Novel double-stranded RNA based on semaphorin-3a RNA sequence and use thereof

Abstract

The present invention provides technology for inhibiting or suppressing proliferation of cells. Disclosed herein is a double-stranded RNA that has a first strand and a second strand which is complementary to the first strand, wherein the first strand has a main sequence which comprises 19-23 bases and in which a base at the 5'-end is guanine (G) or cytosine (C) and an additional sequence which comprises 2-4 bases and which is added to the 3'-end side of the main sequence. The main sequence is a portion of a base sequence that encodes semaphorin-3A, the portion including at least a portion of a base sequence that encodes a signal peptide region of the semaphorin-3A.

Description

Novel double-stranded RNA based on SEMAPHORIN-3A RNA sequence and its use

[0001] The present disclosure relates to double-stranded RNA, compositions containing the double-stranded RNA, and methods of using the same. Specifically, the present disclosure relates to double-stranded RNA used to suppress or inhibit tumor cell growth or metastasis, and compositions comprising the double-stranded RNA. This application claims priority to Japanese Patent Application No. 2024-076803, filed May 9, 2024, the entire contents of which are incorporated herein by reference.

[0002] Semaphorins, a type of secreted cytokine, are known as a group of proteins involved in intercellular signaling. Semaphorins have been shown to be involved in various biological phenomena, such as axonal elongation, immune responses, organogenesis, and angiogenesis. Semaphorins are classified into eight classes based on their structure. Among these, class 3 semaphorins are known to be involved in many processes, such as axonal regrowth after central nervous system trauma, revascularization, remyelination, and regulation of immune responses.

[0003] Class 3 semaphorins have seven isoforms, A through G. Semaphorin 3A is secreted by neurons and their surrounding tissues and is known to guide migrating cells and axons in the developing nervous system. Semaphorin 3A is expressed in human nervous tissue, lymphatic tissue, bone tissue, adipose tissue, connective tissue, vascular endothelium, intestine, and nasopharyngeal epithelium. Semaphorin 3A is known to regulate axon outgrowth in neuronal cells.

[0004] Incidentally, semaphorin 3A is known to be highly expressed not only in the above-mentioned tissues but also in tumor cells. This suggests that semaphorin 3A also plays an important role in cancer. For example, International Publication No. 2014-123186 and Japanese Patent Application Laid-Open No. 2023-130473 disclose anti-semaphorin 3A antibodies that can treat neurodegenerative diseases and cancer.

[0005] International Publication No. 2014-123186 Japanese Patent Application Laid-Open No. 2023-130473

[0006] However, antibody drugs such as those disclosed in International Publication No. 2014-123186 and Japanese Patent Application Laid-Open No. 2023-130473 are expensive and it is difficult to maintain uniform quality. On the other hand, nucleic acid drugs can be mass-produced by organic synthesis, making it easy to control uniform quality.

[0007] Therefore, a main object of the present disclosure is to provide a technique for suppressing or inhibiting cell proliferation involving semaphorin 3A gene expression by using double-stranded RNA.

[0008] The double-stranded RNA disclosed herein comprises a first strand and a second strand complementary to the first strand. The first strand comprises a main sequence consisting of 19 to 23 bases, the 5'-terminal base of which is guanine (G) or cytosine (C), and an additional sequence consisting of 2 to 4 bases added to the 3'-terminal side of the main sequence. Here, the main sequence is a portion of a base sequence encoding semaphorin 3A, and includes at least a portion of a base sequence encoding a signal peptide region of semaphorin 3A.

[0009] The double-stranded RNA can function as at least small interfering RNA (siRNA). That is, such double-stranded RNA is predicted to induce RNA interference (RNAi). This effect is due to the suppression of at least semaphorin 3A expression, thereby inhibiting cell proliferation in which semaphorin 3A is involved.

[0010] In one embodiment of the double-stranded RNA disclosed herein, the second strand has a main sequence complementary to the first strand and an additional sequence consisting of 2 to 4 bases added to the 3'-end of the complementary main sequence. Such double-stranded RNA can function favorably as siRNA. This allows for more reliable inhibition of cell proliferation involving semaphorin 3A.

[0011] In one embodiment of the double-stranded RNA disclosed herein, at least three of the five bases on the 3'-end of the main sequence are adenine (A) and / or uracil (U), thereby more fully suppressing SEMA3A expression and inhibiting cell proliferation involving semaphorin 3A.

[0012] In one embodiment of the double-stranded RNA disclosed herein, the base sequence comprising at least a portion of the base sequence encoding the signal peptide region of semaphorin 3A consists of either of the following base sequences: GGAGTATTACTTACAGCAA (SEQ ID NO: 1); CAGCAAGAGCAAAACTATCA (SEQ ID NO: 2). Such double-stranded RNA more specifically suppresses the expression of semaphorin 3A, thereby inhibiting the proliferation of cells with increased expression of SEMA3A.

[0013] In one embodiment of the double-stranded RNA disclosed herein, the base sequence constituting the additional sequence is thymine-thymine (TT), which can improve the stability of the double-stranded RNA.

[0014] The present disclosure provides a composition capable of inhibiting the proliferation of at least one type of cell. One embodiment of the composition disclosed herein comprises a first strand and a second strand complementary to the first strand, the first strand having a main sequence of 19 to 23 bases, the 5'-terminal base of which is guanine (G) or cytosine (C), and an additional sequence of 2 to 4 bases added to the 3'-terminal side of the main sequence. Here, the main sequence is a portion of a base sequence encoding semaphorin 3A, and comprises double-stranded RNA including at least a portion of a base sequence encoding the signal peptide region of semaphorin 3A. When supplied to cells, such a composition inhibits the expression of at least SEMA3A, thereby inhibiting the proliferation of cells in which semaphorin 3A is involved.

