Splice-switching oligonucleotides targeting insulin receptor as a cancer therapeutic

Abstract

The disclosure relates to the field of gene therapy for the treatment of an osteosarcoma using splice-switching oligonucleotides. Increased expression of INSR-A, an isoform frequently expressed in cancer, can effectively evade current therapeutic mechanisms and contribute to resistance in cancer patients. As a means to address the ability of cancer to evade therapies through this mechanism, Applicant provides a polynucleotide comprising a promoter, for example a U7 or a U1 promoter, and a first splice-switching oligonucleotide (SSO) that targets a regulatory element of an insulin receptor (JR).

Description

SPLICE-SWITCHING OLIGONUCLEOTIDES TARGETING INSULIN RECEPTOR AS A CANCER THERAPEUTICCROSS-REFERENCE TO RELATED APPLICATION

[0001] This application claims priority under 35 U.S.C. § 119(e) to U.S. Patent Provisional Application No. 63 / 572,178, filed March 29, 2024, the entirety of which is incorporated herein by reference in its entirety.FIELD10002] The disclosure relates to the field of gene therapy for the treatment of cancers such as osteosarcoma. Splice-switching oligonucleotides (SSOs) target regulatory elements of the insulin receptor to induce splicing to the non-oncogenic isoform.BACKGROUND

[0003] After DNA is transcribed into RNA, the premature mRNA undergoes a series of processing steps before it becomes the mature mRNA that is then used for translation. RNA splicing is one such event, where introns are removed and exons are joined together. Exons can be differentially skipped or retained and ligated to produce different mRNA transcripts. RNA alternative splicing contributes to protein diversity in both normal (healthy) conditions and disease. The exons and introns of a single mRNA transcript can be manipulated to produce unique proteins, and this process is implicated in diseases such as cancers and genetic disorders. Cancers can take advantage of this by upregulating the production of RNA isoforms that promote tumorigenesis or evade cell death. This is a highly regulated process. RNA splicing can happen, for example, in the insulin receptor gene.

[0004] The success of splice-switching oligonucleotide (SSO) therapy is contingent on overcoming challenges related to the efficiency of its delivery to specific target cells. This disclosure addresses these limitations.SUMMARY OF THE DISCLOSURE

[0005] Ewing sarcoma (ES) is a highly aggressive cancer of the bone and soft tissues that affects children and young adults. The current treatment regimen is a combination of surgery,radiation, and chemotherapy. Despite this multifaceted approach, cancer recurrence and relapse are common, and survival outcomes for these young patients are as low as 25%.

[0006] Further, osteosarcoma (OS), the most common pediatric bone sarcoma, is characterized by a high propensity to metastasize, usually to the lungs, bones, or lymph nodes, and overall dismal prognosis for patients with recurrent / relapsed tumors or distant spread. The five-year survival rates for those with localized disease is as high as 70%, but this figure drops drastically to 20% for the 15-20% of patients who have identified metastatic disease at the time of diagnosis. With the presence of undetectable micrometastases far before clinical intervention and metastasis being the leading cause of mortality in OS and cancers in general, there is a direct need to better understand the molecular processes that promote OS tumorigenesis but also contribute to oncogenic spread.

[0007] A growing body of literature has identified various gene modules that contribute to proliferation, migration, and cell survival in ES and OS among metabolic genes, the IGF / insulin receptor (77?; as used herein, INSR and 77? are used interchangeably) had the most significant impact on ES and OS metastasis. Both 77? and its closely homologous family member IGF -I receptor (IGF-IR) have been repeatedly implicated in the progression and malignant transformation of sarcomas, including ES and OS.

[0008] Initial targeted therapeutics research focused on targeting the IGF-IR and the 77? signaling pathway Unfortunately, only a small subset of patients has favorably responded to anti-IGF-IR therapies. Additional studies attribute this phenomenon to 77?, which can bind the same ligands as IGF-IR and potentiate downstream signaling despite IGF-IR inhibition.

[0009] INSR has two alternatively spliced isoforms — INSR-A (exon 11 skipped) and INSR-B (exon 11 included). Insulin receptor has 22 exons and can be alternatively spliced at exon 11, which results in gene isoforms IR-A and IR-B. Exon 11 is 36 nucleotides long, coding for 12 amino acids which encode the insulin receptor (IR). IR is a transmembrane protein activated by insulin, insulin-like growth factor 1 (IGF-1), and IGF-2. IR has two isoforms, IR-A (INR- A) and IR-B (INR-B). These receptors are functionally different with preferential ligand binding. Both IR-A and IR-B can bind to insulin, IGF-1, an IGF-2. IR-A has a preferential binding affinity to IGF-2. The increased affinity of IR-A to IGF-2 orchestrates a cascade of signals involved in developmental and mitogenic pathways; further, increased expression ofIGF-2 and consequent over-activation of the pathway by insulin and IGF-2 is prevalent in cancer cells. Khurshid et al, 2022 (doi.org / 10.1038 / s41698-021-00245-5). That is, the IR-A isoform is oncogenic, and prevalent in cancer cells while the IR-B isoform is non-oncogenic. SSOs can be used to switch the IR isoform towards the non-oncogenic IR-B.

[0010] Increased expression of INSR-A, an isoform frequently expressed in cancer, can effectively evade current therapeutic mechanisms and contribute to resistance in ES patients.[0011 [ As a means to address the ability of cancer to evade therapies through this mechanism, Applicant provides a polynucleotide comprising a promoter, for example a U7 or a U1 promoter, and a first splice-switching oligonucleotide (SSO) that targets a regulatory element of an insulin receptor (IR). In some aspects, the IR is a mammalian IR, e.g., a human IR. In some aspects, the SSO is selected from SEQ ID NOs: 2, 5, 8, 11, 14, 17, 20, 23, 26, 29, 32, 35, or 38 as set forth in Table 1, or alternatively comprises or consists essentially of a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the SSO set out in SEQ ID NOs: 2, 5, 8, 11, 14, 17, 20, 23, 26, 29, 32, 35, or 38 as set forth in Table 1. In some embodiments, the polynucleotide comprises two SSOs. In one embodiment, the polynucleotide further comprises a second SSO capable of targeting a regulatory element of an insulin receptor and the first SSO and the second SSO are the same or different from each other. Alternatively, the polynucleotide further comprises a third SSO that targets a regulatory element of an insulin receptor. In some aspects, the third SSO is the same or different from the first SSO and / or the second SSO. The polynucleotide can further comprise a fourth SSO that targets a regulatory element of an insulin receptor. In some aspects, the fourth SSO is the same or different from one or more of the first SSO, the second SSO, and the third SSO. In some embodiments the polynucleotide as described herein further comprises a detectable label or a purification label.

[0012] This disclosure further provides a polynucleotide comprising a promoter and a SSO that binds or is complementary to a nucleic acid sequence encoding all or a portion of intron 10, exon 11, or intron 11 of the insulin receptor gene, wherein the promoter is selected from a U7 promoter or a U1 promoter, and wherein the nucleic acid sequence encoding intron 10, exon 11, or intron 11 comprises or consists essentially of the nucleotide sequence set out in the sequences shown in Table 1. In some aspects, the polynucleotide is selected from theSSO set forth in SEQ ID NOs: 2, 5, 8, 11, 14, 17, 20, 23, 26, 29, 32, 35, or 38, as set forth in Table 1, or alternatively comprises or consists essentially of a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the nucleotide sequence set out in SEQ ID NOs: 2, 5, 8, 11, 14, 17, 20, 23, 26, 29, 32, 35, or 38 as set forth in Table 1. In some aspects, the nucleic acid sequence encoding the CUG triplet repeat, RNA binding protein 1 (CUG-BP1) binding site in intron 10, comprising or consisting essentially of TTACTCGGACACATGTGGCCTCCAAGTGTCAGAGCCCAGTGG (SEQ ID NO: 75), as indicated in the nucleotide sequence set out in SEQ ID NO: 1 as set forth in Table 1. In some embodiments, the nucleic acid sequence encodes the muscleblind like splicing regulator 1 (MBNL1) binding site in intron 11.

[0013] Applicant further provides a vector comprising at least one polynucleotide, as disclosed or described herein. In some respects, the vector is a gene delivery vehicle, nonlimiting examples of such include for example, an extracellular vesicle, a plasmid, a lipid nanoparticle, or a viral vector, optionally selected from a retroviral vector, a lentiviral vector, a non-replicating lentiviral vector, an adenovirus vector, or an adeno-associated virus (AAV) vector. According to one aspect, the plasmid is pBR322. Alternatively, the AAV vector is AAV-Rh74.

[0014] In some aspects, the vector has a sequence according to SEQ ID NOs: 42-51. In some aspects, the vector comprises or consists essentially of a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the nucleotide sequence set out in SEQ ID NOs: 42-51.

[0015] Applicant further provides a composition. According to some embodiments, the composition is comprised of one or more of at least one polynucleotide as described herein, at least one vector as described herein, more than one polynucleotide and / or vector as described herein that can be the same or different from each other. The composition is further comprised of one or more of a carrier, and adjuvant, or an anticancer therapy.

[0016] Applicant provides a method to deliver a splice-switching oligonucleotide (SSO) to a cell, thereby modulating IR alternative splicing in the cell. The methods comprise contacting the cell with one or more of the polynucleotides, and / or vectors, and / or compositionsdisclosed or described herein. Wherein more than one polynucleotide, vector or composition is delivered, the polynucleotides, or vectors or compositions can be the same or different from each other. In some aspects, the methods comprise contacting the cell with more than one composition comprising as described or disclosed herein. In one embodiment, at least one SSO in the polynucleotide, vector or composition targets a regulatory element of an insulin receptor, optionally wherein the regulatory element is selected from CUG-BP1 binding site or MBNL-1 binding site.100.17] The contacting in in vivo or in vitro, and the cell can be any cell, e.g., a cell containing an IR. In some respects, the cell is a mammalian cell or a human cell and it can be a primary cell or a cultured cell from a commercial vendor, e.g., American Type Culture Collection (ATCC). In one embodiment, the cell is a cancer cell, optionally an osteosarcoma cell. When practiced in vitro, the method provides an assay to identify personalized therapies or to test for new combination therapies. When practiced in an animal, it can provide an animal model to test for new combination therapies or personalized therapies, as well as treatments for patients suffering from cancer.

[0018] Applicant provides a method for preventing mammalian cell growth comprising contacting the cell with at least one of the polynucleotides, vectors, or compositions as disclosed or described herein. The contacting in in vivo or in vitro, and the cell can be any cell, e.g., a cell containing an 77?. In some respects, the cell is a mammalian cell or a human cell. In one embodiment, the cell is a cancer cell, optionally an osteosarcoma cell. In a further aspect, the method further provides contacting a control cell (a positive control and / or a negative control) with the at least one of the polynucleotides, vectors, or compositions as disclosed or described herein. When practiced in vitro, the method provides an assay to identify personalized therapies or to test for new combination therapies. When practiced in an animal, it can provide an animal model to test for new combination therapies or personalized therapies, as well as treatments for patients suffering from cancer.

[0019] Applicant also provides a method for treating and / or preventing a cancer such as osteosarcoma in a subject in need thereof comprising, or consisting essentially of, or yet further consisting of administering to the subject at least one of the polynucleotides disclosed or described herein. In some aspects, the method comprises, or consists of, or consistsessentially of, contacting the cell with at least one of the polynucleotides disclosed or described herein. In some embodiments, the method comprises, or consists of, or consists essentially of, administering to the subject a vector as disclosed or described herein. Also provided herein are methods comprising, or consisting essentially of, or consisting of administering to the subject at least one composition as disclosed or described herein. Alternatively, or in addition, the method comprises administering to the subject in need thereof more than one of the polynucleotide, vector, or composition disclosed or described herein.

[0020] With respect the subject in need thereof, the subject is a mammal, optionally wherein the mammal is selected from human, an ape, a gibbon, a chimpanzee, an orangutan, a monkey, a macaque, a dog, a cat, a horse, a cow, a goat, a sheep, a pig, a mouse, a rabbit, or a guinea pig. In some respects the subject in need thereof is a juvenile.

[0021] The subject in need thereof can be suffering from cancer, e.g., osteosarcoma that can be localized or metastatic. Alternatively, the osteosarcoma is a rhabdosarcoma, that can be localized or metastatic.

[0022] In some embodiments, the polynucleotide, vector, or composition in the disclosed methods are combined with an additional anticancer therapy.

[0023] Other features and advantages of the disclosure will become apparent from the following description of the drawing and the detailed description. It should be understood, however, that the drawing, detailed description, and the specific examples, while indicating embodiments of the disclosed subject matter, are given by way of illustration only, because various changes and modifications within the spirit and scope of the disclosure will become apparent to those skilled in the art from this detailed description.BRIEF DESCRIPTION OF THE DRAWINGS

[0024] FIG. 1: Receptors INR-B, INR-A, and IGF-1R across a cellular membrane.Insulin binds to INR-A and INR-B. IGF-2 binds to INRA and IGF-1R. IFG-1 binds to IGF- 1R. INR-B and INR-A facilitate cellular differentiation and metabolism. INR-A and IGF-1R facilitate cellular growth, proliferation, motility, and angiogenesis.

[0025] FIG. 2: Shows the theory behind the SSOs disclosed herein. IR specific SSOs can promote the conversion of the IR-A isoform to the IR-B isoform. The IR-B isoform contains exon 11 while the IR-A isoform does not. Higher prevalence of IR-B to IR-A results in less cellular growth and proliferation.

[0026] FIGS. 3A-3D: Insulin receptor is alternatively spliced to the IR-A isoform in OS patient-derived xenografts and cell lines. FIG. 3A) Schematic depicting the exon 11 alternative (also referred to as differential) splicing event in insulin receptor (IR). Deletion of exon 11 results in the IR-A (IR-A) isoform. The full-length isoform IR-B includes exon 11, whereas the cancer-related isoform IR-A lacks exon 11. The IR-A and IR-B proteins are closely homologous to the IGF-IR, and they exhibit differential affinity for the ligands they bind. IGF-IR and IR-A bind IGF-2 to activate growth, proliferation, and migratory signaling, whereas IR-B binds insulin to initiate metabolic and differentiation pathways. Higher expression of IR-B can reduce cell proliferation, motility, and angiogenesis. (FIG. 3B) Cumulative IR gene expression in normal osteoblasts (n=2) and human OS patient tumors (n=12) in the Sadikovic et al. Mixed Osteosarcoma dataset (Human molecular genetics 18, 1962-1975). Analysis was performed in the R2: Genomics Analysis and Visualization platform (**** p<0.0001 by one-way ANOVA). FIG. 3C, FIG. 3D) RT-PCR of IR alternative splicing in (FIG. 3C) patient-derived xenograft (PDX) samples from unclassified, primary, and metastatic human OS tumors and (FIG. 3D) osteoblasts (OB) and human OS cell lines. RT-PCR was performed on RNA extracted from these tissues, and the isoforms were amplified using primers indicated by the black arrows in (FIG. 3A) and detailed in Table 4. The levels of IR-B are quantified as percent spliced in (PSI). GAPDHi shown in (FIG. 3C) as a loading control.

[0027] FIGS. 4A-4D: SSOs targeting the negative splicing regulator CUG-BPl’s binding site robustly and specifically shifts splicing from IR-A to IR-B. (FIG. 4A) Schematic depicting the sequence of SSO55, the lead candidate, complementary to the IR intron 10 CUG-BP1 (CELF1) binding site. Figure discloses SEQ ID NOS 94 and 77 respectively, in order of appearance. (FIG. 4B) Dose-response transfection of NS SSO72 or SSO55 for 24 hours in OS cell lines. RT-PCR was performed on RNA harvested from these cells, and 77? isoforms were amplified using primers in Exons 10 and 12 (see FIG. 4A and Table 4). (FIG. 4C) 100 nM NS SSO72 (“NS,” i.e. the control non-specific SSO) or SSO55(“SSO”) in U20S, 143.98.2 Luc-GFP, and OHS Luc-GFP cells for 24 hours. A representative gel image shows IR isoforms and the splicing switch in the NS and SSO conditions.Statistical significance was determined using a t-test (n=3 for both U2OS, 143.98.2 Luc-GFP, and OHS Luc-GFP; *** p < 0.001). (FIG. 4D) Effect of NS / SSO55 treatment on wild-type IR minigene (IR Mg) or CUG-BP1 mutant minigene (Mutant 1) in HeLa cells. A deletion mutant was created by deleting seven nucleotides outside of the CUG-BP1 consensus sequence in the wild-type IR minigene to test the specificity of SSO55 for its target sequence. The mutagenized plasmid was verified by Sanger sequencing. Then, NS / SSO55 and wildtype IR / the Mutant 1 minigene were co-transfected in HeLa cells for 24 hours. RT-PCR on RNA extracted from these cells and quantification of IR-B showed no statistically significant increase in IR splicing in the mutant minigene (n=3 replicates, * p < 0.05, ns if p > 0.05 by paired t-test). Figure discloses SEQ ID NOS 97, 95, and 77, respectively, in order of appearance.

[0028] FIGS. 5A-5D: SSO55 mitigates OS cancer cell hallmarks in vitro. (FIG. 5A) Proliferation curves of U2OS, 143.98.2 Luc-GFP, and OHS Luc-GFP cells transfected with 100 nM NS / SSO55. The proliferation assay measured cell confluency and was performed using Incucyte software (**** p < 0.0001 by the Brown-Forsythe and Welch ANOVA tests). (FIG. 5B) Growth in low attachment (GILA) assay of U2OS, 143.98.2 Luc-GFP, and OHS Luc-GFP cells. Cells were seeded and transfected with 100 nM NS / SSO55. After 24 hours, all cells were reseeded at 10,000 cells / well in low attachment plates and incubated for five days. Subsequently, 100 uL Cell Titer Gio was added to each well, and luminescence was measured the Promega GlowMax Plate Reader (integration time = 1 second) (n=4-6 for each condition, ** p < 0.01, by paired t-test). Cells treated with SSO55 show decreased cell growth in low adhesion conditions compared to the NS-treated controls. (FIG. 5C) Annexin 5 staining in 143.98.2 Luc-GFP cells treated with NS or SSO55 for 24-72 hours (n=3 for each condition, *** p < 0.0001 by unpaired t-test). Cells were seeded, transfected with NS / SSO55, and then collected and stained with Annexin 5, which was measured by flow cytometry (n=3 for each condition, *** p < 0.001 by unpaired t-test). Splicing data corresponding to each time point is also shown. (FIG. 5D) qPCR analysis of apoptotic targets in U2OS and 143.98.2 Luc-GFP cells treated with NS or SSO55 for 48 hours (n=3 for U2OS, n=6 for 143.98.2 Luc-GFP, ** p < 0.01, *** p < 0.001 by unpaired t-test).

[0029] FIGS. 6A-6D: SSO55 can be expressed as an antisense RNA in an AAV.rh74 U7 snRNA vector to modulate IR splicing in OS. (FIG. 6A) Schematic of the viral plasmid that expresses either the NS SSO or SSO55 sequences downstream of the U7 promoter. The histone binding elements of the native U7 snRNP have been replaced with spliceosomal components (Sm binding and loop sequences) to facilitate entry into the nucleus. The resulting NS or SSO55 sequences are expressed as antisense RNAs. Two types of viral vectors were manufactured by VectorBuilder: 1) p-Nl (encoding NS) and p-Al (encoding SSO55) were viral plasmids with the U7 - SSO - stuffer sequence unit repeated twice, and 2) p-N2 (encoding NS) and p-A2 (encoding SSO55) had a single U7 - stuffer unit with four SSO repeats interspaced by a linker region. (FIG. 6B) Transfection of the IR minigene and viral plasmids p-Nl, p-Al, p-N2, p-A2 in HeLa cells to test their efficacy in switching IR splicing. 3 ug of the IR minigene and viral plasmid were transfected in HeLa cells using Lipofectamine 3000. Cells were harvested for RNA after 48 and 72 hours to allow sufficient time for plasmid expression. Minigene-specific primers were used to only measure the splicing of the minigene and not endogenous IR (see Table 4). Based on n=2 replicates shown on the right (gels shown in FIG. 6B and FIG. 11B), the p-Nl and p-Al plasmids were selected to be packaged into AAVs. (FIG. 6C) Transduction of recombinant AAV serotype 8 (AAV8) or rh74 (AAVrh74) in OS cells. U2OS and 143.98.2 cells were transduced with AAV-8-eGFP or AAVrh74-eGFP empty vectors at a MOI of 1E6 and observed for up to five days post viral infection (PVI). GFP fluorescence was observed on a fluorescent microscope (scale bar, 400 pM). (FIG. 6D) Transduction of AAVrh74.U7snRNA-N (expressing p-Nl) and AAVrh74.U7snRNA-A (expressing p-Al) viruses in U2OS and 143.98.2 Luc-GFP cells. Cells were transduced with virus at MOIs 1E6, 5E6, and 1E7, and IR splicing was measured after 48 and 72 hours of transduction (n=4 replicates, * p < 0.05, ** p < 0.01, *** p < 0.0001 by ordinary one-way ANOVA).

[0030] FIGS. 7A-7E: The IGF-IR monoclonal antibody dalotuzumab alters human phosphoprotein phosphorylation in combination with SSO55 and slows OS cell proliferation with AAVrh74.U7snRNA viruses. (FIG. 7A) Experimental design of transfection and dalotuzumab (indicated as “IGF-1R Ab” throughout figure) treatment in 143.98.2 Luc-GFP cells to profile a panel of human phosphoprotein. The 48 hour timepoint was selected due to the IR-B splicing switch and concomitant pAKT decrease previouslyobserved in FIG. 10. (FIG. 7B) Selected phosphoprotein spots (in duplicate) shown in the four treatment conditions - 100 nM NS only, 100 nM SSO55 only, 100 nM NS + dalotuzumab, 100 nM SSO55 + dalotuzumab. Relative mean pixel density of each phosphoprotein duplicate is shown to the right. Quantification was performed in Image J by calculating relative pixel density of each spot and averaging the duplicates. The negative control on each membrane (PBS) was quantified and subtracted from the averaged values as background. The complete images and quantifications of the array membranes are shown in FIGS. 13A-13B and annotated in Table 5. FIG. 7C) GILA assay of U2OS and OHS cells treated with NS or SSO55 alone or in combination with dalotuzumab. Cells treated with SSO55 alone or with dalotuzumab show decreased cell transformation compared to the NS- or NS + dalotuzumab-treated controls (n=4-6 for each condition, ** p < 0.01, **** p< 0.0001 by one-way ANOVA). (FIG. 7D) Experimental design of proliferation assay with dalotozumab and AAVrh74.U7snRNA viruses. Cells were incubated in low serum media for 24 hours post transduction and then in full serum media for the duration of the assay. Dalotuzumab was replaced during media changes every 48 hours. (FIG. 7E) Proliferation curve of U2OS transduced with AAVrh74.U7snRNA-N and rAAVrh74.U7snRNA-A viruses alone or in combination with dalotuzumab. Cells that received AAVrh74.U7snRNA-A + dalotuzumab showed significantly slower proliferation than other treatment conditions (** p< 0.01, *** p < 0.001, or **** p < 0.0001 by paired t-test).

