Methods and compositions for the analysis of nucleic acids

A PCR-based method using allele-specific primers and LNAs addresses inaccuracies in TR and SNP genotyping, ensuring precise determination of repeat units and allelic variants, enhancing genetic analysis and personalized medicine applications.

WO2025235787A1PCT designated stage Publication Date: 2025-11-13STANDARD BIOTOOLS INC
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/028447
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-05-10
Filing Date
2025-05-08
Publication Date
2025-11-13

AI Technical Summary

Technical Problem

Existing methods for determining tandem repeat (TR) copy numbers in microsatellite regions face challenges such as polymerase slippage, stutter peaks, primer mismatches, and complex repeat structures, leading to inaccurate genotype calls and reproducibility issues, while SNP genotyping is limited by allelic bias and population-specific variability.

Method used

A PCR-based strategy using unlabeled allele-specific oligonucleotide primers, test probes with fluorescent labels and quenchers, and amplification blocking nucleic acids to directly determine TR and SNP units without additional steps, employing Locked Nucleic Acids (LNAs) for precise genotyping.

Benefits of technology

This method provides accurate and reproducible determination of TR and SNP units, overcoming inaccuracies and population-specific variations, enabling precise genetic analysis and personalized medicine.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025028447_13112025_PF_FP_ABST
    Figure US2025028447_13112025_PF_FP_ABST
Patent Text Reader

Abstract

Methods and compositions for analyzing Tandem Repeats and single nucleotide polymorphisms use unlabeled, allele-specific PCR primers, a quenched fluorescent probe, and blocking nucleic acids which prevent amplification of specific numbers of tandem repeat units.
Need to check novelty before this filing date? Find Prior Art