[0015] In one embodiment of the composition disclosed herein, the cell type whose proliferation is inhibited by the composition is tumor cells, thereby enabling more reliable inhibition of cell proliferation.

[0016] One embodiment of the composition disclosed herein comprises a peptide fragment having cell membrane permeability that allows a foreign substance to be introduced into the cytoplasm by passing through the cell membrane from the outside of the cell, thereby facilitating the introduction of double-stranded RNA into a target cell.

[0017] The present disclosure provides a method for inhibiting the proliferation of at least one type of cell. One aspect of the method disclosed herein comprises the steps of (1) preparing a composition disclosed herein and (2) supplying the composition to a target cell in vitro. This allows for the inhibition of cell proliferation in which semaphorin 3A is involved.

[0018] In one embodiment of the method disclosed herein, the biological species of the cells is the same as the biological species containing semaphorin 3A, thereby more reliably inhibiting the proliferation of cells in which semaphorin 3A is involved.

[0019] 1 is a graph showing the cell viability of neuroblastoma cells in Samples 1 and 2 and a Comparative Example; 2 is a graph showing the cell viability of neuroblastoma cells at different amounts of siRNA added for Samples 1 and 2 and a Comparative Example; 3 is a graph showing the cell viability of lung cancer cells in Samples 1 and 2 and a Comparative Example.

[0020] <Definition of Terms> The technology disclosed herein is described in detail below. Matters other than those specifically mentioned in this specification (e.g., the structure of double-stranded RNA) that are necessary for implementing this technology (e.g., general matters such as methods for synthesizing polynucleotides, cell culture techniques, and constructs mainly composed of peptides or nucleic acids) can be understood as design matters of a person skilled in the art based on conventional technology in the fields of cell engineering, physiology, medicine, pharmacology, organic chemistry, biochemistry, genetic engineering, protein engineering, molecular biology, genetics, etc. The technology disclosed herein can be implemented based on the content disclosed in this specification and common general technical knowledge in the relevant field.

[0021] As used herein, the term "polynucleotide" refers to a polymer in which multiple (two or more) nucleotides are linked by phosphodiester bonds, and is not limited by the number of nucleotides. For example, a "polynucleotide" herein also encompasses those containing both deoxyribonucleotides and nucleotides. Furthermore, as used herein, the term "artificially designed polynucleotide" refers to a polynucleotide whose nucleotide chain (full length) does not exist alone in nature, but is artificially synthesized by chemical synthesis or biosynthesis (i.e., production based on genetic engineering).

[0022] As used herein, the terms "first strand" and "second strand" refer to one being a sense strand (or coding strand or passenger strand) and the other being an antisense strand (or template strand or non-coding strand or guide strand). That is, if the first strand is a sense strand, the second strand refers to an antisense strand. Also, if the second strand is a sense strand, the first strand refers to an antisense strand. The first strand and the second strand may be completely complementary to each other, or may be at least partially complementary. That is, they may be capable of hybridizing at least under physiological conditions.

[0023] In the present specification, unless the notation "5'" and "3'" is used, the left side of a base sequence always indicates the 5'-terminal side and the right side indicates the 3'-terminal side. Furthermore, in the present specification, the term "amino acid residue" includes the N-terminal amino acid and the C-terminal amino acid of a peptide chain, unless otherwise specified. Furthermore, in the amino acid sequences described in the present specification, the left side always indicates the N-terminal side and the right side indicates the C-terminal side.

[0024] As used herein, the term "tumor" is broadly interpreted and refers to tumors in general (typically malignant tumors), including carcinomas and sarcomas, as well as lesions of the blood or hematopoietic tissues (leukemia, lymphoma, etc.). Furthermore, "tumor cells" are synonymous with "cancer cells," and refer to cells that form such tumors, typically cells that have reached the stage of abnormal proliferation independent of surrounding normal tissues (so-called cancerous cells). Therefore, unless otherwise specified, any cell that is classified as a tumor cell (cancer cell) rather than a normal cell is referred to as a tumor cell, regardless of its origin or properties.

[0025] In this specification, when a numerical range is described as "A to B (where A and B are any numerical values)," it means "A or more and B or less," and also encompasses the meanings of "greater than A and less than B," "greater than A and B or less," and "greater than A and less than B."

[0026] <Semaphorin 3A> In this specification, "semaphorin 3A" is also referred to as collapsin 1, semaphorin III, and Sema3A. However, this term is intended to encompass all synonyms, including naturally occurring semaphorin 3A and its variants. The biological species from which semaphorin 3A is derived is not particularly limited. However, it is preferably the same as the animal species to which the double-stranded RNA or composition disclosed herein is to be delivered. For example, when delivering the double-stranded RNA or composition disclosed herein to human-derived cells, it is preferable to use a base sequence based on the base sequence of human semaphorin 3A as the main sequence. Note that human-derived semaphorin 3A is described as a preferred example. However, the present technology can also be applied to semaphorin 3A derived from biological species, including mammals other than humans and other animal species.

[0027] Semaphorin 3A is known to be involved in neuronal axonal elongation, angiogenesis, immune response, organogenesis, and the like. Overexpression of semaphorin 3A has also been suggested to be associated with retinopathy, retinal vein occlusion (macular edema), Alzheimer's disease, Parkinson's disease, schizophrenia, and cancer. Examples of cancers in which semaphorin 3A expression is involved include pancreatic cancer, urothelial carcinoma, prostate cancer, breast cancer, ovarian cancer, lung cancer, neuroblastoma, tongue cancer, liver cancer, pharyngeal cancer, and gastric cancer. Semaphorin 3A is also involved in the inflammatory responses, migration, and infiltration associated with these diseases. Specifically, increased expression of semaphorin 3A has been suggested in cells associated with the aforementioned diseases. The double-stranded RNA and compositions disclosed herein can act favorably on cells in which increased semaphorin 3A expression is associated with the aforementioned diseases and inhibit their proliferation.