[0031] FIGS. 8A-8C: SSO55 successfully switches IR splicing toward the IR-B isoform and slows cell proliferation in OS cells. (FIG. 8A) U2OS and 143.98.2 Luc-GFP cells were transfected with NS or SSO55 + / - Lipofectamine 2000. RNA from these cells was harvested 24 hours post transfection, and endogenous IR splicing was measured through RT-PCR with primers flanking exons 10 and 12 (see FIG. 3A). In both cell lines, addition of Lipofectamine 2000 was necessary to observe increases in IR-B splicing after SSO55 treatment. No splicing differences were observed in NS- or SSO55-treated cells without Lipofectamine 2000. (FIG. 8B) OS-17 was transfected with 100 nM NS or SSO55. Statistical significance was determined using a t-test (n=3 for OS-17; p < 0.001). (FIG. 8C) Transfection of 100 nM SSO55 in OS-17 cells significantly slows proliferation as measured by cell confluency compared to NS-treated cells. Grey square (bottom) is SSO55 and black circle (top) is NS.The proliferation assay was performed using Incucyte software (**** p < 0.0001 by the Brown-Forsythe and Welch ANOVA tests).

[0032] FIGS. 9A-9B: Modulation of IR splicing by SSO55 is disrupted by alterations to the CUG-BP1 binding site. (FIG. 9A) Schematic depicting the three IR minigenes used in the experiment - wild-type IR Mg (“IR Mg”) (SEQ ID NO: 97), the deletion mutant minigene (“Mutant 1”) (SEQ ID NO: 95), and a substitution mutant minigene (“Mutant 2”) (SEQ ID NO: 96). The substitution mutant was generated by altering three adenosines to thymidines in the wild-type minigene with the intention of preserving the thermodynamic properties of the original sequence (see Table 4 for primers). The mutagenized plasmid was verified by Sanger sequencing. Figure discloses “SSO55” sequence as SEQ ID NO: 77. (FIG. 9B) Effect of a SSO55 dose response treatment on the IR minigenes in HeLa cells. NS (100 nM) or SSO55 (10, 30, 50 nM) and wild-type IR / Mutant 1 / Mutant 2 minigenes were cotransfected in HeLa cells for 24 hours. RT-PCR on RNA extracted from these cells and quantification of IR-B showed a splicing correction to IR-B in only the wild-type IR minigene and not in the mutant minigenes.

[0033] FIG. 10: SSO55 treatment alters AKT phosphorylation in a time-responsive manner. Time-course of 100 nM NS or SSO55 transfection in U2OS and 143.98.2 Luc-GFP cells to measure IR isoform expression and pAKT / panAKT protein levels. RNA and protein lysates were harvested from U2OS and 143.98.2 Luc-GFP cells at 4, 8, 12, 24, 48, and 72 hours after NS or SSO55 transfection. RT-PCR was performed using primers flanking IR exons 10 and 12 (see FIG. 3 A), and products were run on a 2% agarose gel. pAKT and panAKT levels were measured on Western blot, and GAPDH was used as the loading control. The 24 and 48 hour timepoints in U2OS and 143.98.2 Luc-GFP respectively showed the largest IR-B splicing switch and decrease in pAKT.

[0034] FIGS. 11A-11B: SSO-Viral Plasmid Transfection in HeLa Cells (repetition of vectors shown in FIGS. 6A-6B) (FIG. 11 A) shows the polynucleotide sequences tested in FIG. 11B. The polynucleotide sequences were transformed into vectors. NS indicates the control and INSR indicates the SSO SSO55 (INSR corresponds to SEQ ID NO.: 5 as set forth in Table 1). x2 indicates how many copies of the polynucleotide were transformed into the vector. (FIG. 11B) shows expression levels of INSR-A and INSR-B after 48 and 72 hoursin cells treated with the different vector constructs. After 48 hours, pASV003 (SSO INSR) had 100% INSR-B.

[0035] FIG. 12: Brightfield images of U2OS and 143.98.2 cells transduced with AAV serotype 8 (AAV8) or rh74 (AAVrh74). Images correspond to the GFP images in FIG. 6C. Scale bars are 400 pM.

[0036] FIGS. 13A-13C: SSO55 mediates phosphokinase phosphorylation alone and in combination with the IGF-IR monoclonal antibody dalotuzumab. (FIG. 13A) Full blots of the R&D Systems Human Proteome Phophokinase Phosphoarray in the four experimental conditions - NS only, SSO55 only, NS + dalotuzumab (indicated as IGF-IR Ab in figure), and SSO55 + dalotuzumab. The array template can be found on the product website, and the list of profiled phosphokinases is provided in Table 5. (FIG. 13B) Relative mean pixel density of each phosphoprotein duplicate is shown to the right. Quantification was performed in Image J by calculating relative pixel density of each spot and averaging the duplicates. The negative control on each membrane (PBS) was quantified and subtracted from the averaged values as background. Columns from left to right in each phosphoprotein are NS, SSO55, NS + IGF-IR Ab, SSO55 + IGF-IR Ab (FIG. 13C) Western blot of pGSK3a / p in U2OS cells treated with NS / SSO55 + / - dalotuzumab for 24 hours (n=3, * p < 0.05, ** p < 0.001 by unpaired t-test, unmarked comparisons are not significant).

[0037] FIGS. 14A-14B: The anti-IGF-lR antibody dalotuzumab decreases cancer cell hallmarks in combination with SSO55 or AAVrh74.U7 snRNA IR virus in OS cells.(FIG. 14A) GILA assay of OHS cells transfected with 100 nM NS / SSO55 and treated with dalotuzumab (0.04 mg). Luminescence was measured the Promega GlowMax Plate Reader (integration time = 1 second). Compared to NS + dalotuzumab-treated cells, SSO55 + dalotuzumab significantly decreases growth in low adhesion conditions (n=6, **** p < 0.0001 by paired t-test). (FIG. 14B) Proliferation assay of 143.98.2 Luc-GFP cells treated with AAVrh74.U7-N, AAVrh74.U7-A alone or with dalotuzumab (0.04 mg). Cells were transduced in low-serum media for 24 hours, after which full-serum media was replaced dalotuzumab was added. Media and dalotuzumab were replaced every 48 hours following virus transduction. Cell proliferation was measured as cell confluency on Incucyte (Sartorius) (** p < 0.01, *** p < 0.001, **** p < 0.0001 by paired t-test) From top to bottom asindicated at the final time point, the lines in the graph in FIG. 14B are AAVrh74.U7-N, AAVrh74.U7-A, AAVrh74.U7-N + IGF-1R Ab, and AAVrh74.U7-A + IGF-1R Ab.

[0038] FIG. 15: shows exemplary polynucleotides comprising SSOs and U7 promoters.As viewed in the figure, the polynucleotides include at least one SSO, but exemplary polynucleotides shown include up to four SSOs. The elements of the polynucleotides can vary in order. Some vectors can include multiple copies of a polynucleotide, as indicated by the x2 and x4. The polynucleotides can vary by length.DETAILED DESCRIPTION

[0039] Applicant provides SSOs that will shift IR splicing towards IR-B, resulting in a decrease in cancer cell hallmarks. The shift towards the IR-B isoform results in increased expression of IR-B over IR-A, which can be used to treat cancer. Also provided herein are polynucleotides comprising SSOs, vectors and compositions comprising the polynucleotides, and methods of use of the polynucleotides, vectors, and / or compositions to treat cancer. In one aspect the cancer is an osteosarcoma.Definitions

[0040] The practice of the present disclosure will employ, unless otherwise indicated, conventional techniques of tissue culture, immunology, molecular biology, microbiology, cell biology and recombinant DNA, which are within the skill of the art. See, e.g., Sambrook and Russell eds. (2001) Molecular Cloning: A Laboratory Manual, 3rd edition; the series Ausubel et al. eds. (2007) Current Protocols in Molecular Biology; the series Methods in Enzymology (Academic Press, Inc., N.Y.); MacPherson et al. (1991) PCR 1 : A Practical Approach (IRL Press at Oxford University Press); MacPherson et al. (1995) PCR 2: A Practical Approach; Harlow and Lane eds. (1999) Antibodies, A Laboratory Manual; Freshney (2005) Culture of Animal Cells: A Manual of Basic Techique, 5th edition; Gait ed. (1984) Oligonucleotide Synthesis; U.S. Patent No. 4,683,195; Hames and Higgins eds. (1984) Nucleic Acid Hybridization; Anderson (1999) Nucleic Acid Hybridization; Hames and Higgins eds. (1984) Transcription and Translation; Immobilized Cells and Enzymes (IRL Press (1986)); Perbal (1984) A Practical Guide to Molecular Cloning; Miller and Calos eds. (1987) Gene Transfer Vectors for Mammalian Cells (Cold Spring Harbor Laboratory); Makrides ed. (2003) Gene Transfer and Expression in Mammalian Cells; Mayer and Walker eds. (1987)Immunochemical Methods in Cell and Molecular Biology (Academic Press, London); Herzenberg et al. eds (1996) Weir’s Handbook of Experimental Immunology; Manipulating the Mouse Embryo: A Laboratory Manual, 3rd edition (Cold Spring Harbor Laboratory Press (2002)); Sohail (ed.) (2004) Gene Silencing by RNA Interference: Technology and Application (CRC Press).

[0041] As used in the specification and claims, the singular form “a”, “an”, and “the” include plural references unless the context clearly dictates otherwise. For example, the term “a cell” includes a plurality of cells, including mixtures thereof.10042] As used herein, the term “comprising” is intended to mean that the compositions and methods include the recited elements, but do not exclude others. “Consisting essentially of’ when used to define compositions and methods, shall mean excluding other elements of any essential significance to the combination for the intended use. For example, a composition consisting essentially of the elements as defined herein would not exclude trace contaminants from the isolation and purification method and pharmaceutically acceptable carriers, such as phosphate buffered saline, preservatives and the like. “Consisting of’ shall mean excluding more than trace elements of other ingredients and substantial method steps for administering the compositions disclosed herein. Aspects defined by each of these transition terms are within the scope of the present disclosure.

[0043] As used herein, the term “about” is used to indicate that a value includes the standard deviation of error for the device or method being employed to determine the value. The term “about” when used before a numerical designation, e.g., temperature, time, amount, and concentration, including range, indicates approximations which can vary by (+) or (-) 15%, 10%, 5%, 3%, 2%, or 1 %.

[0044] As used herein, the term “animal” refers to living multi-cellular vertebrate organisms, a category that includes, for example, mammals and birds. The term “mammal” includes both human and non-human mammals.

[0045] The term “subject,” “host,” “individual,” and “patient” are as used interchangeably herein to refer to animals, typically mammalian animals. Any suitable mammal can be treated by a method, cell or composition described herein. Non-limiting examples of mammals include humans, non-human primates (e.g., apes, gibbons, chimpanzees, orangutans,monkeys, macaques, and the like), domestic animals (e.g., dogs and cats), farm animals (e.g., horses, cows, goats, sheep, pigs) and experimental animals (e.g., mouse, rat, rabbit, guinea pig). In some embodiments a mammal is a human. A mammal can be any age or at any stage of development (e.g., an adult, teen, child, infant, or a mammal in utero). A mammal can be male or female. A mammal can be a pregnant female. In some embodiments a subject is a human. In some embodiments, a subject has or is suspected of having a cancer or neoplastic disorder.

[0046] “Eukaryotic cells” comprise all the life kingdoms except monera. They can be easily distinguished through a membrane-bound nucleus. Animals, plants, fungi, and protists are eukaryotes or organisms whose cells are organized into complex structures by internal membranes and a cytoskeleton. The most characteristic membrane-bound structure is the nucleus. Unless specifically recited, the term “host” includes a eukaryotic host, including, for example, yeast, higher plant, insect and mammalian cells. Non-limiting examples of eukaryotic cells or hosts include simian, bovine, porcine, murine, rat, avian, reptilian and human and they can be primary or cultured cells obtained from a commercial vendor such as American Type Culture Collection (ATCC).

[0047] “Prokaryotic cells” usually lack a nucleus or any other membrane-bound organelles and are divided into two domains, bacteria and archaea. In addition to chromosomal DNA, these cells can also contain genetic information in a circular loop called on episome.Bacterial cells are very small, roughly the size of an animal mitochondrion (about 1-2 pm in diameter and 10 pm long). Prokaryotic cells feature three major shapes: rod shaped, spherical, and spiral. Instead of going through elaborate replication processes like eukaryotes, bacterial cells divide by binary fission. Examples include but are not limited to Bacillus bacteria, E. coli bacterium, and Salmonella bacterium.{0048] A “composition” typically intends a combination of the active agent, e.g., the ringshaped nanoparticle of this disclosure and a naturally-occurring or non-naturally-occurring carrier, inert (for example, a detectable agent or label) or active, such as an adjuvant, diluent, binder, stabilizer, buffers, salts, lipophilic solvents, preservative, adjuvant or the like and include pharmaceutically acceptable carriers. Carriers also include pharmaceutical excipients and additives proteins, peptides, amino acids, lipids, and carbohydrates (e.g., sugars,including monosaccharides, di-, tri, tetra-oligosaccharides, and oligosaccharides; derivatized sugars such as alditols, aldonic acids, esterified sugars and the like; and polysaccharides or sugar polymers), which can be present singly or in combination, comprising alone or in combination 1-99.99% by weight or volume. Exemplary protein excipients include serum albumin such as human serum albumin (HSA), recombinant human albumin (rHA), gelatin, casein, and the like. Representative amino acid components, which can also function in a buffering capacity, include alanine, arginine, glycine, arginine, betaine, histidine, glutamic acid, aspartic acid, cysteine, lysine, leucine, isoleucine, valine, methionine, phenylalanine, aspartame, and the like. Carbohydrate excipients are also intended within the scope of this technology, examples of which include but are not limited to monosaccharides such as fructose, maltose, galactose, glucose, D-mannose, sorbose, and the like; disaccharides, such as lactose, sucrose, trehalose, cellobiose, and the like; polysaccharides, such as raffinose, melezitose, maltodextrins, dextrans, starches, and the like; and alditols, such as mannitol, xylitol, maltitol, lactitol, xylitol sorbitol (glucitol) and myoinositol.

[0049] The compositions used in accordance with the disclosure, including cells, treatments, therapies, agents, drugs and pharmaceutical formulations can be packaged in dosage unit form for ease of administration and uniformity of dosage. The term "unit dose" or "dosage" refers to physically discrete units suitable for use in a subject, each unit containing a predetermined quantity of the composition calculated to produce the desired responses in association with its administration, i.e., the appropriate route and regimen. The quantity to be administered, both according to number of treatments and unit dose, depends on the result and / or protection desired. Precise amounts of the composition also depend on the judgment of the practitioner and are peculiar to each individual. Factors affecting dose include physical and clinical state of the subject, route of administration, intended goal of treatment (alleviation of symptoms versus cure), and potency, stability, and toxicity of the particular composition. Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically or prophylactically effective. The formulations are easily administered in a variety of dosage forms, such as the type of injectable solutions described herein.(0050] The term “encode” as it is applied to nucleic acid sequences refers to a polynucleotide which is said to “encode” a polypeptide if, in its native state or when manipulated by methodswell known to those skilled in the art, can be transcribed and / or translated to produce the mRNA for the polypeptide and / or a fragment thereof. The antisense strand is the complement of such a nucleic acid, and the encoding sequence can be deduced therefrom.

[0051] As used herein, the term “isolated cell” generally refers to a cell that is substantially separated from other cells of a tissue. The term includes prokaryotic and eukaryotic cells.

[0052] As used herein, the term “vector” refers to a nucleic acid construct deigned for transfer between different hosts, including but not limited to a plasmid, a virus, a cosmid, a phage, a BAC, a YAC, etc. A “viral vector” is defined as a recombinantly produced virus or viral particle that comprises a polynucleotide to be delivered into a host cell, either in vivo, ex vivo or in vitro. In some embodiments, plasmid vectors can be prepared from commercially available vectors. In other embodiments, viral vectors can be produced from baculoviruses, retroviruses, adenoviruses, AAVs, etc. according to techniques known in the art. In one embodiment, the viral vector is a lentiviral vector. Examples of viral vectors include retroviral vectors, adenovirus vectors, adeno-associated virus vectors, alphavirus vectors and the like. Infectious tobacco mosaic virus (TMV)-based vectors can be used to manufacturer proteins and have been reported to express Griffithsin in tobacco leaves (O'Keefe et al.(2009) Proc. Nat. Acad. Sci. USA 106(15): 6099-6104). Alphavirus vectors, such as Semliki Forest virus-based vectors and Sindbis virus-based vectors, have also been developed for use in gene therapy and immunotherapy. See, Schlesinger & Dubensky (1999) Curr. Opin. Biotechnol. 5:434-439 and Ying et al. (1999) Nat. Med. 5(7):823-827. Further details as to modern methods of vectors for use in gene transfer can be found in, for example, Kotterman et al. (2015) Viral Vectors for Gene Therapy: Translational and Clinical Outlook Annual Review of Biomedical Engineering 17. Vectors that contain both a promoter and a cloning site into which a polynucleotide can be operatively linked are well known in the art. Such vectors are capable of transcribing RNA in vitro or in vivo and are commercially available from sources such as Agilent Technologies (Santa Clara, Calif.) and Promega Biotech (Madison, Wis.).

[0053] An “effective amount” or “efficacious amount” refers to the amount of an agent or combined amounts of two or more agents, that, when administered for the treatment of a mammal or other subject, is sufficient to effect such treatment for the disease. The “effectiveamount” will vary depending on the agent(s), the disease and its severity and the age, weight, etc., of the subject to be treated.

[0054] As used herein, a “cancer” is a disease state characterized by the presence in a subject of cells demonstrating abnormal uncontrolled replication and can be used interchangeably with the term “tumor.”

[0055] The tumor is not limited and can be any kind of cancer, e.g., solid or blood cancer, e.g., carcinoma or sarcoma. In some embodiments, the cancer is ICI resistant. Exemplary cancers include, but are not limited to, acoustic neuroma; adenocarcinoma; adrenal gland cancer; anal cancer; angiosarcoma (e.g., lymphangiosarcoma, lymphangioendotheliosarcoma, hemangiosarcoma); appendix cancer; benign monoclonal gammopathy; biliary cancer (e.g., cholangiocarcinoma); bladder cancer; breast cancer (e.g., adenocarcinoma of the breast, papillary carcinoma of the breast, mammary cancer, medullary carcinoma of the breast); brain cancer (e.g., meningioma, glioblastomas, glioma (e.g., astrocytoma, oligodendroglioma), medulloblastoma); bronchus cancer; carcinoid tumor; cervical cancer (e.g., cervical adenocarcinoma); choriocarcinoma; chordoma; craniopharyngioma; colorectal cancer (e.g., colon cancer, rectal cancer, colorectal adenocarcinoma); connective tissue cancer; epithelial carcinoma; ependymoma; endotheliosarcoma (e.g., Kaposi’ s sarcoma, multiple idiopathic hemorrhagic sarcoma); endometrial cancer (e.g., uterine cancer, uterine sarcoma); esophageal cancer (e.g., adenocarcinoma of the esophagus, Barrett’ s adenocarinoma); Ewing’ s sarcoma; eye cancer (e.g., intraocular melanoma, retinoblastoma); familiar hypereosinophilia; gall bladder cancer; gastric cancer (e.g., stomach adenocarcinoma); gastrointestinal stromal tumor (GIST); germ cell cancer; head and neck cancer (e.g., head and neck squamous cell carcinoma, oral cancer (e.g., oral squamous cell carcinoma), throat cancer (e.g., laryngeal cancer, pharyngeal cancer, nasopharyngeal cancer, oropharyngeal cancer)); hematopoietic cancers (e.g., leukemia such as acute lymphocytic leukemia (ALL) (e.g., B-cell ALL, T-cell ALL), acute myelocytic leukemia (AML) (e.g., B- cell AML, T-cell AML), chronic myelocytic leukemia (CML) (e.g., B-cell CML, T-cell CML), and chronic lymphocytic leukemia (CLL) (e.g., B-cell CLL, T-cell CLL)); lymphoma such as Hodgkin lymphoma (HL) (e.g., B-cell HL, T-cell HL) and non-Hodgkin lymphoma (NHL) (e.g., B-cell NHL such as diffuse large cell lymphoma (DLCL) (e.g., diffuse large B- cell lymphoma), follicular lymphoma, chronic lymphocytic leukemia / small lymphocyticlymphoma (CLL / SLL), mantle cell lymphoma (MCL), marginal zone B-cell lymphomas (e.g., mucosa-associated lymphoid tissue (MALT) lymphomas, nodal marginal zone B-cell lymphoma, splenic marginal zone B-cell lymphoma), primary mediastinal B-cell lymphoma, Burkitt lymphoma, lymphoplasmacytic lymphoma (i.e., Waldenstrom’ s macroglobulinemia), hairy cell leukemia (HCL), immunoblastic large cell lymphoma, precursor B-lymphoblastic lymphoma and primary central nervous system (CNS) lymphoma; and T-cell NHL such as precursor T-lymphoblastic lymphoma / leukemia, peripheral T-cell lymphoma (PTCL) (e.g., cutaneous T-cell lymphoma (CTCL) (e.g., mycosis fungiodes, Sezary syndrome), angioimmunoblastic T-cell lymphoma, extranodal natural killer T-cell lymphoma, enteropathy type T-cell lymphoma, subcutaneous panniculitis-like T-cell lymphoma, and anaplastic large cell lymphoma); a mixture of one or more leukemia / lymphoma as described above; and multiple myeloma (MM)), heavy chain disease (e.g., alpha chain disease, gamma chain disease, mu chain disease); hemangioblastoma; hypopharynx cancer; inflammatory myofibroblastic tumors; immunocytic amyloidosis; kidney cancer (e.g., nephroblastoma a.k.a. Wilms’ tumor, renal cell carcinoma); liver cancer (e.g., hepatocellular cancer (HCC), malignant hepatoma); lung cancer (e.g., bronchogenic carcinoma, small cell lung cancer (SCLC), non-small cell lung cancer (NSCLC), adenocarcinoma of the lung); leiomyosarcoma (LMS); mastocytosis (e.g., systemic mastocytosis); muscle cancer; myelodysplastic syndrome (MDS); mesothelioma; myeloproliferative disorder (MPD) (e.g., polycythemia vera (PV), essential thrombocytosis (ET), agnogenic myeloid metaplasia (AMM) a.k.a. myelofibrosis (MF), chronic idiopathic myelofibrosis, chronic myelocytic leukemia (CML), chronic neutrophilic leukemia (CNL), hypereosinophilic syndrome (HES)); neuroblastoma; neurofibroma (e.g., neurofibromatosis (NF) type 1 or type 2, schwannomatosis); neuroendocrine cancer (e.g., gastroenteropancreatic neuroendoctrine tumor (GEP-NET), carcinoid tumor); osteosarcoma (e.g., bone cancer); ovarian cancer (e.g., cystadenocarcinoma, ovarian embryonal carcinoma, ovarian adenocarcinoma); papillary adenocarcinoma; pancreatic cancer (e.g., pancreatic andenocarcinoma, intraductal papillary mucinous neoplasm (IPMN), Islet cell tumors); penile cancer (e.g., Paget’ s disease of the penis and scrotum); pinealoma; primitive neuroectodermal tumor (PNT); plasma cell neoplasia; paraneoplastic syndromes; intraepithelial neoplasms; prostate cancer (e.g., prostate adenocarcinoma); rectal cancer; rhabdomyosarcoma; salivary gland cancer; skin cancer (e.g.,squamous cell carcinoma (SCC), keratoacanthoma (KA), melanoma, basal cell carcinoma (BCC)); small bowel cancer (e.g., appendix cancer); soft tissue sarcoma (e.g., malignant fibrous histiocytoma (MFH), liposarcoma, malignant peripheral nerve sheath tumor (MPNST), chondrosarcoma, fibrosarcoma, myxosarcoma); sebaceous gland carcinoma; small intestine cancer; sweat gland carcinoma; synovioma; testicular cancer (e.g., seminoma, testicular embryonal carcinoma); thyroid cancer (e.g., papillary carcinoma of the thyroid, papillary thyroid carcinoma (PTC), medullary thyroid cancer); urethral cancer; vaginal cancer; and vulvar cancer (e.g., Paget’ s disease of the vulva).

