (EPS) of a lactic acid bacterium.

[0015] [Active Ingredient] The active ingredient in the composition of the present invention is EPS from lactic acid bacteria. The EPS used in the composition of the present invention is not particularly limited as long as it has the desired effect. For example, it includes EPS produced by lactic acid bacteria and EPS produced by a microorganism (e.g., Escherichia coli) into which a lactic acid bacteria-derived EPS-producing gene has been introduced. In one embodiment, the EPS from lactic acid bacteria is EPS produced by lactic acid bacteria. EPS from lactic acid bacteria are structurally classified as homopolysaccharides or heteropolysaccharides (e.g., those composed of galactose and glucose), and may be further modified by phosphorylation or sulfation. However, as long as it has the desired effect, there is no particular limitation, and either can be used as an active ingredient in the composition of the present invention. Furthermore, EPS may be a neutral polysaccharide or an acidic polysaccharide (e.g., a neutral polysaccharide to which a phosphate group or the like has been added). Such EPSs are known to be produced by Lactobacillus delbrueckii subsp. bulgaricus, Lactococcus lactis subsp. lactis, Lactococcus lactis subsp. cremoris, etc. The EPS used in the present invention may be one type or a combination of two or more types. Furthermore, the EPS may be obtained by purification from a fermentation product of lactic acid bacteria, etc.

[0016] Lactic acid bacteria is a general term for microorganisms that utilize glucose to produce lactic acid at a sugar yield of 50% or more. Physiological properties include Gram-positive cocci or bacilli, lack of motility, lack of spore formation in many cases (although some lactic acid bacteria, such as Bacillus coagulans, are capable of spore formation), and catalase-negative activity. Lactic acid bacteria have been consumed throughout the world since ancient times in the form of fermented milk and the like, and are considered to be extremely safe microorganisms. Lactic acid bacteria are classified into several genera. In the present invention, the lactic acid bacteria may be any bacteria that produce EPS, and are preferably bacteria belonging to the genus Lactobacillus or Lactococcus.

[0017] Examples of Lactobacillus lactic acid bacteria include bulgaricus, casei, Lactobacillus, and plantarum species. In the present invention, "bacteria belonging to the genus Lactobacillus" refer to bacteria belonging to the genus Lactobacillus, as defined in the article "A taxonomic note on the genus Lactobacillus: Description of 23 novel genera, emended description of the genus Lactobacillus Beijerinck 1901, and union of Lactobacillaceae and The 25 genera newly established by the reorganization of lactic acid bacteria published in the "Leuconostocaceae" are: Lactobacillus, Paralactobacillus, Holzapfelia, Amylolactobacillus, Bombilactobacillus, Companilactobacillus, Lapidilactobacillus, Agrilactobacillus, Schleiferilactobacillus, Loigolactobacilus, Lacticaseibacillus, Latilactobacillus, and This refers to bacteria belonging to any of the following genera: Lactobacillus, Dellaglioa, Liquorilactobacillus, Ligilactobacillus, Lactiplantibacillus, Furfurilactobacillus, Paucilactobacillus, Limosilactobacillus, Fructilactobacillus, Acetilactobacillus, Apilactobacillus, Levilactobacillus, Secundilactobacillus, and Lentilactobacillus.In the present invention, lactic acid bacteria (also referred to as bulgaricus bacteria) classified into the species Lactobacillus delbrueckii subsp. bulgaricus are preferred. Furthermore, bacteria belonging to the genus Lactobacillus are preferably bacteria belonging to Lactobacillus delbrueckii, and more preferably bacteria belonging to Lactobacillus delbrueckii subsp. bulgaricus. That is, one particularly preferred example of the EPS used in the composition of the present invention is an EPS of lactic acid bacteria classified into Lactobacillus delbrueckii subsp. bulgaricus.

[0018] Lactobacillus delbrueckii subsp. bulgaricus FERM BP-10741 The bacterium belonging to the genus Lactobacillus is particularly preferably Lactobacillus delbrueckii subsp. bulgaricus FERM BP-10741 or a strain taxonomically equivalent to Lactobacillus delbrueckii subsp. bulgaricus FERM BP-10741. Lactobacillus delbrueckii subsp. bulgaricus FERM BP-10741 is also sometimes referred to as Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1. Lactobacillus delbrueckii subsp. bulgaricus FERM BP-10741 has been internationally deposited with the International Patent Organism Depositary, National Institute of Technology and Evaluation (IPOD, NITE) (Room 120, 2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture, Japan) in accordance with the Budapest Treaty (depositor: Meiji Co., Ltd., date of deposit: November 29, 2006, accession number: FERM BP-10741).

[0019] The nucleotide sequence of the V1 to V3 regions of the 16S rRNA gene of Lactobacillus delbrueckii subsp. bulgaricus FERM BP-10741 (corresponding to the nucleotide sequence from bases 34 to 535 in the full-length sequence of the 16S rRNA gene) is shown in SEQ ID NO: 1 in the Sequence Listing. 16S rRNA gene. Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1 (SEQ ID NO: 1) GCTGGCGGCGTGCCTAATACATGCAAGTCGAGCGAGCTGAATTCAAAGATYCCTTCGGGRTGATTTGTTGGACGCTAGCGGCGGATGGGTGAGTAACACGTGGGCAATCTGCCCTAAAGACTGGG ATACCACTTGGAAACAGGTGCTAATACCGGATAACAACATGAATCGCATGATTCAAGTTTGAAAGGCGGCGYAAGCTGTCACTTTAGGATGAGCCCGCGGCGCATTAGCTAGTTGGTGGGGTAAAG GCCTACCAAGGCAATGATGCGTAGCCGAGTTGAGAGACTGATCGGCCACATTGGGACTGAGACACGGCCCAAACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCACAATGGACGCAAGTCTGAT GGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAGCTCTGTTGTTGGTGAAGAAGGATAGAGGCAGTAACTGGTCTTTATTTGACGGTAATCAACCAGAAAGTCACGGCTAACTACGT

[0020] A strain taxonomically equivalent to a certain strain (hereinafter referred to as strain S) refers to, for example, any of the following: A strain belonging to the same genus as strain S, preferably the same species as strain S, in which the entire sequence of its 16S rRNA gene or a characteristic portion thereof (such as the V1 region, the V2 region, or all or a portion of the V1 and V2 regions, or a portion including the V1 and V2 regions) has 90% or more, preferably 95% or more, more preferably 98% or more, even more preferably 98.5% or more, even more preferably more than 98.7%, even more preferably 99% or more, even more preferably 99.5% or more, and even more preferably 100% sequence identity with the sequence of strain S; A strain belonging to the same genus as strain S, preferably the same species as strain S, more preferably the same subspecies as strain S, in which the strain has the same mycological properties as strain S.

[0021] Regarding criteria for determining species identity based on 16S rRNA gene sequences, those skilled in the art can refer to Stackebrandt E, Ebers J. Taxonomic parameters revisited: tarnished gold standards. Microbiology Today 2006;33:152-155.

