Compositions and methods for treating liver dysfunction

By administering compositions that reduce ER stress with agents like 4-PBA, the method addresses the lack of therapies for MASLD, improving liver function and preventing disease progression by enhancing protein folding and reducing lipid accumulation and inflammation.

WO2026022624A1PCT designated stage Publication Date: 2026-01-29UNIV OF PITTSBURGH OF THE COMMONWEALTH SYST OF HIGHER EDUCATION
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
PCT/IB2025/057204
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-07-25
Filing Date
2025-07-16
Publication Date
2026-01-29

AI Technical Summary

Technical Problem

Current therapies for metabolic dysfunction-associated steatohepatitis (MASLD) are lacking, and there is a limited ability to predict disease progression and response to treatments due to the complex patient pathogenesis and heterogeneity, with no FDA-approved therapy available.

Method used

Administering a composition that reduces stress in the endoplasmic reticulum (ER) using agents like 4-phenylbutyric acid (4-PBA) and histone deacetylase inhibitors to treat liver dysfunction, including conditions such as cirrhosis, nonalcoholic steatohepatitis, and metabolic dysfunction-associated steatotic liver disease (MASLD), by enhancing protein folding and mitigating ER stress.

Benefits of technology

The approach alleviates ER stress, reduces lipid accumulation, decreases inflammation, and promotes a balanced lipid profile, effectively treating liver dysfunction and potentially preventing progression to end-stage liver disease.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IB2025057204_29012026_PF_FP_ABST
    Figure IB2025057204_29012026_PF_FP_ABST
Patent Text Reader

Abstract

Provided herein is a method of treating liver dysfunction in a patient, comprising administering to the patient a composition that reduces stress in the endoplasmic reticulum in an amount effective to treat the dysfunction in the patient.
Need to check novelty before this filing date? Find Prior Art

Description

COMPOSITIONS AND METHODS FOR TREATING LIVER DYSFUNCTIONCROSS REFERENCE TO RELATED APPLICATION

[0001] The present application claims priority to U.S. Provisional Patent Application No. 63 / 675,471 , filed July 25, 2024, the disclosure of which is hereby incorporated by reference in its entirety.STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH

[0002] This invention was made with government support under DK099257 awarded by the National Institutes of Health. The government has certain rights in the invention.REFERENCE TO A SEQUENCING LISTING

[0003] The Sequence Listing associated with this application is filed in electronic format via Patent Center and is hereby incorporated by reference into the specification in its entirety. The name of the file containing the Sequence Listing is 2502283. xml. The size of the file is 28,087 bytes, and the file was created on July 13, 2025.BACKGROUND OF THE INVENTIONField of the Invention

[0004] Provided herein are compositions and method for treating liver dysfunction. Description of Related Art

[0005] Chronic liver disease (CLD) progressing to liver failure, HCC, and portal hypertension result in 2 million deaths annually worldwide. HCC alone ranks as the fifth leading cause of cancer-related deaths in the United States. The etiology of CLD has changed dramatically over the last few decades. The burden of chronic hepatitis C has diminished due to the emergence of highly effective direct-acting antiviral agents, while the incidence of metabolic dysfunction-associated steatotic liver disease (MASLD), including metabolic dysfunction-associated steatohepatitis (MASH), has grown. MASLD is currently the leading indication of adult liver transplantation and significantly increases an individual’s risk for developing HCC and associated CLD. Despite its public health importance and financial burden, there is currently no FDA- approved therapy for MASLD. The lack of therapeutic options reflects the complex patient pathogenesis and heterogeneity, as well as the lack of experimental modelsthat fully recapitulate disease phenotypes. Thus, our current ability to predict disease progression and response to treatments is limited.SUMMARY OF THE INVENTION

[0006] Provided herein is a method of treating liver dysfunction in a patient, including administering to the patient a composition that reduces stress in the endoplasmic reticulum in an amount effective to treat the dysfunction in the patient.

[0007] Further non-limiting embodiments are set forth in the following numbered clauses:

[0008] 1. A method of treating liver dysfunction in a patient, comprising administering to the patient a composition that reduces stress in the endoplasmic reticulum in an amount effective to treat the dysfunction in the patient.

[0009] 2. The method of clause 1 , wherein the patient has cirrhosis.

[0010] 3. The method of clause 1 or clause 2, wherein the patient has nonalcoholic steatohepatitis.

[0011] 4. The method of any of clauses 1 -3, wherein the patient has fatty liver disease.

[0012] 5. The method of any of clauses 1 -4, wherein the patient has end-stage liver disease.

[0013] 6. The method of any of clauses 1 -5, wherein the patient has hepatitis.

[0014] 7. The method of any of clauses 1 -6, wherein the patient has metabolic dysfunction-associated steatotic liver disease (MASLD)

[0015] 8. The method of any of clauses 1 -7, wherein the patient has a polymorphism in a gene encoding a transmembrane 6 superfamily 2 (TM6SF2) protein, a Patatin-like phospholipase domain-containing protein 3 (PNPLA3), and / or a protein tyrosine phosphatase receptor type D (PTPRD).

[0016] 9. The method of any of clauses 1 -8, wherein the polymorphism is rs58542926, rs738409, and / or rs10756038.

[0017] 10. The method of any of clauses 1 -9, wherein the patient exhibits reduced levels of fatty acids.

[0018] 11. The method of any of clauses 1 -10, wherein administering the composition to the patient increases the levels of fatty acids in the patient.

[0019] 12. The method of any of clauses 1 -11 , wherein the patient exhibits reduced levels of lipids.

[0020] 13. The method of any of clauses 1 -12, wherein administering the composition to the patient increases the levels of lipids in the patient.

[0021] 14. The method of any of clauses 1 -13, wherein the lipid is VLDL

[0022] 15. The method of any of clauses 1 -14, wherein the composition comprises a protein folding facilitator.

[0023] 16. The method of any of clauses 1 -15, wherein the protein folding facilitator comprises 4-phenylbutyric acid (4-PBA), or a pharmaceutically acceptable salt thereof.

[0024] 17. The method of any of clauses 1 -16, wherein the composition comprises a histone deacetylase (HDAC) inhibitor.

[0025] 18. The method of any of clauses 1 -17, wherein the histone deacetylase inhibitor is one or more of vorinostat, romidepsin, belinostat, Panobinostat, entinostat, givinostat, abexinostat, tucidinostat, pracinostat, ricolinostat, valproic acid, 4- phenylbutyric acid (4-PBA), a pharmaceutically-acceptable salt of any of the foregoing, and / or any combination thereof.

[0026] 19. The method of any of clauses 1 -18, wherein the HDAC inhibitor is 4-PBA.

[0027] 20. The method of any of clauses 1 -19 wherein the composition is an antioxidant.

[0028] 21. The method of any of clauses 1 -20, wherein the composition is ursodeoxycholic acid, tauroursodeoxycholic acid, a GLP-1 receptor agonist, vitamin C, vitamin E, 4p8c, epigallocatechin-3-gallate (EGCG), quercetin, luteolin, GSK2606414, N-acetyl cysteine, resveratrol, rapamycin, a pharmaceutically- acceptable salt of any of the foregoing, and / or any combination thereof.

[0029] 22. The method of any of clauses 1 -21 , wherein the patient has a polymorphism in a gene that is associated with lipid metabolism.

[0030] 23. The method of any of clauses 1 -22, wherein the polymorphism is in a gene having a sequence having at least 80%, at least 85%, at least 90%, at least 95%, and / or at least 99% sequence identity to SEQ ID NO: 12, SEQ ID NO: 14, and / or SEQ ID NO: 16.

[0031] 24. The method of any of clauses 1 -23, wherein the gene has a sequence having at least 80%, at least 85%, at least 90%, at least 95%, and / or at least 99% sequence identity to SEQ ID NO: 13, SEQ ID NO: 15, and / or SEQ ID NO: 17.BRIEF DESCRIPTION OF THE DRAWINGS

[0032] FIGS. 1A-1 E show (A) Genotype frequency of the TM6SF2 rs58542926 variant in a US cohort (healthy individuals, n = 123, and ESLD samples, n = 50). Human symbols represent 20% of the prevalence. (B) Schematic design of the generation of iPSC-TM6SF2-WT and iPSC-TM6SF2-E167K. We generated iPSC- TM6SF2-WT from fibroblasts obtained from a healthy individual, followed by gene editing using CRISPR / Cas9 to generate iPSC-TM6SF2-E167K. Sanger sequencing confirmed that iPSC-TM6SF2-WT cells were major homozygous (CC) and iPSC- TM6SF2-E167K cells are minor homozygous (TT) after gene editing for the TM6SF2 rs58542926, as indicated by the red arrow. (C) Immunofluorescence micrographs of pluripotency markers: Nanog, SSEA4, OCT4, and TRA-1 -60 (left panel) and quantitative gene expressions of pluripotency markers: SOX2, LIN28A, OCT4, and Nanog (right panel) in both iPSC-TM6SF2-WT (n = 3) and iPSC-TM6SF2-E167K (n = 3). WTC11 cells were used as a positive control, and human fibroblasts were used as a negative control. Values are determined relative to p-actin and presented as fold change relative to the expression in human WTC1 1 , which is set as 1 . (D) Micrographs of embryoid bodies and immunofluorescence micrographs of the three germ layer markers: ectoderm (SOX1 , OTX-2), mesoderm (HAND-1 , Brachyury), and endoderm (SOX17, GATA-4) in both iPSC-TM6SF2-WT and iPSC-TM6SF2-E167K. (E) G- banding analysis for karyotype in both iPSC-TM6SF2-WT and iPSC-TM6SF2-E167K shows no abnormalities in the cells.

[0033] FIGS. 2A-2F show (A) Schematic illustration of the hepatocyte differentiation protocol, highlighting the three main stages of differentiation by sequential addition of defined medium protocols containing Activin-A, BMP-4, and FGF2 (stage 1 ); Activin- A (stage 2); and dimethyl sulfoxide (DMSO) and hepatocyte growth factor (HGF) (stage 3). (B-C) Immunofluorescence micrographs (left panel) of endoderm marker SOX17 in both iDE-TM6SF2-WT (n = 4) and iDE-TM6SF2-E167K (n = 4). Bright field micrographs of iHep-TM6SF2-WT and iHep-TM6SF2-E167K show cells on the last day of stage 3. Immunofluorescence micrographs of hepatocyte markers, adult isoform HNF4a, AFP, and albumin in both iHep-TM6SF2-WT and iHep-TM6SF2- E167K. Human adult hepatocytes (PHH) (n = 3) and human fetal hepatocytes (n = 3) were used as positive and negative controls, respectively. (D-F) Quantitative gene expression for hepatocyte markers: HNF4a, HNF1 a, FOXA1 , FOXA2, PPARa, LXR, RXR, FASN, EGFR, SREBPI c, ACC, and CEBPA in both iHep-TM6SF2-WT (n = 4)and iHep-TM6SF2-E167K (n = 4). PHH cells (n = 3) were used as a positive control, and both undifferentiated iPSC lines (n = 3) were used as a negative control. Values are determined relative to [3-actin and presented as fold change relative to the expression in PHH, which is set as 1 .