[0056] A “solid tumor” is an abnormal mass of tissue that usually does not contain cysts or liquid areas. Solid tumors can be benign or malignant. Different types of solid tumors are named for the type of cells that form them. Examples of solid tumors include sarcomas, carcinomas, and lymphomas. In some embodiments, a solid tumor comprises bladder cancer, bone cancer, brain cancer, breast cancer, colorectal cancer, esophageal cancer, eye cancer, head and neck cancer, kidney cancer, lung cancer, melanoma, ovarian cancer, pancreatic cancer, prostate cancer, or stomach cancer.

[0057] As used herein, the term “hematologic malignancy” refers to cancers with hematopoietic origin. In some instances, the hematologic malignancy is a B-cell malignancy. In some instances, the hematologic malignancy is a lymphoma, optionally a B-cell lymphoma. Exemplary hematologic malignancies include, but are not limited to, Diffuse large B-cell lymphoma (DLBCL), follicular lymphoma, chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), mantel cell lymphoma (MCL), marginal zone lymphomas, Burkitt lymphoma, Waldenstrom macroglobulinemia, hairy cell leukemia (HCL), primary central nervous system (CNS) lymphoma, or primary intraocular lymphoma.

[0058] As used herein, “homology” or “identical”, percent “identity” or “similarity”, when used in the context of two or more nucleic acids or polypeptide sequences, refers to two or more sequences or subsequences that are the same or have a specified percentage of nucleotides or amino acid residues that are the same, e.g., at least 60% identity, preferably at least 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity over a specified region (e.g., nucleotide sequence encoding the SSO described herein). Homology can be determined by comparing a position in each sequencewhich can be aligned for purposes of comparison. When a position in the compared sequence is occupied by the same base or amino acid, then the molecules are homologous at that position. A degree of homology between sequences is a function of the number of matching or homologous positions shared by the sequences. The alignment and the percent homology or sequence identity can be determined using software programs known in the art, for example those described in Current Protocols in Molecular Biology (Ausubel et al., eds.1987) Supplement 30, section 7.7.18, Table 7.7.1. Preferably, default parameters are used for alignment. A preferred alignment program is BLAST, using default parameters. In particular, preferred programs are BLASTN and BLASTP, using the following default parameters: Genetic code = standard; filter = none; strand = both; cutoff = 60; expect = 10; Matrix = BLOSUM62; Descriptions = 50 sequences; sort by = HIGH SCORE; Databases = non-redundant, GenBank + EMBL + DDBJ + PDB + GenBank CDS translations + SwissProtein + SPupdate + PIR. Details of these programs can be found at the following Internet address: ncbi.nlm.nih.gov / cgi-bin / BLAST. The terms “homology” or “identical,” percent “identity” or “similarity” also refer to, or can be applied to, the complement of a test sequence. The terms also include sequences that have deletions and / or additions, as well as those that have substitutions. As described herein, the preferred algorithms can account for gaps and the like. Preferably, identity exists over a region that is at least about 25 amino acids or nucleotides in length, or more preferably over a region that is at least 50-100 amino acids or nucleotides in length. An “unrelated” or “non-homologous” sequence shares less than 40% identity, or alternatively less than 25% identity, with one of the sequences disclosed herein.

[0059] The phrase “first line” or “second line” or “third line” refers to the order of treatment received by a patient. First line therapy regimens are treatments given first, whereas second or third line therapy are given after the first line therapy or after the second line therapy, respectively. The National Cancer Institute defines first line therapy as “the first treatment for a disease or condition. In patients with cancer, primary treatment can be surgery, chemotherapy, radiation therapy, or a combination of these therapies. First line therapy is also referred to those skilled in the art as “primary therapy and primary treatment.” See National Cancer Institute website at cancer.gov, last visited on May 1, 2008. Typically, a patient is given a subsequent chemotherapy regimen because the patient did not show apositive clinical or sub-clinical response to the first line therapy or the first line therapy has stopped.

[0060] It is to be inferred without explicit recitation and unless otherwise intended, that when the present disclosure relates to a polypeptide, protein, polynucleotide, an equivalent or a biologically equivalent of such is intended within the scope of this disclosure. As used herein, the term “biological equivalent thereof’ is intended to be synonymous with “equivalent thereof’ when referring to a reference protein, polypeptide or nucleic acid, intends those having minimal homology while still maintaining desired structure or functionality. Unless specifically recited herein, it is contemplated that any of the above also includes equivalents thereof. For example, an equivalent intends at least about 70% homology or identity, or at least 80% homology or identity and alternatively, or at least about 85%, or alternatively at least about 90%, or alternatively at least about 95%, or alternatively at least 98% percent homology or identity and / or exhibits substantially equivalent biological activity to the reference protein, polypeptide, or nucleic acid. Alternatively, when referring to polynucleotides, an equivalent thereof is a polynucleotide that hybridizes under stringent conditions to the reference polynucleotide or its complement.

[0061] The term “isolated” as used herein refers to molecules or biologicals or cellular materials being substantially free from other materials. In one aspect, the term “isolated” refers to nucleic acid, such as DNA or RNA, or protein or polypeptide, or cell or cellular organelle, or tissue or organ, separated from other DNAs or RNAs, or proteins or polypeptides, or cells or cellular organelles, or tissues or organs, respectively, that are present in the natural source. The term “isolated” also refers to a nucleic acid or peptide that is substantially free of cellular material, viral material, or culture medium when produced by recombinant DNA techniques, or chemical precursors or other chemicals when chemically synthesized. Moreover, an “isolated nucleic acid” is meant to include nucleic acid fragments which are not naturally occurring as fragments and would not be found in the natural state. The term “isolated” is also used herein to refer to polypeptides which are isolated from other cellular proteins and is meant to encompass both purified and recombinant polypeptides. The term “isolated” is also used herein to refer to cells or tissues that are isolated from other cells or tissues and is meant to encompass both cultured and engineered cells or tissues.

[0062] The term “protein”, “peptide” and “polypeptide” are used interchangeably and in their broadest sense to refer to a compound of two or more subunit amino acids, amino acid analogs or peptidomimetics. The subunits can be linked by peptide bonds. In another aspect, the subunit can be linked by other bonds, e.g., ester, ether, etc. A protein or peptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids which can comprise a protein’s or peptide’s sequence. As used herein the term “amino acid” refers to either natural and / or unnatural or synthetic amino acids, including glycine and both the D and L optical isomers, amino acid analogs and peptidomimetics.

[0063] The terms “polynucleotide” and “oligonucleotide” are used interchangeably and refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides or analogs thereof. Polynucleotides can have any three-dimensional structure and can perform any function, known or unknown. The following are non-limiting examples of polynucleotides: a gene or gene fragment (for example, a probe, primer, EST or SAGE tag), exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, RNAi, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes and primers. A polynucleotide can comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure can be imparted before or after assembly of the polynucleotide. The sequence of nucleotides can be interrupted by non-nucleotide components. A polynucleotide can be further modified after polymerization, such as by conjugation with a labeling component. The term also refers to both double and single stranded molecules. Unless otherwise specified or required, any aspect of this technology that is a polynucleotide encompasses both the double stranded form and each of two complementary single stranded forms known or predicted to make up the double stranded form. The polynucleotides as described herein are comprised of at least a SSO and a promoter.

[0064] As used herein, the term “purified” does not require absolute purity; rather, it is intended as a relative term. Thus, for example, a purified nucleic acid, peptide, protein, biological complexes or other active compound is one that is isolated in whole or in part from proteins or other contaminants. Generally, substantially purified peptides, proteins, biological complexes, or other active compounds for use within the disclosure comprise morethan 80% of all macromolecular species present in a preparation prior to admixture or formulation of the peptide, protein, biological complex or other active compound with a pharmaceutical carrier, excipient, buffer, absorption enhancing agent, stabilizer, preservative, adjuvant or other co-ingredient in a complete pharmaceutical formulation for therapeutic administration. More typically, the peptide, protein, biological complex or other active compound is purified to represent greater than 90%, often greater than 95% of all macromolecular species present in a purified preparation prior to admixture with other formulation ingredients. In other cases, the purified preparation can be essentially homogeneous, wherein other macromolecular species are not detectable by conventional techniques.

[0065] As used herein, the term “recombinant protein” refers to a polypeptide which is produced by recombinant DNA techniques, wherein generally, DNA encoding the polypeptide is inserted into a suitable expression vector which is in turn used to transform a host cell to produce the heterologous protein.

[0066] As used herein, “treating” or “treatment” of a disease in a subject refers to (1) preventing the symptoms or disease from occurring in a subject that is predisposed or does not yet display symptoms of the disease; (2) inhibiting the disease or arresting its development; or (3) ameliorating or causing regression of the disease or the symptoms of the disease. As understood in the art, “treatment” is an approach for obtaining beneficial or desired results, including clinical results. For the purposes of the present technology, beneficial or desired results can include one or more, but are not limited to, alleviation or amelioration of one or more symptoms, diminishment of extent of a condition (including a disease), stabilized (i.e., not worsening) state of a condition (including disease), delay or slowing of condition (including disease), progression, amelioration or palliation of the condition (including disease), states and remission (whether partial or total), whether detectable or undetectable. When the disease is cancer, the following clinical end points are non-limiting examples of treatment: reduction in tumor burden, slowing of tumor growth, longer overall survival, longer time to tumor progression, inhibition of metastasis or a reduction in metastasis of the tumor. In one aspect, treatment excludes prophylaxis.

[0067] As used herein, the term “overexpress" with respect to a cell, a tissue, or an organ expresses a protein to an amount that is greater than the amount that is produced in a control cell, a control issue, or an organ. A protein that is overexpressed can be endogenous to the host cell or exogenous to the host cell.

[0068] As used herein, the term “enhancer”, denotes sequence elements that augment, improve or ameliorate transcription of a nucleic acid sequence irrespective of its location and orientation in relation to the nucleic acid sequence to be expressed. An enhancer can enhance transcription from a single promoter or simultaneously from more than one promoter. As long as this functionality of improving transcription is retained or substantially retained (e.g., at least 70%, at least 80%, at least 90% or at least 95% of wild-type activity, that is, activity of a full-length sequence), any truncated, mutated or otherwise modified variants of a wild-type enhancer sequence are also within the above definition.

[0069] The term “promoter” as used herein refers to any sequence that regulates the expression of a coding sequence, such as a gene. Promoters can be constitutive, inducible, repressible, or tissue-specific, for example. A “promoter” is a control sequence that is a region of a polynucleotide sequence at which initiation and rate of transcription are controlled. It can contain genetic elements at which regulatory proteins and molecules can bind such as RNA polymerase and other transcription factors.[00701 The term “contacting” means direct or indirect binding or interaction between two or more. A particular example of direct interaction is binding. A particular example of an indirect interaction is where one entity acts upon an intermediary molecule, which in turn acts upon the second referenced entity. Contacting as used herein includes in solution, in solid phase, in vitro, ex vivo, in a cell and in vivo. Contacting in vivo can be referred to as administering, or administration.[00711 The term “introduce” as applied to methods of producing modified cells such as chimeric antigen receptor cells refers to the process whereby a foreign (i.e. extrinsic or extracellular) agent is introduced into a host cell thereby producing a cell comprising the foreign agent. Methods of introducing nucleic acids include but are not limited to transduction, retroviral gene transfer, transfection, electroporation, transformation, viral infection, and other recombinant DNA techniques known in the art. In some embodiments,transduction is done via a vector (e.g., a viral vector). In some embodiments, transfection is done via a chemical carrier, DNA / liposome complex, or micelle (e.g., Lipofectamine (Invitrogen)). In some embodiments, viral infection is done via infecting the cells with a viral particle comprising the polynucleotide of interest (e.g., AAV).[0072 | The term “culturing” refers to growing cells in a culture medium under conditions that favor expansion and proliferation of the cell. The term “culture medium” or “medium” is recognized in the art and refers generally to any substance or preparation used for the cultivation of living cells. The term “medium”, as used in reference to a cell culture, includes the components of the environment surrounding the cells. Media can be solid, liquid, gaseous or a mixture of phases and materials. Media include liquid growth media as well as liquid media that do not sustain cell growth. Media also include gelatinous media such as agar, agarose, gelatin and collagen matrices. Exemplary gaseous media include the gaseous phase to which cells growing on a petri dish or other solid or semisolid support are exposed. The term “medium” also refers to material that is intended for use in a cell culture, even if it has not yet been contacted with cells. In other words, a nutrient rich liquid prepared for culture is a medium. Similarly, a powder mixture that when mixed with water or other liquid becomes suitable for cell culture can be termed a “powdered medium.” “Defined medium” refers to media that are made of chemically defined (usually purified) components. “Defined media” do not contain poorly characterized biological extracts such as yeast extract and beef broth. “Rich medium” includes media that are designed to support growth of most or all viable forms of a particular species. Rich media often include complex biological extracts. A “medium suitable for growth of a high-density culture” is any medium that allows a cell culture to reach an OD600 of 3 or greater when other conditions (such as temperature and oxygen transfer rate) permit such growth. The term “basal medium” refers to a medium which promotes the growth of many types of microorganisms which do not require any special nutrient supplements. Most basal media generally comprise of four basic chemical groups: amino acids, carbohydrates, inorganic salts, and vitamins. A basal medium generally serves as the basis for a more complex medium, to which supplements such as serum, buffers, growth factors, lipids, and the like are added. In one aspect, the growth medium can be a complex medium with the necessary growth factors to support the growth and expansion of the cells of the disclosure while maintaining their self-renewal capability. Examples of basalmedia include, but are not limited to, Eagles Basal Medium, Minimum Essential Medium, Dulbecco’s Modified Eagle’s Medium, Medium 199, Nutrient Mixtures Ham’s F-10 and Ham’s F-12, McCoy’s 5A, Dulbecco’s MEM / F-12, RPMI 1640, and Iscove’s Modified Dulbecco’s Medium (IMDM).

[0073] “Cryoprotectants” are known in the art and include without limitation, e.g., sucrose, trehalose, and glycerol. A cryoprotectant exhibiting low toxicity in biological systems is generally used.

[0074] A non-coding RNA (ncRNA) is an RNA molecule that is not translated into a protein. Non-limiting examples of non-coding RNA include transfer RNAs (tRNAs) and ribosomal RNAs (rRNAs), microRNAs, siRNAs etc.

[0075] As used herein, the term “splice-switching oligonucleotide” or “SSO” refers to a oligonucleotide comprising a modified nucleic acid, for example bridged nucleic acids (BNAs), base-pairing with pre-mRNA and disrupting normal splicing of transcripts by blocking the RNA-RNA base-pairing or protein-RNA binding interactions that occur between components of the splicing machinery and pre-mRNAs. In some embodiments, the SSO is a splice-switching antisense oligonucleotide comprising, or consisting essentially of, or yet further consisting of a backbone modified with 2’-O-methyl-phosphorothioate groups and approximately 60% BNAs, as well as two BNA-modified nucleotides at the 3 ’-end and one BNA-modified nucleotide at the 5 ’-end appear to work well for controlling and modulating the expression of specific exons, hence acting as antisense oligonucleotides enabling modulation and regulation of splicing events.

[0076] Antisense oligonucleotide design principles and protocols to follow are known in the art and described for example on the Gene Link™ website (genelink.com / oligo_modifications_reference / OMR_mod_category_design.asp7mod_sp_cat_ id=17#:~:text=Anti-sense%2001igo%20Design%20Considerations- Selection%20of%20mRNA%20Target%20Site,chemical%20modifications%2C%20is%20th en%20designed%20around%20that%20sequence, last accessed on March 28, 2024).

[0077] As used herein, SSO is used interchangeably with antisense oligonucleotide (ASO). While not every ASO known in the art is a SSO, all of the ASOs disclosed and described in herein are SSOs (INSR long (also referred to as IR long), NS negative control, SSO55,SSO54, SS07, SS08, SS09, SSOIO, SSO81, SS082, SS084, SS086, SS087, and SSO88). TheSSO SSO55 is also referred to herein as INSR or IR in the context of the vectors and experimental data (see e.g. FIG. 11A-11B and Tables 2-3).

[0078] As used herein, IR and INSR are used interchangeably, and both refer to the insulin receptor gene. As used herein IR and INSR are used interchangeably, and both refer to the insulin receptor protein.Modes for Carrying out the DisclosurePolynucleotides comprising SSOs

[0079] This disclosure provides a polynucleotide comprising a promoter such as a U7 or a U1 promoter and a first splice-switching oligonucleotide (SSO) capable of targeting a regulatory element of an insulin receptor (IR, alternatively referred to as INSR). In some aspects, the regulatory element is CUG-BP1 or MBNL1. In some embodiments, the target region in the insulin receptor gene is the intron 10-11 region. In some aspects, regulatory element is the CUG-BP1 binding site in intron 10, comprising or consisting essentially of the nucleotide sequence TTACTCGGACACATGTGGCCTCCAAGTGTCAGAGCCCAGTGG (SEQ ID NO: 75), as set out in SEQ ID NO: 1, as set forth in Table 1. In some aspects, regulatory element is MBNL1 binding site in intron 11. The target sequences are not limited to those described herein.

[0080] In some embodiments, the IR is a human IR. An exemplary sequence of the human IR gene is Genbank Accession Numbers NG_008852.2. Non-limiting examples of SSOs are selected from SEQ ID NOs: 2, 5, 8, 11, 14, 17, 20, 23, 26, 29, 32, 35, and 38, as set forth in Table 1. Alternatively, the SSO comprises or consists essentially of a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID Nos.: 2, 5, 8, 11, 14, 17, 20, 23, 26, 29, 32, 35, or 38, as set forth in Table 1, or an equivalent thereof.

[0081] Applicant further provides polynucleotide sequences for the U7-antisense (SSO) and inverted or reverse complemented U7-antisense (SSO) as set forth in SEQ ID NOs: 3-4, 7-8. 9-10, 12-13, 15-16, 18-19, 21-22, 24-25, 27-28, 30-31, 33-34, 36-37, and 39-40, as set forth in Table 1.(0082] In some embodiments, the polynucleotide comprises two SSOs. In some aspects, the polynucleotide further comprises a second SSO capable of targeting a regulatory element of an insulin receptor. In some aspects, the first SSO and the second SSO are the same or different from each other. In some aspects, the polynucleotide further comprises a third SSO capable of targeting a regulatory element of an insulin receptor. In some aspects, the third SSO is the same or different from the first SSO and / or the second SSO. In some aspects, the polynucleotide further comprises a fourth SSO capable of targeting a regulatory element of an insulin receptor. In some aspects, the fourth SSO is the same or different from one or more of the first SSO, the second SSO, and the third SSO.

[0083] This disclosure further provides a polynucleotide comprising a promoter and a SSO that binds or is complementary to a nucleic acid sequence encoding all or a portion of intron 10, exon 11, or intron 11 of the insulin receptor gene, wherein the promoter is selected from a U7 promoter or a U1 promoter, and wherein the nucleic acid sequence encoding all or a portion of intron 10, exon 11, or intron 11. Alternatively, the SSO comprises or consists essentially of a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the SSO set out in SEQ ID NO.: 2, 5, 8, 11, 14, 17, 20, 23, 26, 29, 32, 35, or 38 as set forth in Table 1 below, or an equivalent thereof. In some aspects, the nucleic acid sequence encodes the CUG-BP1 binding site in intron 10. In some aspects, the nucleic acid sequence encodes the MBNL1 binding site in intron 11.

[0084] U7 snRNA (small nuclear RNA) is normally involved in histone pre-mRNA 3' end processing but, in some aspects, it is converted into a versatile tool for splicing modulation or as antisense RNA that is continuously expressed in cells (Goyenvalle et al., Science 306(5702): 1796-9 (2004)). By replacing the wild-type U7 Sm binding site with a consensus sequence derived from spliceosomal snRNAs, the resulting RNA assembles with the seven Sm proteins found in spliceosomal snRNAs. As a result, this U7 Sm OPT RNA accumulates more efficiently in the nucleoplasm and no longer mediates histone pre-mRNA cleavage, although it can still bind to histone pre-mRNA and act as a competitive inhibitor for wildtype U7 small nuclear ribonucleoproteins (snRNPs). By further replacing the sequence binding to the histone downstream element with one complementary to a particular target in a splicing substrate, it is possible to create U7 snRNAs capable of modulating specific splicingevents. One advantage of using U7 derivatives is that the antisense sequence is embedded into a small nuclear ribonucleoprotein (snRNP) complex. Moreover, when embedded into a gene therapy vector, these small RNAs can be permanently expressed inside the target cell after a single injection and their use using an AAV approach has been investigated in vivo (Levy et al., Eur J Hum Genet 18(9): 969-70 (2010); Wein et al., Hum Mutat 31(2): 136-42 (2010); Wein et al., Nat Med 20(9): 992-1000 (2014)).