[0022] The mycological properties of Lactobacillus delbrueckii subsp. bulgaricus FERM BP-10741 are as follows: (1) Morphological properties Cell shape: rod-shaped Motility: none Presence or absence of spores: none Gram staining: positive

[0023] (2) Growth on medium The strain was spread on a BL agar medium (Eiken Chemical) plate and cultured at 37°C for 48 hours by the steel wool method, resulting in the formation of opaque, rough colonies.

[0024] (3) Physiological properties Nitrate reduction: negative Indole production: negative Gelatin liquefaction: negative Catalase: negative Attitude towards oxygen: facultative anaerobic Produces D(-) lactic acid from glucose by homolactic fermentation, and in BL liquid medium (which does not produce gas), growth at 10°C is negative, growth at 45°C is positive Arginine decomposition: negative Gas production from malic acid: negative Decomposition of various carbohydrates (positive +, negative -) Arabinose (-), Xylose (-), Rhamnose (-), Ribose (-), Glucose (+), Mannose (+), Fructose (+), Galactose (-), Sucrose (-), Maltose (-), Cellobiose (-), Lactose (+), Trehalose (-), Melibiose (-), Raffinose (-), Melezitose (-), Dextrin (-), Starch (-), Glycogen (-), Inulin (-), Mannitol (-), Sorbitol (-), Inositol (-), Esculin (-), Salicin (-)

[0025] (4) EPS productivity The present strain has EPS productivity.

[0026] As bacteria belonging to the genus Lactobacillus that are capable of producing EPS, the following lactic acid bacteria are known to exist. Lactiplantibacillus plantarum C88 (Non-patent Document 5); Lactobacillus johnsonii strain 151 (Non-patent Document 6); Lactobacillus delbrueckii subsp. bulgaricus NCFB2074 (Non-patent Document 7); Lacticaseibacillus casei CG11 (Non-patent Document 8); Lacticaseibacillus rhamnosus E / N (Non-patent Document 9); Lactobacillus fermentum TDS030603 (Non-patent Document 10); and Lactobacillus gasseri FR4 (Non-patent Document 11).

[0027] For this reason, it is believed that the effects of the present invention can be achieved with EPS produced by bacteria belonging to the genus Lactobacillus, for example.

[0028] Examples of Lactococcus lactic acid bacteria include species such as lactis, plantarum, and Raffinolactis. Among these Lactococcus lactic acid bacteria, lactic acid bacteria classified as lactis are preferred in the present invention. Furthermore, among Lactococcus lactic acid bacteria, those classified as Lactococcus lactis subsp. lactis or Lactococcus lactis subsp. cremoris are more preferred. That is, one particularly preferred example of the EPS used in the composition of the present invention is an EPS of a lactic acid bacterium classified as Lactococcus lactis subsp. lactis or Lactococcus lactis subsp. cremoris.

[0029] EPS produced by Lactococcus lactic acid bacteria is known to contain, for example, galactose and glucose. For example, the repeating units of EPS produced by Lactococcus lactis NIZO B40 consist of glucose, galactose, rhamnose, and phosphate in a 2:2:1:1 ratio (Non-Patent Documents 12 and 13). Furthermore, Lactococcus lactis subsp. cremoris FC (isolated from Fujicco Caspian Sea Yogurt (registered trademark)) produces a phosphate polysaccharide containing rhamnose, galactose, and glucose in a molar ratio of 1:1:3 (Non-Patent Document 14). Lactococcus lactis subsp. lactis YZ1 produces a polysaccharide composed of mannose, galactose, and glucose (Non-Patent Document 15). Based on these findings, it is believed that EPS produced by Lactococcus lactic acid bacteria also exhibit the effects of the present invention.

[0030] In addition, lactic acid bacteria having at least one type of DNA selected from the group consisting of DNAs encoding any of the following proteins (a) to (d) (DNAs that improve spinnability) can also be used: (a) a protein consisting of the amino acid sequence shown in SEQ ID NO: 2, (b) a protein consisting of the amino acid sequence shown in SEQ ID NO: 2 in which one or more amino acids other than tyrosine at position 40 have been substituted, deleted, inserted and / or added, and which has the effect of improving the spinnability of fermented milk, (c) a protein consisting of an amino acid sequence that is 80% or more identical to the amino acid sequence shown in SEQ ID NO: 2, in which the amino acid corresponding to position 40 in the amino acid sequence shown in SEQ ID NO: 2 is tyrosine, and which has the effect of improving the spinnability of fermented milk, and (d) a protein consisting of an amino acid sequence encoded by DNA that hybridizes under strict conditions with a complementary strand of DNA consisting of the nucleotide sequence shown in SEQ ID NO: 3, in which the amino acid corresponding to position 40 in the amino acid sequence shown in SEQ ID NO: 2 is tyrosine, and which has the effect of improving the spinnability of fermented milk.

[0031] In the present invention, "spinnability of fermented milk" refers to the property of fermented milk to form threads due to its viscosity and / or elasticity, and "the effect of improving the spinnability of fermented milk" refers to the effect of imparting the spinnability to fermented milk or improving the spinnability of fermented milk (sometimes referred to as "spinnability-improving effect" in this specification). The reason why the protein has the spinnability-improving effect is not clear, but the inventors speculate that this may be because the protein of the present invention acts in the process of EPS biosynthesis by lactic acid bacteria to produce EPS with a highly spinnable structure.

[0032] Whether or not a lactic acid bacterium has the spinnability-improving DNA of the present invention can be determined by detecting the DNA. As a method for detecting the spinnability-improving DNA, a known method or a method based thereon can be appropriately adopted.

[0033] (Constituent sugars of EPS, etc.) In one aspect, the EPS of a lactic acid bacterium contained in the composition of the present invention may contain an acidic exopolysaccharide having a repeating structure in which repeating units represented by the following formula (I) are linked together.

[0034] In formula (I), n is 0 or 1; α-D-Galp represents a pyranose-type α-D-galactose residue; β-D-Galp represents a pyranose-type β-D-galactose residue; β-D-Galf represents a furanose-type β-D-galactose residue; Gro3P represents a glycerol 3-phosphate group; and (1-2), (1-3), (1-5), and (1-6) represent 1-2 bond (i.e., carbon-1-carbon bond-2), 1-3 bond, 1-5 bond, and 1-6 bond, respectively, between residues.

[0035] In one aspect, in the acidic exopolysaccharide, in the repeating structure in which the repeating units represented by formula (I) are linked together, it is preferred that an average of about one glycerol 3-phosphate group be added per repeating unit (for example, one (n=1) or zero for each repeating unit, and about one per repeating unit on a weighted average for the entire acidic EPS), but this is not limitative.

[0036] In another aspect, the EPS of lactic acid bacteria contained in the composition of the present invention may include a neutral polysaccharide having a repeating structure in which repeating units represented by the following formula (II) are linked together.