[0034] FIGS. 3A-3G show (A-C) TM6SF2 expression in both iHep-TM6SF2-WT and iHep-TM6SF2-E167K. The left upper panel shows quantitative gene expression. iPSC-TM6SF2-WT (n = 3), iPSC-TM6SF2-E167K (n = 3), and human fibroblast cells (n = 3) were applied as negative controls. Human normal liver tissue (n = 3), human ESLD-WT hepatocytes (n = 5), and adult PHH (n = 3) were used as positive controls. Values are determined relative to [3-actin and presented as fold change relative to the expression in PHH, which is set as 1. The middle upper panel shows immunofluorescence micrographs of the TM6SF2 marker in iHep-TM6SF2-WT and iHep-TM6SF2-E167K. Adult PHH was used as a positive control and fibroblast as a negative control. The relative TM6SF2 intensity showed a significant decrease in iHep- TM6SF2-E167K cells when compared to iHep-TM6SF2-WT (mean ± SD ***p = 0.0002 unpaired Welch’s t-test, n = 20 cells). The same was observed by western blot. The bar chart shows the quantification of protein expression. There was a significant decrease in iHep-TM6SF2-E167K in comparison to iHep-TM6SF2-WT (mean ± SD ***p = 0.0005, unpaired Welch’s t-test, n = 6). (D-E) The upper panel shows nile red staining micrographs in both iHep-TM6SF2-WT and iHep-TM6SF2-E167K and shows that iHep-TM6SF2-E167K has a higher intracellular lipid droplet content when compared to iHep-TM6SF2-WT. Quantification shows a significant increase in the percentage of Nile red signal when the cells carry the E167K mutation (mean ± SD *p = 0.0274, unpaired Welch’s t-test n = 5). The lower panel shows Perilipin 2 staining micrographs in both iHep-TM6SF2-WT and iHep-TM6SF2-E167K and shows that iHep-TM6SF2-E167K has a higher intracellular lipid droplet content when compared to iHep-TM6SF2-WT. Quantification shows a significant increase in intensity of Perilipin 2 signal when the cells carry the E167K mutation (mean ± SD *p = 0.0229, unpaired Welch’s t-test n = 3). (F) ApoB100 secretion is impaired in iHep-TM6SF2- E167K. The intracellular content of ApoB100 in iHep-TM6SF2-WT and iHep-TM6SF2- E167K was quantified by western blot. The bar chart shows an increase of ApoB100 inside the iHep-TM6SF2-E167K (mean ± SD *p=0.0144, unpaired Welch’s t-test). iHep-TM6SF2-WT (n = 3), and iHep-TM6SF2-E167K (n = 4). (G) Intracellular total cholesterol and HLD amounts were measured in iHep-TM6SF2-WT and iHep-TM6SF2-E167K. The bar charts show a significant increase in the intracellular and extracellular ratio of total cholesterol in iHep-TM6SF2-E167K when compared to iHep- TM6SF2-WT (mean ± SD **p=0.0079, unpaired Welch’s t-test, iHep-TM6SF2-WT, n = 4 and iHep-TM6SF2-E167K, n = 4). The secretion of ApoB100 in iHep-TM6SF2-WT and iHep-TM6SF2-E167K was evaluated by ELISA and showed a decrease of this apolipoprotein in iHep-TM6SF2-E167K (mean ± SD **p=0.0042, unpaired Welch’s t- test) in iHep-TM6SF2-WT (n = 9) and iHep-TM6SF2-E167K (n = 11 ). The secretion of VLDL in iHep-TM6SF2-WT and iHep-TM6SF2-E167K was evaluated by ELISA and showed a decrease of VLDL in iHep-TM6SF2-E167K (mean ± SD *p=0.0217, unpaired Welch’s t-test) in iHep-TM6SF2-WT (n = 3) and iHep-TM6SF2-E167K (n = 3).

[0035] FIGS. 4A-4F show (A-C) The inflammatory response in iHep-TM6SF2-WT and iHep-TM6SF2-E167K was quantified by Multiplex Protein Detection. The representative images of human inflammatory array membranes show the expression analysis of three independent differentiations of iHep-TM6SF2-WT and three independent differentiations of iHep-TM6SF2-E167K. The blue rectangle represents the experimental positive control, the red rectangles represent down-regulated cytokines and chemokines in iHep-TM6SF2-E167K, and the green rectangles represent up-regulated cytokines and chemokines in iHep-TM6SF2-WT. After development of the membranes, images were scanned and analyzed using Imaged software. All dots density values were normalized to the dot density for positive control. The bar charts show an increase of IL-6 (mean ± SD *p=0.0307, unpaired Welch’s t- test), IL-8 (mean ± SD *p=0.0410, unpaired Welch’s t-test), MIP-113 (mean ± SD *p=0.0279, unpaired Welch’s t-test), and TIMP-2 (mean ± SD ****p<0.0001 , unpaired Welch’s t-test), levels in iHep-TM6SF2-E167K when compared to iHep-TM6SF2-WT. (D) The bar chart shows that total ROS is significantly increased in iHep-TM6SF2- E167K when compared to iHep-TM6SF2-WT ( mean ± SD **p=0.0026, unpaired Welch’s t-test n=3). Total Caspase 3 measurement shows a significant increase in iHep-TM6SF2-E167K when compared to iHep-TM6SF2-WT (mean ± SD *p=0.0317, unpaired Welch’s t-test, n=5). Total NAD / NADH quantification in iHep-TM6SF2-WT and iHep-TM6SF2-167K treated with 100 pM of PA for 48h shows the significant increase of NAD / NADH in iHep-TM6SF2-E167K treated when compared to iHep- TM6SF2-E167K non-treated (mean ± SD *p=0.0407, unpaired Welch’s t-test, n=3). No difference was observed in iHep-TM6SF2-WT treated and non-treated (mean ± SDp=0.0975, unpaired Welch’s t-test, n=3). (E-F) Transmission electron microscopy (TEM) images of ESLD-TM6SF2-WT (n = 1 ), ESLD-TM6SF2-E167K (n = 1 ), iHep- TM6SF2-WT (n = 3), and iHep-TM6SF2-E167K (n = 3). The white arrows indicate the rod mitochondrial shape commonly found in human hepatocytes. The yellow arrows show the round mitochondrial shape in hepatocytes that carried the TM6SF2-E167K mutation (scale bar: 600nm). The right panel shows DNA quantitative gene expression for important functional mitochondria genes. iHep-TM6SF2-E167K showed an decrease in expression of mtCYB (mean ± SD **p = 0.0079, unpaired Welch’s t-test, n = 5), mtCO3 (mean ± SD **p = 0.0079, unpaired Welch’s t-test, n = 5), mtCO1 (mean ± SD **p = 0.0079, unpaired Welch’s t-test, n = 5), and mtATP6 (mean ± SD **p = 0.0079, unpaired Welch’s t-test, n = 5) when compared to iHep-TM6SF2-WT. Values are determined relative to p-actin and presented as fold change relative to the expression in iHep-TM6SF2-WT, which is set as 1

[0036] FIGS. 5A-5K show (A) Immunofluorescence micrographs of XBP1 , a protein related to ER stress, in ESLD-TM6SF2-WT (n = 1 ), ESLD-TM6SF2-E167K (n = 1 ), iHep-TM6SF2-WT (n = 3), and iHep-TM6SF2-E167K (n = 3), showing an increase in protein expression in the mutant samples (ESLD-TM6SF2-E167K and iHep-TM6SF2- E167K). The relative XBP1 expression was not significantly different in iHep-TM6SF2- E167K when compared to iHep-TM6SF2-WT (mean ± SD P=0.4000, unpaired Welch’s t-test n = 3). The opposite was observed by western blot. The bar chart shows the quantification of XBP1 s protein expression, and a significant increase was observed in iHep-TM6SF2-E167K in comparison to iHep-TM6SF2-WT (mean ± SD SD****p<0.0001 , unpaired Welch’s t-test n = 6). (B) Immunofluorescence micrographs of HSPA5, a protein related to ER stress, in ESLD-TM6SF2-WT (n = 1 ), ESLD- TM6SF2-E167K (n = 1), iHep-TM6SF2-WT (n = 3), and iHep-TM6SF2-E167K (n = 3), showing an increase in protein expression in the mutant samples (ESLD-TM6SF2- E167K and iHep-TM6SF2-E167K). The relative HSPA5 expression showed a significant increase in iHep-TM6SF2-E167K when compared to iHep-TM6SF2-WT (mean ± SD*p=0.0188, unpaired Welch’s t-test n = 4). Values are determined relative to p-actin. The same was observed by western blot. The bar chart shows the quantification of HSPA5 protein expression, and a significant increase was observed in iHep-TM6SF2-E167K in comparison to iHep-TM6SF2-WT (mean ± SD **p=0.0010, unpaired Welch’s t-test n = 6). (C-D) Immunofluorescence micrographs of CHOP, protein related to ER stress, in iHep-TM6SF2-WT (n = 3), and iHep-TM6SF2-E167K(n = 3), showing an increase in protein expression in iHep-TM6SF2-E167K. The bar chart shows that the intensity quantification of CHOP is significantly increased in iHep- TM6SF2-E167K in comparison to iHep-TM6SF2-WT (mean ± SD *p = 0.01 18, unpaired Welch’s t-test n = 3). The same was observed by western blot for AFT4, another protein related to ER stress. The bar chart shows that ATF4 protein expression is significantly increased in iHep-TM6SF2-E167K in comparison to iHep- TM6SF2-WT (mean ± SD ****p<0.0001 , unpaired Welch’s t-test n = 6). (E-H) ER and Golgi expression in both iHep-TM6SF2-WT and iHep-TM6SF2-E167K. Immunofluorescence micrographs show calnexin marking ER in red and GM130 marking Golgi in green (40X, n=3), The histograms shows that that is no difference in ER region area in iHep-TM6SF2- E167K when compared to iHep-TM6SF2-WT. The opposite was observed in Golgi area and ER intensity, where the histograms show a significant difference in iHep-TM6SF2- E167K when compared to iHep-TM6SF2-WT. (I-K) After treatment with 2 pM of 4-PBA for 48h, ATF4 and HSPA5 protein expression was observed by western blot in both iHep-TM6SF2-WT and iHep-TM6SF2-E167K. The bar chart shows the quantification of ATF4 and HSPA5 normalized to non-treated cells. ATF4 and HSPA5 showed a significant increase in expression in iHep-TM6SF2- E167K treated when compared to non-treated iHep-TM6SF2-E167K (ATF4 - mean ± SD *p=0.0313, unpaired Welch’s t-test n = 3), (HSPA5- mean ± SD ***p=0.0007, unpaired Welch’s t-test n = 3). No difference in either protein was observed in iHep- TM6SF2- WT treated when compared to non-treated iHep-TM6SF2-WT. The quantification of VLDL secretion showed no difference iHep-TM6SF2- WT treated when compared to non-treated iHep-TM6SF2-WT (mean ± SD p=0.6752, unpaired Welch’s t-test n = 3) and a significant increase in the secretion of VLDL in iHep- TM6SF2- E167K treated when compared to non-treated iHep-TM6SF2- E167K (mean ± SD *p=0.0321 , unpaired Welch’s t-test n = 3).