[0085] There are three major features to the U7-snRNA system: the U7 promoter to drive expression of (1) the modified snRNA in target cells; (2) an antisense sequence inserted in the snRNA backbone, which is designed to base-pair with splice junctions, branch points, or splicing enhancers; (3) a modified sequence (called smOPT) which recruits a distinct ring of RNA binding proteins that complexes with the U7snRNA making it more stable. (Schumperli et al., Cell and Mol Life Sciences 61 :2560-70 (2004)). It is noteworthy that the antisense sequence and the U7 small nuclear RNA (snRNA) (U7 snRNA) have proven safe for use in vivo in large animal models of muscular dystrophy (LeGuiner et al., Mol Ther 22: 1923-35 (2014)).

[0086] In some cases, the U7 promoter comprises, or consists essentially of, or yet further consists of, the sequence as set forth:

[0087] taacaacataggagctgtgattggctgttttcagccaatcagcactgactcatttgcatagcctttacaagcggtcacaaactc aagaaacgagcggttttaatagtcttttagaatattgtttatcgaaccgaataaggaactgtgctttgtgattcacatatcagtggaggggt gtggaaatggcaccttgatctcaccctcatcgaaagtggagttgatgtccttccctggctcgctacagacgcacttccgc (SEQ ID No: 55), or an equivalent thereof.

[0088] The U7 promoter can target the SSO towards the nucleus of a cell when the polynucleotide, or a vector or composition comprising the polynucleotide are contacted with the cell.

[0089] The U1 promoter sequence has also been characterized in the art. The U1 promoter is described for example in Gunderson et al. (Genes Dev. 4(12A): 2048-60 (1990), doi: 10.1101 / gad.4.12a.2048); and Denti et al, (Molecular Therapy, 10(1): 192-199 (2004), doi.org / 10.1016 / j.ymthe.2004.04.008), both of which are incorporated herein in their entirety. The U1 as described in the art can be applied to the polynucleotides herein.

[0090] In some aspects, the polynucleotide comprises one of the polynucleotides as set forth in FIG. 15. As seen in FIG. 15, the polynucleotides can vary in length and order of elements. Each polynucleotide comprises a U7 promoter and a least one SSO. Additional elements can include Sm binding, loop, 3’ UTR, and stuffer sequence.

[0091] In some aspects, the elements of the polynucleotide comprises, or consists essentially of, or yet further consists of, the sequence of the individual elements as set forth in FIG. 15 and Tables 1 and 3. In some aspects, the sm binding has a sequence of AATTTTTGGAG (SEQ ID NO: 57). In some aspects, the loop has a sequence of caggttttctgacttcggtcggaaaacccct (SEQ ID NO: 58). In some aspects, the 3’ UTR has a sequence of cccaatttcactggtctacaatgaaagcaaaacagttctcttccccgctccccggtgtgtgagaggggctttgatccttctctggtttccta ggaaacgcgtatgtg (SEQ ID NO: 59).

[0092] In some aspects, the polynucleotide further comprises a detectable label or a purification label.

[0093] In some embodiments, the polynucleotide disclosed herein further comprises, or alternatively consists essentially of, or yet further consists of a detectable marker or a purification marker. As used herein, the term detectable marker refers to at least one marker capable of directly or indirectly, producing a detectable signal. A non-exhaustive list of this marker includes enzymes which produce a detectable signal, for example by colorimetry, fluorescence, luminescence, such as horseradish peroxidase, alkaline phosphatase, P- galactosidase, glucose-6-phosphate dehydrogenase, chromophores such as fluorescent, luminescent dyes, groups with electron density detected by electron microscopy or by their electrical property such as conductivity, amperometry, voltammetry, impedance, detectable groups, for example whose molecules are of sufficient size to induce detectable modifications in their physical and / or chemical properties, such detection can be accomplished by optical methods such as diffraction, surface plasmon resonance, surface variation , the contact angle change or physical methods such as atomic force spectroscopy, tunnel effect, or radioactive molecules such as 32 P, 35 S or 125 I. As used herein, the term purification marker or reporter protein refer to at least one marker useful for purification or identification. A non- exhaustive list of this marker includes His, lacZ, GST, maltose-binding protein, NusA,BCCP, c-myc, CaM, FLAG, GFP, YFP, cherry, thioredoxin, poly(NANP), V5, Snap, HA, chitin-binding protein, Softag 1, Softag 3, Strep, or S-protein. Suitable direct or indirect fluorescence marker comprise FLAG, GFP, YFP, RFP, dTomato, cherry, Cy3, Cy 5, Cy 5.5, Cy 7, DNP, AMCA, Biotin, Digoxigenin, Tamra, Texas Red, rhodamine, Alexa fluors, FITC, TRITC or any other fluorescent dye or hapten.Vectors and Compositions comprising polynucleotides comprising SSOsSSO Vector

[0094] In one aspect, provided herein is a vector comprising, or alternatively consisting essentially of, or yet further consisting of at least one polynucleotide, as described herein.

[0095] In some aspects, the vector is selected from an extracellular vesicle, a plasmid, a lipid nanoparticle, or a viral vector, optionally selected from a retroviral vector, a lentiviral vector, a non-replicating lentiviral vector, an adenovirus vector, or an adeno-associated virus (AAV) vector. According to one aspect, the vector is a plasmid, wherein the plasmid is pBR322. According to another aspect, the vector is an AAV vector, wherein the AAV vector is AAV- Rh74 or scAAV. In some aspects, the vector is the vector as disclosed and described in Tables 2 and 3, and SEQ ID NOs: 42-51.

[0096] Adeno-associated virus (AAV) is a replication-deficient parvovirus, the singlestranded DNA genome of which is about 4.7 kb in length including two 145 nucleotide inverted terminal repeat (ITRs) and the double-stranded DNA genome of which is about 2.3 kb in length, including two 145 nucleotide ITRs. There are multiple serotypes of AAV. These vectors are commercially available or have been described in the patent or technical literature. The nucleotide sequences of the genomes of the AAV serotypes are known. For example, the complete genome of AAV-1 is provided in GenBank Accession No.NC_002077; the complete genome of AAV-2 is provided in GenBank Accession No.NC 001401 and Srivastava et al., J Virol, 45: 555-64 (1983); the complete genome of AAV-3 is provided in GenBank Accession No. NC_1829; the complete genome of AAV-4 is provided in GenBank Accession No. NC_001829; the AAV-5 genome is provided in GenBank Accession No. AF085716; the complete genome of AAV-6 is provided in GenBank Accession No. NC_00 1862; at least portions of AAV-7 and AAV-8 genomes are provided in GenBank Accession Nos. AX753246 and AX753249, respectively; the AAVrh74 genome;the AAV-9 genome is provided in Gao et al., J Virol, 78: 6381-8 (2004); the AAV-10 genome is provided in Mol Ther 13(1): 67-76 (2006); the AAV-11 genome is provided in Virology, 330(2): 375-83 (2004); the genome of AAV-12 is provided in GenBank Accession No. DQ813647.1; and the genome of AAV-13 is provided in GenBank Accession No. EU285562.1. Cis-acting sequences directing viral DNA replication (rep), encapsidation / packaging and host cell chromosome integration are contained within the AAV ITRs. Three AAV promoters (named p5, pl 9, and p40 for their relative map locations) drive the expression of the two AAV internal open reading frames encoding rep and cap genes.The two rep promoters (p5 and pl 9), coupled with the differential splicing of the single AAV intron (at nucleotides 2107 and 2227), result in the production of four rep proteins (rep 78, rep 68, rep 52, and rep 40) from the rep gene. Rep proteins possess multiple enzymatic properties that are ultimately responsible for replicating the viral genome. The cap gene is expressed from the p40 promoter and it encodes the three capsid proteins VP1, VP2, and VP3. Alternative splicing and non-consensus translational start sites are responsible for the production of the three related capsid proteins. A single consensus polyadenylation site is located at map position 95 of the AAV genome. The life cycle and genetics of AAV are reviewed in Muzyczka, Current Topics in Microbiology and Immunology, 158: 97-129 (1992).

[0097] AAV possesses unique features that make it attractive as a vector for delivering foreign DNA to cells, for example, in gene therapy. AAV infection of cells in culture is noncytopathic, and natural infection of humans and other animals is silent and asymptomatic. Moreover, AAV infects many mammalian cells allowing the possibility of targeting many different tissues in vivo. Moreover, AAV transduces slowly dividing and non-dividing cells, and can persist essentially for the lifetime of those cells as a transcriptionally active nuclear episome (extrachromosomal element). The AAV proviral genome is inserted as cloned DNA in plasmids which makes construction of recombinant genomes feasible. Furthermore, because the signals directing AAV replication and genome encapsidation are contained within the ITRs of the AAV genome, some or all of the internal approximately 4.3 kb of the genome (encoding replication and structural capsid proteins, rep-cap) may be replaced with foreign DNA. To generate AAV vectors, the rep and cap proteins may be provided in trans. Another significant feature of AAV is that it is an extremely stable and hearty virus. It easilywithstands the conditions used to inactivate adenovirus (56° to 65°C for several hours), making cold preservation of AAV less critical. AAV may even be lyophilized. Finally, AAV-infected cells are not resistant to superinfection.

[0098] AAV DNA in the rAAV genomes can be from any AAV serotype for which a recombinant virus can be derived including, but not limited to, AAV serotypes AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12 and AAV-13, AAV-rh74, and AAV-anc80. The nucleotide sequences of the genomes of these various AAV serotypes are known in the art.

[0099] AAV-rh74 is commercially available, for example at American Research Products, Inc. (arpl.com / aavrh74-empty-ca-66v740.html).

[0100] The complete sequence for pBR322 is provided in GenBank accession number J01749.1. The pBR322 vector is commercially available, for example at lifescience- market.com (lifescience-market.com / plasmid-c-94 / pbr322-plasmid-p-63159.html, last accessed on March 29, 2024) or New England Biolabs (neb.com / en-us / products / n3033- pbr322-vector, last accessed on March 29, 2024).

[0101] General principles of rAAV production are reviewed in, for example, Carter, Current Opinions in Biotechnology, 1533-539 (1992); and Muzyczka, Curr Topics in Microbial and Immunol, 158:97-129 (1992)). Various approaches are described in Ratschin et al., Mol. Cell. Biol. 4:2072 (1984); Hermonat et al., Proc. Natl. Acad. Sci. USA, 81 :6466 (1984); Tratschin et al., Mol. Cell. Biol. 5:3251 (1985); McLaughlin et al., J. Virol., 62: 1963 (1988); and Lebkowski et al., Mol. Cell. Biol., 7:349 (1988); Samulski et al., J. Virol., 63:3822-8 (1989); U.S. Patent No. 5,173,414; WO 95 / 13365 and corresponding U.S. Patent No. 5,658.776; WO 95 / 13392; WO 96 / 17947; PCT / US98 / 18600; WO 97 / 09441 (PCT / US96 / 14423); WO 97 / 08298 (PCT / US96 / 13872); WO 97 / 21825 (PCT / US96 / 20777); WO 97 / 06243 (PCT / FR96 / 01064); WO 99 / 11764; Perrin et al., Vaccine 13: 1244-50 (1995); Paul et al., Human Gene Therapy 4:609-615 (1993); Clark et al., Gene Therapy 3: 1124-32 (1996); U.S. Patent. No. 5,786,211; U.S. Patent No. 5,871,982; and U.S. Patent. No. 6,258,595. The foregoing documents are hereby incorporated by reference in their entirety herein, with particular emphasis on those sections of the documents relating to rAAV production.SSO Composition

[0102] The disclosure further provides a composition. According to some embodiments, the composition is comprised of a polynucleotide as disclosed or described herein. According to some aspects, the composition is comprised of a vector as disclosed or described herein. The composition is further comprised of one or more of a carrier, and adjuvant, or an anticancer therapy.

[0103] In another aspect, the composition further comprises an additional therapeutic agent. In some embodiments, the additional therapeutic agent is an anti-cancer therapy.

[0104] In some embodiments, the additional therapeutic agent comprises a antibody. In one aspect the antibody is a monoclonal antibody. In some aspects, the antibody comprises, or is an antibody selected from the group consisting of: abagovomab, adecatumumab, afutuzumab, alemtuzumab, altumomab, amatuximab, anatumomab, arcitumomab, bavituximab, bectumomab, bevacizumab, bivatuzumab, blinatumomab, brentuximab, cantuzumab, catumaxomab, cetuximab, citatuzumab, cixutumumab, clivatuzumab, conatumumab, daratumumab, drozitumab, duligotumab, dusigitumab, detumomab, dacetuzumab, dalotuzumab, ecromeximab, elotuzumab, ensituximab, ertumaxomab, farletuzumab, ficlatuzumab, figitumumab, flanvotumab, futuximab, ganitumab, gemtuzumab, girentuximab, glembatumumab, ibritumomab, igovomab, imgatuzumab, indatuximab, inotuzumab, intetumumab, ipilimumab, iratumumab, labetuzumab, lexatumumab, lintuzumab, lorvotuzumab, lucatumumab, mapatumumab, matuzumab, milatuzumab, minretumomab, mitumomab, moxetumomab, narnatumab, naptumomab, necitumumab, nimotuzumab, nofetumomabn, ocaratuzumab, ofatumumab, olaratumab, onartuzumab, oportuzumab,oregovomab, panitumumab, parsatuzumab, patritumab, pemtumomab, pertuzumab, pintumomab, pritumumab, racotumomab, radretumab, rilotumumab, rituximab, robatumumab, satumomab, sibrotuzumab, siltuximab, simtuzumab, solitomab, tacatuzumab, taplitumomab, tenatumomab, teprotumumab, tigatuzumab, tositumomab, trastuzumab, tucotuzumab, ublituximab, veltuzumab, vorsetuzumab, votumumab, zalutumumab and / or any combination thereof. In one aspect, the monoclonal antibody is dalotuzumab.10.1.051 In some embodiments, the additional therapeutic agent comprises chemotherapeutic agent, an immunotherapeutic agent, a targeted therapy, radiation therapy, or a combination thereof. Illustrative additional therapeutic agents include, but are not limited to, alkylatingagents such as altretamine, busulfan, carboplatin, carmustine, chlorambucil, cisplatin, cyclophosphamide, dacarbazine, lomustine, melphalan, oxalaplatin, temozolomide, or thiotepa; antimetabolites such as 5 -fluorouracil (5-FU), 6-mercaptopurine (6-MP), capecitabine, cytarabine, floxuridine, fludarabine, gemcitabine, hydroxyurea, methotrexate, or pemetrexed; anthracyclines such as daunorubicin, doxorubicin, epirubicin, or idarubicin; topoisomerase I inhibitors such as topotecan or irinotecan (CPT-11); topoisomerase II inhibitors such as etoposide (VP- 16), teniposide, or mitoxantrone; mitotic inhibitors such as docetaxel, estramustine, ixabepilone, paclitaxel, vinblastine, vincristine, or vinorelbine; or corticosteroids such as prednisone, methylprednisolone, or dexamethasone.

[0106] In some cases, the additional therapeutic agent comprises an inhibitor of the enzyme poly ADP ribose polymerase (PARP). Exemplary PARP inhibitors include, but are not limited to, olaparib (AZD-2281, Lynparza®, from Astra Zeneca), rucaparib (PF-01367338, Rubraca®, from Clovis Oncology), niraparib (MK-4827, Zejula®, from Tesaro), talazoparib (BMN-673, from BioMarin Pharmaceutical Inc.), veliparib (ABT-888, from Abb Vie), CK- 102 (formerly CEP 9722, from Teva Pharmaceutical Industries Ltd.), E7016 (from Eisai), iniparib (BSI 201, from Sanofi), and pamiparib (BGB-290, from BeiGene).

[0107] In some cases, the additional therapeutic agent comprises an immune checkpoint inhibitor. Exemplary checkpoint inhibitors include:

[0108] PD-L1 inhibitors such as Genentech' s MPDL3280A (RG7446), anti-PD-Ll monoclonal antibody MDX-1105 (BMS-936559) and BMS-935559 from Bristol -Meyer's Squibb, MSB0010718C, and AstraZeneca's MEDI4736;

[0109] PD-L2 inhibitors such as GlaxoSmithKline's AMP -224 (Amplimmune), and rHIgM12B7;10110] PD-1 inhibitors such as anti -mouse PD-1 antibody Clone J43 (Cat # BE0033-2) from BioXcell, anti -mouse PD-1 antibody Clone RMP1-14 (Cat # BE0146) from BioXcell, mouse anti-PD-1 antibody Clone EH12, Merck's MK-3475 anti-mouse PD-1 antibody (Keytruda, pembrolizumab, lambrolizumab), AnaptysBio's anti-PD-1 antibody known as ANB011, antibody MDX-1 106 (ONO-4538), Bristol-Myers Squibb's human IgG4 monoclonal antibody nivolumab (Opdivo®, BMS-936558, MDX1106), AstraZeneca's AMP-514 and AMP -224, and Pidilizumab (CT-011) from CureTech Ltd;

[0111] CTLA-4 inhibitors such as Bristol Meyers Squibb's anti-CTLA-4 antibody ipilimumab (also known as Yervoy®, MDX-010, BMS-734016 and MDX-101), anti-CTLA4 antibody clone 9H10 from Millipore, Pfizer' s tremelimumab (CP-675,206, ticilimumab), and anti-CTLA4 antibody clone BNI3 from Abeam;

[0112] LAG3 inhibitors such as anti -Lag-3 antibody clone eBioC9B7W (C9B7W) from eBioscience, anti-Lag3 antibody LS-B2237 from LifeSpan Biosciences, IMP321 (ImmuFact) from Immutep, anti-Lag3 antibody BMS-986016, and the LAG-3 chimeric antibody A9H12;

[0113] B7-H3 inhibitors such as MGA271;

[0114] KIR inhibitors such as Lirilumab (IPH2101);

[0115] CD137 inhibitors such as urelumab (BMS-663513, Bristol-Myers Squibb), PF- 05082566 (anti-4-lBB, PF-2566, Pfizer), or XmAb-5592 (Xencor);

[0116] PS inhibitors such as Bavituximab;

[0117] and inhibitors such as an antibody or fragments (e.g., a monoclonal antibody, a human, humanized, or chimeric antibody) thereof, RNAi molecules, or small molecules to TFM3, CD52, CD30, CD20, CD33, CD27, 0X40, GITR, ICOS, BTLA (CD272), CD160, 2B4, LAIR1, TIGHT, LIGHT, DR3, CD226, CD2, or SLAM.

[0118] In some cases, the additional therapeutic agent comprises pembrolizumab, nivolumab, tremelimumab, or ipilimumab.

[0119] In some cases, the additional therapeutic agent comprises an antibody such as alemtuzumab, trastuzumab, ibritumomab tiuxetan, brentuximab vedotin, ado-trastuzumab emtansine, or blinatumomab.10120] In some cases, the additional therapeutic agent comprises a cytokine. Exemplary cytokines include, but are not limited to, IL-ip, IL-6, IL-7, IL-10, IL-12, IL-15, IL-21, or TNFa.

[0121] In some embodiments, the additional therapeutic agent comprises a receptor agonist. In some instances, the receptor agonist comprises a Toll-like receptor (TLR) ligand. In some cases, the TLR ligand comprises TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, or TLR9. In some cases, the TLR ligand comprises a synthetic ligand such as, for example,Pam3Cys, CFA, MALP2, Pam2Cys, FSL-1, Hib-OMPC, Poly I:C, poly A:U, AGP, MPL A, RC-529, MDF2p, CFA, or Flagellin.

[0122] In some cases, the additional therapeutic agent comprises an adoptive T cell transfer (ACT) therapy. In one embodiment, ACT involves identification of autologous T lymphocytes in a subject with, e.g., anti-tumor activity, expansion of the autologous T lymphocytes in vitro, and subsequent reinfusion of the expanded T lymphocytes into the subject. In another embodiment, ACT comprises use of allogeneic T lymphocytes with, e.g., anti-tumor activity, expansion of the T lymphocytes in vitro, and subsequent infusion of the expanded allogeneic T lymphocytes into a subject in need thereof.

[0123] Pharmaceutical compositions of the present disclosure can be administered in a manner appropriate to the disease to be treated or prevented. The quantity and frequency of administration will be determined by such factors as the condition of the patient, and the type and severity of the patient's disease, although appropriate dosages can be determined by clinical trials.

[0124] In some embodiments, the pharmaceutical composition and formulations described herein are administered to a subject by multiple administration routes, including but not limited to, parenteral, oral, buccal, rectal, sublingual, or transdermal administration routes. In some cases, parenteral administration comprises intravenous, subcutaneous, intramuscular, intracerebral, intranasal, intra-arterial, intra-articular, intradermal, intravitreal, intraosseous infusion, intraperitoneal, or intratechal administration. In some instances, the pharmaceutical composition is formulated for local administration. In other instances, the pharmaceutical composition is formulated for systemic administration.

[0125] In some embodiments, the pharmaceutical formulations include, but are not limited to, aqueous liquid dispersions, self-emulsifying dispersions, solid solutions, liposomal dispersions, aerosols, solid dosage forms, powders, immediate release formulations, controlled release formulations, fast melt formulations, tablets, capsules, pills, delayed release formulations, extended release formulations, pulsatile release formulations, multiparticulate formulations (e.g., nanoparticle formulations), and mixed immediate and controlled release formulations.