Description

[0001]Attorney Docket No. 4637-0020WO01 METHODS AND COMPOSITIONS FOR THE ANALYSIS OF NUCLEIC ACIDS SPECIFICATION BACKGROUND Tandem repeats (TRs) or simple sequence repeats (SSRs), are stretches of DNA consisting of short sequences (typically 1-6 base pairs) repeated in tandem. For instance, a microsatellite might contain a sequence like "AGAT" repeated several times in a row. These regions are highly polymorphic, meaning the number of repeats can vary greatly among individuals within a population. This variability makes them valuable for genetic analysis, including paternity testing, forensic identification, and studies of population genetics. Fragment analysis to determine tandem repeat copy numbers is usually performed by PCR amplification of the target followed by electrophoresis (gel or capillary) to resolve the PCR products. The workflow is long and requires a lot of hands-on steps. Disclosed herein is a PCR-based strategy for the determination of the repeat sizes directly without any additional steps. Determining the copy numbers of TR involves PCR (polymerase chain reaction) amplification followed by fragment analysis. In PCR amplification, a small segment of DNA containing the microsatellite region is targeted using PCR. Primers specific to sequences flanking the repeat region are used to amplify the DNA. In fragment analysis the PCR products are then analyzed using techniques such as gel electrophoresis or capillary electrophoresis. In fragment analysis, the amplified DNA fragments are separated based on size. Because the number of repeats affects the size of the PCR product, individuals with different numbers of repeats will produce fragments of different lengths. The lengths of the fragments are measured, and the number of repeats in each allele is inferred based on these lengths. Each unique combination of repeat numbers at a particular microsatellite locus is referred to as an allele. The data collected from fragment analysis are typically represented as a histogram or electropherogram, with peaks corresponding to different alleles. By comparing the sizes of the peaks to a known standard or reference, the number of repeats in each allele can be determined. The copy numbers of TR repeats are often reported as the number of repeat units for each allele. Statistical methods may be used to analyze the distribution of repeat numbers in a population and infer relationships or identify individuals. While microsatellite regions are valuable for genetic analysis due to their polymorphic nature, there are several challenges associated with accurately determining the copy numbers of Attorney Docket No. 4637-0020WO01 TRs. For example, during PCR amplification, polymerase enzymes may slip or stutter, leading to the incorporation of additional repeat units or the deletion of repeat units. This phenomenon can result in the generation of PCR products with slightly different lengths than the original template. Stutter peaks can complicate the interpretation of fragment analysis data, particularly when determining the true number of repeats. PCR amplification may fail to amplify one allele present in a sample due to factors such as primer mismatches, secondary structures in the DNA, or low DNA quality / quantity. This can result in an underestimation of the true number of repeats for that allele, leading to inaccurate genotype calls. PCR artifacts, such as non-specific amplification or preferential amplification of certain alleles, can occur and distort the results of fragment analysis. These artifacts may lead to incorrect allele calls or difficulty in distinguishing true alleles from background noise. Variability in PCR conditions, fragment analysis techniques, and instrumentation can introduce technical variability into the analysis, affecting the accuracy and reproducibility of repeat number determination. Some microsatellite regions may have complex repeat structures, such as compound repeats or interrupted repeats, which can complicate PCR amplification and fragment analysis. Analyzing such regions may require specialized techniques or software algorithms capable of handling complex repeat structures. The frequency distribution of TR alleles can vary among different populations due to factors such as genetic drift, migration, and natural selection. Population-specific variability must be taken into account when interpreting TR data and making inferences about relationships or population structure. Addressing these challenges often involves a combination of experimental optimization, data validation, and statistical analysis techniques to ensure accurate determination of TR repeat copy numbers in microsatellite regions. The methods and compositions as disclosed herein are a significant advancement over the prior art methods of fragment analysis of microsatellite regions to determine the number of repeat units. Disclosed herein are methods and compositions for a direct PCR-based strategy for the determination of the number of repeat units in a microsatellite region directly without any additional steps. Genotyping based on single nucleotide polymorphisms (SNPs) is important because SNPs are often associated with certain diseases or conditions. By genotyping individuals, researchers can identify which SNPs they carry and determine if any are linked to diseases. This helps in understanding genetic predispositions to diseases like cancer, diabetes, and heart disease. Different individuals respond differently to medications due to genetic variations, and genotyping Attorney Docket No. 4637-0020WO01 allows personalization of treatment plans based on a patient's genetic makeup, leading to more effective and safer drug therapies. Studying SNPs across populations helps in understanding human evolutionary history, migration patterns, and genetic diversity. This information is valuable for various fields, including anthropology, evolutionary biology, and forensics. SNPs are used in forensic DNA analysis to identify individuals or determine familial relationships. Since SNPs are abundant in the genome and vary between individuals, they provide a powerful tool for forensic investigations. Genotyping of SNPs is extensively used in breeding programs to select for desired traits in plants and animals. This helps in developing new varieties with improved yield, disease resistance, and other desirable characteristics. SNPs serve as genetic markers for mapping genes and identifying regions associated with specific traits or diseases. This aids in understanding the genetic basis of various traits and diseases, paving the way for targeted research and interventions. While genotyping using SNPs has revolutionized genetic research and applications, there are still challenges associated with this approach. SNP arrays used for genotyping typically cover only a fraction of the total SNP variation in the human genome. This limited coverage may miss important genetic variants that could be relevant for certain traits or diseases. SNP arrays may have allelic bias, meaning they are more sensitive to detecting certain alleles over others. This can lead to inaccuracies in genotyping and potentially bias results. SNP arrays are designed to capture common genetic variants, but they may miss rare variants that could have significant effects on disease susceptibility or treatment response. Identifying and genotyping rare variants require more advanced sequencing techniques, which may be costly and time-consuming. Some SNPs associated with diseases or traits may be specific to certain populations or ethnic groups. SNP arrays designed based on one population may not accurately capture genetic variation in other populations, leading to limited generalizability of findings. SNPs in close proximity on a chromosome tend to be inherited together due to linkage disequilibrium (LD). While LD can be useful for genetic mapping studies, it can also complicate interpretation of genotyping data, especially when trying to pinpoint causal variants. Analyzing SNP genotyping data requires sophisticated bioinformatics tools and algorithms. Handling large datasets, correcting for population stratification, and accounting for multiple testing are some of the challenges in analyzing SNP data accurately. Attorney Docket No. 4637-0020WO01 The methods and compositions as disclosed herein are a significant advancement over the prior art methods of the genotyping of difficult SNP loci. For example, typical TaqMan genotyping arrays contain two primers and two allele-specific probes for the detection and discrimination of SNPs (single nucleotide polymorphisms). The probes are usually longer than the primers and have higher melting temperatures (Tms). Although the PCR-based TaqMan genotyping is considered gold standard and is very easy to perform on different PCR instruments, there are situations where the standard TaqMan assays are difficult or impossible to design. One of these situations is when two SNPs are too close to each other (a few bases apart), making genotyping of either one very challenging. These challenges are overcome by the significant advancement of the methods and compositions comprising LNA probes for SNPs that are impossible to study using standard TaqMan assays. All references cited herein are incorporated herein by reference in their entireties. BRIEF SUMMARY The disclosure provides a method of determining the number of repeat units of tandem repeats (TRs) of a target nucleic acid, the method comprising: a. providing a sample comprising a target nucleic acid to be characterized for the number of repeat units of TRs; b. providing a polymerase chain reaction (PCR) reaction mixture comprising: i. a pair of unlabeled allele specific oligonucleotide PCR primers or PCR primers; ii. at least one test probe, wherein the test probe comprises a sequence complementary to a sense or anti-sense strand with a known number of repeat units of TR, wherein the test probe comprises a 5'- fluorescent dye label and 3'- quencher capable of quenching the fluorescence of the 5' fluorescent label; iii. a plurality of amplification blocking nucleic acids, each comprising a sequence complementary to the sense or anti-sense strand and comprising a known number of repeat units of TR which differs from the number of repeat units of TR of the test probe, each amplification blocking nucleic acid comprising a 3'-amino modifier which blocks amplification; iv. an amplification buffer, at least one nucleic acid polymerase, and a mixture of nucleotides; c. adding the target nucleic acid to the PCR reaction mixture; d. performing a PCR amplification in the PCR reaction mixture to amplify the target nucleic acid in the sample, e. measuring the amplification products of the target nucleic acid by monitoring the fluorescence of the 5'- fluorescent dye label, wherein amplification of the target nucleic acid is inhibited by the amplification blocking nucleic acids if the target nucleic acid comprises a number of repeat units of TR different than the number of repeat units of TR in Attorney Docket No. 4637-0020WO01 the test probe, but amplification of the target nucleic acid is not inhibited if the target nucleic acid comprises a number of repeat units of TR corresponding to the number of repeat units of TR of the test probe, wherein amplification of the target nucleic acid indicates that the target nucleic acid has a number of repeat units of TR corresponding to the known number of repeat units of TR in the test probe. The disclosure provides a method of determining the number of repeat units of tandem repeats (TRs) of a target nucleic acid wherein the TR has a motif unit length selected from the group consisting of homopolymers (1 base pair (bp) motifs), short tandem repeats (STRs; 2– 6-bp motifs), and variable number tandem repeats (VNTRs; >6-bp motifs). The disclosure provides a method of determining the number of repeat units of tandem repeats (TRs) of a target nucleic acid wherein the test probe comprises 2 repeat units and the amplification blocking nucleic acids comprise 3- and 4-repeat units. The disclosure provides a method of determining the number of repeat units of tandem repeats (TRs) of a target nucleic acid wherein the test probe comprises 3 repeat units and the amplification blocking nucleic acids comprise 2- and 4-repeat units. The disclosure provides a method of determining the number of repeat units of tandem repeats (TRs) of a target nucleic acid wherein the test probe comprises 4 repeat units and the amplification blocking nucleic acids comprise 2-, 3-, and 5-repeat units. The disclosure provides a method of determining the number of repeat units of tandem repeats (TRs) of a target nucleic acid wherein the test probe comprises 5 repeat units and the amplification blocking nucleic acids comprise 6-, 7-, and 8-repeat units. The disclosure provides a method of determining the number of repeat units of tandem repeats (TRs) of a target nucleic acid wherein the test probe comprises 6 repeat units and the amplification blocking nucleic acids comprise 5-, 7-, and 8-repeat units. The disclosure provides a method of determining the number of repeat units of tandem repeats (TRs) of a target nucleic acid wherein the test probe comprises 7 repeat units and the amplification blocking nucleic acids comprise 5-, 6-, and 8-repeat units. The disclosure provides a method of determining the number of repeat units of tandem repeats (TRs) of a target nucleic acid wherein the test probe comprises 8 repeat units and the amplification blocking nucleic acids comprise 5-, 7-, and 9-repeat units. The disclosure provides a method of determining the number of repeat units of tandem repeats (TRs) of a target nucleic acid wherein the 3'-amino modifier of the amplification blocking nucleic acids is selected from the group consisting of a Peptide Nucleic Acid (PNA), Locked Nucleic Acid (LNA), Zip Nucleic Acid (ZNA), a Bridged Nucleic Acid (BNA), a nucleotide analogue, and combinations thereof. The disclosure provides a method of determining the number Attorney Docket No. 4637-0020WO01 of repeat units of tandem repeats (TRs) of a target nucleic acid wherein the 5' fluorescent dye label are selected from the group consisting of ALEX-350, FAM, VIC, TET, CAL Fluor Gold 540, JOE, HEX, CAL Fluor Orange 560, TAMRA, CAL Fluor Red 590, ROX, CAL Fluor Red 610, TEXAS RED, CAL Fluor Red 635, Quasar 670, CY3, CY5, CY5.5, Quasar 705, and Yakima Yellow. The disclosure provides a method of determining the number of repeat units of tandem repeats (TRs) of a target nucleic acid wherein the 3' quencher group is selected from the group consisting of DABCYL, BHQ, BHQ-1, BHQ-2, ECLIPSE, TAMRA, and Iowa Black® FQ. The disclosure provides a method of determining the number of repeat units of tandem repeats (TRs) of a target