[0037] FIGS. 6A-6D provide exemplary sequences of genes of interest and polymorphisms thereof.DESCRIPTION OF THE INVENTION

[0038] Other than in the operating examples, or where otherwise indicated, all numbers expressing quantities of ingredients, reaction conditions, and so forth used in the specification and claims are to be understood as being modified in all instances by the term "about". Accordingly, unless indicated to the contrary, the numericalparameters set forth in the following specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained by the present invention. At the very least, and not as an attempt to limit the application of the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.

[0039] Notwithstanding that the numerical ranges and parameters setting forth the broad scope of the invention are approximations, the numerical values set forth in the specific examples are reported as precisely as possible. Any numerical values, however, inherently contain certain errors necessarily resulting from the standard deviation found in their respective testing measurements. Furthermore, when numerical ranges of varying scope are set forth herein, it is contemplated that any combination of these values inclusive of the recited values may be used.

[0040] As used herein, the terms “comprising,” “comprise” or “comprised,” and variations thereof, in reference to elements of an item, composition, apparatus, method, process, system, claim etc. are intended to be open-ended, meaning that the item, composition, apparatus, method, process, system, claim etc. includes those elements and other elements can be included and still fall within the scope / definition of the described item, composition, apparatus, method, process, system, claim etc. As used herein, "a" or "an" means one or more. As used herein "another" may mean at least a second or more.

[0041] As used herein, the terms "patient" or "subject" refer to members of the animal kingdom, including, but not limited to human beings.

[0042] Unless otherwise explained, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. It is to be understood that all base sizes or amino acid sizes, and all molecular weight or molecular mass values, given for nucleic acids or polypeptides are approximate, and are provided for description. Unless otherwise indicated, polymer molecular weight is expressed as number-average molecular weight (Mn). Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, suitable methods and materials are described below.

[0043] The terms “treat,” “treating”, “treatment,” “ameliorate” or “ameliorating” and other grammatical equivalents as used herein, can include alleviating, or abating adisease or condition symptoms, inhibiting a disease or condition, e.g., arresting the development of a disease or condition, relieving a disease or condition, causing regression of a disease or condition, relieving a condition caused by the disease or condition, or stopping symptoms of a disease or condition.

[0044] The term “preventing” can mean preventing additional symptoms, ameliorating or preventing the underlying metabolic causes of symptoms, and can include prophylaxis.

[0045] In some instances, “treat,” “treating”, “treatment,” “ameliorate” or “ameliorating” and other grammatical equivalents can include prophylaxis. “Treat,” “treating”, “treatment,” “ameliorate” or “ameliorating” and other grammatical equivalents can further include achieving a therapeutic benefit and / or a prophylactic benefit. Therapeutic benefit can mean eradication of the underlying disease being treated. Also, a therapeutic benefit can be achieved with the eradication of one or more of the physiological symptoms associated with the underlying disease such that an improvement can be observed in a subject notwithstanding that, in some embodiments, the subject can still be afflicted with the underlying disease.

[0046] The terms “effective amount”, “therapeutically effective amount” or “pharmaceutically effective amount” as used herein, can refer to a sufficient amount of a compound being administered which will at least partially ameliorate a symptom of a disease or condition being treated.

[0047] Therapeutic compositions, including those containing the compositions disclosed herein, may comprise a pharmaceutically acceptable carrier, or excipient. An excipient is an inactive substance used as a carrier for the active ingredients of a medication. Although "inactive," excipients may facilitate and aid in increasing the delivery or bioavailability of an active ingredient in a drug product. Non-limiting examples of useful excipients include: adjuvants, antiadherents, binders, rheology modifiers, carriers, coatings, disintegrants, emulsifiers, oils, buffers, salts, acids, bases, fillers, diluents, solvents, flavors, colorants, glidants, lubricants, preservatives, antioxidants, sorbents, vitamins, sweeteners, etc., as are available in the pharmaceutical / compounding arts.

[0048] Useful dosage forms for the compositions disclosed herein include, for example and without limitation: parenteral, intravenous, intramuscular, intraocular, or intraperitoneal solutions, oral tablets or liquids, topical drops, ointments, or creams, and transdermal devices (e.g., patches). The compound may be a sterile solutioncomprising the active ingredient (e.g., cell(s)), and a solvent, such as water, saline, lactated Ringer's solution, or phosphate-buffered saline (PBS). Additional excipients, such as polyethylene glycol, emulsifiers, salts, and buffers may be included in the solution. Suitable dosage forms may include single-dose, or multiple-dose vials or other containers, such as medical syringes or droppers, e.g., eye droppers. Pharmaceutical formulations adapted for administration include aqueous and nonaqueous sterile solutions which may contain, in addition to the active pharmaceutical ingredient or drug, for example and without limitation, adjuvants, anti-oxidants, buffers, bacteriostats, lipids, liposomes, lipid nanoparticles, emulsifiers, suspending agents, and rheology modifiers. The formulations may be presented in unit-dose or multi-dose containers, for example, sealed ampoules and vials, and may be stored in a freeze- dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example, water for injections, immediately prior to use. Extemporaneous solutions and suspensions may be prepared.

[0049] Therapeutic / pharmaceutical compositions as described herein may be prepared in accordance with acceptable pharmaceutical procedures, such as described in Remington: The Science and Practice of Pharmacy, 21 st edition, ed. Paul Beringer et al., Lippincott, Williams & Wilkins, Baltimore, MD Easton, Pa. (2005) (see, e.g., Chapters 39, 41 , and 42 for examples of liquid, parenteral, and intravenous formulations and methods of making such formulations).

[0050] Therapeutic compositions typically must be sterile and stable under the conditions of manufacture and storage, other than where live cells are required. For example, sterile injectable solutions can be prepared by incorporating the active agent, e.g., cells or a nucleic acid, in the required amount in an appropriate solvent with one or a combination of ingredients enumerated herein, as required. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, typical methods of preparation are vacuum drying and freeze- drying that yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof. The proper fluidity of a solution can be maintained, for example, by the use of a rheology modifier. Prolonged absorption of injectable compositions can be brought about by including in thecomposition an agent that delays absorption, for example, monostearate salts, gelatin or a hydrogel.

[0051] The phrase "pharmaceutically-acceptable carrier" as used herein means a pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g., lubricant, talc magnesium, calcium or zinc stearate, or steric acid), solvent, or encapsulating material, involved in carrying or transporting a cell or compound from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject being treated. Some examples of materials which can serve as pharmaceutically- acceptable carriers include: (1 ) sugars, such as lactose, glucose and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricating agents, such as magnesium state, sodium lauryl sulfate and talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols, such as propylene glycol; (11 ) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) pH buffered solutions; (21 ) polyesters, polycarbonates and / or polyanhydrides; (22) bulking agents, such as polypeptides and amino acids (23) serum component, such as serum albumin, HDL and LDL; and (22) other non-toxic compatible substances employed in pharmaceutical formulations. Remington: The Science and Practice of Pharmacy, The University of the Sciences in Philadelphia, Editor, Lippincott, Williams, & Wilkins, Philadelphia, Pa., 21 st Edition (2005) (see above), describes compositions and formulations suitable for pharmaceutical delivery of one or more therapeutic compositions, such as a cell, and additional pharmaceutical agents.

[0052] In general, the nature of the carrier will depend on the particular mode of administration being employed. For instance, parenteral formulations usually comprise injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle. For solid compositions (for example, powder, pill,tablet, or capsule forms), conventional non-toxic solid carriers can include, for example, pharmaceutical grades of mannitol, lactose, starch, or magnesium stearate. In addition to biologically-neutral carriers, pharmaceutical compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.

[0053] Provided herein are methods for treating a condition related to protein misfolding and / or increased stress in the endoplasmic reticulum (ER), including administering to the patient a composition that aids in protein folding and / or reduces stress in the endoplasmic reticulum, in an amount effective to treat the condition.

[0054] When the ER becomes overloaded with unfolded or misfolded proteins, it triggers ER stress and activates the Unfolded Protein Response (UPR). Therapies that enhance protein folding can influence lipid metabolism, as both the ER and its stress status play a key role in lipid synthesis and storage. One such therapeutic agent, 4- phenylbutyric acid (4PBA), shows potential in alleviating protein misfolding and ER stress. It mitigates the adverse effects of UPR and helps restore ER lipid homeostasis by downregulating SREBP1 c, a critical transcription factor that controls the expression of lipid metabolism genes such as ACC and FASN. This downregulation reduces lipid accumulation, alleviates lipotoxicity-induced ER stress, and promotes a balanced lipid profile. Moreover, by decreasing ER stress, 4PBA can also reduce the inflammatory phenotype often associated with metabolic disorders, which further exacerbates lipid metabolism dysfunction. Therefore, genetic polymorphisms that contribute to ER stress, such as PNPLA3 rs738409 and PTPRD rs10756038, may benefit from treatment with 4PBA.

[0055] In non-limiting embodiments, the patient has a liver dysfunction and the method includes administering to the patient a composition that reduces stress in the endoplasmic reticulum in an amount effective to treat the liver dysfunction in the patient.

[0056] In non-limiting embodiments, the patient has cirrhosis. In non-limiting embodiments, the patient has non-alcoholic steatohepatitis. In non-limiting embodiments, the patient has fatty liver disease. In non-limiting embodiments, the patient has end-stage liver disease. In non-limiting embodiments, the patient has hepatitis. In non-limiting embodiments, the patient has metabolic dysfunction- associated steatotic liver disease (MASLD). While specific conditions are disclosedherein those of skill in the art will appreciate that other conditions associated with and / or related to ER stress and / or protein misfolding may benefit from the treatments described herein.

[0057] A number of potential mutations can result in protein misfolding and / or increased stress in the ER. In non-limiting embodiments, the mutations is in a gene encoding a transmembrane 6 superfamily 2 (TM6SF2) protein, a Patatin-like phospholipase domain-containing protein 3 (PNPLA3), and / or a protein tyrosine phosphatase receptor type D (PTPRD).

[0058] In non-limiting embodiments, the mutation is in TM6SF2. Such mutations may contribute to liver disease progression, advancing from simple steatosis to fibrosis and ultimately end-stage liver disease. In non-limiting embodiments, the mutation is an E167K mutation in TM6SF2, which may result in a loss of function that impairs the liver's ability to secrete very low-density lipoproteins (VLDL), leading to triglyceride accumulation within hepatocytes. RNA-seq analysis revealed that iHep-TM6SF2- E167K cells show upregulation of genes involved in cholesterol, fatty acid, and glucose metabolism compared to iHep-TM6SF2-WT. Global lipidomics demonstrated increased levels of lipids related to fatty acid synthesis and degradation. Tracing experiments showed a significant increase in the fraction of high-mass isotopologues derived from glucose for all the fatty acids in iHep-TM6SF2-E167K. The major building block for fatty acid synthesis is acetyl-CoA. One of the major sources of acetyl-CoA is glycolysis, in which glucose is broken into pyruvate, enters the TCA cycle, and generates acetyl-CoA. This acetyl-CoA forms long-chain fatty acids that are incorporated into triacylglycerol, phospholipids, and cholesterol esters in hepatocytes, which are stored in lipid droplets. Our results from the tracing experiments suggest that there is significantly higher production of acetyl-CoA contributing to fatty acid synthesis in iHep-TM6SF2-E167K cells when compared to iHep-TM6SF2-WT.