[0126] In some embodiments, the pharmaceutical formulations include a carrier or carrier materials selected on the basis of compatibility with the composition disclosed herein, and the release profile properties of the desired dosage form. Exemplary carrier materials include, e.g., binders, suspending agents, disintegration agents, filling agents, surfactants, solubilizers, stabilizers, lubricants, wetting agents, diluents, and the like. Pharmaceutically compatible carrier materials include, but are not limited to, acacia, gelatin, colloidal silicon dioxide, calcium glycerophosphate, calcium lactate, maltodextrin, glycerine, magnesium silicate, polyvinylpyrrollidone (PVP), cholesterol, cholesterol esters, sodium caseinate, soy lecithin, taurocholic acid, phosphotidylcholine, sodium chloride, tricalcium phosphate, dipotassium phosphate, cellulose and cellulose conjugates, sugars sodium stearoyl lactylate, carrageenan, monoglyceride, diglyceride, pregelatinized starch, and the like. See, e.g., Remington: The Science and Practice of Pharmacy, Nineteenth Ed (Easton, Pa.: Mack Publishing Company, 1995), Hoover, John E., Remington 's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pennsylvania 1975, Liberman, H.A. and Lachman, L., Eds., Pharmaceutical Dosage Forms, Marcel Decker, New York, N.Y., 1980, and Pharmaceutical Dosage Forms and Drug Delivery Systems, Seventh Ed. (Lippincott Williams & Wilkins (1999).10127] In some instances, the pharmaceutical formulations further include pH adjusting agents or buffering agents which include acids such as acetic, boric, citric, lactic, phosphoric and hydrochloric acids, bases such as sodium hydroxide, sodium phosphate, sodium borate, sodium citrate, sodium acetate, sodium lactate and tris-hydroxymethylaminomethane, and buffers such as citrate / dextrose, sodium bicarbonate and ammonium chloride. Such acids, bases and buffers are included in an amount required to maintain pH of the composition in an acceptable range.[0128| In some instances, the pharmaceutical formulation includes one or more salts in an amount required to bring osmolality of the composition into an acceptable range. Such salts include those having sodium, potassium or ammonium cations and chloride, citrate, ascorbate, borate, phosphate, bicarbonate, sulfate, thiosulfate or bisulfite anions, suitable salts include sodium chloride, potassium chloride, sodium thiosulfate, sodium bisulfite and ammonium sulfate.

[0129] In some embodiments, the pharmaceutical formulations include, but are not limited to, sugars like trehalose, sucrose, mannitol, maltose, glucose, or salts like potassium phosphate, sodium citrate, ammonium sulfate and / or other agents such as heparin to increase the solubility and in vivo stability of polypeptides.[0130| In some instances, the pharmaceutical formulations further include diluent which are used to stabilize compounds because they can provide a more stable environment. Salts dissolved in buffered solutions (which also can provide pH control or maintenance) are utilized as diluents in the art, including, but not limited to a phosphate buffered saline solution. In certain instances, diluents increase bulk of the composition to facilitate compression or create sufficient bulk for homogenous blend for capsule filling. Such compounds can include e.g., lactose, starch, mannitol, sorbitol, dextrose, microcrystalline cellulose such as Avicel®, dibasic calcium phosphate, dicalcium phosphate dihydrate, tricalcium phosphate, calcium phosphate, anhydrous lactose, spray-dried lactose, pregelatinized starch, compressible sugar, such as Di- Pac® (Amstar), mannitol, hydroxypropylmethylcellulose, hydroxypropylmethylcellulose acetate stearate, sucrose-based diluents, confectioner's sugar, monobasic calcium sulfate monohydrate, calcium sulfate dihydrate, calcium lactate trihydrate, dextrates, hydrolyzed cereal solids, amylose, powdered cellulose, calcium carbonate, glycine, kaolin, mannitol, sodium chloride, inositol, bentonite, and the like.

[0131] In some cases, the pharmaceutical formulations include disintegration agents or disintegrants to facilitate the breakup or disintegration of a substance. The term "disintegrate" include both the dissolution and dispersion of the dosage form when contacted with gastrointestinal fluid. Examples of disintegration agents include a starch, e.g., a natural starch such as corn starch or potato starch, a pregelatinized starch such as National 1551 or Amijel®, or sodium starch glycolate such as Promogel® or Explotab®, a cellulose such as a wood product, methylcrystalline cellulose, e.g., Avicel®, Avicel® PH101, Avicel®PH102, Avicel® PHI 05, Elcema® Pl 00, Emcocel®, Vivacel®, Ming Tia®, and Solka-Floc®, methylcellulose, croscarmellose, or a cross-linked cellulose, such as cross-linked sodium carboxymethylcellulose (Ac-Di-Sol®), cross-linked carboxymethylcellulose, or cross-linked croscarmellose, a cross- linked starch such as sodium starch glycolate, a cross-linked polymer such as crospovidone, a cross-linked polyvinylpyrrolidone, alginate such as alginic acid or asalt of alginic acid such as sodium alginate, a clay such as Veegum® HV (magnesium aluminum silicate), a gum such as agar, guar, locust bean, Karaya, pectin, or tragacanth, sodium starch glycolate, bentonite, a natural sponge, a surfactant, a resin such as a cationexchange resin, citrus pulp, sodium lauryl sulfate, sodium lauryl sulfate in combination starch, and the like.

[0132] In some instances, the pharmaceutical formulations include filling agents such as lactose, calcium carbonate, calcium phosphate, dibasic calcium phosphate, calcium sulfate, microcrystalline cellulose, cellulose powder, dextrose, dextrates, dextran, starches, pregelatinized starch, sucrose, xylitol, lactitol, mannitol, sorbitol, sodium chloride, polyethylene glycol, and the like.

[0133] Lubricants and glidants are also optionally included in the pharmaceutical formulations described herein for preventing, reducing or inhibiting adhesion or friction of materials.

[0134] Exemplary lubricants include, e.g., stearic acid, calcium hydroxide, talc, sodium stearyl fumerate, a hydrocarbon such as mineral oil, or hydrogenated vegetable oil such as hydrogenated soybean oil (Sterotex®), higher fatty acids and their alkali-metal and alkaline earth metal salts, such as aluminum, calcium, magnesium, zinc, stearic acid, sodium stearates, glycerol, talc, waxes, Stearowet®, boric acid, sodium benzoate, sodium acetate, sodium chloride, leucine, a polyethylene glycol (e.g., PEG-4000) or a methoxypolyethylene glycol such as Carbowax™, sodium oleate, sodium benzoate, glyceryl behenate, polyethylene glycol, magnesium or sodium lauryl sulfate, colloidal silica such as Syloid™, Cab-O-Sil®, a starch such as corn starch, silicone oil, a surfactant, and the like.

[0135] Plasticizers include compounds used to soften the microencapsulation material or film coatings to make them less brittle. Suitable plasticizers include, e.g., polyethylene glycols such as PEG 300, PEG 400, PEG 600, PEG 1450, PEG 3350, and PEG 800, stearic acid, propylene glycol, oleic acid, triethyl cellulose and triacetin. Plasticizers can also function as dispersing agents or wetting agents.

[0136] Solubilizers include compounds such as triacetin, triethyl citrate, ethyl oleate, ethyl caprylate, sodium lauryl sulfate, sodium doccusate, vitamin E TPGS, dimethylacetamide, N- methylpyrrolidone, N-hydroxyethylpyrrolidone, polyvinylpyrrolidone, hydroxypropylmethylcellulose, hydroxypropyl cyclodextrins, ethanol, n-butanol, isopropyl alcohol, cholesterol, bile salts, polyethylene glycol 200-600, glycofurol, transcutol, propylene glycol, and dimethyl isosorbide and the like.101371 Stabilizers include compounds such as any antioxidation agents, buffers, acids, preservatives and the like. Exemplary stabilizers include L-arginine hydrochloride, tromethamine, albumin (human), citric acid, benzyl alcohol, phenol, disodium biphosphate dehydrate, propylene glycol, metacresol or m-cresol, zinc acetate, poly sorb ate-20 or Tween® 20, or trometamol. Suspending agents include compounds such as polyvinylpyrrolidone, e.g., polyvinylpyrrolidone KI 2, polyvinylpyrrolidone KI 7, polyvinylpyrrolidone K25, or polyvinylpyrrolidone K30, vinyl pyrrolidone / vinyl acetate copolymer (S630), polyethylene glycol, e.g., the polyethylene glycol can have a molecular weight of about 300 to about 6000, or about 3350 to about 4000, or about 7000 to about 5400, sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethylcellulose, hydroxymethylcellulose acetate stearate, polysorbate-80, hydroxyethylcellulose, sodium alginate, gums, such as, e.g., gum tragacanth and gum acacia, guar gum, xanthans, including xanthan gum, sugars, cellulosics, such as, e.g., sodium carboxymethylcellulose, methylcellulose, sodium carboxymethylcellulose, hydroxypropylmethylcellulose, hydroxyethylcellulose, polysorbate-80, sodium alginate, polyethoxylated sorbitan monolaurate, polyethoxylated sorbitan monolaurate, povidone and the like.

[0138] Surfactants include compounds such as sodium lauryl sulfate, sodium docusate, Tween 60 or 80, triacetin, vitamin E TPGS, sorbitan monooleate, polyoxyethylene sorbitan monooleate, polysorbates, polaxomers, bile salts, glyceryl monostearate, copolymers of ethylene oxide and propylene oxide, e.g., Pluronic® (BASF), and the like. Additional surfactants include polyoxyethylene fatty acid glycerides and vegetable oils, e.g., polyoxyethylene (60) hydrogenated castor oil, and polyoxyethylene alkyl ethers and alkylphenyl ethers, e.g., octoxynol 10, octoxynol 40. Sometimes, a surfactant is included to enhance physical stability or for other purposes.|0.139| Viscosity enhancing agents include, e.g., methyl cellulose, xanthan gum, carboxymethyl cellulose, hydroxypropyl cellulose, hydroxypropylmethyl cellulose,hydroxypropylmethyl cellulose acetate stearate, hydroxypropylmethyl cellulose phthalate, carbomer, polyvinyl alcohol, alginates, acacia, chitosans and combinations thereof.

[0140] Wetting agents include compounds such as oleic acid, glyceryl monostearate, sorbitan monooleate, sorbitan monolaurate, triethanolamine oleate, polyoxyethylene sorbitan monooleate, polyoxyethylene sorbitan monolaurate, sodium docusate, sodium oleate, sodium lauryl sulfate, sodium doccusate, triacetin, Tween 80, vitamin E TPGS, ammonium salts and the like.

[0011] In some embodiments, the pharmaceutical compositions described herein are administered for therapeutic applications. In some embodiments, the pharmaceutical composition is administered once per day, twice per day, three times per day or more. The pharmaceutical composition is administered daily, every day, every alternate day, five days a week, once a week, every other week, two weeks per month, three weeks per month, once a month, twice a month, three times per month, or more. The pharmaceutical composition is administered for at least 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 18 months, 2 years, 3 years, or more.

[0142] In the case wherein the patient's status does improve, upon the doctor's discretion the administration of the composition is given continuously, alternatively, the dose of the composition being administered is temporarily reduced or temporarily suspended for a certain length of time (i.e., a "drug holiday"). In some instances, the length of the drug holiday varies between 2 days and 1 year, including by way of example only, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 10 days, 12 days, 15 days, 20 days, 28 days, 35 days, 50 days, 70 days, 100 days, 120 days, 150 days, 180 days, 200 days, 250 days, 280 days, 300 days, 320 days, 350 days, or 365 days. The dose reduction during a drug holiday is from 10%-100%, including, by way of example only, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%.

[0143] Titers of viral vector to be administered in methods of the disclosure will vary depending, for example, on the particular rAAV, the mode of administration, the treatment goal, the individual, and the cell type(s) being targeted, and may be determined by methods standard in the art. Titers of rAAV may range from about IxlO6, about IxlO7, about IxlO8,about IxlO9, about IxlO10, about IxlO11, about IxlO12, about IxlO13to about IxlO14Dosages may also be expressed in units of viral genomes (vg) (z.e., IxlO7vg, IxlO8vg, IxlO9vg, lxlOlovg, lxlOnvg, lxl012vg, lxl013vg, lxl014vg, respectively).101441 Once improvement of the patient's conditions has occurred, a maintenance dose is administered if necessary. Subsequently, the dosage or the frequency of administration, or both, can be reduced, as a function of the symptoms, to a level at which the improved disease, disorder or condition is retained.

[0145] In some embodiments, the amount of a given agent that correspond to such an amount varies depending upon factors such as the particular compound, the severity of the disease, the identity (e.g., weight) of the subject or host in need of treatment, but nevertheless is routinely determined in a manner known in the art according to the particular circumstances surrounding the case, including, e.g., the specific agent being administered, the route of administration, and the subject or host being treated. In some instances, the desired dose is conveniently presented in a single dose or as divided doses administered simultaneously (or over a short period of time) or at appropriate intervals, for example as two, three, four or more sub-doses per day.

[0146] The foregoing ranges are merely suggestive, as the number of variables in regard to an individual treatment regime is large, and considerable excursions from these recommended values are not uncommon. Such dosages are altered depending on a number of variables, not limited to the activity of the compound used, the disease or condition to be treated, the mode of administration, the requirements of the individual subject, the severity of the disease or condition being treated, and the judgment of the practitioner.

[0147] In some embodiments, toxicity and therapeutic efficacy of such therapeutic regimens are determined by standard pharmaceutical procedures in cell cultures or experimental animals, including, but not limited to, the determination of the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between the toxic and therapeutic effects is the therapeutic index and it is expressed as the ratio between LD50 and ED50. Compounds exhibiting high therapeutic indices are preferred. The data obtained from cell culture assays and animal studies are used in formulating a range of dosage for use in human. The dosage of such compounds liespreferably within a range of circulating concentrations that include the ED50 with minimal toxicity. The dosage varies within this range depending upon the dosage form employed and the route of administration utilized.Methods of Treatment with the polynucleotides, vectors, or compositionsCell Therapy

[0148] The polynucleotide, vector, and / or composition of the present disclosure can be used to deliver a SSO to a cell. In some embodiments, the SSO is delivered by contacting the cell with the polynucleotide, vector, and / or composition in vivo. In some embodiments, the SSO is delivered by contacting the cell with the polynucleotide, vector, and or composition in vitro. In some embodiments the cell is a mammalian cell or a human cell. In some aspects, the cell is a cancer cell, optionally an osteosarcoma cell or an Ewing sarcoma cell.

[0149] In some aspects, the method comprises contacting the cell with at least one of the polynucleotides as disclosed or described herein. In one embodiment, the method comprises contacting the cell with more than one of the polynucleotides as disclosed or described herein. In another embodiment, the method comprises contacting the cell with a vector comprising at least one of the polynucleotides disclosed or described herein. In one aspect, the method comprises contacting the cell with a vector comprising more than one of the polynucleotides as disclosed or described herein. In another aspect, the method comprises contacting the cell with a composition comprising at least one of the polynucleotides as described or disclosed herein. In a further aspect, the method comprises contacting the cell with a composition comprising at least one of the vectors as described or disclosed herein. In some embodiments the method comprises contacting the cell with a composition comprising more than one polynucleotide and / or vector as described herein. In some aspects, the methods comprise contacting the cell with more than one composition, vector, or polynucleotide as disclosed or described herein.

[0150] In some aspects, at least one SSO in the polynucleotide targets a regulatory element of an insulin receptor, optionally wherein the regulatory element is selected from CUG-BP1 and MBNL-1.

[0151] In one aspect, the cell expresses IR. In another embodiment, the cell is a mammalian cell or a human cell that expresses IR. In a further embodiment, the cell is a cancer cell, e.g., a mammalian or human cancer cell, e.g., an osteosarcoma cell. The cell can be from a biopsy or a cultured cell such as a cell from a commercial vendor.

[0152] In a further aspect, the method further comprises contacting one or more control samples with one or more polynucleotide, a composition comprising more than one polynucleotide and / or vector as described herein.

[0153] The method is useful to test for personalized therapies or to test for new therapies such as new combination therapies.Methods to prevent mammalian cell growth

[0154] The polynucleotide, vector, and / or composition of the present disclosure can be used in a method to prevent mammalian cell growth. In some embodiments the method comprises contacting the cell with at least one polynucleotide, vector, and / or composition in vivo. In some aspects, the method comprises contacting the cell with at least one polynucleotide, vector, and or composition in vitro. In some aspects, the cell is a mammalian cell. In some embodiments the cell is a cancer cell, optionally an osteosarcoma cell.{0155] The cell can be from a biopsy or a cultured cell such as a cell from a commercial vendor. In some aspects, the cancer cells are HeLa cells or U2OS cells. Other suitable cells can be used which in one embodiment, are commercially available for purchase, for example from American Type Culture Collection.

[0156] In some aspects, the cell is an osteosarcoma cell, optionally wherein the osteosarcoma cell is selected from a cell line selected from U2OS, 143.98.2 Luc-GFP, OHS Luc-GFP, Saos-2, OS-17, OS-25, and OS-26.(0157[ In a further aspect, the method further comprises contacting one or more control samples with one or more polynucleotide, a composition comprising more than one polynucleotide and / or vector as described herein.

[0158] The method is useful to test for personalized therapies or to test for new therapies such as new combination therapies.Methods to treat tumors and cancer

[0159] The polynucleotide, vector, and / or composition of the present disclosure can be used in a method to treat tumors and cancer. In some embodiments, the method comprises administering to the subject at least one polynucleotide as disclosed or described herein. In some aspects, the method comprises administering to the subject a vector comprising at least one of the polynucleotides as disclosed or described herein. In some aspects, the method comprises administering to the subject a composition comprising at least one of the polynucleotides or vectors as disclosed or described herein. In some embodiments, the method comprises administering to the subject in need thereof more than one polynucleotide, vector, or composition disclosed or described herein.

[0160] The polynucleotide, vector, and / or the composition provided herein can be administered either alone or in combination with diluents, known anti-cancer therapeutics, and / or with other components such as cytokines or other cell populations that are immunostimulatory. They can be administered as a first line therapy, a second line therapy, a third line therapy, or further therapy. The disclosed polynucleotide, vector, and / or composition can be combined with other therapies (e.g., chemotherapy, radiation, surgery etc.). Non-limiting examples of additional therapies include chemotherapeutics or biologies. Appropriate treatment regimens will be determined by the treating physician or veterinarian. In one embodiment, disclosed herein is a method of inhibiting the growth of a tumor and / or treating a cancer and / or preventing relapse of cancer in a subject in need thereof, comprising, or alternatively consisting essentially of, or yet further consisting of administering to the subject an effective amount of the ring-shaped nanoparticle and / or the composition provided herein.

[0161] The methods are useful to treat subjects such as humans, non-human primates (e.g., apes, gibbons, chimpanzees, orangutans, monkeys, macaques, and the like), domestic animals (e.g., dogs and cats), farm animals (e.g., horses, cows, goats, sheep, pigs) and experimental animals (e.g., mouse, rat, rabbit, guinea pig). A mammal can be any age or at any stage of development (e.g., an adult, teen, child, infant, or a mammal in utero). A mammal can be male or female. In certain embodiments the subject has or is suspected of having a neoplasticdisorder, neoplasia, tumor, malignancy or cancer. In certain embodiments the mammal is a juvenile.

[0162] In one embodiment, the cancer is a sarcoma. In one aspect, the sarcoma is an osteosarcoma. In some aspects, the osteosarcoma is localized or metastatic. In some aspects, the osteosarcoma is a rhabdosarcoma.

[0163] For the above methods, an effective amount is administered, and administration of the cell or population serves to attenuate any symptom or prevent additional symptoms from arising. When administration is for the purposes of preventing or reducing the likelihood of cancer recurrence or metastasis, the cell or compositions can be administered in advance of any visible or detectable symptom. Routes of administration include, but are not limited to, oral (such as a tablet, capsule or suspension), topical, transdermal, intranasal, vaginal, rectal, subcutaneous intravenous, intraarterial, intramuscular, intraosseous, intraperitoneal, epidural and intrathecal.10164] In some embodiments, the pharmaceutical compositions described herein are administered for therapeutic applications. In some embodiments, the pharmaceutical composition is administered once per day, twice per day, three times per day or more. The pharmaceutical composition is administered daily, every day, every alternate day, five days a week, once a week, every other week, two weeks per month, three weeks per month, once a month, twice a month, three times per month, or more. The pharmaceutical composition is administered for at least 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 18 months, 2 years, 3 years, or more.

[0165] In the case wherein the patient's status does improve, upon the doctor's discretion the administration of the composition is given continuously, alternatively, the dose of the composition being administered is temporarily reduced or temporarily suspended for a certain length of time (i.e., a "drug holiday"). In some instances, the length of the drug holiday varies between 2 days and 1 year, including by way of example only, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 10 days, 12 days, 15 days, 20 days, 28 days, 35 days, 50 days, 70 days, 100 days, 120 days, 150 days, 180 days, 200 days, 250 days, 280 days, 300 days, 320 days, 350 days, or 365 days. The dose reduction during a drug holiday is from 10%-100%, including,by way of example only, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%,65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%.

[0166] Titers of viral vector to be administered in methods of the disclosure will vary depending, for example, on the particular rAAV, the mode of administration, the treatment goal, the individual, and the cell type(s) being targeted, and may be determined by methods standard in the art. Titers of rAAV may range from about IxlO6, about IxlO7, about IxlO8, about IxlO9, about IxlO10, about IxlO11, about IxlO12, about IxlO13to about IxlO14. Dosages may also be expressed in units of viral genomes (vg) (z.e., IxlO7vg, IxlO8vg, lxl09vg, lxlOlovg, IxlO11vg, lxl012vg, lxl013vg, lxl014vg, respectively).

[0167] Once improvement of the patient's conditions has occurred, a maintenance dose is administered if necessary. Subsequently, the dosage or the frequency of administration, or both, can be reduced, as a function of the symptoms, to a level at which the improved disease, disorder or condition is retained.10168] In some embodiments, the amount of a given agent that correspond to such an amount varies depending upon factors such as the particular compound, the severity of the disease, the identity (e.g., weight) of the subject or host in need of treatment, but nevertheless is routinely determined in a manner known in the art according to the particular circumstances surrounding the case, including, e.g., the specific agent being administered, the route of administration, and the subject or host being treated. In some instances, the desired dose is conveniently presented in a single dose or as divided doses administered simultaneously (or over a short period of time) or at appropriate intervals, for example as two, three, four or more sub-doses per day.

[0169] The foregoing ranges are merely suggestive, as the number of variables in regard to an individual treatment regime is large, and considerable excursions from these recommended values are not uncommon. Such dosages are altered depending on a number of variables, not limited to the activity of the compound used, the disease or condition to be treated, the mode of administration, the requirements of the individual subject, the severity of the disease or condition being treated, and the judgment of the practitioner.|0170] In some embodiments, toxicity and therapeutic efficacy of such therapeutic regimens are determined by standard pharmaceutical procedures in cell cultures or experimentalanimals, including, but not limited to, the determination of the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between the toxic and therapeutic effects is the therapeutic index and it is expressed as the ratio between LD50 and ED50. Compounds exhibiting high therapeutic indices are preferred. The data obtained from cell culture assays and animal studies are used in formulating a range of dosage for use in human. The dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with minimal toxicity. The dosage varies within this range depending upon the dosage form employed and the route of administration utilized.