[0037] Fermented Product EPS may be contained in the composition of the present invention as a fermented product of lactic acid bacteria (preferably, a fermented product of animal milk). Fermented products of lactic acid bacteria include not only the fermented product itself but also processed products thereof. Examples of fermented products themselves include fermented milk (specifically, yogurt, etc.). Processed products include, for example, crude products, precipitates obtained by filtering, centrifuging, or membrane filtration of the fermented product, culture concentrates with reduced liquid components, culture filtrates and culture supernatants, concentrates obtained by concentrating culture filtrates and culture supernatants, and dried concentrates. Alternatively, the composition may be a powdery or granular aggregate obtained by spraying a culture solution, concentrated culture concentrate, culture filtrate, or culture supernatant with a binder solution. The substrate for fermentation is not particularly limited, but may be a general lactic acid bacteria growth medium, preferably animal milk, and preferably does not contain a legume extract. The composition of the present invention may or may not contain bacteria.

[0038] Lactic acid bacteria EPS may be prepared by a conventional method, such as that described in Patent Document 4, or may be produced by chemical synthesis. When preparing lactic acid bacteria EPS as a fermentation product of lactic acid bacteria, fermented milk containing EPS can be produced by adding EPS-producing lactic acid bacteria as a starter to raw milk and fermenting it to produce EPS in the fermentation product. Fermentation conditions, such as raw milk, fermentation temperature, and fermentation time, are not particularly limited as long as the lactic acid bacteria used can produce EPS, and can be appropriately determined by a person skilled in the art.

[0039] Examples of starters that can be used include bacteria belonging to the genus Lactobacillus, and bacteria belonging to the genus Streptococcus thermophilus in addition to bacteria belonging to the genus Lactobacillus. Thus, in one embodiment, the fermentation product of lactic acid bacteria is a fermentation product of bacteria belonging to the genus Lactobacillus and bacteria belonging to Streptococcus thermophilus. The bacteria belonging to Streptococcus thermophilus is preferably Streptococcus thermophilus 1131. Streptococcus thermophilus 1131 can be isolated from Meiji Bulgaria Yogurt LB81 (Meiji Co., Ltd.) and is commercially available.

[0040] [Application] (Function) CXCR3 + / CCR4 low / CCR6 high CD4 with the cell surface marker expression pattern of + The composition of the present invention promotes proliferation of T cells. + / CCR4 low / CCR6 high Cells with the expression pattern of cell surface markers of (hereinafter referred to as Th7R cells or TH7R or CXCR3 + / CCR4 lo / CCR6 hi It can be used to promote the proliferation of CXCR3. + / CCR4 low / CCR6 highCD4 with the cell surface marker expression pattern of + T cells are those that express at least CXCR3 + / CCR4 low / CCR6 high It is sufficient for the cluster to have the cell surface marker expression pattern described above, for example, cluster 44352 described in the Examples. In this specification, the definitions of +, low (lo), high (hi), and -, which indicate the expression level of the chemokine receptor, are as follows: + indicates that the expression of the chemokine receptor is positive, i.e., the measured value in the expression analysis of the cell surface marker by flow cytometry or the like is equal to or higher than a certain measurement limit. Low indicates that the expression level of the chemokine receptor is equal to or lower than the median expression intensity of the cell surface marker per cell in the PBMCs of the population to be analyzed. Note that "equal to or lower" may also include negative expression. High indicates that the expression level of the chemokine receptor is equal to or higher than the median expression intensity of the cell surface marker per cell in the PBMCs of the population to be analyzed. Alternatively, it may be equal to or higher than any higher value. "-" indicates that chemokine receptor expression is negative, i.e., the measured value in cell surface marker analysis by flow cytometry or the like is below the detection limit, i.e., expression cannot be said to be positive. Here, expression intensity can be measured, for example, by directly analyzing cells by flow cytometry using a fluorescently labeled antibody specific to the cell surface marker, or, as in the Examples, by directly analyzing cells by mass cytometry using a metal isotope-labeled antibody specific to the cell surface marker, and quantifying the metal isotope. If the above analysis is difficult, expression intensity can be measured based on the fluorescence intensity of the fluorescently labeled antibody. If either method is difficult, other methods well known to those skilled in the art may be used.

[0041] The promotion of Th7R cell proliferation is, for example, as shown in this example, + T cell clustering detects CD4 T cells in PBMCs (peripheral blood mononuclear cells) collected from the subject. +Evaluation can be performed by determining whether the percentage of Th7R cells in a T cell population is increased after ingestion of the component to be evaluated compared to an appropriate control. Promotion of Th7R cell proliferation can include increasing the number of Th7R cells themselves, promoting differentiation into Th7R cells, preventing the death of Th7R cells to increase the percentage of the population, and promoting influx from other tissues to increase the percentage of the population. In one embodiment, promotion of Th7R cell proliferation refers to promotion of proliferation of Th7R cells in the blood. Detection of the Th7R cell population can be performed by clustering or other scientifically acceptable methods.

[0042] The compositions of the present invention can be used for treating diseases or conditions that can be improved by promoting the proliferation of Th7R cells. In the present invention, treatment includes prevention, improvement, and suppression of the progression of a disease or condition.

[0043] Th7R cells can be used as a biomarker to predict the response rate of immune checkpoint inhibitors to cancer (Non-Patent Document 1). Therefore, the compositions of the present invention, which can promote the proliferation of Th7R cells, can be used to improve sensitivity to immune checkpoint inhibitor therapy. Furthermore, the compositions of the present invention can be used to improve sensitivity to immune checkpoint inhibitor therapy by promoting the proliferation of Th7R cells. Improving sensitivity to immune checkpoint inhibitor therapy means changing a subject who is resistant to immune checkpoint inhibitor therapy into one who is susceptible to it (improvement), or making a subject who has become resistant to immune checkpoint inhibitor therapy regain the effect over time (recovery). The effects of immune checkpoint inhibitor therapy include, for example, extending the survival time of cancer patients, killing cancer cells to shrink the cancer (reducing tumor volume), slowing cancer growth (inhibiting tumor volume increase), curing cancer, preventing cancer metastasis and recurrence, and killing cancer cells that may have metastasized.

[0044] The immune checkpoint inhibitor therapy is not particularly limited as long as it is an immune checkpoint inhibitor therapy, but may be, for example, PD-1 inhibitor therapy, PD-L1 inhibitor therapy, CTLA-4 inhibitor therapy, LAG-3 inhibitor therapy, TIGIT inhibitor therapy, CSF-1 / CSF-1R inhibitor therapy, TIM-3 inhibitor therapy, or a combination of these. It may also be a combination of immune checkpoint inhibitor therapy with anti-cancer treatments such as chemotherapy, radiation therapy, or surgery, with PD-1 inhibitor therapy being preferred. PD-1 inhibitor therapy, PD-L1 inhibitor therapy, CTLA-4 inhibitor therapy, and LAG-3 inhibitor therapy refer to therapies using PD-1 inhibitors, PD-L1 inhibitors, CTLA-4 inhibitors, and LAG-3 inhibitors, respectively. Examples of PD-1 inhibitors include pembrolizumab and nivolumab. Examples of PD-L1 inhibitors include atezolizumab, avelumab, and durvalumab. Examples of CTLA-4 inhibitors include ipilimumab and tremelimumab. Examples of LAG-3 inhibitors include leratolimab. Examples of multiple immune checkpoint inhibitors include combinations of the anti-PD-1 antibody nivolumab and the anti-LAG-3 antibody leratolimab (e.g., opdualagu).