[0059] This aforementioned lipid retention may promote hepatic steatosis by reducing lipid export. Over time, repeated lipotoxic injury and associated inflammation activate hepatic stellate cells, triggering extracellular matrix deposition and fibrogenesis. Persistent fibrosis and chronic inflammation progressively damage liver architecture, resulting in cirrhosis and, ultimately, end-stage liver failure.

[0060] Accordingly, in non-limiting embodiments, the patient has a polymorphism in a gene that is associated with lipid metabolism.

[0061] In non-limiting embodiments, the polymorphism is in a gene having a sequence having at least 80%, at least 85%, at least 90%, at least 95%, and / or at least 99% sequence identity to SEQ ID NO: 12, SEQ ID NO: 14, and / or SEQ ID NO: 16. In non-limiting embodiments, the polymorphism is in a gene has a sequence having at least 80%, at least 85%, at least 90%, at least 95%, and / or at least 99% sequence identity to SEQ ID NO: 13, SEQ ID NO: 15, and / or SEQ ID NO: 17.

[0062] In non-limiting embodiments, the polymorphism is in TM6SF2 (e.g., in a gene having the sequence of SEQ ID NO: 14, or a gene having 70%, 75%, 80%, 85%, 90%, 95%, 99%, or greater, all values and subranges therebetween inclusive, sequence identity to SEQ ID NO: 14, so long as, in non-limiting embodiments, the gene has a guanine at position 715), and, in non-limiting embodiments, the polymorphism is rs58542926. In non-limiting embodiments the patient has a gene encoding PNPLA3 having the sequence of SEQ ID NO: 15, or a gene having 70%, 75%, 80%, 85%, 90%, 95%, 99%, or greater, all values and subranges therebetween inclusive, sequence identity to SEQ ID NO: 15, so long as, in non-limiting embodiments, the gene has an adenine at position 715.

[0063] In non-limiting embodiments, the polymorphism is in PNPLA3 (e.g., in a gene having the sequence of SEQ ID NO: 12, or a gene having 70%, 75%, 80%, 85%, 90%, 95%, 99%, or greater, all values and subranges therebetween inclusive, sequence identity to SEQ ID NO: 12, so long as, in non-limiting embodiments, the gene has a cytosine at position 773), and in non-limiting embodiments the polymorphism is rs738409. In non-limiting embodiments the patient has a gene encoding PNPLA3 having the sequence of SEQ ID NO: 13, or a gene having 70%, 75%, 80%, 85%, 90%, 95%, 99%, or greater, all values and subranges therebetween inclusive, sequence identity to SEQ ID NO: 13, so long as, in non-limiting embodiments, the gene has a guanine at position 773.

[0064] In non-limiting embodiments, the polymorphism is in PTPRD (e.g., in a gene having the sequence of SEQ ID NO: 16, or a gene having 70%, 75%, 80%, 85%, 90%, 95%, 99%, or greater, all values and subranges therebetween inclusive, sequence identity to SEQ ID NO: 16, so long as, in non-limiting embodiments, the gene has a thymine at position 1 ,793), and in non-limiting embodiments the polymorphism is rs10756038. In non-limiting embodiments the patient has a gene encoding PNPLA3 having the sequence of SEQ ID NO: 17, or a gene having 70%, 75%, 80%, 85%, 90%, 95%, 99%, or greater, all values and subranges therebetween inclusive, sequenceidentity to SEQ ID NO: 17, so long as, in non-limiting embodiments, the gene has a cytosine at position 1 ,793.

[0065] A patient may have one or more of the aforementioned polymorphisms, or any similar polymorphism that causes protein misfolding and / or increases stress in the ER.

[0066] As discussed above, conditions associated with protein misfolding and / or increased ER stress may have physiologic effects, for example in terms of retention and / or release of fatty acids and / or lipids. Accordingly, in non-limiting embodiments, the patient exhibits reduced circulating (e.g., in the blood) levels of fatty acids. As a result of the treatments described herein, in non-limiting embodiments administering the composition to the patient increases the levels of circulating fatty acids in the patient.

[0067] In non-limiting embodiments, the patient exhibits reduced circulating (e.g., in the blood) levels of lipids. As a result of the treatments described herein, in nonlimiting embodiments administering the composition to the patient increases the levels of circulating lipids in the patient. In non-limiting embodiments, the lipids are VLDL.

[0068] Diagnosis of low VLDL typically begins with a fasting lipid panel, where VLDL cholesterol is estimated by dividing triglyceride levels by five (valid when triglycerides are <400 mg / dL). For more accurate assessment, advanced lipid testing such as nuclear magnetic resonance (NMR) spectroscopy, lipoprotein electrophoresis, or Apolipoprotein B (ApoB) quantification can be used to directly measure VLDL particle numbers and subtypes.

[0069] In non-limiting embodiments, the composition that is administered to the patient is a protein folding facilitator. As used herein, the term “protein folding facilitator” includes both natural and synthetic compositions, including molecular chaperones such as HSP70 and HSP90, as well as chemical chaperones like 4- phenylbutyric acid (4-PBA), tauroursodeoxycholic acid (TUDCA), and trimethylamine N-oxide (TMAO). In non-limiting embodiments, the composition is 4-phenylbutyric acid (4-PBA), or a pharmaceutically acceptable salt thereof.

[0070] In non-limiting embodiments, the composition that is administered to the patient is a histone deacetylase (HDAC) inhibitor. In non-limiting embodiments the HDAC inhibitor is one or more of vorinostat, romidepsin, belinostat, Panobinostat, entinostat, givinostat, abexinostat, tucidinostat, pracinostat, ricolinostat, valproic acid,4-phenylbutyric acid (4-PBA), a pharmaceutically-acceptable salt of any of the foregoing, and / or any combination thereof.

[0071] In non-limiting embodiments, the composition that is administered to the patient is an antioxidant, for example, Vitamin A, Vitamin C, Vitamin E, Uric acid, superoxide dismutase, catalase, glutathione peroxidase, selenium, zinc, manganese, glutathione, carotenoids (e.g., beta-carotene), flavonoids, phenols, coenzyme Q10, lipoic acid, resveratrol, curcumin, quercetin, catechins, melatonin, n-acetylcysteine, astaxanthin, a pharmaceutically-acceptable salt of any of the foregoing, and / or any combination thereof.

[0072] In non-limiting embodiments, the composition that is administered to the patient is ursodeoxycholic acid, tauroursodeoxycholic acid, a GLP-1 receptor agonist, 4p8c, epigallocatechin-3-gallate (EGCG), luteolin, GSK2606414, rapamycin, a pharmaceutically-acceptable salt of any of the foregoing, and / or any combination thereof.

[0073] The aforementioned compositions may be combined, and may be administered in any amount effective to treat the protein misfolding and / or ER stress. For example, compositions may be administered

[0074] Administration of a composition, pharmaceutically acceptable salt thereof, or a formulation comprising a composition or salt thereof to a subject can be used to at least partially ameliorate a condition associated with protein misfolding and / or ER stress in a patient. Administration of a composition, pharmaceutically acceptable, or formulation can be performed for a treatment duration of at least about at least about 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26,27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49,50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72,73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95,96, 97, 98, 99, or 100 days consecutive or nonconsecutive days. In some embodiments, a treatment duration can be from about 1 to about 30 days, from about 2 to about 30 days, from about 3 to about 30 days, from about 4 to about 30 days, from about 5 to about 30 days, from about 6 to about 30 days, from about 7 to about 30 days, from about 8 to about 30 days, from about 9 to about 30 days, from about 10 to about 30 days, from about 11 to about 30 days, from about 12 to about 30 days, from about 13 to about 30 days, from about 14 to about 30 days, from about 15 to about 30 days, from about 16 to about 30 days, from about 17 to about 30 days, fromabout 18 to about 30 days, from about 19 to about 30 days, from about 20 to about 30 days, from about 21 to about 30 days, from about 22 to about 30 days, from about 23 to about 30 days, from about 24 to about 30 days, from about 25 to about 30 days, from about 26 to about 30 days, from about 27 to about 30 days, from about 28 to about 30 days, or from about 29 to about 30 days.

[0075] Administration of a composition, pharmaceutically acceptable, or formulation can be performed at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, or 24 times a day. In some embodiments, administration of a composition, pharmaceutically acceptable, or formulation can be performed at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 times a week. In some embodiments, administration of a composition, pharmaceutically acceptable, or formulation can be performed at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15,16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38,39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 ,62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84,85, 86, 87, 88, 89, or 90 times a month.

[0076] In some embodiments, administration of the pharmaceutical formulation comprising a composition or pharmaceutically acceptable salt occurs over a time period of from at least about 0.5 min to at least about 1 min, from at least about 1 min to at least about 2 min, from at least about 2 min to at least about 3 min, from at least about 3 min to at least about 4 min, from at least about 4 min to at least about 5 min, from at least about 5 min to at least about 6 min, from at least about 6 min to at least about 7 min, from at least about 7 min to at least about 8 min, from at least about 8 min to at least about 9 min, from at least about 9 min to at least about 10 min, from at least about 10 min to at least about 11 min, from at least about 1 1 min to at least about 12 min, from at least about 12 min to at least about 13 min, from at least about 13 min to at least about 14 min, from at least about 14 min to at least about 15 min, from at least about 15 min to at least about 16 min, from at least about 16 min to at least about 17 min, from at least about 17 min to at least about 18 min, from at least about 18 min to at least about 19 min, from at least about 19 min to at least about 20 min, from at least about 21 min to at least about 22 min, from at least about 22 min to at least about 23 min, from at least about 23 min to at least about 24 min, from at least about 24 min to at least about 25 min, from at least about 25 min to at least about 26 min, from at least about 26 min to at least about 27 min, from at least about 27 min to at least about28 min, from at least about 28 min to at least about 29 min, or from at least about 29 min to at least about 30 min.