[0171] The methods provide one or more of: (1) preventing the symptoms or disease from occurring in a subject that is predisposed or does not yet display symptoms of the disease; (2) inhibiting the disease or arresting its development; or (3) ameliorating or causing regression or relapse of the disease or the symptoms of the disease. As understood in the art, “treatment” is an approach for obtaining beneficial or desired results, including clinical results. For the purposes of the present technology, beneficial or desired results can include one or more, but are not limited to, alleviation or amelioration of one or more symptoms, diminishment of extent of a condition (including a disease), stabilized (i.e., not worsening) state of a condition (including disease), delay or slowing of condition (including disease), progression, amelioration or palliation of the condition (including disease), states and remission (whether partial or total), whether detectable or undetectable. Treatments containing the disclosed compositions and methods can be first line, second line, third line, fourth line, fifth line therapy and are intended to be used as a sole therapy or in combination with other appropriate therapies e.g., surgical recession, chemotherapy, radiation. In one aspect, treatment excludes prophylaxis.

[0172] The following examples are intended to illustrate, and not limit the embodiments of this disclosure.EXAMPLESExample 1

[0173] Sequences of the Disclosure. SSO Sequences (referred to in Table 1 as antisense sequences) that target 77? and U7 snRNA-SSO sequences. The U7 snRNA-SSO sequences comprise promoter, SSO, sm binding, loop, and 3’-UTR domains. The NS (control sequences) have U7 snRNA-anti sense sequences and inverted or reverse complement U7 snRNA-anti sense sequences similar or identical to the sequences shown in Table 1.

[0174] Table 1. Sequences of the Disclosure. All of the antisense sequences in the table are SSOs. Antisense SSO55 is an SSO that is exemplary for the embodiments as disclosed herein. Both the U7snRNA-anti sense and inverted or reverse complement U7-antisense sequences include U7 promoter, antisense sequence, small binding, loop, and 3’ UTR domains. In the U7 snRNA-anti sense sequences, the different domains are marked with a combination of bold, underline, italics, and uppercase and lowercase lettering to clearly delineate the domains. In the inverted or reverse complement U7 snRNA-anti sense sequences, the antisense is marked with uppercase lettering, and the remaining domains (collectively, the U7 snRNA sequence) are marked with lowercase lettering.Example 2

[0175] After previous work characterizing INSR splicing and regulation, Applicant developed a splice-switching oligonucleotide (SSO) that completely shifts INSR splicing from INSR-A to INSR-B and slows cancer cell proliferation (PMID: 35017650). This SSO holds great potential as a therapeutic in ES cells, which predominantly express INSR-A. However, a current challenge is achieving high-level uptake of the SSO in ES cell lines. To overcome this challenge, Applicant engineered the SSO sequence into an adeno-associated viral (AAV) vector, an FDA-approved methodology to deliver SSOs in a tissue-specific manner in pediatric diseases.

[0176] Methods: Applicant designed multiple INSR aRNA-AAV and control vector plasmids (Tables 2-3). The vector constructs include the Mammalian Gene Expression scAAV (self-complementary AAV) vector. The ASO in the vector components table (Table 3) refers to the SSOs as described herein. Applicant validated the vectors in HeLa cells and in a panel of osteosarcoma (OS) cell lines (e.g. U2OS, 143.98.2, 143.98.2 Luc-GFP) to determine which construct is most effective in switching splicing from INSR-A to INSR-B. The vectors can also be used in Ewing sarcoma (ES) cell lines, including CHLA-9, CHLA- 10, TC32, and TC71. The AAVs are designed to include a U7 promoter, which enhances INSR aRNA entry into the nucleus.

[0177] Applicant designed multiple INSR aRNA-AAV and control vector plasmids (Tables 2-3). The vector constructs include the Mammalian Gene Expression scAAV (self- complementary AAV) vector. The ASO in the vector components table (Table 3) refers to the SSOs as described herein. Applicant validated the vectors in HeLa cells and in a panel of OS cell lines (e.g. U2OS, 143.98.2, 143.98.2 Luc-GFP) to determine which construct is most effective in switching splicing from INSR-A to INSR-B. The AAVs are designed to include a U7 promoter, which enhances INSR aRNA entry into the nucleus.

[0178] Table 3 shows the vector components for VB230608-1856jdp (pscAAV[Exp]-Kan- pASV003), which is the vector ID of a vector used in Example 3. The vectors described herein may comprise individual components as set forth in Table 3. According to some embodiments, the vectors described herein may comprise individual components comprisingcomponents as set forth in Table 3. The vector components in Table 3 are exemplary, and individual vectors described herein may comprise different components as necessary.

[0179] Table 2. Vectors comprising an SSO. NS is the control SSO. Information on Vector Builder (vectorbuilder.com, last accessed on February 19, 2025 ) about the vectors in Table 2 is incorporated herein by reference. In the vector components description, the SSO is referred to as ASO. In the vectors, the INSR ASO is also referred to herein as SSO55. INSR long is also referred to herein as IR long.

[0180] Table 3. Vector Components for VB230608-1856jdp (SEQ ID NO: 49). The SSO in this vector is SSO55. The sequences of the components were the same in all vectors tested, however the location and number varied between the vectors.Example 310.1811 Without wishing to be bound to any particular theory, Applicant hypothesized that expressing the IN SR S SO sequence via an AAV vector will enable successful delivery and expression of the SSO as an antisense RNA (aRNA) in osteosarcoma cells, leading to a shift toward INSR-B splicing and decreased ES cell proliferation. A combinatorial INSR aRNA- AAV and IGF-IR inhibitor regimen could then be more effective in treating ES cells.10182] Patients with osteosarcoma (OS), a debilitating pediatric bone malignancy, have limited treatment options to combat aggressive disease. OS thrives on IGF-mediated signaling that can facilitate cell proliferation. Previous efforts to target IGF-IR signaling were mostly unsuccessful, likely due to compensatory signaling through alternative splicing of the insulin receptor (77?) to the proliferative IR-A isoform. Here, Applicant leveragessplice-switching oligonucleotides (SSOs) to mitigate IR splicing toward the IR-B isoform. Applicant shows that SSOs can modulate cancer cell hallmarks and anoikis-resistant growth. Furthermore, Applicant engineered the SSO sequence in an U7 snRNA packaged in an adeno-associated virus (AAV) to test the feasibility of viral vector-mediated gene therapy delivery. Applicant observed modest increases in IR-B isoform levels after virus transduction, which prompted investigation into the role of combinatorial treatments with dalotuzumab, an anti-IGF-IR monoclonal antibody. After observing additive impacts on phosphoprotein phosphorylation and anoikis-resistant growth with the dalotuzumab and SSO combination, Applicant treated OS cells with dalotuzumab and the AAVrh74.U7 snRNA IR virus, which significantly slowed OS cell proliferation. While these viruses require further optimization, herein Applicant highlight the potential for SSO therapy and viral vector delivery as it may offer new treatment avenues for OS patients and be translated to other cancers.Introduction| 0183 | A growing body of literature has identified various gene modules that contribute to proliferation, migration, and cell survival in osteosarcoma (OS); among metabolic genes, the insulin receptor (IR) had the most significant impact on OS metastasis (Huang et al., Frontiers in Endocrinology 13, 1047433; Guan et al., Cancer Cell International 20, 1-10). Both IR and its closely homologous family member IGF-1R have been repeatedly implicated in the progression and malignant transformation of sarcomas, including OS. IGF-1R and IR are receptor tyrosine kinases that are activated by ligand binding and signal through multiple cascades, including Ras / Raf / MEK / ERK and PI3 / AKT. The IGF-1R binds ligands IGF-1 or IGF-2 to block apoptosis and promote cell growth, but IR is a multifaceted receptor that undergoes alternative splicing to either initiate proliferative or metabolic pathways. A 22- exon gene, IR is differentially spliced at exon 11 to generate two distinct isoforms - IR-B (includes exon 11) and IR-A (excludes exon 11). This exon, though only 36 nucleotides long and encoding 12 amino acids, is instrumental in distinguishing IR-A and IR- A abilities to bind the ligands IGF-2 and insulin. IR-B binds insulin to mediate glucose homeostasis and is the predominant isoform in adult tissues, such as the muscle, liver, and adipose tissue.Though IR-A can also bind insulin, it has a five-fold higher affinity to bind IGF-2, enabling it to be the primary isoform during highly proliferative stages like fetal embryogenesis and cancer.

[0184] Since IGF-1R and IGF-2 upregulation is a common feature across cancer types, the IGF-1R was the target of multiple clinical trials in the 2000s. Anti-7GF-7A monoclonal antibodies (e.g., dalotuzumab, figitumumab, and ganitumab) acted by inhibiting IGF-1 and IGF-2 from binding IGF-1R homodimers and IGF-1RUR-A heterodimers, and the promise they showed in vitro was sufficient to elicit enthusiasm for phase III clinical trials across sarcomas and various other cancers. Unfortunately, monotherapies against IGF-1R were largely unsuccessful for the majority of sarcoma patients, and subsequent studies in Ewing sarcoma, another pediatric bone sarcoma, pointed to adaptive resistance through IR-A as a contributor to the failure of these single-agent trials. Through modulation of IR alternative splicing and upregulation of IR-A, cancer cells can use IR-A homodimers and circulating IGF- 2 to achieve the same downstream proliferative pathways typically activated by IGF-1R and IGF-1. This compensatory signaling warrants dual targeting approaches that harness the potential of IGF-1R monotherapies and novel therapies against IR-A.

[0185] Because the IR-A and IR-B isoforms are produced by a single exon exclusion event, Applicant employed splice-switching oligonucleotides (SSOs) (also referred to as antisense oligonucleotides, or ASOs) to modulate IR alternative splicing (in collaboration with lonis Pharmaceuticals). SSOs are synthetic, antisense RNA sequences that can bind pre-mRNA to sterically hinder splicing factors from acting at their regulatory elements, and they have been approved by the U.S. Food & Drug Administration (FDA) to correct alternative splicing events in spinal muscular atrophy (SMA) and Duchenne muscular dystrophy (DMD). SSO synthesis, chemistry, and physicochemical properties are critical elements in the characterization and validation of oligonucleotides as therapeutics. Specifically, Applicant tested IR SSOs with a phosphorothioate (PS) backbone and a 2’-O-methoxyethyl (MOE) modification. The feasibility and stability of multiple ASOs in this generation have been studied (approximately 30 members) both in in vitro and in vivo scenarios and are by far the most understood of RNA-targeted drugs. Differing only in the sequence, the members of each class of oligonucleotides have similar physicochemical characteristics and thus common pharmacokinetic and biological properties. Extensive studies in non-human primates and healthy human volunteers have assessed the stability and safety of 2’MOE ASOs. Overall, 2’MOE ASOs manufactured by lonis Pharmaceuticals at varying doses and treatment exposures do not impact liver or kidney function, hematologic panels, or complementactivation in humans. They also demonstrate long-term tissue half-lives while maintaining a potent splicing correction in mice and non-human primates receiving intrathecal or intracerebroventricular injections (Rigo et al., Journal of Pharmacology and Experimental Therapeutics 350, 46-55). Though sequence- and disease-specific effects may be observed with any candidate oligonucleotide, 2’MOE ASOs are generally stable in human tissue and safe in in vivo models.

[0186] Applicant previously described an approach to promote IR exon 11 inclusion by targeting the negative regulatory element CUG-BP1 (CELF1) (Sen et al., Mol. and Cell. Bio. 29, 871-880; Kosaki et al., J. of Bio. Chem. 273, 10331-10337). Applicant tested a series of 2’MOE SSOs across the characterized CUG-BP1 binding site in IR intron 10 and identified a lead candidate that significantly restored IR splicing from the IR-A isoform to the IR-B isoform (Khurshid et al., NPJ Precision Oncology 6, 1-11). SSO treatment reduced cell proliferation and angiogenesis in rhabdomyosarcoma cell lines, as well as vessel staining in an in vivo matrigel plug assay for angiogenesis (Khurshid et al., NPJ Precision Oncology 6, 1-11).

[0187] Without wishing to be bound by theory, Applicant hypothesized that toggling IR alternative splicing toward IR-B with an IR SSO candidate would be therapeutic in OS, a cancer that capitalizes upon IGF / IR signaling for oncogenesis and metastatic progression. As described herein, Applicant has established that OS tumors predominantly express the IR-A isoform and that SSO treatment specifically targets the CUG-BP1 binding site to shift IR splicing toward the IR-B isoform, while also decreasing AKT phosphorylation and altering cancer cell hallmarks like proliferation, growth in low adhesion, and apoptosis. To investigate the feasibility of expressing the IR SSO sequence in an AAV gene therapy model, Applicant engineered the SSO sequence in a U7 snRNA vector system and packaged it in AAVrh74, which induced modest changes in IR-B levels but significantly reduced OS cell proliferation when combined with the anti-IGF-IR antibody dalotuzumab. Overall, data identifies the therapeutic benefits of modulating IR alternative splicing through SSOs, highlight the additive potential of splice-switching therapies in viral gene delivery models and pre-existing IGF-1R drugs, and underscore a novel strategy to mitigate cancer cell hallmarks in OS.ResultsInsulin receptor is alternatively spliced to the IR-A isoform in OS patient-derived xenografts and cell lines

[0188] The insulin receptor (IR), a 22-exon gene encoded on chromosome 19, is alternatively spliced into two isoforms depending on the inclusion or exclusion of exon 11 (IR-B o IR-A respectively) (FIG. 3A). The resulting two isoforms differ in the downstream signaling that they trigger, in part due to their ability to preferentially bind the ligands insulin and IGF-2. While both IR protein isoforms bind insulin, IR-A additionally binds IGF-2 at a higher affinity than insulin, a property it shares with the closely homologous IGF-1 receptor. Consequently, the IR-B receptor mediates differentiation and metabolic signaling, while the IR-A receptor affects growth pathways, motility, and angiogenesis during embryogenesis and tumorigenesis (FIG. 3A). IR-A is upregulated in multiple cancer types, and IGF-2-mediated signaling through the IR-A receptor promotes increased proliferative signaling through activation of RAS / Raf / MEK / ERK and PI3 / AKT / mTOR.

[0189] To understand the impact of IR in OS tumors, Applicant first analyzed IR gene expression in normal osteoblasts and pediatric OS tumor samples in the Sadikovic-14- rma sketch hugenelOt dataset (Sadikovic et al., Human molecular genetics 18, 1962-1975). Applicant found that the cumulative gene expression of IR is statistically significantly higher in OS tumors than osteoblasts (p < 0.0001) (FIG. 3B). Applicant then profiled human patient-derived xenografts (PDXs) from primary and metastatic OS tumors and a panel of human OS cell lines and observed that IR is preferentially spliced to the IR-A isoform (FIGS. 3C-3D). The upregulation of cumulative IR and predominance of the IR-A isoform in OS highlight a therapeutic opportunity for splice-modulating therapies that can toggle splicing toward the IR-B isoform.SSOs targeting the negative splicing regulator CUG-BP1 ’s binding site robustly and specifically shift IR splicing from IR-A to IR-B

[0190] The inclusion or exclusion of IR exon 11 to produce the IR-B o IR-A isoforms is largely mediated by the positive and negative splicing regulators MBNL1 and CUG-BP1 (CELF1) respectively. While CUG-BP1 binding induces exon 11 skipping, MBNL1 binding promotes exon 11 inclusion. The 77? pre-mRNA contains CUG-BP1 binding sites in both IRintron 10 and exon 11 and a MBNL1 site in intron 11. Applicant previously designed spliceswitching oligonucleotides (SSOs) spanning these regulatory elements to identify SSO candidates that could mask the binding of CUG-BP1 and increase the inclusion of exon 11. Initially, Applicant performed a SSO “macro-walk” with six overlapping SSOs, each different in five-nucleotide increments, across the entire CUG-BP1 binding site (40-50 bp). Two of these six SSOs, including SSO55, significantly switched IR splicing toward IR-B. Next, Applicant performed a “micro-walk” of 20 consecutive SSO sequences at a two- nucleotide resolution around the CUG-BP1 sequence complementary to SSO55. Out of this panel in the “micro-walk,” Applicant selected SSO55, the most effective SSO to robustly switch IR alternative splicing in an IR minigene system and in endogenous settings, as the lead candidate (FIG. 4A). To test this SSO’s ability to modulate IR splicing in OS, Applicant transfected varying concentrations of SSO55 (denoted SSO) and a control non-specific SSO (denoted NS SSO72 or “NS”) in multiple OS cell lines and determined 100 nM to be the optimal dose that results in the IR splicing switch without ensuing toxicity (FIG. 4B, FIGS. 9A-9B). Applicant then observed that 100 nM SSO55 transfection for 24 hours in U2OS and OHS GFP-Luc (U2OS - derived from a primary OS tumor, OHS GFP-Luc - derived from a primary tumor and transduced with Luc-GFP) and 143.98.2-Luc-GFP cells (derived from the metastatic parent cell line 143B and transduced with Luc-GFP) yielded significant switching toward IR-B (p < 0.001 for all cell lines) (FIG. 4C).

[0191] To test the specificity of the SSO candidate to IR, Applicant initially used both NCBL BLAST and Bowtie to confirm that SSO55 bound only the IR genomic region and no other DNA sequences with 100% complementarity. Applicant also confirmed that SSO55 did not have predicted binding sites in global targets of CUG-BP1 regulation as identified in Xia et al. (2017, Biochimica et Biophysica Acta (BBA), 1860, 911-921), and SSO55 transfection did not change the splicing patterns of select genes from this list of targets (LM07, PARD3, and ZDHHC16). Additionally, Applicant mutagenized the parent IR minigene (denoted as “IR Mg” in FIG. 4D) to create a CUG-BP1 mutant minigene. The CUG-BP1 binding site has been characterized to a 35 base pair region, and the GU-rich consensus sequence of this site (5’UGUUUGUUGU-3’ (SEQ ID NO: 76)) is similar to the element that the SSO55 sequence targets. Applicant generated a deletion mutant that lacked seven nucleotides but retained over 50% sequence complementarity with SSO55 (denoted as “Mutant 1” in FIG. 4D). Applicanttransfected either the wild-type IR minigene or the deletion mutant with 100 nM NS or SSO55 for 24 hours in HeLa cells, the cell line used in foundational studies that characterized the wild-type minigene. While Applicant observed a statistically significant switch toward IR-B in the parent 77? minigene after SSO55 treatment, there was no significant difference in IR-B levels in the deletion mutant minigene (p < 0.05 for IR Mg and p > 0.05 for the Mutant 1 Mg) (FIG. 4D). Applicant also investigated SSO55’s effect on IR splicing at much lower concentrations (10, 30, 50 nM). For this study, Applicant used the wild-type minigene, the deletion mutant, and a substitution mutant minigene (denoted as “Mutant 2”), where three adenosines were replaced with thymidines to create discrete, single base pair alterations that maintained the thermodynamic binding properties of the wild-type sequence (FIG. 9A, SEQ ID NOs:). Here, Applicant observed that lower concentrations of SSO55 were able to switch splicing in only the wild-type minigene but not in either mutant minigene (FIG. 9B) in HeLa cells, suggesting that the integrity of the SSO55 target sequence in the CUG-BP1 binding site is essential for splicing modulation at lower doses. Altogether, these results demonstrate that SSO55’s splice-switching effect is specific to 77? and occurs by targeting a key sequence element within the CUG-BP1 binding site.The restoration of IR splicing to IR-B using SSOs targeting the IR intron 10 CUG-BP1 site consequently alters cancer hallmarks in OS cells

[0192] Upon ligand binding, both 77? isoforms and IGF-1R execute a vast downstream signaling network mediated by the master regulator PI3 / AKT. When insulin binds the IR-B receptor, phosphorylation of AKT activates a number of glucogenic and metabolic pathways through GSK3, AMPK, GLUT4, among others, and simultaneously downregulates proliferative pathways via Ras / Raf / MEK / ERK, NFkB, and INK. Conversely, IGF-1 or IGF-2 binding to IGF-1R or IR-A respectively activate growth signaling and silence metabolic functions.

[0193] Because Applicant observed statistically significant exon 11 inclusion upon SSO55 transfection, Applicant sought to determine whether this shift affected the 77? receptor’s downstream signaling mediators, such as AKT. Applicant transfected 100 nM NS or SSO55 in U2OS and 143.98.2 Luc-GFP cells and harvested RNA and protein at time points ranging from 4 to 72 hours post transfection. Applicant observed that pAKT levels decreasedfollowing SSO55 treatment in both U2OS and 143.98.2 Luc-GFP cells and that this decrease was time-dependent. The largest shift toward IR-B splicing and subsequent decrease in pAKT protein levels occurred in the window of 24 to 48 hours in U2OS and 143.98.2 Luc-GFP cells (FIG. 10). Decreased pAKT levels were maintained at later time points, though the efficacy of exon 11 inclusion was reduced most likely due to the dilution effect of overall SSO among dividing cells.

[0194] OS tumors display high plasticity and likelihood of dissemination and metastasis, a process that requires coordination of multiple regulatory networks, many of which converge at PI3 / AKT. Because preliminary data showed that SSO55 decreases AKT phosphorylation, Applicant sought to determine if SSO55 treatment would also alter cancer cell hallmarks that promote tumorigenesis and metastasis. Applicant first assessed differences in proliferation of OS cells (measured by cell confluency) following 100 nM transfection of either the control NS SSO or SSO55. Applicant found that U2OS, 143.98.2-Luc-GFP, OHS Luc-GFP, and other OS cell lines treated with SSO55 had significantly slower proliferation compared to NS-treated cells over the course of five days (p < 0.0001 for U2OS, 143.98.2-Luc-GFP, and OHS) (FIG. 5A, FIG. 8C). Applicant also interrogated changes in anoikis, a key metastatic process when cells undergo programmed cell death following detachment from the extracellular matrix, via the growth in low attachment (GILA) assay. Briefly, OS cells were transfected with 100 nM NS or SSO55, seeded in low adhesion plates, and incubated for five days before luminescence was measured (FIG. 5B). Cells that received SSO55 were significantly less likely to grow in low adhesion conditions, indicating their inability to overcome anoikis as compared to cells treated with NS SSO (p < 0.01 for U2OS and 143.98.2 Luc-GFP, p < 0.0001 for OHS) (FIG. 5B). These changes in cell confluency and growth in low adhesion prompted Applicant to profile changes in apoptosis via flow cytometry and quantitative real-time PCR (qPCR). Annexin 5 recognizes cells that present phosphatidylserine on their outer membrane, a property associated with early apoptosis and predictive of subsequent apoptotic processes, and it can be used to identify and quantify cell death. Applicant treated 143.98.2 Luc-GFP cells with NS SSO or SSO55 for 24-72 hours and stained them for annexin 5. Applicant observed an increase in annexin 5-positive cells at 48 hours post SSO55 transfection, which was sustained at 72 hours (p < 0.001 at 72 hours) (FIG. 5C). Additional qPCR validation of a panel of apoptotic targets revealed significantupregulation of Noxa and FAS after 48 hours of SSO55 transfection in U2OS and 143.98.2 Luc-GFP cells (p < 0.001 for Noxa and p < 0.01 for Fas) (FIG. 5D). Noxa, a member of the BCL-2 family, is a pro-apoptotic BH3-only protein that can induce apoptosis, reactive oxygen species accumulation, and mitochondrial outer membrane permeabilization. The FAS receptor, also known as CD95 or Apol, is a death receptor that triggers programmed cell death or apoptosis when it interacts with its ligand FasL. The upregulation of FAS has been documented to sensitize OS cells to chemotherapeutic drugs. In fact, the Fas receptor and IR signaling pathways are interconnected through their roles in apoptosis, cell survival, and metabolic regulation. Prior studies have found that a decrease in AKT signaling triggers a / NA'-dependent apoptosis in cancer cells. Overall, data indicates that modulation of IR splicing and subsequent attenuation of the AKT pathway could be therapeutic via induction of specific apoptotic signaling cascades.The IR SSO can be expressed as an antisense RNA in the U7 snRNA viral vector delivery system to switch IR splicing

[0195] Antisense oligonucleotide (ASO) technology has revolutionized the treatment of genetic diseases with genetic diseases with concomitant aberrant splicing events, such as spinal muscular atrophy (SMA) and Duchenne muscular dystrophy (DMD). In both diseases, the use of SSOs to induce exon inclusion or exclusion has corrected the splicing defect in key genes (SMNI, DMD and resulted in major therapeutic improvements for patients. The FDA has approved over a dozen ASO therapies for various genetic, cardiovascular, infectious, and metabolic disorders, but many of them require local, repeated administration of the therapies in the target tissues (muscle, CNS) to be effective. Furthermore, ASO biodistribution is largely biased to the liver, preventing the target tissues from receiving the intended dose.