[0028] <Signal Peptide Region> The nucleotide sequence of semaphorin 3A can be obtained from international databases. For example, international databases include NCBI (National Center for Biotechnology Information), ENA (European Nucleotide Archive), DDBJ (DNA Data Bank of Japan), UniPlot, Ensembl, etc. Specifically, the nucleotide sequence of human semaphorin 3A is provided by NCBI under accession number NM_006080.3, etc. Information on the signal peptide region of semaphorin 3A, etc., can also be obtained from the above-mentioned international databases.

[0029] Semaphorin 3A consists of approximately 771 amino acid residues. It is a secreted glycoprotein. From the N-terminus, semaphorin 3A is mainly composed of a signal peptide region, a semaphorin (Sema) domain, a plexin-semaphorin-integrin (PSI) domain, a C-2 immunoglobulin (Ig) domain, and a basic C-terminal domain.

[0030] The amino acid sequence shown in SEQ ID NO: 3 consists of 771 amino acid residues and is the entire amino acid sequence of human semaphorin 3A. The amino acid sequence shown in SEQ ID NO: 4 consists of 21 amino acid residues and represents the amino acid sequence of the signal peptide of human semaphorin 3A. Furthermore, the nucleotide sequence shown in SEQ ID NO: 5 consists of 63 nucleotides and represents the nucleotide sequence of the signal peptide of human semaphorin 3A.

[0031] <Double-Stranded RNA> The double-stranded RNA of the present disclosure is a double-stranded RNA having a first strand and a second strand complementary to the first strand. Hereinafter, the first strand will be referred to as the sense strand and the second strand as the antisense strand, as will be described in detail. The sense strand has a main sequence consisting of 19 to 23 bases, the 5'-terminal base of which is guanine (G) or cytosine (C), and an additional sequence consisting of 2 to 4 bases added to the 3'-terminal side of the main sequence. Furthermore, the main sequence is a portion of a base sequence encoding semaphorin 3A, and includes at least a portion of a base sequence encoding the signal peptide region of semaphorin 3A.

[0032] The main sequence is typically composed of a polynucleotide, which is a polymer of ribonucleotides. In other words, the main sequence is composed of RNA. That is, the base sequence of the main sequence is typically represented by the four letters A (adenine), U (uracil), G (guanine), and C (cytosine), or the four letters a, u, g, and c. However, in the attached sequence listing, uracil may be represented by T (thymine).

[0033] The main sequence of the sense strand may be, for example, a base sequence including a portion of the base sequence encoding the signal peptide region of semaphorin 3A. This allows the double-stranded RNA to function as an siRNA (small interfering RNA) targeting semaphorin 3A. Furthermore, because the base sequence of the signal peptide region of semaphorin 3A is located upstream of the mRNA, the double-stranded RNA may be able to effectively suppress the expression of semaphorin 3A when functioning as an siRNA.

[0034] The double-stranded RNA disclosed herein can at least function as an siRNA. That is, such double-stranded RNA is predicted to induce RNA interference (RNAi). RNAi is a gene silencing process in which short double-stranded RNAs such as siRNAs suppress gene expression in a sequence-specific manner. When siRNAs are introduced into cells, they form a complex called RISC (RNA-induced silencing complex) with intracellular proteins. RISC binds to homologous sequences in mRNA transcribed from the target gene (here, the semaphorin 3A gene) and specifically cleaves the mRNA, thereby inhibiting translation.

[0035] The main sequence is preferably selected to include the signal peptide region of semaphorin 3A or a base sequence encoding the signal peptide region of semaphorin 3A, but one or more bases (e.g., two bases) may be substituted with other bases, deleted, and / or added (inserted) within the scope that achieves the effects of the present technology.

[0036] The proportion of the signal peptide region of semaphorin 3A or the base sequence encoding the signal peptide region of semaphorin 3A in the main sequence is not particularly limited and, when the entire main sequence is taken as 100%, it is preferably 5% or more, but may also be 10% or more, 15% or more, 90% or more, or 100% or more.

[0037] The 5' end of the main sequence is preferably guanine or cytosine. Because guanine and cytosine have stronger binding strength with complementary strands than adenine and uracil, the stability of the 5' end of the sense strand (i.e., the 3' end of the antisense strand) is increased. In other words, the stability of the 5' end of the antisense strand is relatively reduced. Although the details of the mechanism are unclear, RISC, an RNAi-related protein, tends to preferentially incorporate the strand with the more energetically unstable 5' end between the sense strand and the antisense strand. Therefore, by having guanine or cytosine at the 5' end of the main sequence, the antisense strand can be more easily incorporated into RISC, thereby more effectively inducing RNAi. This allows the double-stranded RNA to function favorably as siRNA.

[0038] Of the five bases on the 3'-end of the main sequence, adenine and / or uracil preferably account for 60% or more (i.e., 3 or more bases), but may also account for 80% or more (i.e., 4 or more bases), or even 100% (i.e., 5 bases). This makes the 5'-end of the antisense strand less stable than the 3'-end. As a result, the antisense strand is more easily incorporated into RISC, allowing for more effective induction of RNAi.

[0039] The GC content of the entire main sequence (the total proportion of G and C in the entire base sequence constituting the main sequence) is not particularly limited, but may be, for example, 20% to 60% or less, preferably 30% to 50% or less, or may be 30% to 45% or less. The GC content is a parameter related to the binding strength between the antisense strand incorporated into RISC and RNA having the main sequence, the ease of cleavage of RNA, etc. The above GC content allows the RNAi effect to be efficiently exerted.