[0045] Furthermore, Th7R cells are known to contribute to the suppression of cancer recurrence after surgical removal (Non-Patent Document 2). Therefore, the composition of the present invention, which can promote the proliferation of Th7R cells, can be used to suppress the recurrence of cancer (particularly lung cancer) after surgical removal. Furthermore, the composition of the present invention can be used to suppress the recurrence of cancer (particularly lung cancer) after surgical removal by promoting the proliferation of Th7R cells.

[0046] 1. Promoting the proliferation of MAIT cells and NKT cells (hereinafter also referred to as MAIT / NKT cells) The composition of the present invention can be used to promote the proliferation of MAIT (Mucosal-Associated Invariant T Cells) cells and NKT (Natural Killer T Cells) cells. MAIT cells and NKT cells are each a type of effector T cell, and while they contribute to adaptive immunity, they also have the characteristics of having rapid effector activity and contributing to innate immunity. MAIT cells and NKT cells are, for example, CD3 + , CD4 - , CD28 + , and CD161 + The cells having the above cell surface marker expression pattern can be detected and measured, for example, by the methods described in the Examples.

[0047] Promotion of proliferation of MAIT cells and NKT cells can be evaluated, for example, as shown in the present Examples, by measuring the change in the percentage of MAIT / NKT cells (the sum of MAIT cells and NKT cells) in PBMCs collected from a subject before and after ingestion of a component to be evaluated compared to an appropriate control, using mass cytometry, which comprehensively analyzes markers expressed in cells in PBMCs collected from a subject. Promotion of proliferation of MAIT cells and NKT cells can include an increase in the number of MAIT cells and NKT cells themselves, promotion of differentiation into MAIT cells and NKT cells, prevention of death of MAIT cells and NKT cells to increase the percentage of the population, and promotion of influx from other tissues to increase the percentage of the population. In one aspect, promotion of proliferation of MAIT cells and NKT cells refers to promotion of MAIT cells and NKT cells in the blood.

[0048] The compositions of the present invention can be used for the treatment of diseases or conditions that are ameliorated by the promotion of MAIT cells and NKT cells.

[0049] It is known that MAIT cells contribute to the suppression of cancer metastasis (Non-Patent Document 3), and NKT cells contribute to the prevention of cancer (particularly liver cancer) (Non-Patent Document 4). Therefore, the compositions of the present invention, which can promote the proliferation of MAIT cells and NKT cells, can be used for either or both of the suppression of cancer metastasis and the prevention of cancer. Furthermore, the compositions of the present invention can be used to suppress cancer metastasis by promoting the proliferation of MAIT cells, or can be used to prevent cancer (particularly liver cancer) by promoting the proliferation of NKT cells.

[0050] (Subject) The subject to which the composition of the present invention is administered may be, for example, a mammal, preferably a human. The age and sex of the subject are not particularly limited. In the case of humans, the subject includes infants, young children, children, adults, and the elderly.

[0051] It is known that when the proportion of Th7R cell clusters in peripheral blood is equal to or greater than a certain level, sensitivity to immune checkpoint inhibitor therapy is improved (Non-Patent Document 1). Therefore, promoting the proliferation of Th7R cells is considered preferable for improving sensitivity to immune checkpoint inhibitor therapy. Therefore, when the composition of the present invention is used to improve sensitivity to immune checkpoint inhibitor therapy, subjects suitable for administering the composition of the present invention may be subjects for whom it is necessary or desirable to promote the proliferation of Th7R cells. Subjects for whom it is necessary or desirable to promote the proliferation of Th7R cells include, for example, subjects with CD4 cytotoxicity in PBMCs. + The subject may have a composition rate of Th7R cells in T cells of 6.0% or less, preferably 5.0% or less, more preferably 4.0% or less.

[0052] It is known that MAIT cells contribute to the suppression of cancer metastasis (Non-Patent Document 3), and NKT cells contribute to the prevention of cancer (particularly liver cancer) (Non-Patent Document 4). Therefore, when the composition of the present invention is used for either or both of the suppression of cancer metastasis and the prevention of cancer, it is preferable to administer it to a subject in whom it is necessary or desirable to promote the proliferation of MAIT cells and NKT cells. Furthermore, this Example demonstrates that ingestion of the composition of the present invention increases the percentage of MAIT cells and NKT cells in PBMCs from about 2.56% to about 0.14%. A subject in whom it is necessary or desirable to promote the proliferation of MAIT cells and NKT cells may be, for example, a subject in whom the percentage of MAIT cells and NKT cells in PBMCs is 4.0% or less, preferably 3.5% or less, more preferably 3.0% or less, and even more preferably 2.5% or less.

[0053] Further examples of subjects suitable for administering the composition of the present invention include: healthy subjects in whom it is necessary or desirable to promote the proliferation of one or more of Th7R cells, MAIT cells, and NKT cells; healthy subjects in whom it has been determined that there are few Th7R cells, MAIT cells, and NKT cells in the blood or PBMC; healthy subjects in whom there are few CD4 +Subjects recognized to have low levels of Th7R T cells; healthy subjects not undergoing cancer treatment; healthy subjects not undergoing immune checkpoint inhibitor therapy; healthy subjects not undergoing cancer removal surgery; healthy subjects for whom suppression of cancer metastasis or recurrence is necessary or desirable (e.g., subjects after cancer treatment); healthy subjects at high risk of developing cancer (especially liver cancer) (e.g., alcoholics, smokers, those with underlying diseases such as hepatitis B or C, obesity, fatty liver, or diabetes, elderly people, etc.); healthy subjects not undergoing cancer treatment (e.g., surgical therapy, radiation therapy, chemotherapy, etc.). In the present invention, "administration" refers not only to the administration of pharmaceuticals to a subject, but also to the ingestion of non-pharmaceutical foods (e.g., by a subject). A healthy subject refers to a human or companion animal (described below) who has not been diagnosed with any disease (pre-disease). In other words, when the composition of the present invention is used in these healthy subjects, the composition of the present invention is not used for therapeutic purposes.

[0054] The composition of the present invention can also be used for non-therapeutic purposes in healthy subjects. In one embodiment, the composition of the present invention can be used in the form of food or the like (for example, as a food composition). In the above embodiment, the composition is not a medicine, and is provided in the form of, for example, the food described below. Non-therapeutic uses refer to uses for maintaining, temporarily alleviating, supporting (assisting), or taking into consideration the condition.