[0196] To overcome the barriers surrounding in vivo delivery and to promote therapeutic SSO uptake in both cancer cells and sites of OS metastasis, Applicant turned toward delivery via viral vectors, specifically recombinant adeno-associated viruses (rAAVs) and the U7 small nuclear RNA (U7 snRNA) system. rAAVs are efficient delivery vehicles and do not integrate into the genome, and the FDA has approved their use for SMA and other genetic diseases. The U7 small nuclear ribonucleoprotein (snRNP) traditionally facilitates 3’ end processing of histone RNAs through a complementary sequence to the histone downstreamelement (HDE) and is therefore not involved in spliceosomal processes. By modifying the HDE to a specific antisense sequence targeting a region of interest and substituting the U7 snRNP-specific proteins (Lsm 10 and Lsm 11) with the consensus sequence of proteins in the major spliceosome, the U7 snRNA can efficiently deliver therapeutic antisense RNAs that localize in the nucleus, where splicing occurs.

[0197] As proof-of-principle of viral vector-mediated delivery of SSOs in cancer, Applicant designed a modified U7 snRNA vector to express either the control NS or SSO55 sequence as an antisense RNA (FIG. 6A). The modified U7 snRNA contains its own promoter that drives the expression of the NS or SSO55 sequence, Sm-binding and loop sequences (to induce the formation of a spliceosomal -like protein core that protects the snRNA), and its 3’ UTR. Applicant validated two types of plasmids, where the U7snRNA-NS / SSO unit was encoded twice (p-Nl, p-Al) or where a single U7 promoter expressed the NS / SSO sequence four times interspersed with a linker region (p-N2, p-A2) (FIG. 6A). These viral plasmids were transfected with the IR minigene (see FIG. 4D) in HeLa cells, and IR isoform levels were measured after 48 and 72 hours post transfection to allow for sufficient expression of the plasmids (FIG. 6B). Compared to the p-Nl U7 control vector, the p-Al vector promoted a complete shift toward the IR-B isoform at both 48 and 72 hours in two replicate experiments, an effect that was comparable to the synthetic SSO55 (FIG. 6B). Additionally, while SSO55’s splicing switch was less pronounced at 72 hours, likely in part to the oligonucleotide’s dilution during cell division, p-Al’s impact on IR-B levels was sustained. Applicant consequently selected the p-Nl and p-Al U7 vector pair to be packaged in rAAVs.

[0198] Different types of rAAVs (termed “serotypes”) are distinguished by their surface antigens, and these features lead to selective tissue tropism that can target rAAVs to specific tissues. However, this advantage is offset by the prevalence of rAAVs in the general environment and acquired humoral immunity against them in humans. Applicant tested the transduction efficacy of AAV-8 against AAVrh74, a serotype with a low seroprevalence of binding antibodies in humans, in OS cells. Applicant transduced AAVrh74-eGFP and AAV- 8-eGFP in U2OS and 143.98.2 cells at a multiplicity of infection (MOI) of 1E6 and observed GFP fluorescence over five days after transduction (FIG. 6C, FIG. 12). AAVrh74 was more efficiently transduced in both cell lines compared to AAV-8 and was chosen as the packaging serotype for the U7 snRNA candidate plasmids (p-Nl, p-Al).

[0199] When compared to AAVrh74.U7-Nl, transduction of AAVrh74.U7-Al at higher MOIs yielded modest but significant IR-B: IR-A splicing shifts at the 72 hour time point in U2OS and 143.98.2 Luc-GFP cells (MOI 5E6 for U2OS, MOI 5E6 and 1E7 for 143.98.2 Luc-GFP) (FIG. 6D). AAVrh74.U7-Al’s impact on IR-B isoform levels was not as pronounced as SSO55. Previous applications of U7 snRNA-mediated antisense RNA expression for splicing events were in the context of genetic diseases, which usually have less dynamic microenvironments than cancer.The IGF-1R antibody dalotuzumab acts additively with SSO55 to modulate phosphoprotein phosphorylation and with AA Vrh74. U7snRNA to slow OS cell proliferation

[0200] Because only a modest splicing shift toward IR-B upon AAVrh74.U7 snRNA virus transduction was observed, Applicant considered whether this small increase could be leveraged with an anti-IGF-IR therapy. Applicant investigated the combination of SSO55 or later the AAVrh74.U7snRNA virus with the IGF-1R monoclonal antibody dalotuzumab (also known as MK0646), a humanized antibody that specifically inhibits IGF-l / IGF-2 binding to IGF-1R homodimers and prevents downstream activation of PI3 / AKT and Ras / Raf / MEK / ERK signaling. Like other IGF-1R antagonists, dalotuzumab’ s modest therapeutic benefit in patients and overall failure as a prospective treatment for IGF-driven cancers was in part attributed to IR alternative splicing and PI3-AKT signaling via IR-A. Therefore, without wishing to be bound by theory, Applicant hypothesized that co-targeting of the IGF-1R and IR-A receptors with dalotuzumab and SSO55 or AAVrh74.U7snRNA respectively would be a therapeutic combination in OS cells.

[0201] To ascertain the individual and combined effects of dalotuzumab with SSO55 on OS cells, Applicant performed a phosphorylation array on a broad spectrum of human phosphoproteins. Applicant selected the metastatic cell line 143.98.2 Luc-GFP for the array and transfected cells with 100 nM NS or SSO55 in combination with dalotuzumab (FIG. 7A). Because Applicant observed the largest shift in AKT phosphorylation in this cell line at 48 hours after SSO transfection (see FIG. 10), Applicant harvested these lysates at 48 hours and incubated them on a multiplex antibody array of 37 human phosphoproteins (spotted in duplicate) to measure relative phosphorylation (FIGS. 7A-7B, FIG. 13A). The array contained AKT 1 / 2 / 3 (S473 and T308), ERK 1 / 2 (T202 / Y204, T185 / Y187), and GSK-3a / p(S21 / 9) as known targets in the / signaling pathway (Table 2). Surprisingly, addition of dalotuzumab with either NS or SSO55 abolished phosphorylation of all but a few profiled phosphoproteins compared to SSO55 treatment alone (shown in FIG. 7B, quantified in FIG. 13B). AKT phosphorylation was minimally changed after SSO55 treatment alone and almost completely abolished with the addition of dalotuzumab. Since SSO55 facilitates IR-B splicing, without wishing to be bound by theory, Applicant hypothesized that this would increase the activation of metabolic protein targets and partners. Applicant congruently observed an increase in GSK-3a / p and GSK-3P phosphorylation after SSO55 alone and with dalotuzumab. ERK1 / 2 phosphorylation initially increased with SSO55 treatment, which may be due to constitutive Ras activation from Kirsten murine sarcoma virus infection in 143.98.2 Luc-GFP’s parent cell line 143B. Despite this, the addition of dalotuzumab reduced ERK1 / 2 phosphorylation in both the NS and SSO55 conditions. Applicant also identified a number of additional phosphorylated targets affected by SSO55 (FIG. 7B). To verify the phosphoarray findings in a cell line without constitutive Ras activation, Applicant profiled the impact of SSO55 and dalotuzumab on pGSK-3a / p protein in U2OS cells. Indeed, Applicant observed that protein levels of GSK3a / 3p, a known substrate of AKT that participates in metabolic signaling, increase modestly in SSO55-treated U2OS cells compared to NS-treated cells, and this effect is enhanced with the addition of dalotuzumab (FIG. 13C).

[0202] Based on the distinct phosphorylation changes in a variety of phosphoproteins that was induced by the combination of SSO55 and dalotuzumab rather than SSO55 alone, Applicant examined whether these two agents would also change properties of anoikis in OS cells. Applicant repeated the GILA assay in OS cells and observed that simultaneous treatment with SSO55 and dalotuzumab statistically significantly decreased growth in low adhesion compared to control cells (p < 0.05 for U2OS and 143.98.2) (FIG. 7C, FIG. 14A), highlighting that dalotuzumab could enhance SSO55’s favorable effects on cancer cell hallmarks.

[0203] The phosphoarray and GILA results suggested that dalotuzumab’ s widespread impact on downstream signaling in both NS- and SSO55-treated cells may be a favorable mechanism to augment the modest increase in IR-B levels observed with the AAVrh74.U7 snRNA virus. Applicant treated both U2OS and 143.98.2 Luc-GFP cells with dalotozumab and the AAVrh74.U7 snRNA control or IR viruses, with the caveat that Rh74-eGFP more efficientlytransduced U20S cells than 143.98.2 Luc-GFP cells and the former would be the more reliable cell line to measure cell proliferation (FIG. 6C, FIG. 7C, FIG. 14B). In order to maximize the number of U2OS cells that would be transduced, Applicant used an MOI of 1E7 and observed that AAVrh74.U7-A and dalotuzumab (indicated as IGF-1R Ab in the figure) were more effective in significantly slowing OS cell proliferation (measured by cell confluency) than the virus alone or the control virus with dalotuzumab (p < 0.0001 in all conditions) (FIG. 7E).

[0204] In comparison to AAVrh74.U7snRNA transduction, SSO transfection was highly efficient in significantly switching IR splicing toward the IR-B isoform, which was also sufficient to reduce proliferation and anoikis-resistant growth. However, in the absence of a major splicing correction, combinatorial therapy wherein both the IGF-1R and IR-A can be targeted, as illustrated through the dual use of dalotuzumab and AAVrh74.U7snR.NA / / virus, might be additive and elicit anti-tumorigenic molecular and functional changes in cancer cells.Discussion{0205] Alternative splicing is a pivotal biological process that enables genes to generate multiple protein isoforms, contributing to transcript variation and proteome diversity. However, recent advancements in high-throughput sequencing have revealed that splicing deregulation, which impacts a wide array of genes, plays a substantial role in various hallmarks of the tumorigenic process, including angiogenesis and metastasis. It is imperative that in order to understand the mechanistic details of cancers as well as to treat them effectively, Applicant tap into this level of regulation and identify splicing targets that contribute to tumorigenicity.

[0206] While the introduction of chemotherapy has greatly improved OS patient survival since the disease was first described in the 1950s, the overall treatment regimen and the dismal outlook for patients with metastases has remained stagnant. The IGF-2 / AKT pathway is highly upregulated in all OS patients, and copy number gains of the IGF-1R gene have been found in osteosarcoma patients with corresponding IGF-1R overexpression. Additionally, IGF-2 is also known to protect OS cells against chemotherapy. However, unfortunately the inhibition of IGF-1R using monoclonal antibodies like cixutumumab ordalotuzumab or even with tyrosine kinase inhibitors has not resulted in successful tumor remission. Enzymatic quantification has shown that the alternatively spliced IR-A receptor demonstrates increased binding affinity for IGF-2 as compared to the full-length IR-B receptor. As such, in the setting of anti -IGF- IR monotherapy, the IGF-2 : IR-A signaling pathway could be contributing to lack of clinical success as it circumvents IGF-1R inhibition and promotes oncogenic growth responses.

[0207] As described herein, Applicant has shown that IR-A is the dominant isoform in OS tumors, and induction of the IR-B isoform with the IR SSO candidate across multiple OS cell lines resulted in changes in cell proliferation, growth in low attachment, and apoptosis. To advance the use of SSO technology in cancer, which currently has limitations in delivery to target tissues and biodistribution, Applicant engineered the IR SSO as an antisense RNA in a recombinant adeno-associated virus (AAV) vector with a U7 promoter. This approach has been used to deliver ASOs in genetic diseases but has not yet been reported in a cancer model to Applicant’s knowledge. Transduction of OS cells with AAVrh74.U7snRNA virus resulted in a modest but significant splicing shift from IR-A to IR-B, which prompted investigation of the potential for combinatorial treatment regimens with the anti-7GF-7A monoclonal antibody dalotuzumab. Applicant found that dalotuzumab acted in an additive manner with the SSO to alter phosphokinase phosphorylation and anoikis-resistant growth. Additionally, dalotuzumab enhanced the effect of the AAVrh74.U7snRNA virus to slow OS cell proliferation.

[0208] Multiple classes of RNA therapeutics have been shown to impact the expression of disease-causing genes — ASOs, siRNAs, microRNAs, CRISPR / Cas9, to name a few. Within these classifications, ASOs (also known as SSOs) have received the most support for clinical applications from the FDA, with 10 therapeutics receiving approval as of 2020. Applicant has characterized the use of a second-generation SSO with a phosphorothioate (PS) backbone and 2’MOE modification on the ribose sugars to modulate IR splicing and induce functional changes in OS cells. The PS backbone stabilizes the ASOs to nuclease degradation, reduces hydrophobicity, and enhances protein binding, properties that helps increase cell uptake and intracellular distribution. The 2’MOE modification improves pharmacokinetics, increases half-life of these ASOs, and enhances binding affinity to target RNA. These synthesized oligonucleotides thus exhibit increased binding to serum proteins such as albumin, which maintains them in circulation long enough for tissue distribution. Following intravenous orsubcutaneous administration, the phase of distribution from plasma to tissues ranges from minutes to a few hours, followed by a prolonged elimination phase that can last for several weeks. Additionally, oligonucleotides containing both PS and sugar modifications such as 2'MOE have tissue half-lives measured in weeks. PS and MOE-modified single-stranded ASOs can be administered by all routes, and their oral bioavailability and absorption profiles have been demonstrated in animals and humans.

[0209] Of note, SSOs, specifically those with unmodified chemistries, have been previously described to impact toll-like receptors (TLRs) 3, 7, 8, and 9 and mounting of innate immune responses. However, the addition of sugar moieties and other modifications has been shown to abrogate an innate immune response that may be triggered through TLR and interferon signaling.

[0210] The present in vitro success of mitigating some cancer cell hallmarks with SSO treatment, compounded with a desire to address barriers of SSO therapy (such as targeted delivery to tumors) in cancer, prompted engineering of the IR SSO55 sequence as a transgene expressed via the U7 snRNA - AAV gene therapy tool. While AAVrh74.U7snRNA did not switch IR splicing as efficiently as the synthetic SSO, the chemistry of the oligonucleotide versus the antisense RNA produced from the AAV or the strength of the U7 promoter could impact its efficacy. It is unclear how effective the U7 promoter is in driving downstream antisense sequence expression in cancer. Tumor cells are comparatively more hypoxic and nutrient-starved than healthy cells, and these stresses can be used as leverage in gene therapy to selectively activate transgene expression. In the case of spliceosomal snRNPs, modified U7, U6, and U1 snRNAs are all capable of delivering antisense sequences to the nucleus. However, unlike U7, U1 and U6 are abundant core components of the spliceosome, which may interfere with the efficacy of modified U1 and U6 snRNAs used as gene therapy.

[0211] In addition to the choice of promoter, the AAVrh74.U7 snRNA viruses may have demonstrated less splice-switching capabilities due to choice of serotype and AAV capsid design. While Applicant selected AAVrh74 due to low seroprevalence of binding antibodies in humans and prior successful use in DMD gene therapy development, the U7 snRNA vectors could theoretically be packaged into one of several other studied AAV serotypes that may be more efficiently transduced in OS cells or transforming osteoblasts. Furtheroptimization of the viral capsid may also be key in increasing delivery efficacy. The viral capsid can be enhanced through the use of adaptors or bispecific antibodies that interact with cell surface receptors or inserting target cell-specific moieties in the viral capsid. Prior studies have shown that OS cells express EGFR, FGFR, VEGFR, avB3 and avB5 integrins, and transferrin, and any of these proteins could improve AAV attachment and entry in OS (Witlox et al., 2007, Bone 40, 797-812).

[0212] Taken in the context of emerging therapies for OS, the approach of using SSOs and AAV-mediated delivery has the same goals as immunotherapies (monoclonal antibodies and CAR-T cell therapy, to name a few), and small molecule inhibitors — to modulate OS cell expression and sensitize it to other chemotherapeutic agents or a host-mediated immune response. OS tumors demonstrate intra- and inter-tumor heterogeneity and numerous molecular alterations that induce metastatic transformation, making regimens that target OS- specific surface markers and disease-causing pathways a therapeutic necessity. Multiple studies and clinical trials have focused on OS surface proteins by using immune checkpoint inhibitors and T-cell therapy targeting PD-1 / PD-L1 and CTLA-4, bispecific T-cell engagers (BiTEs) targeting GD2, and CAR-T cell therapy with HER2 and dextrotecan. While these immunomodulatory therapies have shown initial preclinical and clinical promise for OS, issues with tumor specificity and immunosuppressive microenvironment remain. Additional described approaches include direct targeting of the DNA damage repair, angiogenesis, and other molecular pathways enriched in OS (reviewed in Hu et al, (2022) Current status and prospects of targeted therapy for osteosarcoma. Cells 11, 3507; and Li et al, 2023, J. of cancer research and clinical oncology 149, 6785-6797). Monoclonal antibodies aimed at the mTOR pathway (sirolimus and related drugs) and multi-level inhibition of receptor tyrosine kinases (EGFR, PDGFR, IGF-1R, VEGRF, to name a few) have been especially helpful for patients with unresectable or relapsed disease. To this end, mitigating IGF- 7 7IR. signaling via SSOs / AAV.U7 snRNA viruses and anti-7GF-77? antibodies is a new approach to deregulating key growth pathways at the level of pre-mRNA and protein in OS. Nevertheless, further in vitro and in vivo characterization of the 77? SSO and AAVrh74.U7 snRNA viruses are paramount to characterizing their efficacy and clinical utility as therapeutics, both alone and in combination with 7GF-77? inhibitors, chemotherapies, and / or immunotherapies.

[0213] Altogether, SSOs can be used as a modality to switch IR alternative splicing toward the non-proliferative IR-B isoform and to be combined with anti-IGF-IR therapies. The results shown herein demonstrate that SSOs can mediate cancer cell hallmarks, suggesting that modulating alternative splicing has the power to shift cancer cells away from oncogenic, proliferative signaling and sensitize them to chemotherapeutics or other agents. Importantly, this perspective on advancing SSO therapeutics through viral vector delivery is an innovative approach that still requires further design optimization and consideration of the dynamic tumor microenvironment, heterogeneity of tumor cells, or complexity of the coordinated gene networks that promote tumorigenesis. Results shed light on the role of IR alternative splicing in cancer and the testing of novel therapeutics against disease-inducing splicing events, an approach can be translated to other cancers to improve the clinical outcomes in pediatric populations.Materials and MethodsCell lines and patient-derived xenografts (PDXs):

[0214] Cells and cell culture'. The human cell lines Saos-2 (HTB-85, osteosarcoma), U2OS (HTB-96, osteosarcoma), SJSA-1 (CRL-2098, osteosarcoma), HeLa (CRM-CCL-2, cervical adenocarcinoma) were obtained from American Type Culture Collection (Manassas, VA). OS- 17, OS-25, OHS were kind gifts from Ryan Roberts (Nationwide Children’s Hospital, Columbus, OH). The osteosarcoma cell line 143.98.2 was obtained from ATCC (CRL- 11226). 143.98.2 and OHS cells were transduced with firefly luciferase-T2A-GFP expressing lentiviral vector (PLV-10172, Cellomics Technology, Halethorpe, MD USA) and selected with 0.75ug / ml of puromycin for two weeks to become stable reporter cell lines named 143.98.2-Luc-GFP and OHS-Luc-GFP. OS-17, OS-26, OHS, Saos-2, U2OS, and SJSA-1 were cultured in RPMI 1640 supplemented with 10% fetal bovine serum (FBS) and 1% penicillin / streptomycin. HeLa and 143.98.2 Luc-GFP were cultured in DMEM supplemented with 10% FBS and 1% penicillin / streptomycin. All cell lines were verified by short tandem repeat genotyping and confirmed to free of mycoplasma by IDEXX Bioanalytics or in-house mycoplasma testing.

[0215] PDXs: PDXs 1-6 (osteosarcoma) were obtained as snap-frozen vials of tissue chunks from the Tumor Core at Nationwide Children’s Hospital (Columbus, OH). Tissues weredesignated as derived from primary or metastatic tumors by the Tumor Core at Nationwide Children’s Hospital. The tissue specimens were ground using a mortar and pestle in liquid nitrogen. Approximately 1000 ng RNA was then extracted from the specimens using the RNeasy (Qiagen, Cat# 74106, Hilden, Germany). Reverse transcription (RT) was performed using ~1 pg of RNA as described in Jacobs et al. (2013, Neoplasia 15, 1049-IN1048).

[0216] Plasmids and minigenes: The IR 10-11-12 minigene was a kind gift from Nick Webster (2013, Nature communications 4, 1336). The IR mutant and substitution minigenes were generated using the Quikchange Lightning mutagenesis kit (Agilent, Cat# 210519, Santa Clara, CA) and primers listed in Table 4.