[0040] The main sequence can be selected from 19 to 23 bases from G or C of the gene encoding semaphorin 3A. For example, the main sequence can be either of the following base sequences: GGAGUAUUACUUACAGCAA (SEQ ID NO: 10); CAGCAAGAGCAAACUAUCA (SEQ ID NO: 11). The base sequences shown in SEQ ID NOs: 10 and 11 are both composed of RNA. Double-stranded RNAs having the base sequences shown in SEQ ID NOs: 10 and 11 as main sequences significantly suppress the proliferation of abnormally proliferating cells even at low concentrations, and can therefore avoid nonspecific inhibition of expression, nonspecific inhibition of cell proliferation, stress on cells, and the like.

[0041] The base sequence shown in SEQ ID NO: 1 is the 37th to 55th bases of the base sequence encoding human semaphorin 3A (i.e., the sequence from the initiation codon to the termination codon). The base sequence shown in SEQ ID NO: 2 is the 49th to 67th bases of the base sequence encoding human semaphorin 3A. The base sequence shown in SEQ ID NO: 1 is the base sequence of a portion of the signal peptide region of human semaphorin 3A. The base sequence shown in SEQ ID NO: 2 is a base sequence including a portion of the signal peptide region of human semaphorin 3A.

[0042] Double-stranded RNAs comprising the main sequences shown in SEQ ID NOs: 1 and 2 can suppress or inhibit the proliferation of at least one type of cell by supplying them to the cell. Typically, by supplying them to tumor cells (e.g., neuroblastoma, etc.), the proliferation of the tumor cells can be suppressed or inhibited. Semaphorin 3A is expressed at low levels in normal cells other than tumor cells, but is overexpressed in tumor cells. Therefore, even if the double-stranded RNA disclosed herein is supplied to normal cells, the amount of semaphorin 3A present in normal cells is relatively small, and therefore the double-stranded RNA is thought to have little effect.

[0043] <Additional Sequence> The sense strand of the double-stranded RNA disclosed herein may have an additional sequence consisting of 2 to 4 bases added to the 5'-end or 3'-end of the main sequence. Preferably, the additional sequence is added to the 3'-end of the main sequence. The addition of an additional sequence can more effectively induce RNAi.

[0044] The additional sequence is composed of a polynucleotide (dimer, trimer, or tetramer). The polynucleotide constituting the additional sequence may be composed of only ribonucleotides, only deoxynucleotides, or both ribonucleotides and deoxynucleotides. That is, the sense strand and the antisense strand may be entirely RNA, or may be chimeric polynucleotides of RNA and DNA. The additional sequence may also contain modified deoxyribonucleotides, modified ribonucleotides, other known nucleotide analogs, and the like.

[0045] The base sequence constituting the additional sequence is not particularly limited, but preferably contains at least one base of adenine, uracil, or thymine. From the viewpoint of improving the stability of the double-stranded RNA, the base sequence constituting the additional sequence is more preferably TT (thymine-thymine).

[0046] <Sense strand and antisense strand> The sense strand is composed of a base sequence of, for example, 21 to 27 bases, and may be composed of 21 to 25 bases, or 21 to 23 bases. In a preferred example, the sense strand is composed of 21 to 23 bases, consisting of a main sequence of 19 to 21 bases and an additional sequence of 2 bases. In such an example, RNAi can be effectively induced.

[0047] The antisense strand has a base sequence complementary to the main sequence of the sense strand. This allows the antisense strand to hybridize with the sense strand, forming a double-stranded structure. The base sequence of the antisense strand may also be partially complementary to the main sequence of the sense strand. That is, one or more bases (e.g., two bases) of the antisense strand may be substituted, deleted, and / or added (inserted) with other bases. As long as the sense strand and the antisense strand can hybridize at least under physiological conditions, they can function as siRNA. The complementary base sequence is typically composed of a ribonucleotide polymer (RNA).

[0048] In the double-stranded RNA of the present disclosure, the sense strand or antisense strand is typically composed of chemically unmodified ribonucleotides (RNA). However, the double-stranded RNA of the present disclosure may also contain DNA, chemically modified DNA or RNA, other known nucleotide analogs, etc., to the extent that the technology of the present disclosure is not significantly impaired. That is, one or more bases (e.g., two bases) in the sense strand or antisense strand may be substituted with chemically modified RNA (or DNA) such as methylated or pseudouridylated. Examples of chemically modified RNA include pseudouridine, N1-methylpseudouridine, 5-methylcytosine, or inosine. For example, one or more bases (e.g., two bases) of uridine in the double-stranded RNA of the present disclosure can be substituted with pseudouridine.

[0049] In the double-stranded RNA of the present disclosure, the antisense strand may have a main sequence complementary to the sense strand and an additional sequence consisting of 2 to 4 bases added to the 5'-end or 3'-end of the complementary main sequence. From the viewpoint of improving the function of the siRNA, the additional sequence may be added to the 3'-end of the complementary base sequence. In a preferred example, when the additional sequence of the sense strand is added to the 3'-end of the main sequence, the additional sequence of the antisense strand is added to the 3'-end of the complementary base sequence. The configuration of the additional sequence in the antisense strand may be the same as the configuration of the additional sequence in the sense strand described above. Typically, the base sequence of the additional sequence in the antisense strand is the same as the additional sequence in the sense strand to which it hybridizes, but it may also be a different base sequence.