[0055] Further examples of subjects suitable for receiving the compositions of the present invention include: subjects with a disease in which it is necessary or desirable to promote the proliferation of one or more of Th7R cells, MAIT cells, and NKT cells; subjects with a disease in which it has been determined that there are few Th7R cells, MAIT cells, and NKT cells in the blood or PBMCs; subjects with a disease in which there are few CD4+ cells in the blood or PBMCs; +Subjects with a disease who are not undergoing cancer treatment; Subjects with a disease who are undergoing or should undergo immune checkpoint inhibitor therapy; Subjects with a disease who are not undergoing immune checkpoint inhibitor therapy; Subjects with a disease who are scheduled to undergo immune checkpoint inhibitor therapy; Subjects with a disease who are not receiving sufficient immune checkpoint inhibitor therapy (for example, subjects whose cancer has progressed despite immune checkpoint inhibitor therapy; Subjects with a disease who are not receiving PD (progressive phase morbidity) therapy) Subjects diagnosed with a cancer disease); subjects with a disease who have undergone or should undergo cancer removal surgery; subjects with a disease who have not undergone cancer removal surgery; subjects with a disease who are scheduled to undergo cancer removal surgery; subjects with a disease for whom it is necessary or desirable to suppress cancer metastasis (subjects diagnosed with cancer; subjects undergoing or after cancer treatment, etc.); subjects with a disease who are at high risk of developing cancer (especially liver cancer) (e.g., alcoholics, smokers, those with underlying diseases such as hepatitis B or C, obesity, fatty liver, or diabetes, elderly people, etc.); subjects with a disease who have not undergone cancer treatment (surgery, radiation therapy, chemotherapy, etc.); and subjects with a disease who are scheduled to undergo cancer treatment. A subject with a disease refers to a human diagnosed with any of the diseases or a companion animal, as described below. When the composition of the present invention is used on subjects with these diseases, the composition of the present invention is not used for therapeutic purposes, but for non-therapeutic purposes such as adjunctive treatment.

[0056] The composition of the present invention can be used for non-therapeutic purposes in subjects with diseases. In one embodiment, the composition of the present invention can be used in the form of a food or the like (e.g., as a food composition) as a composition for supporting treatment. Here, "supporting treatment" refers to non-therapeutic uses for the treatment of diseases or illnesses. Examples of support for treatment include use in subjects undergoing treatment for diseases or illnesses to enhance the therapeutic effect or provide nutritional support during treatment; use in subjects treated for diseases or illnesses to improve the prognosis, maintain a good prognosis, or provide nutritional support after treatment; and use in subjects scheduled to be treated for diseases or illnesses to enhance the therapeutic effect after treatment or provide nutritional support before treatment. In these embodiments, the composition is provided not as a pharmaceutical but, for example, in the form of a food as described below. Non-therapeutic uses for the treatment of diseases or illnesses include use for nutritional management of subjects requiring special care, use as hospital food, maintenance of condition, temporary relief, support (assistance), and use taking into consideration the condition.

[0057] When using the composition of the present invention for non-therapeutic purposes, judgments as to whether it is desirable or necessary may include judgments as non-therapeutic actions, such as advice other than diagnosis, by medical professionals such as doctors, nurses, pharmacists, midwives, and clinical laboratory technicians, judgments by those involved in non-therapeutic actions, such as nutritionists (including registered dietitians and sports nutritionists), public health nurses, sports instructors, pharmaceutical manufacturers, pharmaceutical distributors, food manufacturers, and food distributors, judgments by the subject himself or her family, etc. Furthermore, the above judgments include judgments based on the output results of questionnaires on lifestyle habits, eating habits, nutritional status, and subjective symptoms, health checkup data related to the immune system, and judgments based on subjective symptoms (concerns about obesity or lifestyle-related diseases, etc.).

[0058] The subject may be a human or a non-human animal. Non-human animals include mammals, birds, reptiles, amphibians, fish, etc. Non-human animals may be commercial animals, research animals, or companion animals. The phrase "companion animal" refers to a domestic or domestic animal whose physical, emotional, behavioral, and social needs can be readily met as a domestic companion or through close daily association with one or more humans. In one embodiment, species included within the definition of companion animal include dogs, canines, cats, felines, cows, horses, goats, sheep, pigs, primates (such as monkeys), rabbits, ferrets, rodents (such as guinea pigs, hamsters, mice, and rats), and other small mammals. In another embodiment, species included within the definition of companion animals are dogs, cats, horses, rabbits, ferrets, guinea pigs, and other small mammals, birds, small reptiles, fish, and livestock animals.

[0059] The age of the subject is not particularly limited, and when the subject is a human, the subject may be, for example, a newborn (within 28 days of birth); an infant (less than 1 year of age); a toddler (1 to 6 years of age); a child (7 years of age or older, but less than 15 years of age); an adult (15 years of age or older); a person aged 40 years or older, a person aged 50 years or older, a person aged 60 years or older, or a person aged 65 years or older.

[0060] Some embodiments of the present invention relate to a method for promoting the proliferation of Th7R cells in a subject; a method for improving sensitivity to immune checkpoint inhibitor therapy in a subject; or a method for suppressing cancer recurrence in a subject after surgical removal, which may include the following steps: (a) obtaining information on Th7R cells in the subject's blood or PBMCs; and (b) determining, based on the information, whether or not there is a need to ingest lactic acid bacterial exopolysaccharides or a composition containing lactic acid bacterial exopolysaccharides.

[0061] Some embodiments of the present invention relate to a method for promoting the proliferation of MAIT cells and NKT cells in a subject; a method for suppressing cancer metastasis in a subject; or a method for preventing cancer in a subject, which may comprise the following steps: (a) obtaining information on MAIT cells and NKT cells in the blood or PBMCs of the subject; and (b) determining, based on the information, whether or not there is a need to ingest lactic acid bacterial exopolysaccharides or a composition containing lactic acid bacterial exopolysaccharides.

[0062] In the above-described methods, the information on Th7R cells in blood or PBMCs, or the information on MAIT cells and NKT cells, may be, for example, the cell number, composition ratio, concentration, etc. of Th7R cells, or MAIT cells and NKT cells in blood or PBMCs. Furthermore, this information may be obtained by any method; for example, when the information on each cell is the composition ratio in blood or PBMCs, it can be obtained using an immunological technique based on cell surface markers as shown in this example.

[0063] (Others) The uses of the composition of the present invention may exclude the following: treatment of rheumatoid arthritis; activation of NK cells; promotion of YAC-1 cell killing activity of NK cells; antiviral; promotion of YAC-1 cell killing activity of NK cells stimulated with IFN-α; prevention of pneumococcal infection; suppression of decline in acquired immune function caused by anti-influenza drugs; prevention and / or treatment of influenza; increase in salivary IgA that reacts with influenza viruses; regulation of cytokine (IL-1β, TNF-α, CXCL1) production; activation of cellular immunity; activation of cellular immunity against melanoma antigens, influenza antigens, or HBV antigens; suppression of cancer cachexia; promotion of immune checkpoint inhibitor therapy. promotion of immune response; prevention of or reduction of the risk of secondary infections after influenza infection; suppression of the increase in expression of cell adhesion molecules (especially tight junction molecules such as CEACAM-1) after influenza virus infection; suppression of the proliferation of human coronaviruses (especially HCoV-229E); suppression of norovirus proliferation; enhancement of Th1, Th2, and Treg activity; maintenance of Th17 activity; promotion of IFN-γ production by T cells; activation of T cells; increase in CD69 expression rate on T cells; promotion of maturation from CD8+TEM to CD8+TEMRA; increase in antibody titers; use as an adjuvant; retinoic acid production.