[0217] RNA Isolation, RTs and polymerase chain reactions (PCRs and quantitative real-time PCRs): RNA was isolated from cells using the RNeasy Plus Mini Kit (Qiagen, Cat#74134, Hilden, Germany). RT reactions were performed with 500-1000 ng of RNA using Transcriptor RT enzyme (Sigma Aldrich, Cat# 03531287001, Burlington, MA) or SuperScript IV Reverse Transcriptase (Invitrogen, Cat# 18090010). PCRs for endogenous IR were performed using primers in Exons 10 and 12 (see Table 4 for sequences) that distinguished the IR-A (135 bp) and IR-B (160 bp) isoforms. PCRs for the IR minigene were performed using minigene-specific primers in Exons 10 and 12 that would not pick up the endogenous IR (see Table 4 for sequences). PCRs were performed with the following program unless specified otherwise: 94 °C for 5 minutes, 35 cycles of 94 °C for 30 seconds, 65 °C for 30 seconds, 72 °C for 1 minute, 72 °C for 7 minutes. PCR products were then run on a 2% agarose gel at 150 V for 105 minutes and visualized on a Gel Doc XR+ Gel Documentation System (Biorad, Hercules, CA).

[0218] All quantitative real-time PCR (qPCR) reactions were performed with standard PCR conditions using a CFX96 Touch Real Time PCR Detection system (Biorad, Hercules, CA). Real-time PCR reactions were carried out using the SYBR Green PCR Master Mix (Applied Biosystems, Cat# 4309155, Waltham, MA). The primers used to amplify the apoptosis target transcripts have been listed in Table 4. All PCR reactions were carried out with at least three technical replicates, and the amplification of single PCR products in each reaction was confirmed using dissociation curve.-n-|0219] Dalotuzumab, splice-switching oligonucleotides (SSOs), and transfections: Dalotuzumab (also known as MK-0646) was kindly provided by Peter Houghton and later purchased from Med Chem Express (Cat# HY-P99284, Monmouth Junction, NJ). For experiments involving dalotuzumab, 0.04 mg was added to cells with 1 mL of fresh media. Cells were then incubated for 30 minutes before harvest or received fresh media + dalotuzumab every 48 hours.(0220] The SSO targeting CUG-BP1 in intron 10 of the 77? gene and a non-specific control SSO have been previously described in Khurshid et al. (2022, NPJ Precision Oncology 6, 1- 11) and were kindly manufactured by lonis Pharmaceuticals. The SSO55 sequence is 5’- CACAGTCTCGGGTCACCA-3’ (SEQ ID NO: 77), and the NS sequence is 5’- TTAGTTTAATCACGCTCG-3’ (SEQ ID NO: 41).

[0221] For transfections, cells were seeded in the appropriate media in 6-well plates and transfected with 10 uL Lipofectamine 2000 (Invitrogen, Cat# 11668500, Carlsbad, CA) in 1 mL OptiMEM media unless otherwise stated. Following a four hour incubation, OptiMEM was removed and replaced with the appropriate media for each cell line.Functional assays:

[0222] Proliferation: U2OS and 143.98.2 cells were treated with 100 nM NS and SSO55 (using Lipofectamine 2000) and placed in IncuCyte for 60-72 hours. The IncuCyte (Sartorius) allows for live cell imaging and images cells after every 2-4 hours. The data was collected at the end of 72 hours and plotted in Prism.

[0223] Growth in low attachment (GILA) assay: Cells were seeded in 6-well plates (Coming, Cat# 7007, Corning, NY) and transfected the following day with 100 nM NS or SSO55 as described above. After 24 hours, cells were stained with Trypan blue (Gibco, Cat# 1520061, Grand Island, NY) and counted using a hemocytometer. Cells were then reseeded in an ultralow attachment 96-well plate (Corning, Cat# 3474, Corning, NY) at a concentration of 10,000 cells / well and incubated at 37°C for five days. On Day 5, 100 uL Cell Titer Gio (Promega, Cat# G7570, Madison, WI) was added to each well, and the plate was incubated on a shaker at room temperature for 25 minutes. Then, 150 uL from each well was transferred to a white bottom 96-well plate, and luminescence was quantified on the Promega GlowMax Plate Reader (integration time = 1 second).

[0224] Annexin 5 Staining: NS- and SSO- treated 143.98.2 Luc-GFP cells were harvested using Accutase (Gibco, Cat# Al 110501, Grand Island, NY) for detachment at indicated time points for Annexin V / 7ADD staining (Annexin A5 Apoptosis Detection Kit, Cat # 640930, Biolegend, San Diego, CA). Cells were then washed twice with PBS and spun down to a pellet. Cell pellets were resuspended in lOOuL of Annexin V Binding Buffer containing 5uL of APC Annexin V and 5uL of 7-AAD and incubated at room temperature in the dark for 15mins. After incubation, an additional 400uL of Annexin V Binding Buffer were added to the cell suspension. Data were acquired on NovoCyte (Agilent, Santa Clara, CA) and were analyzed with FlowJo software 10.10.0 (BD Bioscience, Ashland, OR).

[0225] Proteome profiler array: The Proteome Profiler Human Phospho-Kinase Array was purchased from R&D Systems (Cat# ARY003C, Minneapolis, MN). The prepared blots came with specific phospho-kinase antibodies blotted on nitrocellulose membranes in duplicate.143.98.2 Luc-GFP cells were seeded at 200,000 cells / well in a 6-well plate and transfected with 100 nM NS or SSO55 the following day. After 48 hrs following transfection, cells were harvested, and whole-cell lysates were collected for the array and processed according to the R&D Systems protocol. The membranes were visualized using the array’s chemilumi scent agent and developed on x-ray film. The signal produced on the film for each antibody correlated with the phosphorylation present in either the NS- or SSO55-treated cells. Phosphorylation was quantified by capturing the relative pixel density of each spot in Image J and subtracting a background signal from the average of each duplicate set.(0226] Western blot and antibodies: U2OS and 143.98.2 Luc-GFP cells were seeded at 300,000 cells / well or 200,000 cells / well respectively in a 6-well plate. After transfection with 100 nM NS or SSO55 via Lipofectamine 2000 for specified time points, cells were harvested, and whole-cell lysates were isolated using cell lysis buffer (Cell Signaling, Cat# 9803, Danvers, MA) supplemented with a protease / phosphatase inhibitor cocktail (Thermo Scientific, Cat# 78440, Waltham, MA). Protein concentrations were calculated using the Pierce BCA Protein Assay Kit (Thermo Scientific, Cat# 23225, Waltham, MA), and ~30 pg protein was loaded onto a denaturing NuPAGE 4 to 12% Bis-Tris gel (Invitrogen, Cat# NP0336BOX, Carlsbad, CA) with a Precision Plus protein standard (Bio-Rad, Cat# 1610376, Hercules, CA). Gels were run at 120V for 105 minutes, and the separated proteins were transferred to poly vinylidene fluoride membranes on ice at 35 V for 60 minutes. Membraneswere blocked for 30 minutes in casein buffer (Thermo Scientific, Cat# 37582, Waltham, MA) and incubated overnight at 4°C in the following antibodies: pAKT (Ser473) (1 : 1000, Cell Signaling, Cat# 4060S, clone D9E, Danvers, MA), panAKT (1 : 1000, Cell Signaling, Cat# 4691 S, clone C67E7, Danvers, MA), pGSK3cc (1 : 1000, Cell Signaling, Cat#9331S, Danvers, MA), and GAPDH (1 :2000, Cell Signaling, Cat#2118S, Danvers, MA). For GAPDH, the membranes were incubated in the primary antibody for 60 minutes at room temperature. Membranes were washed in Tris-buffered saline with 0.1% Tween-20 (TBST) thrice and then incubated with a secondary antibody conjugated to horseradish peroxidase (Cell Signaling, Cat# 7074S, Danvers, MA) for 60 minutes at room temperature. After additional TBST washes, the membranes were covered in ECL Western blotting substrate (Thermo Scientific, Cat# 32106, Waltham, MA) and developed on x-ray film.U7-snRNA Viral Vectors

[0227] Plasmid construction and AAV viral vector production: The U7 snRNA viral vectors used to express the IR NS and SSO55 sequences were constructed and packaged by Vector Builder into AAVrh74. The Vector Builder IDs for the viral vectors shown in FIG. 6 are VB230608-1954gzn (p-Nl) (SEQ ID NO: 48), VB230608-1856jdp (p-Al) (SEQ ID NO: 50), VB230621-1559www (p-N2) (SEQ ID NO: 52), VB230405-1136ksw (p-A2) (SEQ ID NO: 51), and these IDs can be used to obtain the vector details on vectorbuilder.com.

[0228] AAV-eGFP and AAVrh74. U7snRNA virus transduction: U2OS and 143.98.2 Luc-GFP were seeded at appropriate densities in full serum media (10% FBS RPMI for U2OS, 10% DMEM for 143.98.2) one day prior to virus transduction. During the transduction period, media was replaced with 2% FBS RPMI or DMEM, and virus was added to the cells in a dropwise fashion. Full serum media was replaced after 24 hours of virus transduction and every 48 hours during the experimental timeline. Cells transduced with fluorescent eGFP vectors were imaged on a fluorescent microscope under the GFP lamp at lOx magnification.]0229] Table 4: Primer Sequences

[0230] Table 5: Human Proteome Phosphokinase Phosphoarray (R&D Systems)

[0231] Protocol, phosphoarray coordinates, and template: resources. rndsystems.com / pdfs / datasheets / ary003c.pdf?_ga=2.111712964.1319397147.1706157690-1571267669.1695235735EQUIVALENTS

[0232] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this technology belongs.

[0233] Recitation of ranges of values herein are merely intended to serve as a shorthand method for referring individually to each separate value falling within the range and eachendpoint, unless otherwise indicated herein, and each separate value and endpoint is incorporated into the specification as if it were individually recited herein.

[0234] All methods described herein are performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., "such as") provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.

[0235] The present technology illustratively described herein can suitably be practiced in the absence of any element or elements, limitation or limitations, not specifically disclosed herein. Thus, for example, the terms “comprising,” “including,” “containing,” etc. shall be read expansively and without limitation. Additionally, the terms and expressions employed herein have been used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the present technology claimed.

[0236] Thus, it should be understood that the materials, methods, and examples provided here are representative of preferred aspects, are exemplary, and are not intended as limitations on the scope of the present technology.

[0237] The present technology has been described broadly and generically herein. Each of the narrower species and sub-generic groupings falling within the generic disclosure also form part of the present technology. This includes the generic description of the present technology with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the excised material is specifically recited herein.

[0238] In addition, where features or aspects of the present technology are described in terms of Markush groups, those skilled in the art will recognize that the present technology is also thereby described in terms of any individual member or subgroup of members of the Markush group.

[0239] All publications, patent applications, patents, and other references mentioned herein are expressly incorporated by reference in their entirety, to the same extent as if each were incorporated by reference individually. In case of conflict, the present specification, including definitions, will control. Several publications are referenced by an Arabic number and the full bibliographic citation for each is found in the References section, immediately preceding the claims.

[0240] Other embodiments are set forth within the following claims.ADDITIONAL EMBODIMENTS

[0241] 1. A polynucleotide comprising a promoter and a first splice-switching oligonucleotide (SSO) capable of targeting a regulatory element of an insulin receptor (IR), wherein the promoter is selected from a U7 promoter or a U1 promoter, optionally wherein the IR is a human IR.

[0242] 2. The polynucleotide of embodiment 1, wherein the SSO is selected from:(i) a nucleotide sequence comprising SEQ ID Nos.: 2, 5, 8, 11, 14, 17, 20, 23, 26, 29, 32, 35, or 38, as set forth in Table 1; or(iii) a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the SSO set out in SEQ ID NO: 2, 5, 8, 11, 14, 17, 20, 23, 26, 29, 32, 35, or 38, as set forth in Table 1.

[0243] 3. The polynucleotide of embodiment 1 or 2, further comprising a second SSO, optionally wherein the first SSO and the second SSO are the same or different from each other.

[0244] 4. The polynucleotide of embodiment 3, further comprising a third SSO, optionally wherein the third SSO is the same or different from the first SSO and / or the second SSO.

[0245] 5. The polynucleotide of embodiment 4, further comprising a fourth SSO, optionally wherein the fourth SSO is the same or different from one or more of the first SSO, the second SSO, and the third SSO.

[0246] 6. The polynucleotide of any one of embodiments 1-5, further comprising a detectable label or a purification label.

[0247] 7. A polynucleotide comprising a promoter and a SSO that binds or is complementary to a nucleic acid sequence encoding all or a portion of exon 10, intron 10, exon 11, or intron 1 lof the insulin receptor gene, wherein the promoter is selected from a U7 promoter or a U1 promoter, and wherein the nucleic acid sequence encoding all or a portion of exon 10, intron 10, exon 11, or intron 11 of the insulin receptor gene.

[0248] 8. The polynucleotide of embodiment 7, wherein the portion of exon 10 is CUG- BP1 binding site.

[0249] 9. The polynucleotide of embodiment 7, wherein the portion of intron 11 is MBNL1 binding site.

[0250] 10. The polynucleotide of any one of embodiments 7-9, wherein the SSO comprises or consists essentially of a nucleotide sequence according to SEQ ID NOs.: 2, 5, 8, 11, 14, 17, 20, 23, 26, 29, 32, 35, 38, or an equivalent of each thereof.

[0251] 11. The polynucleotide of any one of embodiments 7-9, wherein the SSO comprises or consists essentially of a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity SEQ ID NOs: 2, 5, 8, 11, 14, 17, 20, 23, 26, 29, 32, 35, or 38.

[0252] 12. A vector comprising at least one polynucleotide of any one of embodiments 1- 11, wherein the vector is selected from an extracellular vesicle, a plasmid, a lipid nanoparticle, or a viral vector, optionally selected from a retroviral vector, a lentiviral vector, a non-replicating lentiviral vector, an adenovirus vector, or an adeno-associated virus (AAV) vector.

[0253] 13. The vector of embodiment 12, wherein the plasmid is pBR322 Ori.

[0254] 14. The vector of embodiment 12, wherein the AAV vector is selected from selected from any one of AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV- 8, AAV-9, AAV-10, AAV-11, and AAVrh.74, or a variant thereof.

[0255] 15. The vector of embodiment 14, wherein the AAV vector is AAV-rh74 or sc AAV.

[0256] 16. The vector of embodiment 12, wherein the vector comprises a nucleic acid sequence that is at least 90%, at least 95%, at least 99%, or 100% identical to SEQ ID NO: 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, or 52.

[0257] 17. The vector of embodiment 12, wherein the vector comprises more than one polynucleotide, optionally wherein the vector comprises two, three, or four polynucleotides, optionally wherein the two, three, or four polynucleotides are the same or different.

[0258] 18. A composition comprising at least one polynucleotide of any one of embodiments 1-12 or at least one vector of any one of embodiments 13-17, and one or more of a carrier, an adjuvant, or an anti cancer therapy.

[0259] 19. The composition of embodiment 18, wherein the composition comprises more than one polynucleotide or vector, or a combination of polynucleotides and vectors.

[0260] 20. A method to deliver a splice-switching oligonucleotide (SSO) to a cell, comprising contacting the cell with the polynucleotide of any one of embodiments 1-11, the vector of any one of embodiments 12-17, or the composition of embodiment 18 or 19.

[0261] 21. A method to prevent mammalian cell growth comprising contacting the cell with at least one of the polynucleotide of any one of embodiments 1-11, the vector of any one of embodiments 12-17, or the composition of embodiment 18 or 19, optionally wherein the mammalian cell is a cancer cell.

[0262] 22. The method of embodiment 21, wherein at least one SSO in the polynucleotide targets a regulatory element of an insulin receptor (IR), optionally wherein the regulatory element is selected from CUG-BP1 binding site and MBNL-1 binding site.

[0263] 23. The method of any one of embodiments 20-22, wherein the contacting is in vitro or in vivo.

[0264] 24. The method of any one of embodiments 20-23, wherein the cell is a cancer cell.

[0265] 25. The method of embodiment 24, wherein the cell is an osteosarcoma cell, optionally wherein the osteosarcoma cell is selected from a cell line selected from U2OS, 143.98.2 Luc-GFP, OHS Luc-GFP, Saos-2, OS-17, OS-25, and OS-26.

[0266] 26. A method to treat osteosarcoma in a mammal in need thereof comprising administering to the mammal the polynucleotide of any one of embodiments 1-11, the vector of any one of embodiments 12-17, or the composition of embodiment 18 or 19, thereby treating the osteosarcoma.

[0267] 27. The method of embodiment 26, wherein the mammal is a juvenile.

[0268] 28. The method of embodiment 26 or 27, wherein the osteosarcoma is rhabdomyosarcoma.

[0269] 29. The method of any one of embodiment 26-28, further comprising administering an additional anti-cancer therapy.

[0270] 30. The method of embodiment 29, wherein the additional anti-cancer therapy is a monoclonal antibody, optionally dalotuzumab.

[0271] 31. The method of any one of embodiments 26-30, wherein the osteosarcoma is localized or metastatic.

[0272] 32. The method of any one of embodiments 26-31, wherein the mammal is selected from a human, an ape, a gibbon, a chimpanzee, an orangutan, a monkey, a macaques, a dog, a cat, a horse, a cow, a goat, a sheep, a pig, a mouse, a rabbit, or a guinea pig.

Claims

What is claimed is:

1. A polynucleotide comprising a promoter and a first splice-switching oligonucleotide (SSO) capable of targeting a regulatory element of an insulin receptor (IR), wherein the promoter is selected from a U7 promoter or a U1 promoter, optionally wherein the IR is a human IR.

2. The polynucleotide of claim 1, wherein the SSO is selected from:(i) a nucleotide sequence comprising SEQ ID NOs: 2, 5, 8, 11, 14, 17, 20, 23, 26, 29, 32, 35, or 38; or(iii) a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NOs: 2, 5, 8, 11, 14, 17, 20, 23, 26, 29, 32, 35, or 38.

3. The polynucleotide of claim 1 or 2, further comprising a second SSO, optionally wherein the first SSO and the second SSO are the same or different from each other.

4. The polynucleotide of claim 3, further comprising a third SSO, optionally wherein the third SSO is the same or different from the first SSO and / or the second SSO.

5. The polynucleotide of claim 4, further comprising a fourth SSO, optionally wherein the fourth SSO is the same or different from one or more of the first SSO, the second SSO, and the third SSO.

6. The polynucleotide of any one of claims 1-5, further comprising a detectable label or a purification label.

7. A polynucleotide comprising a promoter and a SSO that binds or is complementary to a nucleic acid sequence encoding all or a portion of exon 10, intron 10, exon 11, or intron1 lof the insulin receptor gene, wherein the promoter is selected from a U7 promoter or a U1 promoter, and wherein the nucleic acid sequence encoding all or a portion of exon 10, intron 10, exon 11, or intron 11 of the insulin receptor gene.

8. The polynucleotide of claim 7, wherein the portion of exon 10 is CUG-BP1 binding site.

9. The polynucleotide of claim 7, wherein the portion of intron 11 is MBNL1 binding site.

10. The polynucleotide of any one of claims 7-9, wherein the SSO comprises or consists essentially of a nucleotide sequence according to SEQ ID NOs: 2, 5, 8, 11, 14, 17, 20, 23, 26, 29, 32, 35, 38, or an equivalent of each thereof.

11. The polynucleotide of any one of claims 7-9, wherein the SSO comprises or consists essentially of a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity SEQ ID NOs: 2, 5, 8,11. 14, 17, 20, 23, 26, 29, 32, 35, or 38.

12. A vector comprising at least one polynucleotide of any one of claims 1-11, wherein the vector is selected from an extracellular vesicle, a plasmid, a lipid nanoparticle, or a viral vector, optionally selected from a retroviral vector, a lentiviral vector, a non-replicating lentiviral vector, an adenovirus vector, or an adeno-associated virus (AAV) vector.

13. The vector of claim 12, wherein the plasmid is pBR322 Ori.

14. The vector of claim 12, wherein the AAV vector is selected from selected from any one of AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV- 10, AAV-11, and AAVrh.74, or a variant thereof.

15. The vector of claim 14, wherein the AAV vector is AAV-rh74 or scAAV.

16. The vector of claim 12, wherein the vector comprises a nucleic acid sequence that is at least 90%, at least 95%, at least 99%, or 100% identical to SEQ ID NO: 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, or 52.

17. The vector of claim 12, wherein the vector comprises more than one polynucleotide, optionally wherein the vector comprises two, three, or four polynucleotides, optionally wherein the two, three, or four polynucleotides are the same or different.

18. A composition comprising at least one polynucleotide of any one of claims 1-11 or at least one vector of any one of claims 12-17, and one or more of a carrier, an adjuvant, or an anti cancer therapy.

19. The composition of claim 18, wherein the composition comprises more than one polynucleotide or vector, or a combination of polynucleotides and vectors.

20. A method to deliver a splice-switching oligonucleotide (SSO) to a cell, comprising contacting the cell with the polynucleotide of any one of claims 1-11, the vector of any one of claims 12-17, or the composition of claim 18 or 19.

21. A method to prevent mammalian cell growth comprising contacting the cell with at least one of the polynucleotide of any one of claims 1-11, the vector of any one of claims 12- 17, or the composition of claim 18 or 19, optionally wherein the mammalian cell is a cancer cell.

22. The method of claim 21, wherein at least one SSO in the polynucleotide targets a regulatory element of an insulin receptor (IR), optionally wherein the regulatory element is selected from CUG-BP1 binding site and MBNL-1 binding site.

23. The method of any one of claims 20-22, wherein the contacting is in vitro or in vivo.

24. The method of any one of claims 20-23, wherein the cell is a cancer cell.

25. The method of claim 24, wherein the cell is an osteosarcoma cell, optionally wherein the osteosarcoma cell is selected from a cell line selected from U2OS, 143.98.2 Luc-GFP, OHS Luc-GFP, Saos-2, OS- 17, OS-25, and OS-26.

26. A method to treat osteosarcoma in a mammal in need thereof comprising administering to the mammal the polynucleotide of any one of claims 1-11, the vector of any one of claims 12-17, or the composition of claim 18 or 19, thereby treating the osteosarcoma.

27. The method of claim 26, wherein the mammal is a juvenile.

28. The method of claim 26 or 27, wherein the osteosarcoma is rhabdomyosarcoma.

29. The method of any one of claims 26-28, further comprising administering an additional anti -cancer therapy.

30. The method of claim 29, wherein the additional anti-cancer therapy is a monoclonal antibody, optionally dalotuzumab.

31. The method of any one of claims 26-30, wherein the osteosarcoma is localized or metastatic.

32. The method of any one of claims 26-31, wherein the mammal is selected from a human, an ape, a gibbon, a chimpanzee, an orangutan, a monkey, a macaque, a dog, a cat, a horse, a cow, a goat, a sheep, a pig, a mouse, a rabbit, or a guinea pig.

Images