nucleic acid wherein the test probe comprises a sequence complementary to a sense strand of the rs746071566 genetic locus in the NUDT15 gene and comprises 2 repeats of the GAGTCG repeat, and the amplification blocking nucleic acids comprise 3 or 4 GAGTCG repeats. The disclosure provides a method of determining the number of repeat units of tandem repeats (TRs) of a target nucleic acid wherein the test probe comprises a sequence complementary to a sense strand of the rs746071566 genetic locus in the NUDT15 gene and comprises 3 repeats of the GAGTCG repeat, and the amplification blocking nucleic acids comprise 2 or 4 GAGTCG repeats. The disclosure provides a method of determining the number of repeat units of tandem repeats (TRs) of a target nucleic acid wherein the test probe comprises a sequence complementary to a sense strand of the rs746071566 genetic locus in the NUDT15 gene and comprises 4 repeats of the GAGTCG repeat, and the amplification blocking nucleic acids comprise 2 or 3 GAGTCG repeats. The disclosure provides a method of determining the number of repeat units of tandem repeats (TRs) of a target nucleic acid wherein the test probe comprises a sequence complementary to a sense strand of the UGT1A1 and comprises 5 AT repeats, and the amplification blocking nucleic acids comprise 6, 7, or 8 AT repeats. The disclosure provides a method of determining the number of repeat units of tandem repeats (TRs) of a target nucleic acid wherein the test probe comprises a sequence complementary to a sense strand of the UGT1A1 and comprises 6 AT repeats, and the amplification blocking nucleic acids comprise 5, 7, or 8 AT repeats. The disclosure provides a method of determining the number of repeat units of tandem repeats (TRs) of a target nucleic acid wherein the test probe comprises a sequence complementary to a sense strand of the UGT1A1 and comprises 7 AT repeats, and the amplification blocking nucleic acids comprise 5, 6, or 8 AT repeats. The disclosure provides a method of determining the number of repeat units of tandem repeats (TRs) of a target nucleic acid wherein the test probe comprises a Attorney Docket No. 4637-0020WO01 sequence complementary to a sense strand of the UGT1A1 and comprises 8 AT repeats, and the amplification blocking nucleic acids comprise 5, 6, or 7 AT repeats. The disclosure provides a method of determining the number of repeat units of tandem repeats (TRs) of a target nucleic acid wherein the test probe comprises a sequence complementary to a sense strand of CYP2D6 and comprises 6 repeats, and the amplification blocking nucleic acids comprise 7 or 8 repeats. The disclosure provides a method of determining the number of repeat units of tandem repeats (TRs) of a target nucleic acid wherein the test probe comprises a sequence complementary to a sense strand of CYP2D6 and comprises 7 repeats, and the amplification blocking nucleic acids comprise 6 or 8 repeats. The disclosure provides a method of determining the number of repeat units of tandem repeats (TRs) of a target nucleic acid wherein the test probe comprises a sequence complementary to a sense strand of CYP2D6 and comprises 8 repeats, and the amplification blocking nucleic acids comprise 6 or 7 repeats. The disclosure provides a method of determining the number of repeat units of tandem repeats (TRs) of a target nucleic acid wherein the test probe comprises a sequence complementary to a sense strand of CYP3A4 and comprises 4 repeats, and the amplification blocking nucleic acids comprise 5 or 6 repeats. The disclosure provides a method of determining the number of repeat units of tandem repeats (TRs) of a target nucleic acid wherein the test probe comprises a sequence complementary to a sense strand of CYP3A4 and comprises 5 repeats, and the amplification blocking nucleic acids comprise 4 or 6 repeats. The disclosure provides a method of determining the number of repeat units of tandem repeats (TRs) of a target nucleic acid wherein the test probe comprises a sequence complementary to a sense strand of CYP3A4 and comprises 6 repeats, and the amplification blocking nucleic acids comprise 4 or 5 repeats. The disclosure provides a method of determining SNP allelic variants that are close together in a target nucleic acid, the method comprising: a. providing a sample comprising a target nucleic acid to be characterized for the presence of SNP allelic variants; b. providing a first polymerase chain reaction (PCR) reaction mixture comprising: i. a pair of unlabeled allele specific oligonucleotide PCR primers; ii. a first test probe, wherein the first test probe comprises a sequence complementary to a sense strand with a first SNP allelic variant, wherein the first test probe comprises at least one Locked Nucleic Acid (LNA), further wherein the first test probe comprises a first 5'- fluorescent dye label, as well as a 3'-quencher capable of quenching the fluorescence of the first 5' fluorescent label, further wherein the length of the first test probe is Attorney Docket No. 4637-0020WO01 selected from the group consisting of 6, 7, 8, and 9 nucleotides; iii. at least one additional test probe, wherein the at least one additional test probe comprises a sequence complementary to a sense strand with an SNP allelic variant different than the first SNP allelic variant, but located close to the first allelic variant, wherein the at least one additional test probe comprises at least one Locked Nucleic Acid (LNA), further wherein the at least one additional test probe comprises a unique 5'- fluorescent dye label which is different that the first 5'-fluorescent dye label, as well as a 3'-quencher capable of quenching the fluorescence of the 5' fluorescent label, further wherein the length of the at least one additional test probe is selected from the group consisting of 6, 7, 8, and 9 nucleotides; iv. an amplification buffer, at least one nucleic acid polymerase, and a mixture of nucleotides; c. adding the target nucleic acid to the PCR reaction mixture; d. amplifying the target nucleic acid with a nucleic acid polymerase to provide amplification products, e. measuring the amplification products of the target nucleic acid by monitoring the fluorescence of the 5'- fluorescent dye labels, wherein detection of the first 5'- fluorescent dye label indicates the presence of the first SNP allelic variant, and detection of the second 5'- fluorescent dye label indicates the presence of the second SNP allelic variant in the target nucleic acid. The disclosure provides a method of determining SNP allelic variants that are close together in a target nucleic acid wherein the first and second allelic variants are less than 7 nucleotides apart. The disclosure provides a method of determining SNP allelic variants that are close together in a target nucleic acid wherein the length of the first test probe is 7 nt. The disclosure provides a method of determining SNP allelic variants that are close together in a target nucleic acid wherein the length of the at least one additional test probe is 7 nt. The disclosure provides a method of determining SNP allelic variants that are close together in a target nucleic acid wherein the allele-specific first test probe comprises more than one LNA. The disclosure provides a method of determining SNP allelic variants that are close together in a target nucleic acid wherein the allele-specific first test probe nucleotides are all LNAs. The disclosure provides a method of determining SNP allelic variants that are close together in a target nucleic acid wherein the allele-specific additional test probe comprises more than one LNA. The disclosure provides a method of determining SNP allelic variants that are close together in a target nucleic acid wherein the allele-specific additional test probe nucleotides are all LNAs. The disclosure provides a method of determining SNP allelic variants that are close together in a target nucleic acid wherein the allele-specific first test probe is complementary to an SNP allele selected from the group consisting of rs61736512 and Attorney Docket No. 4637-0020WO01 rs1058164. The disclosure provides a method of determining SNP allelic variants that are close together in a target nucleic acid wherein the allele-specific additional test probe is complementary to an SNP allele selected from the group consisting of rs61736512 and rs1058164. The disclosure provides a method of determining SNP allelic variants that are close together in a target nucleic acid wherein the 5' fluorescent dye label is selected from the group consisting of ALEX-350, FAM, VIC, TET, CAL Fluor Gold 540, JOE, HEX, CAL Fluor Orange 560, TAMRA, CAL Fluor Red 590, ROX, CAL Fluor Red 610, TEXAS RED, CAL Fluor Red 635, Quasar 670, CY3, CY5, CY5.5, Quasar 705, and Yakima Yellow. The disclosure provides a method of determining SNP allelic variants that are close together in a target nucleic acid wherein the 3' quencher group is selected from the group consisting of DABCYL, BHQ, BHQ-1, BHQ-2, ECLIPSE, TAMRA, and Iowa Black® FQ. The disclosure provides for the use of the compositions of the disclosure for the production of a composition for detecting and / or preventing and / or treating the indications as set forth herein. BRIEF DESCRIPTION OF SEVERAL VIEWS OF THE DRAWINGS The invention will be described in conjunction with the following drawings in which like reference numerals designate like elements and wherein: Figure 1 is a chart showing the results of a NUDT-2G assay. Figure 2 is a chart showing the results of a NUDT-3G Assay. Figure 3 is a chart showing the results of a NUDT-4G Assay. Figure 4 is a chart showing the results of a UGT1A1-5A Assay. Figure 5 is a chart showing the results of a UGT1A1-6A Assay. Figure 6 is a chart showing the results of a UGT1A1-7A Assay. Figure 7 is a chart showing the results of a UGT1A1-8A assay. Figures 8A to 8G are scatter plots showing underperforming TaqMan™ assays. Figure 9 is a scatter plot showing an rs6173651 assay. Figure 10 is a scatter plot showing an rs1058164 assay. Figure 11 is a chart showing assay and sample maps for CYP2D6 and CYP3A4 assays. Figure 12A is a chart showing the results of a CYP2D6-6G assay, 2000 nM blockers. Figure 12B is a chart showing the results of a CYP2D6-6G assay, 6000 nM blockers. Figure 13A is a chart showing the results of a CYP2D6-7G assay, 2000 nM blockers. Figure 13A is a chart showing the results of a CYP2D6-7G assay, 6000 nM blockers. Attorney Docket No. 4637-0020WO01 Figure 14A is a chart showing the results of a CYP2D6-8G assay, 2000 nM blockers. Figure 14B is a chart showing the results of a CYP2D6-8G assay, 6000 nM blockers. Figure 15A is a chart showing the results of a CYP3A4-4T assay, 2000 nM blockers. Figure 15B is a chart showing the results of a CYP3A4-4T assay, 6000 nM blockers. Figure 16A is a chart showing the results of a CYP3A4-5T assay, 2000 nM blockers. Figure 16B is a chart showing the results of a CYP3A4-5T assay, 6000 nM blockers. Figure 17A is a chart showing the results of a CYP3A4-6T assay, 2000 nM blockers. Figure 17B is a is a chart showing the results of a CYP3A4-6T assay, 6000 nM blockers. DETAILED DESCRIPTION As used herein the term “active pharmaceutical ingredient” (“API”) or “pharmaceutically active agent” is a drug or agent which can be employed as disclosed herein and is intended to be used in the human or animal body in order to heal, to alleviate, to prevent or to diagnose diseases, ailments, physical damage or pathological symptoms; allow the state, the condition or the functions of the body or mental states to be identified; to replace active substances produced by the human or animal body, or body fluids; to defend against, to eliminate or to render innocuous pathogens, parasites or exogenous substances or to influence the state, the condition or the functions of the body or mental states. Drugs in use can be found in reference works such as, for example, the Rote Liste or the Merck Index. Examples which may be mentioned include, for example, tretinoin. As used herein, “pharmaceutically acceptable salts” refer to derivatives of the disclosed compounds wherein the therapeutic compound is modified by making acid or base salts thereof. Examples of pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid salts of the active agent. The pharmaceutically acceptable salts include the conventional non- toxic salts, for example, from non-toxic inorganic or organic acids. For example, such conventional non-toxic salts include those derived from inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfonic, sulfamic, phosphoric, nitric and the like; and the salts prepared from organic acids such as amino acids, acetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, pamoic, maleic, hydroxymaleic, phenylacetic, glutamic, benzoic, salicylic, sulfanilic, 2-acetoxybenzoic, fumaric, toluenesulfonic, methanesulfonic, ethane disulfonic, oxalic, isethionic, and other known to those of ordinary skill in the pharmaceutical sciences. Lists of suitable salts are found in texts such as Remington's Pharmaceutical Sciences, Attorney Docket No. 4637-0020WO01 18th Ed. (Alfonso R. Gennaro, ed.; Mack Publishing Company, Easton, Pa., 1990); Remington: the Science and Practice of Pharmacy 19thEd. (Lippincott, Williams & Wilkins, 1995); Handbook of Pharmaceutical Excipients, 3rdEd. (Arthur H. Kibbe, ed.; Amer. Pharmaceutical Assoc., 1999); the Pharmaceutical Codex: Principles and Practice of Pharmaceutics 12thEd. (Walter Lund ed.; Pharmaceutical Press, London, 1994); The United States Pharmacopeia: The National Formulary (United States Pharmacopeial Convention); and Goodman and Gilman's: the Pharmacological Basis of Therapeutics (Louis S. Goodman and Lee E. Limbird, eds.; McGraw Hill, 1992), the disclosures of which are hereby incorporated by reference. An amount is "effective" as used herein, when the amount provides an effect in the subject. As used herein, the term "effective amount" means an amount of a compound or composition sufficient to significantly induce a positive benefit, including independently or in combinations the benefits disclosed herein, but low enough to avoid serious side effects, i.e., to provide a reasonable benefit to risk ratio, within the scope of sound judgment of the skilled artisan. For those skilled in the art, the effective amount, as well as dosage and frequency of administration, may be determined according to their knowledge and standard methodology of merely routine experimentation based on the present disclosure. As used herein, the terms "subject" and "patient" are used interchangeably. As used herein, the term "patient" refers to an animal, preferably a mammal such as a non-primate (e.g., cows, pigs, horses, cats, dogs, rats etc.) and a primate (e.g., monkey and human), and most preferably a human. In some embodiments, the