[0077] In some embodiments, a composition, pharmaceutically acceptable salt thereof, or pharmaceutical formulation comprising a composition or salt thereof described herein can be administered at a dose of from about 1 milligram (mg) to about 1000 mg, from about 5 mg to about 1000 mg, from about 10 mg to about 1000 mg, from about 15 mg to about 1000 mg, from about 20 mg to about 1000 mg, from about 25 mg to about 1000 mg, from about 30 mg to about 1000 mg, from about 35 mg to about 1000 mg, from about 40 mg to about 1000 mg, from about 45 mg to about 1000 mg, from about 50 mg to about 1000 mg, from about 55 mg to about 1000 mg, from about 60 mg to about 1000 mg, from about 65 mg to about 1000 mg, from about 70 mg to about 1000 mg, from about 75 mg to about 1000 mg, from about 80 mg to about 1000 mg, from about 85 mg to about 1000 mg, from about 90 mg to about 1000 mg, from about 95 mg to about 1000 mg, from about 100 mg to about 1000 mg, from about 150 mg to about 1000 mg, from about 200 mg to about 1000 mg, from about 250 mg to about 1000 mg, from about 300 mg to about 1000 mg, from about 350 mg to about 1000 mg, from about 400 mg to about 1000 mg, from about 450 mg to about 1000 mg, from about 500 mg to about 1000 mg, from about 550 mg to about 1000 mg, from about 600 mg to about 1000 mg, from about 650 mg to about 1000 mg, from about 700 mg to about 1000 mg, from about 750 mg to about 1000 mg, from about 800 mg to about 1000 mg, from about 850 mg to about 1000 mg, from about 900 mg to about 1000 mg, or from about 950 mg to about 1000 mg. In some embodiments, a composition, pharmaceutically acceptable salt thereof, or pharmaceutical formulation comprising a composition or salt thereof described herein can be administered at a dose of about 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22,23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45,46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68,69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 ,92, 93, 94, 95, 96, 97, 98, 99, 100, 101 , 102, 103, 104, 105, 106, 107, 108, 109, 1 10, 1 1 1 , 112, 1 13, 1 14, 1 15, 1 16, 1 17, 1 18, 1 19, 120, 121 , 122, 123, 124, 125, 126, 127,128, 129, 130, 131 , 132, 133, 134, 135, 136, 137, 138, 139, 140, 141 , 142, 143, 144,145, 146, 147, 148, 149, 150, 151 , 152, 153, 154, 155, 156, 157, 158, 159, 160, 161 ,162, 163, 164, 165, 166, 167, 168, 169, 170, 171 , 172, 173, 174, 175, 176, 177, 178,179 180, 181 , 182, 183, 184, 184, 186, 187, 188, 189, 190, 191 , 192, 193, 194, 195,196, 197, 198, 199, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320,330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490,500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660,670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830,840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, or 1000 mg.

[0078] In some embodiments, pharmaceutical formulation comprising a composition or pharmaceutically acceptable salt is present at a concentration from at least about 0.01 micrograms per milliliter (pg / mL) to at least about 100 milligrams per milliliter (mg / mL). In some embodiments, the composition or pharmaceutically acceptable salt is present at a concentration from at least about at least about 0.1 mg / mL to at least about 5 mg / mL. In some embodiments, the composition or pharmaceutically acceptable salt is present at a concentration from at least about at least about 0.5 mg / mL to at least about 1 mg / mL. In some embodiments, the composition or pharmaceutically acceptable salt is present at a concentration about 1 mg / mL. In some embodiments, the composition or pharmaceutically acceptable salt is present at a concentration about 2 mg / mL. In some embodiments, the composition or pharmaceutically acceptable salt is present at a concentration about 3 mg / mL. In some embodiments, the composition or pharmaceutically acceptable salt is present at a concentration about 4 mg / mL. In some embodiments, the composition or pharmaceutically acceptable salt is present at a concentration about 5 mg / mL. In some embodiments, the composition or pharmaceutically acceptable salt is present at a concentration about 6 mg / mL. In some embodiments, the composition or pharmaceutically acceptable salt is present at a concentration about 7 mg / mL. In some embodiments, the composition or pharmaceutically acceptable salt is present at a concentration about 8 mg / mL. In some embodiments, the composition or pharmaceutically acceptable salt is present at a concentration about 9 mg / mL. In some embodiments, the composition or pharmaceutically acceptable salt is present at a concentration about 10 mg / mL. In some embodiments, the composition or pharmaceutically acceptable salt is present at a concentration about 20 mg / mL. In some embodiments, the composition or pharmaceutically acceptable salt is present at a concentration about 30 mg / mL. In some embodiments, the composition or pharmaceutically acceptable salt is present at a concentration about 40 mg / mL. In some embodiments, the composition or pharmaceutically acceptable salt is present ata concentration about 50 mg / mL. In some embodiments, the composition or pharmaceutically acceptable salt is present at a concentration about 60 mg / mL. In some embodiments, the composition or pharmaceutically acceptable salt is present at a concentration about 70 mg / mL. In some embodiments, the composition or pharmaceutically acceptable salt is present at a concentration about 80 mg / mL. In some embodiments, the composition or pharmaceutically acceptable salt is present at a concentration about 90 mg / mL. In some embodiments, the composition or pharmaceutically acceptable salt is present at a concentration about 100 mg / mL.

[0079] In some embodiments, pharmaceutical formulation comprising a composition or pharmaceutically acceptable salt can exhibit antimicrobial activity against an infection at a concentration from at least about 0.01 pg / mL to at least about 0.02 pg / mL, from at least about 0.02 pg / mL to at least about 0.03 pg / mL, from at least about 0.03 pg / mL to at least about 0.04 pg / mL, from at least about 0.04 pg / mL to at least about 0.05 pg / mL, from at least about 0.05 pg / mL to at least about 0.06 pg / mL, from at least about 0.06 pg / mL to at least about 0.07 pg / mL, from at least about 0.07 pg / mL to at least about 0.08 pg / mL, from at least about 0.08 pg / mL to at least about 0.09 pg / mL, from at least about 0.09 pg / mL to at least about 0.1 pg / mL, from at least about 0.1 pg / mL to at least about 0.2 pg / mL, from at least about 0.2 pg / mL to at least about 0.3 pg / mL, from at least about 0.3 pg / mL to at least about 0.4 pg / mL, from at least about 0.4 pg / mL to at least about 0.5 pg / mL, from at least about 0.5 pg / mL to at least about 0.6 pg / mL, from at least about 0.6 pg / mL to at least about 0.7 pg / mL, from at least about 0.7 pg / mL to at least about 0.8 pg / mL, from at least about 0.8 pg / mL to at least about 0.9 pg / mL, from at least about 0.9 pg / mL to at least about 1 pg / mL, from at least about 1 pg / mL to at least about 2 pg / mL, from at least about 2 pg / mL to at least about 3 pg / mL, from at least about 3 pg / mL to at least about 4 pg / mL, from at least about 4 pg / mL to at least about 5 pg / mL, from at least about 5 pg / mL to at least about 6 pg / mL, from at least about 6 pg / mL to at least about 7 pg / mL, from at least about 7 pg / mL to at least about 8 pg / mL, from at least about 8 pg / mL to at least about9 pg / mL, from at least about 9 pg / mL to at least about 10 pg / mL, from at least about10 pg / mL to at least about 20 pg / mL, from at least about 20 pg / mL to at least about 30 pg / mL, from at least about 30 pg / mL to at least about 40 pg / mL, from at least about 40 pg / mL to at least about 50 pg / mL, from at least about 50 pg / mL to at least about 60 pg / mL, from at least about 60 pg / mL to at least about 70 pg / mL, from at least about 70 pg / mL to at least about 80 pg / mL, from at least about 80 pg / mL to at least about90 ng / ml_, from at least about 90 pg / mL to at least about 0.1 mg / mL, from at least about 0.1 mg / mL to at least about 0.2 mg / mL, from at least about 0.2 mg / mL to at least about 0.3 mg / mL, from at least about 0.3 mg / mL to at least about 0.4 mg / mL, from at least about 0.4 mg / mL to at least about 0.5 mg / mL, from at least about 0.5 mg / mL to at least about 0.6 mg / mL, from at least about 0.6 mg / mL to at least about 0.7 mg / mL, from at least about 0.7 mg / mL to at least about 0.8 mg / mL, from at least about 0.8 mg / mL to at least about 0.9 mg / mL, from at least about 0.9 mg / mL to at least about 1 mg / mL, from at least about 1 mg / mL to at least about 2 mg / mL, from at least about 2 mg / mL to at least about 3 mg / mL, from at least about 3 mg / mL to at least about 4 mg / mL, from at least about 4 mg / mL to at least about 5 mg / mL, from at least about 5 mg / mL to at least about 6 mg / mL, from at least about 6 mg / mL to at least about 7 mg / mL, from at least about 7 mg / mL to at least about 8 mg / mL, from at least about 8 mg / mL to at least about 9 mg / mL, from at least about 9 mg / mL to at least about 10 mg / mL, from at least about 10 mg / mL to at least about 20 mg / mL, from at least about 20 mg / mL to at least about 30 mg / mL, from at least about 30 mg / mL to at least about 40 mg / mL, from at least about 40 mg / mL to at least about 50 mg / mL, from at least about 50 mg / mL to at least about 60 mg / mL, from at least about 60 mg / mL to at least about 70 mg / mL, from at least about 70 mg / mL to at least about 80 mg / mL, from at least about 80 mg / mL to at least about 90 mg / mL, or from at least about 90 mg / mL to at least about 100 mg / mL.

[0080] In some embodiments, effective amounts of a composition or pharmaceutically acceptable salt for treating or preventing an infection can be a concentration from at least about 0.01 pg / mL to at least about 100 mg / mL. In some embodiments, effective amounts of a composition or pharmaceutically acceptable salt for treating or preventing an infection is at a concentration from at least about at least about 0.1 mg / mL to at least about 5 mg / mL. In some embodiments, effective amounts of a composition or pharmaceutically acceptable salt for treating or preventing an infection is at a concentration from at least about at least about 0.5 mg / mL to at least about 1 mg / mL.

[0081] In some embodiments, effective amounts of a composition or pharmaceutically acceptable salt for treating or preventing an infection is at a concentration about 1 mg / mL. In some embodiments, the effective amounts of a composition or pharmaceutically acceptable salt for treating or preventing an infection is at a concentration about 2 mg / mL. In some embodiments, the effective amounts ofa composition or pharmaceutically acceptable salt for treating or preventing an infection is at a concentration about 3 mg / mL. In some embodiments, the effective amounts of a composition or pharmaceutically acceptable salt for treating or preventing an infection is at a concentration about 4 mg / mL. In some embodiments, the effective amounts of a composition or pharmaceutically acceptable salt for treating or preventing an infection is at a concentration about 5 mg / mL. In some embodiments, the effective amounts of a composition or pharmaceutically acceptable salt for treating or preventing an infection is at a concentration about 6 mg / mL. In some embodiments, the effective amounts of a composition or pharmaceutically acceptable salt for treating or preventing an infection is at a concentration about 7 mg / mL. In some embodiments, the effective amounts of a composition or pharmaceutically acceptable salt for treating or preventing an infection is at a concentration about 8 mg / mL. In some embodiments, the effective amounts of a composition or pharmaceutically acceptable salt for treating or preventing an infection is at a concentration about 9 mg / mL. In some embodiments, the effective amounts of a composition or pharmaceutically acceptable salt for treating or preventing an infection is at a concentration about 10 mg / mL.