[0064] [Form of composition, etc.] The composition of the present invention can be a food composition or a pharmaceutical composition. Foods and pharmaceuticals include not only those for humans but also those for non-human animals, unless otherwise specified. Foods include general foods, functional foods, nutritional compositions, and therapeutic foods (those that serve the purpose of treatment; prepared based on a menu prepared by a nutritionist or other professional prescribed by a doctor), dietary therapy foods, ingredient-modified foods, nursing care foods, therapeutic support foods, and precision nutrition (individualized nutrition, appropriate diets (nutrition) proposed according to an individual's constitution), unless otherwise specified. Foods include not only solid foods but also liquid foods, such as beverages, energy drinks, liquid foods, and soups, unless otherwise specified. Functional foods refer to foods that can impart specific functionality to the body, and include a wide range of health foods, including foods for specified health uses (including conditional FOSHUs [foods for specified health uses]), foods with functional claims, health functional foods including foods with nutrient functions, foods for special dietary uses, dietary supplements, health supplements, dietary supplements, food supplements, medical foods (as defined by the U.S. Food and Drug Administration (FDA)), supplements (e.g., tablets, coated tablets, sugar-coated tablets, capsules, liquids, etc.), and beauty foods (e.g., diet foods). Furthermore, in the present invention, "functional foods" also includes health foods to which a health claim based on the Codex Alimentarius (the Joint FAO / WHO Food Standards Commission) is applicable. Food supplements are supplements to the normal diet and are concentrated with nutrients or other substances, either alone or in combination, that have nutritional or physiological effects, and are labeled as "food supplements." Dietary supplements are products (other than tobacco) intended to supplement the diet, that contain one or more of the targeted ingredients, and that are labeled as a dietary supplement.

[0065] [Intake Route] The composition of the present invention may be taken orally, parenterally, for example, via a tube (gastrostomy, enterostomy), or nasally, but is preferably taken orally.

[0066] [Content and Dosage of Active Ingredient] The content of lactic acid bacteria EPS in the composition of the present invention may be any amount sufficient to achieve the desired effect. The intake amount of the composition can be appropriately determined taking into account various factors, such as the subject's age, weight, symptoms, metabolic and excretory functions, and concomitant medications. The amount of lactic acid bacteria EPS per daily dose can be, for example, 0.1 mg or more, preferably 0.6 mg or more, more preferably 3 mg or more, and even more preferably 3.3 mg or more or 6 mg or more. Regardless of the lower limit, the upper limit of the amount of EPS per daily dose can be 4800 mg or less, preferably 3600 mg or less, more preferably 1800 mg or less, and particularly preferably 900 mg or less. Furthermore, in the present invention, each component in the composition is used at an intake level guaranteed to be safe, or at or below the acceptable daily intake (ADI), in accordance with the food safety laws of each country.

[0067] The amount of EPS of lactic acid bacteria per intake or meal, i.e., per serving, can be, for example, 0.03 mg or more, preferably 0.2 mg or more, and more preferably 1 mg or more. Regardless of the lower limit, the upper limit of the amount of EPS per serving can be 1600 mg or less, preferably 1200 mg or less, more preferably 600 mg or less, and particularly preferably 300 mg or less.

[0068] When the composition of the present invention contains EPS as a fermented product of lactic acid bacteria (fermented milk), the daily amount of fermented milk can be, for example, 10 g or more, preferably 30 g or more, more preferably 60 g or more, even more preferably 100 g or more, and particularly preferably 112 g or more. Regardless of the lower limit, the upper limit of the daily amount of fermented milk can be, for example, 1500 g or less, preferably 1200 g or less, and more preferably 600 g or less.

[0069] The amount per intake or meal, i.e., the amount per serving of fermented milk, can be, for example, 3 g or more, preferably 10 g or more, and more preferably 20 g or more. Regardless of the lower limit, the upper limit of the amount per serving of fermented milk can be, for example, 800 g or less, preferably 400 g or less, and more preferably 200 g or less.

[0070] The composition may be taken once a day or multiple times a day, for example, three times a day with each meal. The composition contains EPS of a lactic acid bacterium that has been consumed extensively as an active ingredient. Therefore, the composition of the present invention may be taken repeatedly or over a long period of time, for example, for one week or more, preferably two weeks or more, more preferably three weeks or more, and even more preferably four weeks or more.

[0071] An example of a method for preparing fermented milk according to an embodiment of the present invention is a method in which raw milk is sterilized and cooled, a lactic acid bacteria starter containing the above-described lactic acid bacteria is added to the raw milk, and the raw milk containing the lactic acid bacteria starter is fermented at a fermentation temperature and for a fermentation time that results in a predetermined lactic acid acidity. The exopolysaccharides are produced by Lactobacillus lactic acid bacteria during fermentation. In this method, the lactic acid acidity is, for example, 0.6 to 1.2. Preferably, the lactic acid acidity is 0.6 to 0.8. The fermentation temperature is, for example, 40 to 45°C. The fermentation time is, for example, 2 to 12 hours. Preferably, the fermentation time is 3 to 8 hours.

[0072] [Other Ingredients and Additives] The composition of the present invention may contain other active ingredients or nutritional ingredients that are acceptable as foods or pharmaceuticals. Examples of such ingredients include amino acids (e.g., lysine, arginine, glycine, alanine, glutamic acid, leucine, isoleucine, valine), carbohydrates (glucose, sucrose, fructose, maltose, trehalose, erythritol, maltitol, palatinose, xylitol, dextrin), electrolytes (e.g., sodium, potassium, calcium, magnesium), vitamins (e.g., vitamin A, vitamin B1, vitamin B2, vitamin B6, vitamin B12, vitamin C, vitamin D, vitamin E, vitamin K, biotin, folic acid, pantothenic acid, and nicotinic acids), minerals (e.g., copper, zinc, iron, cobalt, manganese), antibiotics, dietary fiber, protein, lipids, etc.

[0073] The composition of the present invention may further contain additives acceptable for use as food or pharmaceuticals, such as inert carriers (solid or liquid carriers), excipients, surfactants, binders, disintegrants, lubricants, solubilizers, suspending agents, coating agents, colorants, preservatives, buffers, pH adjusters, emulsifiers, stabilizers, sweeteners, antioxidants, flavors, acidulants, and natural products. More specifically, examples of the additives include water, other aqueous solvents, pharmaceutically acceptable organic solvents, collagen, polyvinyl alcohol, polyvinylpyrrolidone, carboxyvinyl polymers, sodium alginate, water-soluble dextran, water-soluble dextrin, sodium carboxymethyl starch, pectin, xanthan gum, gum arabic, casein, gelatin, agar, glycerin, propylene glycol, polyethylene glycol, petrolatum, paraffin, stearyl alcohol, stearic acid, human serum albumin, mannitol, sodium chloride, propylene glycol, glycerin, benzalkonium chloride, methyl parahydroxybenzoate, lactose, starch, maltose, sorbitol, lactose, sucralose, stevia, aspartame, acesulfame potassium, citric acid, lactic acid, malic acid, tartaric acid, phosphoric acid, acetic acid, fruit juice, and vegetable juice.

[0074] [Dosage Form / Form] The pharmaceutical composition of the present invention can be made into any dosage form suitable for oral ingestion, such as solid preparations such as tablets, granules, powders, pills, and capsules; liquid preparations such as solutions, suspensions, and syrups; gels; and aerosols.