subject is a non-human animal such as a farm animal (e.g., a horse, pig, or cow) or a pet (e.g., a dog or cat). In a specific embodiment, the subject is an elderly human. In another embodiment, the subject is a human adult. In another embodiment, the subject is a human child. In yet another embodiment, the subject is a human infant. The patient or subject to be medicated according to the compositions and methods as disclosed herein may be any animal or human. In certain embodiments, animals may include vertebrates. The terms vertebrate or animals in this context is understood to comprise, for example fish, amphibians, reptiles, birds, and mammals including humans. One preferred group of vertebrates or animals according to the invention comprises warm-blooded animals including farm animals, such as cattle, horses, pigs, sheep and goats, poultry such as chickens, turkeys, guinea fowls and geese, fur-bearing animals such as mink, foxes, chinchillas, rabbits and the like, as well as companion animals such as ferrets, guinea pigs, rats, hamster, cats and dogs. A further group of preferred vertebrates or animals Attorney Docket No. 4637-0020WO01 according to the disclosure comprises fish including salmonids, for example salmon, trout or whitefish. The subject is preferably mammalian. In some embodiments the subject is a human. In other embodiments the subject is an animal, more preferably a non-human mammal. The non- human mammal may be a domestic pet, or animal kept for commercial purposes, e.g., a racehorse, or farming livestock or animals such as pigs, sheep or cattle. As such the disclosure may have veterinary applications. Non-human mammals include rabbits, guinea pigs, rats, mice or other rodents (including any animal in the order Rodentia), cats, dogs, pigs, sheep, goats, cattle (including cows or any animal in the order Bos), horse (including any animal in the order Equidae), donkey, and non-human primates. The subject may be male or female. The subject may be an adult or a child. The subject may be a patient. As used herein, the phrase "pharmaceutically acceptable" means approved by a regulatory agency of the federal or a state government, or listed in the U.S. Pharmacopeia, European Pharmacopeia, or other generally recognized pharmacopeia for use in animals, and more particularly, in humans. As used herein, the terms "prevent," "preventing" and "prevention" in the context of the administration of a therapy to a subject refer to the prevention or inhibition of the recurrence, onset, and / or development of a disease or condition, or a combination of therapies (e.g., a combination of prophylactic or therapeutic agents). As used herein, the terms "therapies" and "therapy" can refer to any method(s), composition(s), and / or agent(s) that can be used in the prevention, treatment and / or management of a disease or condition, or one or more symptoms thereof. As used herein, the terms "treat," "treatment," and "treating" in the context of the administration of a therapy to a subject refer to the reduction or inhibition of the progression and / or duration of a disease or condition, the reduction or amelioration of the severity of a disease or condition, and / or the amelioration of one or more symptoms thereof resulting from the administration of one or more therapies. "Polymerase Chain Reaction (PCR) assays" refer to a technique used in molecular biology and genetics to amplify a specific segment of DNA or RNA targets in a reaction. "Multiplex polymerase chain reaction (PCR) assays" refer to a technique used in molecular biology and genetics to amplify multiple DNA or RNA targets simultaneously in a single reaction. Attorney Docket No. 4637-0020WO01 The term “nucleic acid” encompasses multi-stranded, as well as single-stranded molecules. In double- or triple-stranded nucleic acids, the nucleic acid strands need not be coextensive (i.e., a double-stranded nucleic acid need not be double-stranded along the entire length of both strands). Nucleic acid templates described herein may be any size depending on the sample (from small cell-free DNA fragments to entire genomes), including but not limited to 50-300 bases, 100-2000 bases, 100-750 bases, 170-500 bases, 100-5000 bases, 50-10,000 bases, or 50-2000 bases in length. In some instances, templates are at least 50, 100, 200, 500, 1000, 2000, 5000, 10,000, 20,00050,000, 100,000, 200,000, 500,000, 1,000,000 or more than 1,000,000 bases in length. Methods described herein provide for the amplification of nucleic acid acids, such as nucleic acid templates. Methods described herein additionally provide for the generation of isolated and at least partially purified nucleic acids and libraries of nucleic acids. Nucleic acids include but are not limited to those comprising DNA, RNA, circular RNA, cfDNA (cell free DNA), cfRNA (cell free RNA), siRNA (small interfering RNA), cffDNA (cell free fetal DNA), mRNA, tRNA, rRNA, miRNA (microRNA), synthetic polynucleotides, polynucleotide analogues, any other nucleic acid consistent with the specification, or any combinations thereof. The length of polynucleotides, when provided, are described as the number of bases and abbreviated, such as nt (nucleotides), bp (bases), kb (kilobases), or Gb (gigabases). The phrase “fragment library” refers to a collection of nucleic acid fragments, wherein one or more fragments are used as a sequencing template. A fragment library can be generated in numerous ways that are known in the art. As an example, a fragment library can be generated by cutting, shearing, restricting, or otherwise subdividing a larger nucleic acid into smaller fragments. Fragment libraries can be generated from naturally occurring nucleic acids, such as, for example, from bacteria, cancer cells, normal cells, or solid tissue. Libraries comprising synthetic nucleic acid sequences can also be generated to create a synthetic fragment library. The phrase “synthetic nucleic acid sequence” and variations thereof refers to a designed and synthesized sequence of nucleic acid. For example, a synthetic nucleic acid sequence can be designed to follow rules or guidelines. The term “template” and variations thereof refer to a nucleic acid sequence that is a target of nucleic acid sequencing reactions. A template sequence can comprise a naturally-occurring or synthetic nucleic acid sequence. A template sequence also can include a known or unknown nucleic acid sequence from a sample of interest. In various exemplary embodiments herein, a Attorney Docket No. 4637-0020WO01 template sequence can be attached to a solid support, such as, for example, a bead, microparticle, flow cell, or any other surface or object. As used herein, the term "about" when used in conjunction with a stated numerical value or range has the meaning reasonably ascribed to it by a person skilled in the art, i.e., denoting somewhat more or somewhat less than the stated value or range. When a group of substituents is disclosed herein, it is understood that all individual members of those groups and all subgroups and classes that can be formed using the substituents are disclosed separately. When a Markush group or other grouping is used herein, all individual members of the group and all combinations and subcombinations possible of the group are intended to be individually included in the disclosure. As used herein, “and / or” means that one, all, or any combination of items in a list separated by “and / or” are included in the list; for example, “1, 2 and / or 3” is equivalent to “1, 2, 3, 1 and 2, 1 and 3, 2 and 3, or 1, 2, and 3”. Every formulation or combination of components described or exemplified can be used to practice the disclosure, unless otherwise stated. Specific names of materials are intended to be exemplary, as it is known that one of ordinary skill in the art can name the same material differently. It will be appreciated that methods, device elements, starting materials, and synthetic methods other than those specifically exemplified can be employed in the practice as disclosed herein without resort to undue experimentation. All art-known functional equivalents, of any such methods, device elements, starting materials, and synthetic methods are intended to be included in this disclosure. Whenever a range is given in the specification, for example, a temperature range, a time range, or a composition range, all intermediate ranges and subranges, as well as all individual values included in the ranges given are intended to be included in the disclosure. It is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limits of that range is also specifically disclosed. Each smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in that stated range is encompassed. The upper and lower limits of these smaller ranges may independently be included or excluded in the range, and each range where either, neither, or both limits are included in the smaller ranges is also encompassed within the disclosure, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included. Attorney Docket No. 4637-0020WO01 As used herein, “comprising” is synonymous with “including,” “containing,” or “characterized by,” and is inclusive or open-ended and does not exclude additional, unrecited elements or method steps. As used herein, “consisting of” excludes any element, step, or ingredient not specified in the claim element. As used herein, “consisting essentially of” does not exclude materials or steps that do not materially affect the basic and novel characteristics of the claim. Any recitation herein of the term “comprising”, particularly in a description of components of a composition, in a description of a method, or in a description of elements of a device, is understood to encompass those compositions, methods, or devices consisting essentially of and consisting of the recited components or elements, optionally in addition to other components or elements. The disclosure as illustratively described herein suitably may be practiced in the absence of any element, elements, limitation, or limitations which is not specifically disclosed herein. As used herein and in the appended claims, the singular forms “a”, “an”, and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a method” includes a plurality of such methods and reference to “the nanoparticle” includes reference to one or more nanoparticles and equivalents thereof known to those skilled in the art, and so forth. The terms and expressions which have been employed are used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope as disclosed herein claimed. Thus, it should be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features, modification and variation of the concepts herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention as defined by the appended claims. As used herein, an “isolated” biological component, such as a nucleic acid, protein or cell that has been substantially separated or purified away from other biological components in the environment (such as a cell) in which the component naturally occurs, i.e., chromosomal and extra-chromosomal DNA and RNA, proteins and other cells. Nucleic acids and proteins that have been “isolated” include nucleic acids and proteins purified by standard purification methods. The term also embraces nucleic acids and proteins prepared by recombinant expression in a host cell as well as chemically synthesized nucleic acids and proteins. Similarly, an “isolated” cell has been Attorney Docket No. 4637-0020WO01 substantially separated, produced apart from, or purified away from other cells of the organism in which the cell naturally occurs. Isolated cells can be, for example, at least 99%, at least 98%, at least 97%, at least 96%, 95%, at least 94%, at least 93%, at least 92%, or at least 90% pure. As used herein, the term Marker or Label is an agent capable of detection, for example by ELISA, spectrophotometry, flow cytometry, immunohistochemistry, immunofluorescence, microscopy, Northern analysis or Southern analysis. For example, a marker can be attached to a nucleic acid molecule or protein, thereby permitting detection of the nucleic acid molecule or protein. Examples of markers include, but are not limited to, radioactive isotopes, nitorimidazoles, enzyme substrates, co-factors, ligands, chemiluminescent agents, fluorophores, haptens, enzymes, and combinations thereof. Methods for labeling and guidance in the choice of markers appropriate for various purposes are discussed for example in Sambrook et al. (Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, N.Y., 1989) and Ausubel et al. (In Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1998). As used herein, the terms purified or isolated, a term that may not require absolute purity; rather, it is intended as a relative term. Thus, a purified population is greater than about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 100% pure, or, most preferably, essentially free of other constituents. All references throughout this application, for example patent documents, including issued or granted patents or equivalents and patent application publications, and non-patent literature documents or other source material are hereby incorporated by reference herein in their entireties, as though individually incorporated by reference. None is admitted to being prior art. Polymerase Chain Reaction Polymerase Chain Reaction (PCR) is a molecular biology technique used to amplify a specific segment of DNA. PCR with probes and primers involves the use of specialized nucleic acid sequences to target and amplify specific regions of DNA. Primers are short, single-stranded DNA sequences (usually around 18-25 nucleotides long) that are complementary to the sequences flanking the target region of interest. In PCR, two primers are designed, one complementary to each of the DNA strands at the 3' end of the target region. These primers serve as starting points for DNA synthesis by the DNA polymerase enzyme. Probes are single-stranded nucleic acid molecules, typically DNA or RNA, labeled with a detectable marker such as a fluorescent dye or a radioactive tag. Probes are designed to hybridize specifically to the target DNA sequence during Attorney Docket No. 4637-0020WO01 PCR. They can be used for various purposes, such as monitoring the amplification process or detecting specific mutations or variations in the target DNA sequence. PCR generally involves heating the nucleic acid template containing the target region to a high temperature (typically around 94-98°C), causing the DNA strands to separate, or denature, into single strands; the reaction mixture is cooled to a temperature typically ranging from 50- 65°C. During this step, the primers anneal, or bind, to their complementary sequences on the single-stranded DNA template flanking the