[0082] In some embodiments, effective amounts of a composition or pharmaceutically acceptable salt for treating or preventing an infection may be a concentration from at least about 0.01 pg / mL to at least about 0.02 pg / mL, from at least about 0.02 pg / mL to at least about 0.03 pg / mL, from at least about 0.03 pg / mL to at least about 0.04 pg / mL, from at least about 0.04 pg / mL to at least about 0.05 pg / mL, from at least about 0.05 pg / mL to at least about 0.06 pg / mL, from at least about 0.06 pg / mL to at least about 0.07 pg / mL, from at least about 0.07 pg / mL to at least about 0.08 pg / mL, from at least about 0.08 pg / mL to at least about 0.09 pg / mL, from at least about 0.09 pg / mL to at least about 0.1 pg / mL, from at least about 0.1 pg / mL to at least about 0.2 pg / mL, from at least about 0.2 pg / mL to at least about 0.3 pg / mL, from at least about 0.3 pg / mL to at least about 0.4 pg / mL, from at least about 0.4 pg / mL to at least about 0.5 pg / mL, from at least about 0.5 pg / mL to at least about 0.6 pg / mL, from at least about 0.6 pg / mL to at least about 0.7 pg / mL, from at least about 0.7 pg / mL to at least about 0.8 pg / mL, from at least about 0.8 pg / mL to at least about 0.9 pg / mL, from at least about 0.9 pg / mL to at least about 1 pg / mL, from at least about 1 pg / mL to at least about 2 pg / mL, from at least about 2 pg / mL to at least about 3 pg / mL, from at least about 3 pg / mL to at least about 4 pg / mL, from at least about 4 pg / mL to at least about 5 pg / mL, from at least about 5 pg / mL to at least about 6 pg / mL,from at least about 6 pg / mL to at least about 7 pg / mL, from at least about 7 pg / mL to at least about 8 pg / mL, from at least about 8 pg / mL to at least about 9 pg / mL, from at least about 9 pg / mL to at least about 10 pg / mL, from at least about 10 pg / mL to at least about 20 pg / mL, from at least about 20 pg / mL to at least about 30 pg / mL, from at least about 30 pg / mL to at least about 40 pg / mL, from at least about 40 pg / mL to at least about 50 pg / mL, from at least about 50 pg / mL to at least about 60 pg / mL, from at least about 60 pg / mL to at least about 70 pg / mL, from at least about 70 pg / mL to at least about 80 pg / mL, from at least about 80 pg / mL to at least about 90 pg / mL, from at least about 90 pg / mL to at least about 0.1 mg / mL, from at least about 0.1 mg / mL to at least about 0.2 mg / mL, from at least about 0.2 mg / mL to at least about 0.3 mg / mL, from at least about 0.3 mg / mL to at least about 0.4 mg / mL, from at least about 0.4 mg / mL to at least about 0.5 mg / mL, from at least about 0.5 mg / mL to at least about 0.6 mg / mL, from at least about 0.6 mg / mL to at least about 0.7 mg / mL, from at least about 0.7 mg / mL to at least about 0.8 mg / mL, from at least about 0.8 mg / mL to at least about 0.9 mg / mL, from at least about 0.9 mg / mL to at least about 1 mg / mL, from at least about 1 mg / mL to at least about 2 mg / mL, from at least about 2 mg / mL to at least about 3 mg / mL, from at least about 3 mg / mL to at least about 4 mg / mL, from at least about 4 mg / mL to at least about 5 mg / mL, from at least about 5 mg / mL to at least about 6 mg / mL, from at least about 6 mg / mL to at least about 7 mg / mL, from at least about 7 mg / mL to at least about 8 mg / mL, from at least about 8 mg / mL to at least about 9 mg / mL, from at least about 9 mg / mL to at least about 10 mg / mL, from at least about 10 mg / mL to at least about 20 mg / mL, from at least about 20 mg / mL to at least about 30 mg / mL, from at least about 30 mg / mL to at least about 40 mg / mL, from at least about 40 mg / mL to at least about 50 mg / mL, from at least about 50 mg / mL to at least about 60 mg / mL, from at least about 60 mg / mL to at least about 70 mg / mL, from at least about 70 mg / mL to at least about 80 mg / mL, from at least about 80 mg / mL to at least about 90 mg / mL, or from at least about 90 mg / mL to at least about 100 mg / mL.

[0083] In some embodiments, effective amounts of a composition or pharmaceutically acceptable salt for treating or preventing an infection may be from at least about 1 microliter (pL) to at least about 2 pL, from at least about 2 pL to at least about 3 pL, from at least about 3 pL to at least about 4 pL, from at least about 4 pL to at least about 5 pL, from at least about 5 pL to at least about 6 pL, from at least about 6 pL to at least about 7 pL, from at least about 7 pL to at least about 8 pL, from at least about 8 pL to at least about 9 pL, from at least about 9 pL to at least about 10 pL, fromat least about 10 nL to at least about 20 nL, from at least about 20 [_iL to at least about 30 nL, from at least about 30 nL to at least about 40 nL, from at least about 40 nL to at least about 50 nL, from at least about 50 [_iL to at least about 60 nL, from at least about 60 |_iL to at least about 70 nL, from at least about 70 nL to at least about 80 nL, from at least about 80 nL to at least about 90 nL, from at least about 90 nL to at least about 100 nL, from at least about 100 [_iL to at least about 200 nL, from at least about 200 |JL to at least about 300 nL, from at least about 300 nL to at least about 400 nL, from at least about 400 nL to at least about 500 nL, from at least about 500 nL to at least about 600 nL, from at least about 600 [_iL to at least about 700 nL, from at least about 700 |_iL to at least about 800 nL, from at least about 800 nL to at least about 900 HL, from at least about 900 nL to at least about 1 milliliter (mL), from at least about 1 mL to at least about 2 mL, from at least about 2 mL to at least about 3 mL, from at least about 3 mL to at least about 4 mL, from at least about 4 mL to at least about 5 mL, from at least about 5 mL to at least about 6 mL, from at least about 6 mL to at least about 7 mL, from at least about 7 mL to at least about 8 mL, from at least about8 mL to at least about 9 mL, from at least about 9 mL to at least about 10 mL, from at least about 10 mL to at least about 20 mL, from at least about 20 mL to at least about 30 mL, from at least about 30 mL to at least about 40 mL, from at least about 40 mL to at least about 50 mL, from at least about 50 mL to at least about 60 mL, from at least about 60 mL to at least about 70 mL, from at least about 70 mL to at least about 80 mL, from at least about 80 mL to at least about 90 mL, from at least about 90 mL to at least about 100 mL, from at least about 100 mL to at least about 200 mL, from at least about 200 mL to at least about 300 mL, from at least about 300 mL to at least about 400 mL, from at least about 400 mL to at least about 500 mL, from at least about 500 mL to at least about 600 mL, from at least about 600 mL to at least about 700 mL, from at least about 700 mL to at least about 800 mL, from at least about 800 mL to at least about 900 mL, from at least about 900 mL to at least about 1 liter (L), from at least about 1 L to at least about 2 L, from at least about 2 L to at least about 3 L, from at least about 3 L to at least about 4 L, from at least about 4 L to at least about 5 L, from at least about 5 L to at least about 6 L, from at least about 6 L to at least about 7 L, from at least about 7 L to at least about 8 L, from at least about 8 L to at least about9 L, from at least about 9 L to at least about 10 L, from at least about 10 L to at least about 20 L, from at least about 20 L to at least about 30 L, from at least about 30 L to at least about 40 L, from at least about 40 L to at least about 50 L, from at least about50 L to at least about 60 L, from at least about 60 L to at least about 70 L, from at least about 70 L to at least about 80 L, from at least about 80 L to at least about 90 L, from at least about 90 L to at least about 100 L, from at least about 100 L to at least about 200 L, from at least about 200 L to at least about 300 L, from at least about 300 L to at least about 400 L, from at least about 400 L to at least about 500 L, from at least about 500 L to at least about 600 L, from at least about 600 L to at least about 700 L, from at least about 700 L to at least about 800 L, from at least about 800 L to at least about 900 L, from at least about 900 L to at least about 1 kiloliter (kL), from at least about 1 kL to at least about 2 kL, from at least about 2 kL to at least about 3 kL, from at least about 3 kL to at least about 4 kL, from at least about 4 kL to at least about 5 kL, from at least about 5 kL to at least about 6 kL, from at least about 6 kL to at least about 7 kL, from at least about 7 kL to at least about 8 kL, from at least about 8 kL to at least about 9 kL, or from at least about 9 kL to at least about 10 kL.

[0084] Those of skill in the art will appreciate that any dosing regimen (including frequency and dose) described herein includes all subranges and individua lvalues between the disclosed ranges.

[0085] In non-limiting embodiments, the composition is 4-PBA and is administered in an amount of 500 mg / kg / day, which may be escalated, for example to 675- 1200 mg / kg / day (all values and subranges therebetween inclusive. In non-limiting embodiments, the composition is 4-PBA and is administered in an amount of 60- 360 mg / kg / day (all values and subranges therebetween), from once to twice daily. In non-limiting embodiments, the composition is 4-PBA and is administered in an amount of from 450-600 mg / kg / day, all values and subranges therebetween inclusive.ExampleMethods

[0086] Generation and Culture of Human iPSC

[0087] iPSC-TM6SF2-WT was generated from fibroblasts. Fibroblasts were reprogrammed using episomal plasmid vectors adapted from a previously described method. Briefly, for each nucleofection, 1 million cells were resuspended in 100 mL of the AmaxaTM NHDF Nucleofector Kit (Lonza, Walkersville, MD), containing 1 pg of each of the four episomal plasmid vectors encoding OCT3 / 4 and p53 shRNA, SOX2 and KLF4, L-MYC and LIN28, and enhanced green fluorescent protein (eGFP) (Addgene, Boston, MA). Cells were nucleofected using the Amaxa 4D-Nucleofector (Lonza, Walkersville, MD) and plated in mTeSR on human embryonic stem cell-qualified Matrigel-coated plates (Corning, New York, NY). Colonies were isolated around 60 days after induction based on morphology. These cell lines underwent karyotyping, and pluripotency was validated by the expression of NANOG, OCT4, and membrane markers SSEA and TRA-1 -60 at different passages. Additionally, the cell lines were routinely tested and found to be negative for mycoplasma contamination. A commercial iPS cell (WTC1 1 ) was used as a positive control (Coriell Institute, Camden, NJ).

[0088] Gene Editing

[0089] The single-guide RNA (sgRNA) sequence (GCAAATACAGCTCCGAGATC) (SEQ ID NO: 1 ) was designed to cut the human TM6SF2 gene at position chr19:379,549 and replace the major allele (C) with the minor allele (T). The sgRNA was cloned into a plasmid vector and nucleofected into the iPSC-TM6SF2-WT together with the donor DNA(ACAGATGTCCAGCAGGGTTCTGGCATGGCTGATGCCCTCTCTCCTGCACCATG GAAGGCAAATACAGCTCCAAGATCAGACCTGCCTTCTTCCTCACCATCCCCTAC CTGCTGGTGCCATGCTGGGCTGGCATGAAGGTCT) (SEQ ID NO: 2), using the Amaxa 4D-Nucleofector (Lonza, Walkersville, MD). For each nucleofection, 1 million cells were resuspended in 20 pL of the Amaxa NHDF Nucleofector Kit (Lonza, Walkersville, MD), containing 1 pg of each of the gRNA and donor plasmid vectors (ABM, Richmond, Canada). The plasmid vector containing the gRNA also included a puromycin resistance gene. Forty-eight hours after transfection, selection was performed using 1 pg / mL of puromycin. After 7 days of selection, single clones were harvested. DNA from selected clonal colonies was extracted and amplified before performing Sanger sequencing. Minor homozygous clones were identified, expanded, and cryopreserved, and one clone was used to perform the experiments.