[0050] The antisense strand is composed of, for example, a base sequence of 21 to 27 bases, and may be composed of 21 to 25 bases, or 21 to 23 bases. The antisense strand is composed of a base sequence of the same length as the sense strand, and all or part of the base sequence excluding the additional sequence is composed of a base sequence complementary to the main sequence of the sense strand. In a preferred example, the antisense strand is composed of a base sequence of the same length as the sense strand, and all of the base sequence excluding the additional sequence is composed of a base sequence complementary to the main sequence of the sense strand.

[0051] <Method for Producing Double-Stranded RNA> The sense strand and antisense strand constituting the double-stranded RNA disclosed herein can be produced according to a general chemical synthesis method. For example, they can be synthesized using a commercially available DNA / RNA automatic synthesizer. Alternatively, the sense strand and antisense strand may be synthesized in vitro or in vivo based on genetic engineering techniques. The synthesized sense strand and antisense strand are preferably purified, and can be purified, for example, by HPLC or the like.

[0052] The double-stranded RNA disclosed herein can be produced, for example, by annealing (hybridizing) a sense strand and an antisense strand. Annealing can be performed according to conventional methods. For example, annealing can be performed by mixing equal amounts of the sense strand and the antisense strand in a solvent, heating at 90°C for 1 to 5 minutes, and then cooling to 4°C to room temperature. Examples of such solvents that can be used include distilled water, pure water, ultrapure water, and buffers (e.g., HEPES-KOH buffer at pH 7.4, PBS, etc.). To prevent active RNase (RNA degrading enzyme) from being mixed into the solvent, solvents that have been treated with, for example, DEPC or autoclaved are preferably used.

[0053] <Other Embodiments of Double-Stranded RNA> The double-stranded RNA disclosed herein also includes those in which the first strand and the second strand form a locally double-stranded structure via a loop structure. That is, the double-stranded RNA can also be used as an shRNA (short hairpin RNA) in another embodiment. shRNA is an RNA in which a main sequence and its complementary sequence exist on a single strand, and a loop sequence exists to form these loop structures. By having the loop structure, the shRNA hybridizes with the main sequence and its complementary sequence to form a locally double-stranded structure. This allows the shRNA to be processed by Dicer, an enzyme present in cells, to form the siRNA of the above-mentioned embodiment.

[0054] The structure of the shRNA may be the same as that of conventionally known shRNA. The length of the shRNA may be, for example, 50 to 70 bases. The length of the loop sequence may be, for example, 19 to 29 bases. The shRNA may be incorporated into a vector (e.g., a lentivirus expression vector). Use of the shRNA can stably induce RNAi in cells and stably suppress viral proliferation.

[0055] <Composition> The composition disclosed herein contains the double-stranded RNA described above. In addition to the double-stranded RNA described above, the composition may contain various pharmaceutically acceptable carriers depending on the intended use. Preferred carriers include those commonly used in medicines as diluents, excipients, etc. The carriers vary depending on the intended use and form of the composition. Typical examples include water, physiological buffer solutions, various organic solvents, etc. The carrier may also be an aqueous solution of an appropriate concentration of alcohol (e.g., ethanol), glycerol, a non-drying oil such as olive oil, or liposomes. Examples of secondary components that may be contained in the pharmaceutical composition include various fillers, extenders, binders, humectants, surfactants, dyes, fragrances, etc. The composition may also contain carriers used in conventional drug delivery systems (DDS).

[0056] The form of the composition disclosed herein is not particularly limited. For example, typical composition forms include solutions, suspensions, emulsions, aerosols, foams, granules, powders, tablets, capsules, and ointments. Furthermore, for use in injections, etc., the composition can be made into a lyophilized product or granulated product that is dissolved in physiological saline or an appropriate buffer solution (e.g., PBS) immediately before use to prepare a medicinal solution. Furthermore, the process of preparing various forms of drugs (compositions) using double-stranded RNA (main component) and various carriers (secondary components) can be based on conventionally known methods. Since such formulation methods do not characterize the present disclosure, detailed explanations are omitted. For example, a detailed source of information regarding formulations is "Comprehensive Medicinal Chemistry," edited by Corwin Hansch, published by Pergamon Press (1990).

[0057] The compositions disclosed herein inhibit the proliferation of at least one type of cell. The cells whose proliferation is inhibited are cells in which expression of semaphorin 3A is involved, such as retinal cells and tumor cells (e.g., pancreatic cancer, urothelial carcinoma, prostate cancer, breast cancer, ovarian cancer, lung cancer, neuroblastoma, tongue cancer, liver cancer, pharyngeal cancer, gastric cancer, etc.). Among these, the compositions disclosed herein preferably inhibit the proliferation of tumor cells because they overexpress semaphorin 3A. In other words, the double-stranded RNA and compositions disclosed herein can be preferably used as antitumor agents (anticancer agents) that suppress tumor cell proliferation.

[0058] One embodiment of the composition disclosed herein includes, in addition to the double-stranded RNA described above, a peptide fragment (cell-penetrating peptide, CPP) that has cell membrane permeability and can pass through the cell membrane from the outside of a cell to introduce a foreign substance into the cytoplasm. The peptide fragment is directly or indirectly linked to the double-stranded RNA of the present disclosure to construct a construct of the peptide fragment and double-stranded RNA. Generally, double-stranded RNA is negatively charged and therefore cannot pass through the cell membrane. However, for example, by directly or indirectly linking the double-stranded RNA disclosed herein to the N-terminus and / or C-terminus of the peptide fragment, the construct of the peptide fragment and the double-stranded RNA can be introduced into the cytoplasm. The number of amino acid residues in the peptide fragment is not limited as long as cell membrane permeability is not impaired.