target region; the reaction temperature is raised to the optimal temperature for the DNA polymerase enzyme (usually around 72°C). The DNA polymerase synthesizes a new DNA strand complementary to each single-stranded template by adding nucleotides to the 3' end of the primers (i.e., elongation). This step extends the primers along the DNA template, resulting in the synthesis of new DNA strands; in some PCR assays, probes are added to the reaction mixture during the annealing step. These probes hybridize specifically to the target DNA sequence between the primers. If the probe contains a fluorescent dye, the fluorescence emitted by the bound probe can be detected and measured, providing real- time monitoring of the amplification process; the denaturation, annealing, and extension steps are repeated for a certain number of cycles (typically 20-40 cycles) to exponentially amplify the target DNA sequence. Each cycle doubles the amount of target nucleic acid, resulting in a significant amplification of the target region. Multiplex Polymerase Chain Reaction (PCR) In multiplex PCR, multiple primer pairs are used in the same reaction, allowing for the simultaneous amplification of multiple target sequences from a single sample. The key components of a multiplex PCR assay include: Primers: short DNA sequences that are designed to anneal to specific regions of the target DNA or RNA sequences. In multiplex PCR, there are multiple pairs of primers, each designed to amplify a different target in a sample containing the DNA or RNA sequences to be amplified. It can be a purified DNA / RNA sample or a complex biological sample like blood, tissue, or other bodily fluids. The multiplex PCR process involves setting up the reaction with multiple primer pairs, each specific to the different target sequences. During the temperature cycling, the reaction goes through repeated cycles of denaturation (heating to separate the DNA strands), annealing (cooling to allow primers to bind to their complementary target sequences), and extension (heating to allow DNA polymerase to extend the Attorney Docket No. 4637-0020WO01 primers and create new DNA strands). As a result, the target DNA sequences are exponentially amplified. Primers PCR Primers are designed using primer design parameters for the proposed applications to target DNA / RNA segments within, for example, a targeted organism (e.g., a specific bacteria, or virus), or neoplasia, that is specific to that organism within the reasonably expected organism that could be identified within that sample (meaning, if a PCR primer equally targets two organisms but one is only ever found in the arctic, it is specific to say a human saliva sample) and are therefore diagnostic in nature. In addition, targeted segments which contain sequence variation within them add further value in sequence variation database development. In one embodiment of any of the compositions, systems, and methods as disclosed herein, amplification primers are, for example, between 4 and 70 nucleotides long. In one embodiment of any of the systems and methods as disclosed herein, the amplification products are between about 50 and about 2000 nucleotides in length. In one embodiment of any of the systems and methods as disclosed herein, the target nucleic acid is DNA (e.g., cDNA, or genomic DNA). In one embodiment of any of the systems and methods as disclosed herein, the target nucleic acid is RNA, such as messenger RNA (mRNA), ribosomal RNA (rRNA), transfer RNA (tRNA), small nuclear RNA (snRNA), microRNA (miRNA), small nucleolar RNA (snoRNA), long non-coding RNA (lncRNA), or catalytic RNA (ribozymes). In one embodiment of any of the systems and methods as disclosed herein, the amplification primers are random primers. Target Nucleic Acids The disclosure provides systems and methods to detect, characterize, and / or quantify nucleic acid targets in a sample. In some embodiments, the target nucleic acid sample can be isolated from any source, or sample, such as solid tissue, tissue, cells, yeast, bacteria, or similar sources of nucleic acid samples. Methods for isolating nucleic acids from these sources are well known in the art. For example, the solid tissue or tissue can be weighed, cut, mashed, homogenized, and the nucleic acid can be isolated from the homogenized samples. In some embodiments, the target nucleic acid sample can be fragmented to prepare target nucleic acid fragments, using any procedure known in the art, including cleaving with and enzyme or chemical, or by shearing. Enzyme cleavage includes any type of restriction endonuclease, endonuclease, or transposase-mediated cleavage. In some embodiments, the biomolecules can be Attorney Docket No. 4637-0020WO01 fragmented using well known methods, including enzymatic or chemical cleavage, or shearing forces. Further provided herein are methods wherein the sample is selected from tissue(s) samples, cells, biological fluid samples, bone marrow samples, semen samples, biopsy samples, cancer samples, tumor samples, cell lysate samples, forensic samples, archaeological samples, paleontological samples, infection samples, production samples, whole plants, plant parts, microbiota samples, viral preparations, soil samples, marine samples, freshwater samples, household or industrial samples, and combinations and isolates thereof. Further provided herein are methods wherein the biological fluids are selected from blood, urine, saliva, lymphatic fluid, cerebrospinal fluid (CSF), amniotic fluid, pleural fluid, pericardial fluid, ascites, and aqueous humor. Single Nucleotide Polymorphism A Single Nucleotide Polymorphism (SNP) is a common type of genetic variation that occurs when a single nucleotide (A, T, C, or G) at a specific position in the genome differs among individuals within a population or species. In simpler terms, it refers to a single-letter difference in the DNA sequence at a particular location in the genome. SNPs are the most abundant type of genetic variation in the human genome, with millions of SNPs identified across the genome. SNPs can be inherited from one generation to the next. They can arise as a result of mutations during DNA replication or through recombination events during meiosis. While many SNPs may not have any discernible effect on an individual's traits or health, some SNPs can influence traits such as susceptibility to diseases, response to medications, or physical characteristics. These SNPs are often located within or near genes and can affect gene expression, protein structure, or function. SNPs are widely used in genetic association studies to identify genetic variants associated with diseases, traits, or responses to treatments. Genome-wide association studies (GWAS) compare the frequency of SNPs between individuals with a particular trait or disease and those without it, allowing researchers to identify SNPs that may be linked to the trait or disease of interest. SNPs are typically genotyped using molecular biology techniques such as PCR followed by sequencing, microarrays, or targeted genotyping assays. These methods allow researchers to determine which nucleotide variant (allele) an individual carries at a specific SNP locus. SNPs can provide insights into population history, migration patterns, and evolutionary relationships among different Attorney Docket No. 4637-0020WO01 populations. By analyzing patterns of SNP variation across populations, researchers can infer population demographics and evolutionary processes. qPCR Quantitative Polymerase Chain Reaction (qPCR), also known as real-time PCR, is a molecular biology technique used to quantify the amount of a specific DNA sequence in a sample. It is highly sensitive and allows for the precise measurement of DNA concentration, making it valuable in various applications such as gene expression analysis, detection of pathogens, and quantification of viral load. Like traditional PCR, qPCR requires specific primers that flank the target DNA sequence. In addition to primers, qPCR often uses a fluorescent probe that binds to the amplified DNA during the reaction. This probe typically contains a fluorescent dye and a quencher molecule. As the probe is cleaved during amplification, the fluorescent signal is released, allowing for real-time monitoring of DNA amplification. The qPCR reaction is set up with the DNA sample containing the target sequence, along with the primers, probe, DNA polymerase, dNTPs, buffer, and fluorescent dye. The reaction is thermally cycled through repeated rounds of denaturation, annealing, and extension, similar to traditional PCR. However, in qPCR, fluorescence is measured at each cycle to monitor the amplification process in real-time. The fluorescence signals generated during amplification are recorded and analyzed using specialized qPCR instruments and software. By comparing the fluorescence signals to a standard curve generated from known concentrations of DNA, the initial amount of target DNA in the sample can be determined quantitatively. qPCR provides precise quantification of DNA concentration, allowing for accurate determination of gene expression levels, viral load, or pathogen abundance. qPCR can detect even low levels of target DNA, making it suitable for applications requiring high sensitivity. The ability to monitor amplification in real-time enables rapid and efficient data collection, reducing the time required for analysis. qPCR can be multiplexed to simultaneously detect and quantify multiple target sequences in a single reaction, increasing throughput and efficiency. Probe-based quantitative PCR (qPCR) uses real-time fluorescence from 5ʹ-3ʹ exonuclease cleavage of a fluorescently-labeled, target-specific probe to measure DNA amplification at each cycle of a PCR. Probe designs vary but the most common type, hydrolysis (e.g., TaqMan®) probes, incorporate a 5’ reporter fluorophore and a 3’ quencher on a short oligonucleotide complementary to the target sequence. Fluorescence resonance energy transfer (FRET) prohibits Attorney Docket No. 4637-0020WO01 emission of the fluorophore while the oligo probe is intact. During each PCR cycle, the 5’ flap endonuclease domain of Taq DNA polymerase hydrolyzes the probe as the primer is extended and the target sequence is amplified. This cleavage event separates the reporter fluorophore from the quencher and results in an amplification-dependent increase in fluorescence. Probe-based qPCR allows multiple targets to be quantified in a single reaction (multiplexing) by using a unique fluorescent dye for each amplicon-specific probe. Some probe designs do not require the 5’ flap endonuclease activity of Taq such as molecular beacons, Scorpions® and dual-hybridization probes. Molecular beacons form a stem- loop structure in the absence of the target sequence, forcing a 5’ fluorophore in close proximity to a 3’ quencher. Upon binding to the target sequence, the fluorophore and quencher become spatially separated, resulting in the fluorescence of the reporter dye. Scorpions are bifunctional molecules that link a stem-loop structure carrying a reporter fluorophore and quencher to a PCR primer. A portion of the stem-loop sequence is designed to hybridize to the newly synthesized strand, downstream of the primer binding site. Extension of the dual-labeled primer by the polymerase creates a copy of the complementary target sequence. In the subsequent PCR cycle, the stem-loop unfolds and binds intramolecularly to the recently synthesized DNA strand, separating the fluorophore from the quencher, resulting in an increase in fluorescence. A blocker between the stem-loop and primer prohibits any further extension of the target-probe complex. Finally, dual-hybridization probes, or LightCycler® type probes, rely on FRET in order to produce, rather than to quench, a detectable fluorescence signal. Two sequence-specific probes containing compatible FRET dyes bind adjacently to the target sequence, downstream of the PCR primers. Excitation of the donor fluorophore, located on the 3’ end of the first probe, causes emission of the acceptor fluorophore, located on the 5’ end of the second probe. Monitoring the emission wavelength of the acceptor dye results in an increased fluorescence signal as the target sequence is amplified. In certain embodiments as disclosed herein, the 5' reporter groups include, for example, a fluorophore, such as ALEX-350, FAM, VIC, TET, CAL Fluor Gold 540, JOE, HEX, CAL Fluor Orange 560, TAMRA, CAL Fluor Red 590, ROX, CAL Fluor Red 610, TEXAS RED, CAL Fluor Red 635, Quasar 670, CY3, CY5, CY5.5, Quasar 705, Yakima Yellow, or combinations thereof. In certain embodiments as disclosed herein, the 3' quencher group is a molecule or group capable Attorney Docket No. 4637-0020WO01 of absorbing / quenching the fluorescence, such as, for example, DABCYL, BHQ (e.g., BHQ-1 or BHQ-2), ECLIPSE, TAMRA, 3' Iowa Black® FQ, or combinations thereof. Genotyping Genotyping (GT) refers to the process of determining the genetic makeup, specifically the variations, present in an individual's genome. It involves identifying specific genetic variants, such as single nucleotide polymorphisms (SNPs), insertions, deletions, or other structural variations, across the genome or within targeted regions. Biological samples containing DNA, such as blood, saliva, or tissue, are collected from individuals. DNA is extracted from the collected samples using various methods to isolate the genetic material. Different techniques can be employed for genotyping, depending on the scale and resolution of analysis required. Some common methods include: Microarray-based genotyping involves hybridizing DNA samples to a microarray chip containing probes specific to known genetic variants. By measuring the intensity of fluorescence signals at each probe position, the genotype of the individual can be determined; PCR-based methods can be used to amplify specific regions of DNA containing the genetic variant of interest. Following amplification, various techniques such as sequencing, restriction fragment length polymorphism (RFLP) analysis, or allele-specific PCR can be used to determine the genotype; NGS technologies allow for the high-throughput sequencing of DNA, enabling the simultaneous detection of multiple genetic variants across the genome. This approach provides comprehensive genotyping data but may be more resource-intensive and expensive than other methods. After genotyping, the resulting data are analyzed to determine the genotype at each variant locus. This may involve comparing the observed sequences or signal intensities to reference sequences or known genotypes. Statistical methods are often employed to assess the accuracy and reliability of genotyping calls. Tandem Repeats Tandem repeats (TRs) are regions of the genome consisting of exact or