[0090] Off-target experiments were performed using the same gRNA. For these, we used HepG2 cells which were seeded at a density of 0.3 x 105cells per well in 1000 pL of growth medium in 12-well plates one day prior to transfection. This density was targeted to allow the cells to reach 50-70% confluence at the time of transfection. On the day of transfection, 50 pL of Opti-MEM medium was added to a sterile 1.5 mL Eppendorf tube, followed by 3 pL of Lipofectamine 3000 reagent (ThermoFisher Scientific, Waltham, MA). This mixture was briefly vortexed. Subsequently, the Lipofectamine solution was combined with a solution of 4 pg of the plasmid containing Cas9 and TM6 gRNA and 2 pL of P3000 reagent (ThermoFisher Scientific, Waltham,MA) in 50 pL of Opti-MEM medium. This final mixture was incubated at room temperature for 15 minutes to allow DNA-lipid complexes to form before being added to the cells. Selection with 2 pg / mL puromycin commenced 48 hours post-transfection. Cells were harvested 72 hours after selection to conduct genome modification assays using the GeneArt Genomic Cleavage Detection Kit (ThermoFisher Scientific, Waltham, MA), according to the manufacturer's instructions. The gRNA sequence targeting the TM6SF2 locus was 5'-GCAAATACAGCTCCGAGATC-3' (SEQ ID NO: 3). After transfection and selection, cells were lysed in 50 pL of cell lysis buffer. The lysate was treated with proteinase K for 15 minutes at 68 °C, followed by a denaturation step at 95 °C for 10 minutes. Subsequently, 2 pL of the lysate were used for PCR amplification with the AmpliTaq Gold 360 Master Mix (ThermoFisher Scientific, Waltham, MA). Primers were designed for three regions of the gene locus: premutation site, mutation target, and post-mutation site. The primers used were: Pre-mutation:Forward 5’-ACAGCTATGTGGTGGGCTTC-3’, (SEQ ID NO: 4)Reverse 5’-CCCTGTTGTCCCTTCCATCC-3’ (SEQ ID NO: 5)Mutation target:Forward 5’-GCAATCCACCTGCCTCATCA-3’, (SEQ ID NO: 6) Reverse 5’-CCCCGTGTCAGTTGCTTTTG-3’ (“SEQ ID NO: 7) Post-mutation:Forward 5’-GCCTATGCTCTCACCTTCCC-3’, (SEQ ID NO: 8) Reverse 5’-GCTGGATGCTGAAGGCTTTG-3’ (SEQ ID NO: 9)

[0091] The PCR conditions were as follows: an initial denaturation at 95 °C for 3 minutes, followed by 40 cycles of 30 seconds at 95 °C, 30 seconds at 55 °C, and 30 seconds at 72 °C. The final extension was at 72 °C for 5 minutes. One and a half pL of PCR product were mixed with 1 pL of 10x Detection Reaction Buffer and 5 pL of water, then denatured and re-annealed using a thermal cycle: 95 °C for 5 minutes, 4°C for 5 minutes, 37°C for 5 minutes, and finally, 4°C for 5 minutes. One pL of 10x detection enzyme was added, and the samples were incubated for 1 hour at 37°C. Digestion products were analyzed by electrophoresis on a 2% agarose gel.

[0092] Differentiation of Human iPSCs into Induced Hepatocytes (iHep)

[0093] Our hepatocyte differentiation protocol was reported previously. Briefly, human iPSCs were passaged with Accutase (Stem Cell Technologies, Vancouver, Canada) and re-plated at a density of 1 to 2x105per cm2in reduced growth factorMatrigel (Corning Incorporated, Corning, NY)-coated plates in mTeSR. The next day, cells were exposed to a defined differentiation medium containing RPMI (Invitrogen, Carlsbad, CA), 1 x B-27 without insulin supplement (Invitrogen, Carlsbad, CA), 0.5% penicillin / streptomycin (Millipore, Billerica, MA), 0.5% Non-Essential Amino Acids (Millipore, Billerica, MA), 100 ng / mL Activin A (R&D Systems, Minneapolis, MN), 10 ng / mL BMP4 (R&D Systems, Minneapolis, MN), and 20 ng / mL FGF2 (BD, Franklin Lakes, NJ) for two days and placed in a normal O2 incubator (endoderm induction). Cells were subsequently maintained in a similar medium without FGF2 and BMP4 for two days in ambient O2 (definitive endoderm). Finally, cells were grown for 10 days in a defined medium containing 45% DMEM low glucose (ThermoFisher Scientific, Waltham, MA), 45% F-12 (ThermoFisher Scientific, Waltham, MA), 10% CTS Knockout SR Xenofree Medium (ThermoFisher Scientific, Waltham, MA), 0.5% Non- Essential Amino Acids (ThermoFisher Scientific, Waltham, MA), 0.5% L-glutamine (ThermoFisher Scientific, Waltham, MA), 50 ng / mL HGF (R&D Systems, Minneapolis, MN), and 1 % DMSO (Sigma-Aldrich, St. Louis, MO). The medium was changed every other day (hepatic specification).

[0094] Enzyme-Linked Immunosorbent Assay (ELISA)

[0095] ELISA for ApoB100 was done using the ApoB100 ELISA Kit (Thermo Scientific, Waltham, MA) according to the manufacturer’s protocol. The quantity of extracellular VLDL was measured using the Biomatik Corporation Human Very Low- Density Lipoprotein (VLDL) Elisa Kit (Biomatik Corporation, Kitchener, Canada) according to the manufacturer’s instructions. The reaction was developed for 30 minutes with 100 pL / well TMB substrate solution and stopped with 50 pL / well stop solution. HRP activity was measured in an HTX microplate reader (Biotek, Winooski, VT) at a wavelength of 450 nm. To calculate the sample value, the absorbance was interpolated with a standard curve generated using a four-parameter algorithm.

[0096] RNA-seq, Differential Gene Analysis, and Gene Set Enrichment Analysis (GSEA)

[0097] Whole-genome strand-specific RNA-seq was used to profile RNA expression levels in iHep-TM6SF2-WT and iHep-TM6SF2-E167K. RNA-seq libraries were prepared as previously described. RNA was extracted using TRIzol, followed by column purification using Zymo RNA Clean and Concentrator Columns (Zymo, Irvine, CA) according to the manufacturer’s instructions. Total RNA was depleted of ribosomal RNA using pooled antisense oligo hybridization and depletion throughRNaseH digestion. Following purification, first-strand complementary DNA (cDNA) was synthesized. Subsequently, second-strand cDNA was synthesized, purified, and fragmented. RNA-seq libraries were prepared using Illumina technology (Illumina DRAGEN RNA, 3.10.12). Briefly, end repair, A-tailing, and barcoded adapter ligation were followed by PCR amplification and size selection. The integrity of the libraries was confirmed by qu Bit quantification, fragment analyzer size distribution assessment, and Sanger sequencing of about 10 fragments from each library. Libraries were sequenced using paired-end Illumina sequencing.

[0098] RNA-seq data was processed using the R software (v.4.2.3) DESeq2 package. The adjusted p-value cutoff of 0.05 and logFC > 1.5 were used as filter criteria. The GSEA analysis was done using the R package WebGestaltR and GSEA software (Gene Set Enrichment Analysis, v4.3.2) from the Broad Institute. Gene collections were obtained from the MSigDB KEGG subset of canonical pathways.

[0099] Comparisons to population data were performed using the Kyoto Encyclopedia of Genes and Genomes (KEGG) Pathway Enrichment Analysis and overrepresentation analysis algorithm (ORA). The significantly altered pathways in our dataset were compared to a prior dataset. The initial dataset consisted of gene expression profiles from 1 16 wildtype patients and 9 E167K mutant carriers’ liver biopsies. These results were further visualized with the R software (v.4.2.3) package ggplot2 (v.3.4.2).

[0100] Lipidomics

[0101] For analysis of lipidomics, iHep-TM6SF2-WT and iHep-TM6SF2-E167K cells were collected. Samples were thawed on ice, and 100 pL of ultrapure water extract was added to resuspend the cells. Approximately 10 mg of each sample was weighed and homogenized by ball-mill in 1 mL of extraction solution (MTBE:Methanol = 3:1 , V / V, Merck, Darmstadt, Germany) with internal standards. The mixture was vortexed for 15 minutes. Next, 200 pL of water was added to the mixture (Millipore, Billerica, MA), vortexed for 1 minute, and incubated at 4°C for 10 minutes. After centrifugation at 12000 rpm for 10 minutes (4 °C), 200 pL of the upper phase was collected for complete solvent drying at 20 °C. The residue was reconstituted using 200 pL of reconstitution solution (ACN:IPA = 1 :1 , V / V, Merck, Darmstadt, Germany), followed by vortex for 3 minutes and centrifugation at 12000 rpm for 3 minutes. One hundred and twenty pL of the final supernatant was used for LC-MS analysis.

[0102] The sample extracts were analyzed using an LC-ESI-MS / MS system (UPLC, Nexera LC-40; MS, Triple Quad 6500+). The analytical conditions were as follows, UPLC: column, Thermo Accucore™C30 (2.6 pm, 2.1 mmx100 mm i.d.); solvent system, A: acetonitrile / water (60 / 40, V / V, 0.1% formic acid, 10 mmol / L ammonium formate), B: acetonitrile / isopropanol (10 / 90 VV / V, 0.1% formic acid, 10 mmol / L ammonium formate); gradient program, A / B (80:20, V / V) at 0 minutes, 70:30 V / V at 2.0 minutes, 40:60 V / V at 4 minutes, 15:85 V / V at 9 minutes, 10:90 V / V at 14 minutes, 5:95 V / V at 15.5 minutes, 5:95 V / V at 17.3 minutes, 80:20 V / V at 17.3 minutes, 80:20 V / V at 20 minutes; flow rate, 0.35 mL / min; temperature, 45°C; injection volume: 2 pL. The effluent was alternatively connected to an ESI-triple quadrupole- linear ion trap (QTRAP)-MS. Differential analysis was performed using MetwareBio’s bioinformatics pipeline.

[0103] 4-Phenylbutyric acid (4-PBA) Treatment

[0104] 4-PBA was freshly prepared before each experiment by dissolving 4-PBA powder (Sigma Aldrich, St. Louis, MO) in PBS to a final concentration of 27 mM. This stock was later diluted in PBS and used at a final concentration of 2mM. Cells were treated for 48 hours and a control group without 4-PBA treatment was maintained to compare the effects. After 48 hours, supernatant and cell pellets were collected for further analysis.

[0105] Primary Human Hepatocytes,

[0106] Cryopreserved primary hepatocytes from healthy individuals were obtained from In Vitro ADMET Laboratories Inc. (IVAL, Columbia, MD, USA). End-stage liver disease (ESLD) hepatocytes were isolated from therapeutically resected livers and fresh human liver tissue specimens from patients (IRB: STUDY20090069) undergoing liver transplantation in the adult liver transplant programs at the University of Pittsburgh Medical Center (UPMC). Human fetal liver tissues were obtained from the University of Washington Department of Pediatrics, Division of Genetic Medicine, Laboratory of Developmental Biology (Seattle, WA) after obtaining written informed consent by a protocol approved by the Human Research Review Committee of the University of Pittsburgh (honest broker approval numbers HB015 and HB000836). Human fetal liver hepatocytes were isolated, cultured, and differentiated into fibroblasts, as previously described.