[0075] The food composition of the present invention may be prepared in any form, such as a solid, liquid, mixture, suspension, powder, granules, paste, jelly, gel, or capsule. The food composition of the present invention may also be in any form, such as a dairy product, supplement, confectionery, beverage, drink, seasoning, processed food, prepared dish, or soup. More specifically, the composition of the present invention may be in the form of a milk drink, soft drink, fermented milk, yogurt, ice cream, tablet, cheese, bread, biscuits, crackers, pizza crust, infant formula, liquid food, food for the sick, nutritional food, frozen food, or processed food. It may also be in the form of a granule, powder, paste, or thick liquid to be mixed with a beverage or food for ingestion.

[0076] [Others] In the production of the composition of the present invention, the stage of blending the EPS of lactic acid bacteria can be selected as appropriate. The blending stage is not particularly limited as long as it does not significantly impair the properties of the EPS of lactic acid bacteria. For example, the EPS can be blended with raw materials at an early stage of production. Alternatively, when the composition of the present invention contains EPS as a fermented product of lactic acid bacteria, EPS-producing lactic acid bacteria can be added as a starter to raw milk and fermented to produce EPS, thereby producing fermented milk containing EPS. Alternatively, lactic acid bacteria can be cultured in a medium suitable for culturing lactic acid bacteria, a medium suitable for increasing or producing EPS, or milk (including animal milk, soy milk, etc., with animal milk being preferred), and the culture itself can be concentrated using methods known in the food industry, such as centrifugation, removal of denatured proteins, or filtration. The resulting concentrated culture, dried culture, or granulated culture (e.g., spray-dried with a binder) can be used as the composition of the present invention containing EPS, or can be blended into compositions in various dosage forms to produce the composition of the present invention containing EPS. Alternatively, lactic acid bacteria can be cultured in a medium suitable for culturing lactic acid bacteria, a medium suitable for increasing and producing EPS, or in milk (including animal milk, soy milk, etc., with animal milk being preferred), and the culture is filtered, centrifuged, or membrane-separated to remove bacteria, resulting in a culture filtrate, culture supernatant, or culture isolate, a concentrated culture filtrate, a concentrate obtained by concentrating the culture filtrate, the culture supernatant, or the culture isolate, or a dried concentrate. These crude, purified, freeze-dried, or dried concentrates of EPS can be used as functional ingredients or incorporated into various compositions to produce compositions containing EPS. Note that the term "purified" as used here simply means that the EPS concentration in the purified product is higher than before purification; purity does not need to be 99-100%, and the purified product may contain bacterial cells, bacterial components, or medium components within a range of miscalculation (such as carryover from the culture).

[0077] The composition of the present invention can be labeled with its intended use (application), and can also be labeled with a recommendation for its intake to a specific target. The intended use and target can be selected as described in the above sections "Application" and "Target," respectively. Labeling can be direct or indirect. Examples of direct labeling include inscription on tangible objects such as the product itself, packaging, containers, labels, and tags. Examples of indirect labeling include advertising and promotional activities by place or means such as package inserts, pharmaceutical interview forms (IFs), websites, in-store locations, pamphlets, exhibitions, seminars such as media seminars, books, newspapers, magazines, television, radio, mail, email, sales talks, video streaming sites, social media, influencer marketing, and audio.

[0078] The compositions of the present invention may exclude: compositions produced by culturing Lactobacillus and yeast, or Lactobacillus, yeast and Lactococcus, in a medium containing an aqueous soybean extract, filtering to remove solids, sterilizing and concentrating the prepared liquid solution; fermentates obtained by fermenting a mixture comprising lactic acid bacteria and yeast in a medium containing an aqueous soybean extract under conditions that allow the soybean extract to be fermented by the microorganisms.

[0079] The present invention will be described below with reference to examples. Note that the examples are merely illustrative of the present invention and are not intended to limit the present invention.

[0080] A randomized, placebo-controlled, double-blind, parallel-group comparative study was conducted on healthy Japanese men and women aged 35 to 60 years (excluding those with, undergoing treatment for, or a history of serious diseases such as diabetes, kidney disease, liver disease, or heart disease; thyroid disease, adrenal disease, or other metabolic diseases; those with chronic diseases and regular medication use; and those with a history of gastrointestinal diseases or gastrointestinal surgery that affect digestion and absorption). This study used PBMC (peripheral blood mononuclear cell) samples isolated from blood drawn before and after the study period. In this study, subjects ingested fermented milk (yogurt described in Production Example 1) (112 g, EPS content ≥ 3.3 mg) using Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1 daily for 4 weeks, along with acidic milk (112 g, EPS-free) as a placebo.

[0081] To comprehensively measure markers expressed in PBMC samples and perform deep immunological profiling, mass cytometry analysis was performed using the Maxpar Direct Immune Profiling Assay (Standard Biotools), which stains a total of 30 markers. Seven T cell-related markers were added: CD11a, Tim-3, CD69, PD-1, ICOS, CXCR4, and TIGIT. All 174 samples that passed QC (fermented milk group, n = 44; placebo group, n = 43) were analyzed using the following two methods.

[0082] <Analysis 1: Manual gating analysis> PBMCs were gated according to Standard Biotools' technical note, "Approach to Bivariate Analysis of Data Acquired Using the Maxpar Direct Immune Profiling Assay," and the changes in the percentage of each derived immune cell population before and after ingestion of the test product were compared with those in the placebo group. The results showed a significantly greater change in MAIT / NKT cells before and after ingestion (Figure 1; fermented milk group: the average percentage of MAIT / NKT cells in PBMCs changed from 2.56% (before ingestion of the test product) to 2.7% (after ingestion) (a 0.14% increase); placebo group: the average percentage of MAIT / NKT cells in PBMCs changed from 2.71% (before ingestion of the test product) to 2.33% (after ingestion) (a 0.38% decrease)). MAIT / NKT cells were identified as CD3 + , CD4 - , CD28 + , and CD161 + These cells were detected as having the following cell surface marker expression pattern:

[0083] <Analysis 2: Machine learning analysis> Using various cytometry analysis software capable of machine learning analysis, PBMC clustering and comparison between sample populations were performed. CD4 + CITRUS (cluster identification, characterization, and regression: statistical intergroup comparison using correlation or prediction algorithms) was performed on T cells, and three clusters (#44347, #44352, #44360) with significantly different composition rates (FDR<0.01 and p<0.05) were identified. Of these, cluster #44352 had a higher composition rate after ingestion of the test product (Figure 2), and was found to have strong CCR6 expression and to be systematically distinct from the other strong CCR6 expression clusters (Figure 3). Furthermore, the chemokine receptor expression pattern of the chemokine receptors CXCR3 and CCR4 (CXCR3 + , CCR4low ) and the differentiation marker expression pattern of CD45RA and IL-7Ra (CD45RA - , IL-7Ra + ), and CD25 + CD127 - Considering that these cells are not Treg cells defined by CCR6, it is possible that they are a new lineage-specific CCR6 + CD4 + It was found that the expression pattern of the cell surface markers in the composition of the present invention is very similar to that of Th7R, which was recently discovered as a T cell population (Non-Patent Document 1, etc.). Therefore, the composition of the present invention contains a cell population classified into cluster #44352 (the expression pattern of the cell surface markers is similar to that of CXCR3 + / CCR4 low / CCR6 high It was speculated that this compound may have a growth-promoting effect.