near-exact repetitions of DNA sequence motifs. Many subtypes of TRs have been defined, including homopolymers (1 base pair (bp) motifs), short tandem repeats (STRs; 2–6-bp motifs) and variable number tandem repeats (VNTRs; >6-bp motifs). Tandem repeat repetitions can vary in length from a few base pairs to thousands of base pairs. Tandem repeats are common in the human genome and can be found in both coding and non-coding regions. They can play a role in genetic Attorney Docket No. 4637-0020WO01 variation, gene regulation, and are also used in DNA fingerprinting and forensic analysis due to their variability among individuals. The number of repeats within a TR can vary between individuals, making them highly polymorphic genetic markers. TRs are widely used in genetics, forensics, and population studies due to their high variability and Mendelian inheritance pattern. They are particularly useful for genetic fingerprinting, paternity testing, studying population genetics, and mapping disease genes. The analysis of the number of repeats at specific TR loci can provide valuable information about an individual's genetic profile. These repeats are essential for maintaining the integrity and stability of chromosomes during cell division. Short tandem repeats can serve as binding sites for proteins involved in DNA replication. They help in initiating the replication process and ensure that the entire chromosome is copied accurately during cell division. During cell division, short tandem repeats can aid in the proper segregation of chromosomes into daughter cells. They help in organizing and stabilizing the chromosome ends, preventing them from fusing together or being degraded. Short tandem repeats can contain specialized sequences that protect the ends of chromosomes from degradation by cellular enzymes. This protection is vital for maintaining chromosome integrity and preventing the loss of genetic information. In many organisms, short terminal repeats form specialized structures called telomeres at the ends of chromosomes. Telomeres help in preventing the loss of genetic material during DNA replication and are essential for the long-term stability of chromosomes. Locked Nucleic Acid (LNA) LNA bases (Locked nucleotides), which are analogues that are modified at 2′-O, 4′-C and form a bridge. This bridge results in restricted base pairing giving room to adjust the Tm as needed between the probes. Thus, +A, +T, +C or +G signify A, T, G or C bases are added on the modified backbone. Locked Nucleic Acid (LNA) is a modified nucleic acid analog in which the ribose ring is constrained in the 3'-endo conformation by a methylene bridge connecting the 2'-oxygen and the 4'-carbon. This bridge "locks" the ribose ring in the ideal North conformation, resulting in increased thermal stability and enhanced hybridization properties when incorporated into oligonucleotides. LNA oligonucleotides exhibit higher melting temperatures (Tm) compared to their unmodified counterparts. This increased stability is attributed to the constrained ribose ring, which strengthens the base stacking interactions and enhances the binding affinity with complementary nucleic acid sequences. LNA oligonucleotides demonstrate improved specificity Attorney Docket No. 4637-0020WO01 and discrimination against mismatched sequences due to their higher binding affinity. This property makes them valuable tools for various molecular biology applications requiring precise and selective hybridization, such as PCR, microarray analysis, and in situ hybridization. LNA modifications confer resistance to nuclease degradation, prolonging the half-life of LNA- containing oligonucleotides in biological environments. This feature enhances their stability and effectiveness in applications involving cellular delivery, gene silencing, and therapeutic targeting. LNA oligonucleotides are widely used in antisense technologies and RNA interference (RNAi) strategies for gene regulation and silencing. Their enhanced hybridization properties and nuclease resistance make them valuable tools for modulating gene expression, studying gene function, and developing therapeutic interventions for various diseases. LNA-based probes and inhibitors are employed in diagnostic assays, biomarker detection, and therapeutic interventions targeting nucleic acid sequences associated with diseases, including cancer, viral infections, and genetic disorders. LNA modifications improve the sensitivity, specificity, and stability of nucleic acid- based diagnostics and therapeutics, enhancing their clinical utility. Sample In one embodiment of the systems and methods as disclosed herein, the sample is selected from tissue(s) samples, cells, biological fluid samples (e.g., blood, urine, saliva, lymphatic fluid, cerebrospinal fluid (CSF), amniotic fluid, pleural fluid, pericardial fluid, ascites, aqueous humor), bone marrow samples, semen samples, biopsy samples, cancer samples, tumor samples, cell lysate samples, forensic samples, archaeological samples, paleontological samples, infection samples, production samples, whole plants, plant parts, microbiota samples, viral preparations, soil samples, marine samples, freshwater samples, household or industrial samples, and combinations and isolates thereof. In one embodiment of the systems and methods as disclosed herein, the sample is a cell (e.g., an animal cell [e.g., a human cell], a plant cell, a fungal cell, a bacterial cell, and a protozoal cell). In one specific embodiment, the cell is lysed prior to the replication. In one specific embodiment, cell lysis is accompanied by proteolysis. In one specific embodiment, the cell is selected from a cell from a preimplantation embryo, a stem cell, a fetal cell, a tumor cell, a suspected cancer cell, a cancer cell, a cell subjected to a gene editing procedure, a cell from a pathogenic organism, a cell obtained from a forensic sample, a cell obtained from an archeological sample, and a cell obtained from a paleontological sample. In one embodiment of any of the systems and methods as disclosed herein, the sample is a cell from a Attorney Docket No. 4637-0020WO01 preimplantation embryo (e.g., a blastomere. In one specific embodiment, the method further comprises determining the presence of disease predisposing germline or somatic variants in the embryo cell. In one embodiment of any of the systems and methods as disclosed herein, the sample is a cell from a pathogenic organism (e.g., a bacterium, a fungus, a protozoan). In one specific embodiment, the pathogenic organism cell is obtained from fluid taken from a patient, microbiota sample (e.g., GI microbiota sample, vaginal microbiota sample, skin microbiota sample, etc.) or an indwelling medical device (e.g., an intravenous catheter, a urethral catheter, a cerebrospinal shunt, a prosthetic valve, an artificial joint, an endotracheal tube, etc.). In one specific embodiment, the method further comprises the step of determining the identity of the pathogenic organism. In one specific embodiment, the method further comprises determining the presence of genetic variants responsible for resistance of the pathogenic organism to a treatment. In one embodiment of any of the systems and methods as disclosed herein, the sample is a tumor cell, a suspected cancer cell, or a cancer cell. In one specific embodiment, the method further comprises determining the presence of one or more diagnostic or prognostic mutations. In one specific embodiment, the method further comprises determining the presence of germline or somatic variants responsible for resistance to a treatment. In one embodiment of any of the systems and methods as disclosed herein, the sample is a cell subjected to a gene editing procedure. In one specific embodiment, the method further comprises determining the presence of unplanned mutations caused by the gene editing process. In one embodiment of any of the systems and methods as disclosed herein, the method further comprises determining the history of a cell lineage. In a related aspect, the invention provides a use of any of the systems and methods as disclosed herein for identifying low frequency sequence variants (e.g., variants which constitute ≥0.01% of the total sequences). Single Nucleotide Polymorphism Scatter Plots SNP scatter plots, or Single Nucleotide Polymorphism scatter plots, are graphical representations used in genetic studies to visualize the relationship between genetic variants across individuals or populations. Single nucleotide polymorphisms (SNPs) are variations in a single nucleotide base within the DNA sequence that occur commonly in the human genome. SNP data from multiple individuals or populations are collected, often through genotyping or sequencing technologies. For each individual, genotypes at different SNP loci are determined. Genotypes are typically represented as categorical variables, such as homozygous for the Attorney Docket No. 4637-0020WO01 reference allele (e.g., AA), heterozygous (e.g., AG), or homozygous for the alternate allele (e.g., GG). In the scatter plot, each data point represents an individual or a population sample. The x- axis usually represents one SNP locus, and the y-axis represents another SNP locus. The genotypes of each individual at these two SNP loci determine the position of the data point on the plot. SNP scatter plots are examined for patterns and clusters. Clustering of data points may indicate linkage disequilibrium (LD), which is the non-random association of alleles at different loci. LD can provide insights into the genetic structure and history of populations. SNP scatter plots may be used to visualize the association between genotypes and phenotype. To enhance interpretation, SNP scatter plots may utilize color or size encoding to represent additional information, such as phenotype, ancestry, or allele frequency. This can help distinguish different groups or highlight specific characteristics of the data. The invention will be illustrated in more detail with reference to the following Examples, but it should be understood that the present invention is not deemed to be limited thereto. EXAMPLES Example 1 Fragment Analysis using PCR Exemplified herein are compositions and methods for fragment analysis by direct PCR. Fragment analysis of tandem repeat regions to determine the repeat copy numbers is usually performed by PCR amplification of the target followed by electrophoresis (gel or capillary) to resolve the PCR products. The workflow is long and requires a lot of hands-on steps. Disclosed herein is a PCR-based strategy for the determination of the repeat sizes directly without any additional steps. For example, rs746071566 is a genetic locus in the NUDT15 gene with 3 possible copy numbers of the GAGTCG repeat (2, 3 and 4). To distinguish between different copy numbers, 3 assays containing probes for each of the 3 copy numbers, respectively, were prepared. In addition to the primers and probes, blockers (oligonucleotides with a 3’ modification that is not extendable by the DNA polymerase in PCR) targeting the other two repeat numbers are also included in the assay. The following is an example of an assay for the 2-repeat assay: Attorney Docket No. 4637-0020WO01 2-repeat assay: 2 primers, 1 probe targeting the 2-repeat alleles, and 2 blockers targeting the 3- and 4-repeat alleles. A qPCR-based fragment analysis method for TR (tandem repeat) markers in two genes: UGT1A1 and NUDT15. Copy numbers can be correctly determined by at least 95% by the method. Method: 2x TaqMan GTXpress Master Mix. Samples: Synthetic ssDNA templates 2G, 3G, 4G, and 5G or 5A, 6A, 7A, and 8A (200 copies / µL in 50 ng / µL salmon sperm DNA). Reaction: 2 primers (900 nM each final) 1 probe (200 nM final) 3 blockers (200 – 2000 nM final) e.g. 2G probe + 3G, 4G, and 5G blockers. Cycling conditions: 95C 2 min Hotstart 95C, 15 sec 60C, 60 sec, 40 cycles NUD15 Sequences UGT1A1 Sequences Attorney Docket No. 4637-0020WO01 for the other non-targeting alleles. Fragment assay example: NUDT-2G (See Figure 1): UGT1A1-5 (See Figure 4): Attorney Docket No. 4637-0020WO01 If a sample has an allele that a fragment assay targets, the signal from the reaction containing this sample and this assay will be much higher than the reactions that don’t contain either that allele or that assay. The genotype of a DNA sample can therefore be determined using the data from all fragment assays. qPCR-based fragment analysis strategy using the combination of probes and blockers can successfully determine repeat numbers in two genes: UGT1A1 and NUDT15. When using these “fragment analysis” assays in the PCR reaction, relatively strong signal is observed only when the sample containing certain number of the repeats and the assay targeting that repeat number are in the same reaction. Example 2 LNA Probes for Genotyping Genotyping using the LNA probes. TaqMan genotyping arrays contain two primers and two allele-specific probes for the detection and discrimination of SNPs (single nucleotide polymorphisms). The probes are usually longer than the primers and have higher melting temperatures (Tms). Although the PCR-based TaqMan genotyping is considered gold standard and is very easy to perform on different PCR instruments, there are situations where the standard TaqMan assays are difficult or impossible to design. One of these situations is when two SNPs are too close to each other (a few bases apart), making genotyping of either one very challenging. For example, there are two SNPs (rs1058164 and rs61736512) highlighted in the sequence below: CACCGGAGTGGTTGGCGAAGGCGGCACAAAGGCAGGCGGCCTCCTCGGTCACCCA CTGCTCCAGCGACTTCTTGCCCAGGCCCAAGTTGCGCAAGGTGGA(C / G)A(C / T)GGA GAAGCGCCTCTGCTCGCGCCACGCGGGCCCATAGCGCGCCAGGAACACCCCTGGGG GTGGGACGGGCACGTGCGCGTGGCCATGAAGGCATTAGC (SEQ ID NO: 19) Any standard TaqMan probe will cover both SNPs and cannot interrogate each SNP separately. LNA probes, on the other hand, contain “locked” nucleotides which enable a higher Tm and shorter probe. The following are examples of 8-base probes that were synthesized for the genotyping of these two SNPs in accordance with an embodiment of the present teachings. Attorney Docket No. 4637-0020WO01 rs1058164 (two 8-base LNA probes (underlined), one targeting the C allele and one the G allele at this SNP) CACCGGAGTGGTTGGCGAAGGCGGCACAAAGGCAGGCGGCCTCCTCGGTCACCCA CTGCTCCAGCGACTTCTTGCCCAGGCCCAAGTTGCGCAAGGTGGA(C / G)A(C / T)GGA GAAGCGCCTCTGCTCGCGCCACGCGGGCCCATAGCGCGCCAGGAACACCCCTGGGG GTGGGACGGGCACGTGCGCGTGGCCATGAAGGCATTAGC (SEQ ID NO: 20) rs61736512 (two 8-base LNA probes (underlined), one targeting the C allele and one the T allele at this SNP) CACCGGAGTGGTTGGCGAAGGCGGCACAAAGGCAGGCGGCCTCCTCGGTCACCCA CTGCTCCAGCGACTTCTTGCCCAGGCCCAAGTTGCGCAAGGTGGA(C / G)A(C / T)GGA GAAGCGCCTCTGCTCGCGCCACGCGGGCCCATAGCGCGCCAGGAACACCCCTGGGG