[0059] When the peptide fragment and the double-stranded RNA are indirectly bound, for example, a linker is placed between the peptide fragment and the double-stranded RNA. The type of linker is not particularly limited. Typically, it is a peptidic linker, a non-peptidic linker, or the like. Furthermore, the method for binding the peptide fragment and the double-stranded RNA is not particularly limited, and can be carried out according to various conventionally known scientific techniques.

[0060] One embodiment of the composition disclosed herein comprises a peptide fragment and the double-stranded RNA of the present disclosure. However, the double-stranded RNA does not necessarily have to be bound to the N- or C-terminus of the peptide fragment. In such an embodiment, the double-stranded RNA and the peptide fragment may form a complex, for example, through electrical or molecular interaction. Such a complex is more easily introduced into eukaryotic cells, thereby enabling efficient introduction of the double-stranded RNA. Nucleic acids such as double-stranded RNA are typically negatively charged. Therefore, the peptide fragment used preferably has a high proportion of basic amino acids and is positively charged. Furthermore, the proportion of the peptide fragment in this case may be 5 to 100 times, preferably 40 to 60 times, the molar ratio of the double-stranded RNA.

[0061] <Method for producing the composition disclosed herein and use thereof> The present disclosure may provide a method for inhibiting the proliferation of at least one type of cell using the composition disclosed herein. The method disclosed herein includes the steps of preparing the composition disclosed herein and supplying the composition to a target cell.

[0062] In the preparation step, for example, as described above, the composition disclosed herein may be prepared by a conventionally known method.

[0063] In the supplying step, the composition disclosed herein is supplied to at least one type of cell (e.g., tumor cells) in vivo or ex vivo. The animal species of the supplied cells is not particularly limited and may be, for example, mammals, birds, amphibians, reptiles, fish, etc. Preferably, the animal species from which semaphorin 3A, which is the basis of the main sequence of the double-stranded RNA contained in the composition, is derived is the same as the animal species of the target cells. The type of target cells is also not particularly limited, but is preferably tumor cells, more preferably neuroblastoma or lung cancer cells. Note that, although cells other than tumor cells may be present at the destination of the composition, the composition may be supplied only to the target cells (i.e., tumor cells).

[0064] The method of administering the composition may be similar to methods conventionally used in animal treatments and is not particularly limited. The composition can be used in vivo in a manner and dosage appropriate for its form and purpose. For example, as a liquid formulation, it can be administered in a desired amount to the affected area (e.g., malignant tumor tissue, virus-infected tissue, inflammatory tissue, etc.) of a patient or animal (i.e., living body) by intravenous, intralymphatic, intramuscular, subcutaneous, intradermal, or intraperitoneal injection. Alternatively, a solid form such as a tablet, or a gel or aqueous jelly such as an ointment, can be administered directly to a specific tissue (e.g., an affected area such as a tissue or organ containing tumor cells, inflammatory cells, etc.). Alternatively, a solid form such as a tablet can be administered orally. For oral administration, encapsulation or application of a protective (coating) material is preferred to prevent degradation by digestive enzymes in the digestive tract.

[0065] The amount of the composition to be supplied in vivo is not particularly limited. For example, the lower limit of the amount of double-stranded RNA per kg of animal may be 0.01 mg or more, 0.05 mg or more, or 0.1 mg or more. The upper limit of the amount of double-stranded RNA per kg of animal may be, for example, 10 mg or less, 5 mg or less, or 1 mg or less. The amount of the composition to be supplied in vitro is not particularly limited. In the culture medium of the subject to be supplied, such as cells, the lower limit of the double-stranded RNA concentration may be, for example, 1 nM or more, 5 nM or more, or 10 nM or more. The upper limit of the double-stranded RNA concentration in such culture medium may be, for example, 10 μM or less, 5 μM or less, 2 μM or less, 1 μM or less, or 100 nM or less.

[0066] The compositions disclosed herein can be delivered to the interior of target cells by known transfection methods. Examples include chemical gene transfer methods using cationic molecules (e.g., commercially available transfection reagents), physical transfer methods such as microinjection and electroporation, and biological gene transfer methods using viruses. Alternatively, as described above, the compositions may be delivered to the interior of cells using cell membrane-permeable peptide fragments.

[0067] Below, several test examples relating to the technology disclosed herein will be described, but it is not intended that the technology disclosed herein be limited to those shown in these test examples.

[0068] <Preparation of siRNA> Polynucleotides having the base sequences shown in SEQ ID NOS: 6 to 9 were artificially synthesized. The base sequences of each polynucleotide are shown in Table 1. In each polynucleotide, the "TT" (additional sequence) at the 3' end is DNA, and the remaining sequence (main sequence) is composed of RNA. The obtained polynucleotides were annealed with a sense strand and an antisense strand having complementary sequences to prepare the siRNAs used in Samples 1 and 2 shown in Table 1. Each of the siRNAs shown in Samples 1 and 2 was dissolved in PBS to give an RNA concentration of 2 mM, preparing an RNA solution.

[0069]

[0070] As shown in Table 1, the sense strand of siRNA in Sample 1 is composed of a main sequence consisting of SEQ ID NO: 1 (a base sequence that is a portion of the base sequence that encodes the signal peptide region of semaphorin 3A) and an additional sequence consisting of TT added to the 3' end of the main sequence. Similarly, the sense strand of siRNA in Sample 2 shown in Table 1 is composed of a main sequence consisting of SEQ ID NO: 2 (a base sequence that includes a portion of the base sequence that encodes the signal peptide region of semaphorin 3A) and an additional sequence consisting of TT added to the 3' end of the main sequence. The antisense strand in each example is composed of a sequence complementary to the main sequence and an additional sequence consisting of TT added to the 3' end of the sequence.