[0084] [Production Examples] Production Example 1. EPS-Containing Yogurt Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1 and Streptococcus thermophilus were added as lactic acid bacteria starters to a skim milk powder medium, and the skim milk powder medium was fermented at a temperature of 43°C for 2.5 hours to prepare yogurt.

[0085] Production Example 2. Preparation of EPS Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1 was cultured in a 10% by mass nonfat dry milk medium at 37°C for 18 hours. Trichloroacetic acid was added to the culture to a final concentration of 10% by mass to remove denatured proteins. Cold ethanol was added and the culture was allowed to stand at 4°C for 2 hours to obtain a precipitate containing EPS. This was dialyzed against MilliQ water using a dialysis membrane (molecular weight cutoff 6-8 kDa) to enzymatically hydrolyze nucleic acids and proteins, and then another ethanol precipitation was performed to obtain a precipitate. This precipitate was dissolved in MilliQ water, dialyzed again, and then purified by lyophilization to obtain EPS.

[0086] (References 5:Zhang, L., Liu, C., Li, D., Zhao, Y., Zhang, X., Zeng, X., Yang, Z., Li, S., 2013. Antioxidant activity on exopolysaccharide isolated from Lactobacillus plantarum C88. Int. J. Biol. Macromol. 54, 270-2 References:Gorska-Froczek, S., Sandstrom, C., Kenne, L., Paociak, M., Brzozowska, E., Strus, M., Heczko, P., Gamian, A., 2013. Structure and immunoreactivity of exopolysaccharide isolated from Lactobacillus johnsonii strain 151. Carbohydr. Res. 378 , 148–153 . References7:Harding, LP, Marshall, VM, Hernandez, Y, Gu, Y, Maqsood, M, Mclay, N, Laws, AP, 2005. Structural characterization of a highly branched exopolysaccharide produced by Lactobacillus delbrueckii ssp. bulgaricus NCFB2074. Carbohydr. Res. 340, 1107–1111. References 8: JCMC Cerning, CMGC Renard, JF Thibault, C Bouillanne, M Landon, M Desmazeaud & L. Desmazeaud.Topisirovic: Carbon Source Requirements for Exopolysaccharide Production by Lactobacillus casei CG11 and Partial Structure Analysis of the Polymer Appl. Environ. Microbiol., 60, 3914 (1994). Non - Patent Document 9: M. Polak - Berecka, A. Wasko, D. Szwajgier & A. Choma: Bifidogenic and antioxidant activity of exopolysaccharides produced by Lactobacillus rhamnosus E / N cultivated on different carbon sources. Pol. J. Microbiol., 62, 181 (2013). Non - Patent Document 10: K. Fukuda, T. Shi, K. Nagami, F. Leo, T. Nakamura, K. Yasuda, A. Senda, H. Motoshima & T. Urashima: Effects of carbohydrate source on physicochemical properties of the exopolysaccharide produced by Lactobacillus fermentum TDS030603 in a chemically defined medium. Carbohydr. Polym., 79, 1040 (2010). Non - Patent Document 11; Rizwana Parveen RaniMarimuthu AnandharajAbraham David Ravindran: Characterization of a novel exopolysaccharide produced by Lactobacillus gasseri FR4 and demonstration of its in vitro biological properties.International Journal of Biological Macromolecules Volume 109, 1 April 2018, Pages 772-783. Non-Patent Document 12: Van Casteren W H M, Dijkema C, Schols H A, Beldman G, Voragen A G J. Characterisation and modification of the exopolysaccharide produced by Lactococcus lactis subsp. cremoris B40. Carbohydr Polym. 1998;37:123-130. Non-Patent Document 13: Van Kranenburg R, Marugg J D, Van Swam I I, Willem J, De Vos W M. Molecular characterization of the plasmid-encoded eps gene cluster essential for exopolysaccharide biosynthesis in Lactococcus lactis. Mol Microbiol. 1997;24:387-397. Non-Patent Document 14: Goto, Yayoi: Research on Lactococcus lactis subsp. cremoris FC, a lactic acid bacterium producing exopolysaccharide. 2021.11.19 https: / / doi.org / 10.24729 / 00017528 Non-Patent Document 15: Y. Zakaria et al., A Polysaccharide Produced by Lactococcus lactis subsp. lactis YZ1 Isolated from Traditional Indonesian Fermented Milk, "Dadih". Milk Science Vol. 47, No.1 1998.

Claims

1. A composition for promoting the growth of either or both of (i) and (ii), comprising exopolysaccharides of lactic acid bacteria. (i) CXCR3 + / CCR4 low / CCR6 high CD4 with the cell surface marker expression pattern of + T cells (ii) MAIT cells and NKT cells 2. A composition comprising exopolysaccharides of lactic acid bacteria for either or both of improving sensitivity to immune checkpoint inhibitor therapy and suppressing cancer recurrence after surgical removal.

3. The composition according to claim 2, wherein the improved sensitivity to immune checkpoint inhibitor therapy is achieved by converting a subject who is resistant to immune checkpoint inhibitor therapy into a subject who is susceptible to immune checkpoint inhibitor therapy, or by enabling a subject who has become resistant to immune checkpoint inhibitor therapy over time to once again benefit from the therapy.

4. CXCR3, including exopolysaccharides of lactic acid bacteria + / CCR4 low / CCR6 high CD4 with the cell surface marker expression pattern of + A composition for the treatment of a disease or condition that is ameliorated by promoting the proliferation of T cells.

5. CXCR3 + / CCR4 low / CCR6 high CD4 with the cell surface marker expression pattern of + The composition of claim 4, wherein the treatment of a disease or condition that is improved by promoting T cell proliferation is improving sensitivity to immune checkpoint inhibitor therapy, and the composition is intended to be administered to a subject who is not undergoing immune checkpoint inhibitor therapy.

6. A composition for treating a disease or condition that is ameliorated by promoting the proliferation of MAIT cells and NKT cells, comprising exopolysaccharides of lactic acid bacteria.

7. The composition described in claim 6, wherein the treatment for a disease or condition that is improved by promoting the proliferation of MAIT cells and NKT cells is either or both of suppressing cancer metastasis and preventing cancer, and the composition is intended to be ingested by a subject who is not currently undergoing treatment for cancer.

8. The composition according to any one of claims 1 to 7, wherein the lactic acid bacteria are bacteria belonging to the genus Lactobacillus.

9. The composition according to any one of claims 1 to 7, wherein the lactic acid bacteria are bacteria belonging to the genus Lactobacillus delbrueckii.

10. The composition according to any one of claims 1 to 7, wherein the lactic acid bacterium is Lactobacillus delbrueckii subsp. bulgaricus FERM BP-10741.

11. The composition according to any one of claims 1 to 7, wherein the exopolysaccharide of lactic acid bacteria is contained as a fermentation product of the lactic acid bacteria.

12. The composition according to any one of claims 1 to 7, which is a pharmaceutical composition.

13. The composition according to any one of claims 1 to 7, which is a food composition.

Images