GTGGGACGGGCACGTGCGCGTGGCCATGAAGGCATTAGC (SEQ ID NO: 21) Primers and probes for rs61736512 sequence: Primers: LP1: CCTTCATGGCCACGCG (SEQ ID NO. 22) RP1: CCCATCACCCACCGGAG (SEQ ID NO. 23) LNA Probes: T[C / G]TCCACC (SEQ ID NO: 24) LNA8FAM FAM: +T+C+T+C+C+A+C+C (SEQ ID NO: 25) LNA8YAK YAK: +T+G+T+C+C+A+C+C (SEQ ID NO: 26) LNA7FAM FAM: T+C+T+C+C+A+C+C (SEQ ID NO: 27) LNA7YAK YAK: T+G+T+C+C+A+C+C (SEQ ID NO: 28) YAK: Yakima yellow (VIC equivalent) + : LNA bases Primers and probes for rs1058164 sequence: Primers: LP1: CCTTCATGGCCACGCG (SEQ ID NO: 29) RP1: CCCATCACCCACCGGAG (SEQ ID NO: 30) Attorney Docket No. 4637-0020WO01 LNA Probes: A[C / T]GGAGAA (SEQ ID NO. 31) FAM: A+C+G+G+A+G+A+A (SEQ ID NO: 32) YAK: A+T+G+G+A+G+A+A (SEQ ID NO: 33) YAK: Yakima yellow (VIC equivalent) + : LNA bases GT assays with LNA probes perform better than the standard TaqMan assays from Thermo Fisher for the difficult SNPs. (See Figures 8 and 9). Example 3 CYP2D6 and CYP3A4 Fragment Assay This assay is to determine the repeat numbers of CYP2D6 and CYP3A4 using direct PCR. Both targets are mono-nucleotide repeats. The assay for the mononucleotide repeats is exemplified as follows: Method: 2x TaqMan GTXpress Master Mix. Samples: CYP2D6 and CYP3A4 synthetic templates and their mixtures (artificial heterozygotes). Template concentration: 1250 copies (single or two templates (625 copies each)) / reaction chamber Fragment assays with two blocker concentrations (2000 and 6000 nM). Script: PGx_Assay (UI). CYP2D6 oligos: Attorney Docket No. 4637-0020WO01 The results for the CYP2D6 oligos is shown for 6G blocker (Figures 12A, 12B), 7G blocker (Figures 13A, 13B), and 8G blocker (Figures 14A, 14B). CYP3A4 oligos: The results for the CYP3A4 oligos are shown for the 4T blocker (Figures 15A, 15B), 5T blocker (Figures 16A, 16B), and 6T blocker (Figures 17A, 17B). The results show that the CYP2D6 and CYP3A4 fragment assays work well and can distinguish 3 alleles at both blocker concentrations (2000 and 6000 nM). The present invention also include the following aspects and embodiments. The following aspects and embodiments are listed with numerical references for convenience in exposition and reference, such numerical listing and reference is not meant to be construed in a limiting sense. Embodiment 1, a method of determining the number of repeat units of tandem repeats (TRs) of a target nucleic acid, the method comprising: a. providing a sample comprising a target nucleic acid to be characterized for the number of repeat units of TRs; b. providing a polymerase chain reaction (PCR) reaction mixture comprising: i. a pair of unlabeled allele specific oligonucleotide PCR primers or PCR primers; ii. at least one test probe, wherein the test probe comprises a sequence complementary to a sense or anti-sense strand with a known number of repeat units of TR, wherein the test probe comprises a 5'- fluorescent dye label and 3'-quencher capable of quenching the fluorescence of the 5' fluorescent label; Attorney Docket No. 4637-0020WO01 iii. a plurality of amplification blocking nucleic acids, each comprising a sequence complementary to the sense or anti-sense strand and comprising a known number of repeat units of TR which differs from the number of repeat units of TR of the test probe, each amplification blocking nucleic acid comprising a 3'-amino modifier which blocks amplification; iv. an amplification buffer, at least one nucleic acid polymerase, and a mixture of nucleotides; c. adding the target nucleic acid to the PCR reaction mixture; d. performing a PCR amplification in the PCR reaction mixture to amplify the target nucleic acid in the sample, e. measuring the amplification products of the target nucleic acid by monitoring the fluorescence of the 5'- fluorescent dye label, wherein amplification of the target nucleic acid is inhibited by the amplification blocking nucleic acids if the target nucleic acid comprises a number of repeat units of TR different than the number of repeat units of TR in the test probe, but amplification of the target nucleic acid is not inhibited if the target nucleic acid comprises a number of repeat units of TR corresponding to the number of repeat units of TR of the test probe, wherein amplification of the target nucleic acid indicates that the target nucleic acid has a number of repeat units of TR corresponding to the known number of repeat units of TR in the test probe. Embodiment 2, the method of embodiment 1 wherein the TR has a motif unit length selected from the group consisting of homopolymers (1 base pair (bp) motifs), short tandem repeats (STRs; 2–6-bp motifs), and variable number tandem repeats (VNTRs; >6-bp motifs). Embodiment 3, the method of any one of embodiments 1 – 2 wherein the test probe comprises 2 repeat units and the amplification blocking nucleic acids comprise 3- and 4-repeat units. Embodiment 4, the method of any one of embodiments 1 - 3 wherein the test probe comprises 3 repeat units and the amplification blocking nucleic acids comprise 2- and 4- repeat units. Attorney Docket No. 4637-0020WO01 Embodiment 5, the method of any one of embodiments 1 - 4 wherein the test probe comprises 4 repeat units and the amplification blocking nucleic acids comprise 2-, 3-, and 5- repeat units. Embodiment 6, the method of any one of embodiments 1 - 5 wherein the test probe comprises 5 repeat units and the amplification blocking nucleic acids comprise 6-, 7-, and 8-repeat units. Embodiment 7, the method of any one of embodiments 1 - 6 wherein the test probe comprises 6 repeat units and the amplification blocking nucleic acids comprise 5-, 7-, and 8-repeat units. Embodiment 8, the method of any one of embodiments 1 - 7 wherein the test probe comprises 7 repeat units and the amplification blocking nucleic acids comprise 5-, 6-, and 8-repeat units. Embodiment 9, the method of any one of embodiments 1 - 8 wherein the test probe comprises 8 repeat units and the amplification blocking nucleic acids comprise 5-, 7-, and 9-repeat units. Embodiment 10, the method of any one of embodiments 1 - 9 wherein the 3'-amino modifier of the amplification blocking nucleic acids is selected from the group consisting of a Peptide Nucleic Acid (PNA), Locked Nucleic Acid (LNA), Zip Nucleic Acid (ZNA), a Bridged Nucleic Acid (BNA), a nucleotide analogue, and combinations thereof. Embodiment 11, the method of any one of embodiments 1 – 10 wherein the 5' fluorescent dye label are selected from the group consisting of ALEX-350, FAM, VIC, TET, CAL Fluor Gold 540, JOE, HEX, CAL Fluor Orange 560, TAMRA, CAL Fluor Red 590, ROX, CAL Fluor Red 610, TEXAS RED, CAL Fluor Red 635, Quasar 670, CY3, CY5, CY5.5, Quasar 705, and Yakima Yellow. Embodiment 12, the method of any one of embodiments 1 - 11 wherein the 3' quencher group is selected from the group consisting of DABCYL, BHQ, BHQ-1, BHQ-2, ECLIPSE, TAMRA, and Iowa Black® FQ. Attorney Docket No. 4637-0020WO01 Embodiment 13, the method of any one of embodiments 1 - 12 wherein the test probe comprises a sequence complementary to a sense strand of the rs746071566 genetic locus in the NUDT15 gene and comprises 2 repeats of the GAGTCG repeat, and the amplification blocking nucleic acids comprise 3 or 4 GAGTCG repeats. Embodiment 14, the method of any one of embodiments 1 - 13 wherein the test probe comprises a sequence complementary to a sense strand of the rs746071566 genetic locus in the NUDT15 gene and comprises 3 repeats of the GAGTCG repeat, and the amplification blocking nucleic acids comprise 2 or 4 GAGTCG repeats. Embodiment 15, the method of any one of embodiments 1 - 14 wherein the test probe comprises a sequence complementary to a sense strand of the rs746071566 genetic locus in the NUDT15 gene and comprises 4 repeats of the GAGTCG repeat, and the amplification blocking nucleic acids comprise 2 or 3 GAGTCG repeats. Embodiment 16, the method of any one of embodiments 1 - 15 wherein the test probe comprises a sequence complementary to a sense strand of the UGT1A1 and comprises 5 AT repeats, and the amplification blocking nucleic acids comprise 6, 7, or 8 AT repeats. Embodiment 71, the method of any one of embodiments 1 - 16 wherein the test probe comprises a sequence complementary to a sense strand of the UGT1A1 and comprises 6 AT repeats, and the amplification blocking nucleic acids comprise 5, 7, or 8 AT repeats. Embodiment 18, the method of any one of embodiments 1 - 17 wherein the test probe comprises a sequence complementary to a sense strand of the UGT1A1 and comprises 7 AT repeats, and the amplification blocking nucleic acids comprise 5, 6, or 8 AT repeats. Embodiment 19, the method of any one of embodiments 1 - 18 wherein the test probe comprises a sequence complementary to a sense strand of the UGT1A1 and comprises 8 AT repeats, and the amplification blocking nucleic acids comprise 5, 6, or 7 AT repeats. Attorney Docket No. 4637-0020WO01 Embodiment 20, the method of any one of embodiments 1 – 19 wherein the test probe comprises a sequence complementary to a sense strand of CYP2D6 and comprises 6 repeats, and the amplification blocking nucleic acids comprise 7 or 8 repeats. Embodiment 21. The method of any one of embodiments 1 – 20 wherein the test probe comprises a sequence complementary to a sense strand of CYP2D6 and comprises 7 repeats, and the amplification blocking nucleic acids comprise 6 or 8 repeats. Embodiment 22, the method of any one of embodiments 1 – 21 wherein the test probe comprises a sequence complementary to a sense strand of CYP2D6 and comprises 8 repeats, and the amplification blocking nucleic acids comprise 6 or 7 repeats. Embodiment 23, the method of any one of embodiments 1 – 22 wherein the test probe comprises a sequence complementary to a sense strand of CYP3A4 and comprises 4 repeats, and the amplification blocking nucleic acids comprise 5 or 6 repeats. Embodiment 24, the method of any one of embodiments 1 – 23 wherein the test probe comprises a sequence complementary to a sense strand of CYP3A4 and comprises 5 repeats, and the amplification blocking nucleic acids comprise 4 or 6 repeats. Embodiment 25, the method of any one of embodiments 1 – 24 wherein the test probe comprises a sequence complementary to a sense strand of CYP3A4 and comprises 6 repeats, and the amplification blocking nucleic acids comprise 4 or 5 repeats. Embodiment 26, a method of determining SNP allelic variants that are close together in a target nucleic acid, the method comprising: a. providing a sample comprising a target nucleic acid to be characterized for the presence of SNP allelic variants; b. providing a first polymerase chain reaction (PCR) reaction mixture comprising: i. a pair of unlabeled allele specific oligonucleotide PCR primers; Attorney Docket No. 4637-0020WO01 ii. a first test probe, wherein the first test probe comprises a sequence complementary to a sense strand with a first SNP allelic variant, wherein the first test probe comprises at least one Locked Nucleic Acid (LNA), further wherein the first test probe comprises a first 5'- fluorescent dye label, as well as a 3'-quencher capable of quenching the fluorescence of the first 5' fluorescent label, further wherein the length of the first test probe is selected from the group consisting of 6, 7, 8, and 9 nucleotides; iii. at least one additional test probe, wherein the at least one additional test probe comprises a sequence complementary to a sense strand with an SNP allelic variant different than the first SNP allelic variant, but located close to the first allelic variant, wherein the at least one additional test probe comprises at least one Locked Nucleic Acid (LNA), further wherein the at least one additional test probe comprises a unique 5'- fluorescent dye label which is different that the first 5'-fluorescent dye label, as well as a 3'-quencher capable of quenching the fluorescence of the 5' fluorescent label, further wherein the length of the at least one additional test probe is selected from the group consisting of 6, 7, 8, and 9 nucleotides; iv. an amplification buffer, at least one nucleic acid polymerase, and a mixture of nucleotides; c. adding the target nucleic acid to the PCR reaction mixture; d. amplifying the target nucleic acid with a nucleic acid polymerase to provide amplification products, e. measuring the amplification products of the target nucleic acid by monitoring the fluorescence of the 5'- fluorescent dye labels, wherein detection of the first 5'- fluorescent dye label indicates the presence of the first SNP allelic variant, and detection of the second 5'- fluorescent dye label indicates the presence of the second SNP allelic variant in the target nucleic acid. Embodiment 27, the method of embodiment 26 wherein the first and second allelic variants are less than 7 nucleotides apart. Attorney Docket No. 4637-0020WO01 Embodiment 28, the method of any one of embodiments 26 - 27 wherein the length of the first test probe is 7 nt. Embodiment 29, the method of any one of embodiments 26 - 28 wherein the length of the at least one additional test probe is 7 nt. Embodiment 30, the method of any one of embodiments 26 to 29 wherein the allele-specific first test probe comprises more than one LNA. Embodiment 31, the method of any one of embodiments 26 to 30 wherein the allele-specific first test probe nucleotides are all LNAs. Embodiment 32, the method of any one of embodiments 26 to 31 wherein the allele-specific additional test probe comprises more than one LNA. Embodiment 33, the method of any one of embodiments 26 to 32 wherein the allele-specific additional test probe nucleotides are all LNAs. Embodiment 34, the method of any one of embodiments 26 to 33 wherein the allele-specific first test probe is complementary to an SNP allele selected from the group consisting of rs61736512 and rs1058164. Embodiment 35, the method of any one of embodiments 26 to 34 wherein the allele-specific additional test probe is complementary to an SNP allele selected from the group consisting of rs61736512 and rs1058164. Embodiment 36, the method of any one of embodiments 26 – 35 wherein the 5' fluorescent dye label is selected from the group consisting of ALEX-350, FAM, VIC, TET, CAL Fluor Gold 540, JOE, HEX, CAL Fluor Orange 560, TAMRA, CAL Fluor Red 590, ROX, CAL Fluor Red 610, TEXAS RED, CAL Fluor Red 635, Quasar 670, CY3, CY5, CY5.5, Quasar 705, and Yakima Yellow. Attorney Docket No. 4637-0020WO01 Embodiment 37, the method of any one of embodiments 26 – 36 wherein the 3' quencher group is selected from the group consisting of DABCYL, BHQ, BHQ-1, BHQ-2, ECLIPSE, TAMRA, and Iowa Black® FQ. While the invention has been described in detail and with reference to specific examples thereof, it will be apparent to one skilled in the art that various changes and modifications can be made therein without departing from the spirit and scope thereof.