[0071] <Cell proliferation test of human neuroblastoma cells> Human neuroblastoma cells, the SK-N-SH strain, were used as tumor cells. SK-N-SH cells were pre-cultured in a culture medium containing 10% FBS (fetal bovine serum) + E-MEM (Fujifilm Wako Pure Chemical Industries, Ltd., Cat. No. 051-07615) + 1% MEM non-essential amino acid solution (Fujifilm Wako Pure Chemical Industries, Ltd., Cat. No. 139-15651). Note that 0.5% penicillin-streptomycin (Fujifilm Wako Pure Chemical Industries, Ltd., Cat. No. 168-23191) was added to the culture medium only during pre-culture, but was not added during the following culture and evaluation.

[0072] On day 1, the SK-N-SH cells that had adhered to the culture plate were washed with PBS, and then a 0.25% trypsin / EDTA solution was added and incubated at 37°C for 2 minutes. After this incubation, the above-mentioned culture medium was added to inactivate the trypsin. The cells were then precipitated by centrifugation at 150 x g for 5 minutes. After removing the supernatant resulting from centrifugation, the above-mentioned culture medium was added to the precipitate (cell pellet), and approximately 5 x 10 ４ A cell suspension of 5 × 10 cells / mL was prepared. One commercially available 96-well plate was prepared, and the cell suspension was added to each well at a concentration of 5 × 10 ３ The cells were seeded at 100 μL per well and incubated at 37°C, 5% CO ２ and incubated overnight under

[0073] (Sample 1) On the second day, 3 μL of RNA solution adjusted to 2 mM with PBS was mixed with 75 μL of Opti-MEM™ to prepare Solution A. Furthermore, 4.5 μL of Lipofectamine™ RNAiMAX was mixed with 75 μL of Opti-MEM™ to prepare Solution B. Next, equal amounts of Solution A and Solution B were mixed to prepare Solution C, which was then incubated at room temperature for 5 minutes. The prepared Solution C was added to wells where SK-N-SH cells had been cultured, at 11 μL / well (final siRNA concentration: 4 μM). The mixture was then incubated at 37°C, 5% CO ２ The mixture was incubated under reduced pressure for 3 days.

[0074] Cell proliferation was evaluated using Cell Counting Kit-8 (CCK-8, Dojin Kagaku Kenkyusho). On day 5 (day 3 after siRNA addition), the 96-well plate in which SK-N-SH cells had been cultured was removed, 10 μL of CCK-8 was added to each well, and the cells were incubated at 37°C, 5% CO ２ The wells were incubated for 3.0 hours under reduced pressure. The absorbance at 450 nm of each well was measured. The absorbance was calculated as the average of the absorbances of three wells. In addition, a blank well was prepared containing only the culture medium and CCK-8 reagent. The absorbance of Sample 1 minus the absorbance of the blank was used as the measured value for Sample 1.

[0075] (Sample 2) Sample 2 was prepared in the same manner as Sample 1, except that the siRNA in Sample 2 was changed to the siRNA of Sample 2 shown in Table 1.

[0076] Comparative Example In the comparative example, the same procedure was followed as in sample 1, except that a PBS solution was used instead of the RNA solution in sample 1. In other words, no siRNA was introduced in the comparative example.

[0077] Untreated wells were prepared in the same manner as Sample 1, except that the RNA solution and Lipofectamine™ RNAiMAX were not added. The cell viability in each test example is expressed as a percentage, with the measured value for the untreated well set at 100%, and is shown in Figure 1. Figure 1 shows the results of a test using the siRNAs shown in Table 1, i.e., siRNAs whose main sequence is a base sequence (SEQ ID NOs: 1-2) containing a portion of the base sequence encoding the signal peptide region of semaphorin 3A, on neuroblastoma cells.

[0078] As shown in Figure 1, the cell viability of Samples 1 and 2 was reduced, and was significantly lower than that of the comparative example. Based on these test results, it is believed that the siRNAs of Samples 1 and 2 have the function of inhibiting the proliferation of tumor cells (neuroblastoma cells). Furthermore, although not shown in detail, the sequences of Samples 1 and 2 are specific to the semaphorin 3A gene. Therefore, the siRNAs of Samples 1 and 2 can avoid off-target effects, do not affect other organs, and are therefore expected to be suitable for clinical application.

[0079] <Cell proliferation test of human neuroblastoma cells using low-concentration siRNA> The siRNAs used in Samples 1 and 2 shown in Table 1 were prepared. Each of the siRNAs shown in Samples 1 and 2 was dissolved in PBS to a 2 mM RNA concentration to prepare an RNA solution. This was then further diluted 10-fold with PBS to prepare a low-concentration RNA solution with an RNA concentration of 200 μM. A test similar to the cell proliferation test of human neuroblastoma cells was performed, except that the low-concentration RNA solution was used. That is, the final concentration of siRNA added to the wells in which SK-N-SH cells were cultured was adjusted to 0.4 μM. The cell viability in each test example was expressed as a percentage, with the measured value for the untreated wells set at 100%.

[0080] Figure 2 is a graph comparing cell viability when the final concentration of added siRNA was 4.0 μM and 0.4 μM. As shown in Figure 2, the cell viability of Samples 1 and 2 decreased. Furthermore, the cell viability of Samples 1 and 2 was significantly lower than that of the comparative example. This indicates that the siRNA of Samples 1 and 2 had the ability to inhibit tumor cell (neuroblastoma cell) proliferation even at low concentrations. Because the siRNA of Samples 1 and 2 had sufficient tumor cell proliferation inhibitory function even at low concentrations, it can avoid nonspecific expression inhibition and nonspecific cell proliferation inhibition, making clinical applications highly promising. Furthermore, the siRNA of Samples 1 and 2 had the same or better cell inhibition function even at one-tenth the concentration. The above tests were conducted on the same day.