Claims

Attorney Docket No. 4637-0020WO01 CLAIMS WHAT IS CLAIMED IS:

1. A method of determining the number of repeat units of tandem repeats (TRs) of a target nucleic acid, the method comprising: a. providing a sample comprising a target nucleic acid to be characterized for the number of repeat units of TRs; b. providing a polymerase chain reaction (PCR) reaction mixture comprising: i. a pair of unlabeled allele specific oligonucleotide PCR primers or PCR primers; ii. at least one test probe, wherein the test probe comprises a sequence complementary to a sense or anti-sense strand with a known number of repeat units of TR, wherein the test probe comprises a 5'- fluorescent dye label and 3'-quencher capable of quenching the fluorescence of the 5' fluorescent label; iii. a plurality of amplification blocking nucleic acids, each comprising a sequence complementary to the sense or anti-sense strand and comprising a known number of repeat units of TR which differs from the number of repeat units of TR of the test probe, each amplification blocking nucleic acid comprising a 3'-amino modifier which blocks amplification; iv. an amplification buffer, at least one nucleic acid polymerase, and a mixture of nucleotides; c. adding the target nucleic acid to the PCR reaction mixture; d. performing a PCR amplification in the PCR reaction mixture to amplify the target nucleic acid in the sample, e. measuring the amplification products of the target nucleic acid by monitoring the fluorescence of the 5'- fluorescent dye label, wherein amplification of the target nucleic acid is inhibited by the amplification blocking nucleic acids if the target nucleic acid comprises a number of repeat units of TR different than the number of repeat units of TR in the test probe, but amplification of the target nucleic acidAttorney Docket No. 4637-0020WO01 is not inhibited if the target nucleic acid comprises a number of repeat units of TR corresponding to the number of repeat units of TR of the test probe, wherein amplification of the target nucleic acid indicates that the target nucleic acid has a number of repeat units of TR corresponding to the known number of repeat units of TR in the test probe.

2. The method of claim 1 wherein the TR has a motif unit length selected from the group consisting of homopolymers (1 base pair (bp) motifs), short tandem repeats (STRs; 2–6- bp motifs), and variable number tandem repeats (VNTRs; >6-bp motifs).

3. The method of any one of claims 1 – 2 wherein the test probe comprises 2 repeat units and the amplification blocking nucleic acids comprise 3- and 4-repeat units.

4. The method of any one of claims 1 - 3 wherein the test probe comprises 3 repeat units and the amplification blocking nucleic acids comprise 2- and 4-repeat units.

5. The method of any one of claims 1 - 4 wherein the test probe comprises 4 repeat units and the amplification blocking nucleic acids comprise 2-, 3-, and 5-repeat units.

6. The method of any one of claims 1 - 5 wherein the test probe comprises 5 repeat units and the amplification blocking nucleic acids comprise 6-, 7-, and 8-repeat units.

7. The method of any one of claims 1 - 6 wherein the test probe comprises 6 repeat units and the amplification blocking nucleic acids comprise 5-, 7-, and 8-repeat units.

8. The method of any one of claims 1 - 7 wherein the test probe comprises 7 repeat units and the amplification blocking nucleic acids comprise 5-, 6-, and 8-repeat units.

9. The method of any one of claims 1 - 8 wherein the test probe comprises 8 repeat units and the amplification blocking nucleic acids comprise 5-, 7-, and 9-repeat units.Attorney Docket No. 4637-0020WO01 10. The method of any one of claims 1 - 9 wherein the 3'-amino modifier of the amplification blocking nucleic acids is selected from the group consisting of a Peptide Nucleic Acid (PNA), Locked Nucleic Acid (LNA), Zip Nucleic Acid (ZNA), a Bridged Nucleic Acid (BNA), a nucleotide analogue, and combinations thereof.

11. The method of any one of claims 1 – 10 wherein the 5' fluorescent dye label are selected from the group consisting of ALEX-350, FAM, VIC, TET, CAL Fluor Gold 540, JOE, HEX, CAL Fluor Orange 560, TAMRA, CAL Fluor Red 590, ROX, CAL Fluor Red 610, TEXAS RED, CAL Fluor Red 635, Quasar 670, CY3, CY5, CY5.5, Quasar 705, and Yakima Yellow.

12. The method of any one of claims 1 - 11 wherein the 3' quencher group is selected from the group consisting of DABCYL, BHQ, BHQ-1, BHQ-2, ECLIPSE, TAMRA, and Iowa Black® FQ.

13. The method of any one of claims 1 - 12 wherein the test probe comprises a sequence complementary to a sense strand of the rs746071566 genetic locus in the NUDT15 gene and comprises 2 repeats of the GAGTCG repeat, and the amplification blocking nucleic acids comprise 3 or 4 GAGTCG repeats.

14. The method of any one of claims 1 - 13 wherein the test probe comprises a sequence complementary to a sense strand of the rs746071566 genetic locus in the NUDT15 gene and comprises 3 repeats of the GAGTCG repeat, and the amplification blocking nucleic acids comprise 2 or 4 GAGTCG repeats.

15. The method of any one of claims 1 - 14 wherein the test probe comprises a sequence complementary to a sense strand of the rs746071566 genetic locus in the NUDT15 gene and comprises 4 repeats of the GAGTCG repeat, and the amplification blocking nucleic acids comprise 2 or 3 GAGTCG repeats.

16. The method of any one of claims 1 - 15 wherein the test probe comprises a sequence complementary to a sense strand of the UGT1A1 and comprises:Attorney Docket No. 4637-0020WO01 a. 5 AT repeats, and the amplification blocking nucleic acids comprise 6, 7, or 8 AT repeats, b. 6 AT repeats, and the amplification blocking nucleic acids comprise 5, 7, or 8 AT repeats, c. 7 AT repeats, and the amplification blocking nucleic acids comprise 5, 6, or 8 AT repeats, and / or d. 8 AT repeats, and the amplification blocking nucleic acids comprise 5, 6, or 7 AT repeats.

17. The method of any one of claims 1 – 16 wherein the test probe comprises a sequence complementary to a sense strand of CYP2D6 and comprises: a. 6 repeats, and the amplification blocking nucleic acids comprise 7 or 8 repeats, b. 7 repeats, and the amplification blocking nucleic acids comprise 6 or 8 repeats, and / or c. 8 repeats, and the amplification blocking nucleic acids comprise 6 or 7 repeats.

18. The method of any one of claims 1 – 17 wherein the test probe comprises a sequence complementary to a sense strand of CYP3A4 and comprises: a. 4 repeats, and the amplification blocking nucleic acids comprise 5 or 6 repeats, b. 5 repeats, and the amplification blocking nucleic acids comprise 4 or 6 repeats, and / or c. 6 repeats, and the amplification blocking nucleic acids comprise 4 or 5 repeats.

Citation Information

Patent Citations

  • Oligonucleotides and Uses Thereof

    US20110003290A1

  • Methods for Analyzing Short Tandem Repeats and Single Nucleotide Polymorphisms

    US20140186830A1

  • Probe with multiple target region specificity and of tripartite character

    US20140227683A1

  • Allele-specific amplification of nucleic acids using blocking oligonucleotides for wild type suppression

    US20160177372A1

  • Probe and method for STR-genotyping

    US20220340981A1