[0081] <Cell proliferation test of A549 strain> Human lung cancer cells, A549 strain, were used as tumor cells. Cell proliferation was evaluated by removing the 96-well plate in which A549 cells had been cultured on day 4 (day 2 after siRNA addition), adding 10 μL of CCK-8 to each well, and then incubating the plate at 37°C and 5% CO ２ The cells were evaluated by incubating them under 5% CO₂ for 2.0 hours. The remaining procedures were the same as in the cell proliferation test for human neuroblastoma cells. The cell viability in each test example is expressed as a percentage of the measured value for the untreated well, which is set at 100%, and is shown in Figure 3.

[0082] As shown in Figure 3, the cell viability of Samples 1 and 2 was significantly reduced compared to the comparative example. This suggests that the siRNAs of Samples 1 and 2 have the function of inhibiting the proliferation of tumor cells (lung cancer cells).

[0083] Although specific examples of the technology disclosed herein have been described in detail above, these are merely examples and do not limit the scope of the claims. The technology described in the claims includes various modifications and alterations of the specific examples exemplified above.

[0084] In the technology disclosed herein, each component and each process described herein may be omitted or combined as appropriate, unless a particular problem arises. This specification also includes the disclosures described in the following sections.

[0085] Item 1: A double-stranded RNA having a first strand and a second strand complementary to the first strand, wherein the first strand has a main sequence consisting of 19 to 23 bases, the 5'-terminal base of which is guanine (G) or cytosine (C), and an additional sequence consisting of 2 to 4 bases added to the 3'-terminal side of the main sequence, wherein the main sequence is a part of a base sequence encoding semaphorin 3A and includes at least a part of a base sequence encoding a signal peptide region of semaphorin 3A.

[0086] Item 2: The double-stranded RNA according to Item 1, wherein the second strand is composed of a main sequence complementary to the first strand and an additional sequence consisting of 2 to 4 bases added to the 3'-end of the complementary main sequence.

[0087] Item 3: The double-stranded RNA according to Item 1 or 2, wherein at least three of the five bases on the 3'-terminal side of the main sequence are adenine (A) and / or uracil (U).

[0088] Item 4: The double-stranded RNA according to any one of Items 1 to 3, wherein the base sequence comprising at least a portion of the base sequence encoding the signal peptide region of semaphorin 3A consists of any one of the following base sequences: GGAGTATTACTTACAGCAA (SEQ ID NO: 1); CAGCAAGAGCAAAACTATCA (SEQ ID NO: 2).

[0089] Item 5: The double-stranded RNA according to any one of Items 1 to 4, wherein the base sequence constituting the additional sequence is thymine-thymine (TT).

[0090] Item 6: A composition that inhibits the proliferation of at least one type of cell, comprising the double-stranded RNA of any one of Items 1 to 5.

[0091] Item 7: The composition of Item 6, wherein the cells are tumor cells.

[0092] Item 8: The composition according to Item 6 or 7, wherein the composition comprises a peptide fragment having cell membrane permeability that can pass through the cell membrane from the outside of the cell and introduce a foreign substance into the cytoplasm.

[0093] Item 9: A method for suppressing the proliferation of at least one type of cell, comprising: preparing the composition according to any one of Items 6 to 8; and supplying the composition to the cell in vitro or in vivo.

[0094] Item 10: The method according to Item 9, wherein the biological species of the cells is the same as the biological species containing the semaphorin 3A.

[0095] As described above, the double-stranded RNA disclosed herein can inhibit (or suppress) cell proliferation, and therefore, by using the double-stranded RNA, a composition (e.g., an anti-tumor agent) that inhibits the proliferation of at least one type of cell (e.g., tumor cell) can be provided.

Claims

1. A double-stranded RNA having a first strand and a second strand complementary to the first strand, wherein the first strand has a main sequence consisting of 19 to 23 bases, the 5'-terminal base of which is guanine (G) or cytosine (C), and an additional sequence consisting of 2 to 4 bases added to the 3'-terminal side of the main sequence, wherein the main sequence is a part of a base sequence encoding semaphorin 3A and includes at least a part of a base sequence encoding a signal peptide region of semaphorin 3A.

2. The double-stranded RNA according to claim 1, wherein the second strand has a main sequence complementary to the first strand and an additional sequence consisting of 2 to 4 bases added to the 3' end of the complementary main sequence.

3. The double-stranded RNA according to claim 1, wherein at least three of the five bases on the 3'-terminal side of the main sequence are adenine (A) and / or uracil (U).

4. The double-stranded RNA according to claim 1, wherein the base sequence comprising at least a portion of the base sequence encoding the signal peptide region of semaphorin 3A consists of either of the following base sequences: GGAGTATTACTTACAGCAA (SEQ ID NO: 1); CAGCAAGAGCAAAACTATCA (SEQ ID NO: 2).

5. The double-stranded RNA according to claim 1, wherein the base sequence constituting the additional sequence is thymine-thymine (TT).

6. A composition for inhibiting the proliferation of at least one type of cell, comprising the double-stranded RNA according to any one of claims 1 to 5.

7. The composition of claim 6, wherein the cells are tumor cells.

8. The composition according to claim 7, comprising a peptide fragment having cell membrane permeability that can pass through the cell membrane from the outside of the cell and introduce a foreign substance into the cytoplasm.

9. A method for inhibiting the proliferation of at least one type of cell, comprising the steps of: providing a composition according to claim 8; and delivering said composition to said cells in vitro.

10. The method according to claim 9, wherein the biological species of the cells is the same as the biological species containing the semaphorin 3A.

Images