[0107] Embryoid Body FormationEmbryoid bodies (EBs) were formed by plating iPSC-TM6SF2-WT and iPSC-TM6SF2- E167K cells at a density of 2.5x104cells per cm2on low-attachment 6-well plates in mTeSR with 20% FBS and cultured at 37 °C and 5% CO2. The medium was changed every 72 hours. EBs started to form in suspension after one week of culture. At day 20, EBs were fixed in 4% paraformaldehyde (PFA) for 24 hours and 70% ethanol overnight at 4°C, then embedded in paraffin. Five-micron sections were placed on glass slides and used for immunostaining of the three germ layers.

[0108] Quantitative Real-Time PCRTotal RNA was isolated from human cells using RNeasy Mini Kits (QIAGEN, Hilden, Germany) and reverse transcribed using Super-Script III (Invitrogen, Carlsbad, CA) following the manufacturer’s instructions. We performed qPCR with a StepOnePlus system (Applied Biosystems, Foster City, CA) using TaqMan Fast Advanced Master Mix (Life Technologies, Waltham, MA). Relative gene expression was normalized to B-actin (ACTB) mRNA and mtDNA, using AACT method. Genomic DNA was extracted with the DNeasy Blood & Tissue Kit (QIAGEN, Hilden, Germany) following the manufacturers’ instructions. mtDNA content was analyzed by Sybr green qPCR using primers amplifying mitochondrial cytochrome b (CYB), mitochondrial cytochrome c oxidase subunit 1 (CO1 ), mitochondrial cytochrome c oxidase subunit 3 (CO3), and ATP synthase subunit a (ATP6).

[0109] Genotyping and Sanger Sequencing

[0110] Genotyping and Sanger sequencing were performed by extracting genomic DNA with the DNeasy Blood & Tissue Kit (QIAGEN, Hilden, Germany) following the manufacturer’s instructions. DNA samples were genotyped using TaqMan SNP genotyping assays for TM6SF2 rs58542926, PNPLA3 rs738409, GCKR rs780094, MBOAT7 rs62641738, HSD17B13 rs72613567, and MTARC1 rs2642438 (ThermoFisher Scientific, Waltham, MA). Amplification and genotype clustering were performed using a StepOnePlus system (Applied Biosystems, Foster City, CA).

[0111] For sequencing, polymerase chain reaction (PCR) amplification was conducted with the KOD ONE PCR Master Mix (Toyobo, Osaka, Japan) using the forward (CAAGATGTCCAGCCAGAGAGG) (SEQ ID NO: 10) and reverse primers (CTTTCTTGTGACAAAGGAGAACCT) (SEQ ID NO: 11 ) for TM6SF2. After DNA samples were amplified, the result of the amplification was confirmed with a 2% agarose gel. PCR products were then purified using the ExoSAP-IT Express PCR Cleanup Kit (Applied Biosystems, Foster City, CA) and sequenced at the GenomicsResearch Core at the University of Pittsburgh. Sequencing buffer and a 1 :4 dilution of BigDye 3.1 (ThermoFisher Scientific, Waltham, MA) were added, and thermocycling was performed according to ABI recommendations. Unincorporated sequencing reagents were removed using CleanSeq magnetic beads (Agencourt, Beckman Coulter, Brea, CA) according to manufacturer’s instructions. Two control samples were included with every sequencing run to ensure the proper performance of reagents and equipment.

[0112] Immunostaining

[0113] The samples were fixed with 4% PFA, washed for 15 minutes and washed 3 times with PBS. Following fixation, samples were washed 3 times with wash buffer (PBS, 0.1 % BSA, and 0.1 % TWEEN 20) for 5 minutes and then blocked and permeabilized in blocking buffer (PBS, 10% normal donkey or goat serum, 1 % BSA, 0.1 % TWEEN 20, and 0.1 % Triton X-100) for 1 hour at room temperature. Subsequently, the samples were then incubated with primary antibodies in blocking buffer overnight at 4 °C. The following day, samples were washed 3 times with wash buffer for 5 minutes and incubated with secondary antibodies in blocking buffer for 2 hours in the dark at room temperature. Samples were washed 3 times with wash buffer for 5 minutes, followed by 3 washes with PBS, and counterstained with 1 pg / mL of DAPI (Sigma Aldrich, St. Louis, MO) for 1 minute at room temperature in the dark. Finally, samples were washed 3 times with PBS and stored in the dark at 4°C. Samples were imaged using an Eclipse Ti inverted microscope (Nikon, Melville, NY) and the NIS-Elements software platform (Nikon, Melville, NY). Images were analyzed using Imaged software. RGB stacks were generated, preprocessed to equalize the illumination within the stack, thresholded, and measured.

[0114] To better understand the role of TM6SF2 rs58542926 in ESLD tissue and cells, we first validated the TM6SF2 primary antibody. A substantial body of literature shows variability in antibody performance and the methodologies employed have inconsistent and frequently conflicting results (2, 3, 4). To understand the distribution of TM6SF2 in liver tissue, we analyzed ESLD tissue from patients that were WT (CC) or possessed the E167K (TT) for TM6SF2 rs58542926.

[0115] For endoplasmic reticulum (ER) and Golgi staining, the Revvity Phenix Opera High Content Imaging system was used at 40X / 0.75 hNA in 6-well plates. The analysis was performed using Revvity Harmony 5.1 software to segment each marker using Revvity’s proprietary building blocks for finding cell nuclei and imaging regionssuch as the Golgi and ER. The data consisting of single cell level morphological measures (Golgi Area (pm2), ER Area (pm2), ER Intensity (AU)) were exported and Python libraries, pandas, and seaborn were used to perform transformations and visualizations.

[0116] For TM6SF2 immunohistochemistry staining, 5-7-micron sections were deparaffinized with xylene and dehydrated with ethanol. Antigen unmasking was performed by boiling in 10 mM citrate buffer, pH 6.0. After antigen unmasking, the slides were exposed to 3% hydrogen peroxide and incubated overnight at 4°C with the primary antibody. On the following day, tissue sections were incubated with the secondary biotinylated antibody corresponding to the animal species of the primary antibody (BA-1000; Vector Laboratories, Burlingame, CA) and exposed to 3,30- diaminobenzidine (SK-4105; Vector Laboratories) to visualize the peroxidase activity. Counterstaining was performed with Richard-Allan Scientific Signature Series Hematoxylin (Thermo Scientific, Waltham, MA). Samples were imaged using an Axiovert 40 CFL (Zeiss, NY, USA) microscope and the Zeiss Zen 3.8 software platform (Zeiss, NY, USA).

[0117] Transcription Profiling by the RT2 Profiler PCR Array

[0118] Total RNA was isolated using the RNeasy Mini Kit (QIAGEN, Hilden, Germany) and reverse transcribed using SuperScript III (Invitrogen, Carlsbad, CA) to synthesize and amplify cDNA. Key genes involved in the regulation and enzymatic pathways of fatty liver were simultaneously assayed with the RT2 Profiler PCR Array Human Fatty Liver Assay (PAHS-157ZC-6, QIAGEN, Hilden, Germany) according to the manufacturer’s instructions and analyzed with the Data Analysis Center (QIAGEN Hilden, Germany). Ingenuity pathway analysis (IPA) was used to identify differentially expressed genes, predict downstream effects, and identify targets (QIAGEN Bioinformatics; www.qiagen.com / ingenuity). Regulatory effects analysis within IPA was used to identify the relationships between upstream regulators and biological functions.

[0119] Fatty Acid Synthesis AssayFor general metabolite extraction, cells were treated with 13C L-Glucose tracer (Sigma Aldrich, St. Louis, MO) at a final concentration of 7 mM for 24 hours. Lipid metabolites were recovered and the samples were dried under nitrogen for 15 minutes and either stored at -80 °C or derivatized immediately. After treatment of cells with isotope tracers, cells were quenched with 300 pL of ice-cold optima-grade methanol (ThermoFisherScientific, Waltham, MA). Subsequently, 300 pL of optima-grade water (ThermoFisher Scientific, Waltham, MA) containing 1 pg of norvaline (ThermoFisher Scientific, Waltham, MA) were added to each well. The cells were scraped over ice, and the contents transferred to 1.5 mL tubes (Eppendorf, Hamburg, Germany). Six hundred pL of optima-grade chloroform (ThermoFisher Scientific, Waltham, MA) were added to each tube. The tubes were vortexed at 4 °C for 30 minutes before being centrifuged at 17,000 ref for 15 minutes. After centrifugation, the mixture clarified into a polar supernatant and a non-polar supernatant containing polar and lipid metabolites, respectively.

[0120] Lipid metabolites were recovered in the lower chloroform layer utilizing the methodology described above. After recovery, the samples were dried under nitrogen for 15 minutes and either stored at -80 °C or derivatized immediately. For derivatization, 500 pL of a solution consisting of 2% v / v H2SO4 (Sigma Aldrich, St. Louis, MO) in optima-grade methanol were added to each sample. The samples were incubated while shaking at 175 rpm at 50 °C for 2 hours. After incubation, the reaction was dried through the addition of 100 pL of a saturated NaCI solution (ThermoFisher Scientific, Waltham, MA) in optima-grade water. To extract the fatty acid methyl esters (FAMEs), 500 pL of HPLC-grade hexane (ThermoFisher Scientific, Waltham, MA) was added to each sample and briefly vortexed, resulting in a phase separation into two layers. The hexane supernatant containing the FAMEs was transferred to a new tube, and dried under nitrogen for 15 minutes. Afterwards, the samples were reconstituted in 100 pL of MS-grade hexane and transferred to glass inserts for analysis using GC- MS. The samples were analyzed using a Select FAME column (Agilent, Santa Clara, CA). The temperature gradient for analysis of fatty acids consisted of an initial temperature of 80 °C, a gradient of 20°C / min up to 170 °C, a gradient of 1 °C / min to 204 °C, a gradient of 20°C / min up to 250 °C, followed by a final hold at 250 °C for 10 minutes. The total run time of the method was approximately 51 minutes.

[0121] Nile Red Staining

[0122] Samples were fixed with 4% PFA for 15 minutes and washed three times with PBS. After that, the samples were incubated with a 0.3 mM Nile Red (Sigma Aldrich, St. Louis, MO) solution for 30 minutes at room temperature. Then, they were washed twice with PBS and counterstained with 1 pg / mL of DAPI (Sigma Aldrich, St. Louis, MO) for 1 minute. Samples were imaged using an Eclipse Ti invertedmicroscope (Nikon, Melville, NY) and the NIS-Elements software platform (Nikon, Melville, NY). Following that, images were analyzed using Imaged software.

[0123] Cholesterol Analysis

[0124] For analysis of cholesterol metabolism, cells were cultured for 48 hours, after which the supernatant and cells were collected. The Qquantification of intracellular total cholesterol and its fractions was measured using the Cholesterol Assay Kit (Abeam, Cambridge, UK) according to the manufacturer’s instructions. The fluorescence signal (Ex / Em: 535 / 587 nm) was measured on an HTX microplate reader (Biotek, Winooski, VT).

[0125] Western Blotting

[0126] Human samples were incubated with RIPA lysis buffer (Sigma Aldrich, St. Louis, MO), 1 x Halt™ Protease (Thermo Scientific, Waltham, MA), and Phosphatase Inhibitor Cocktail (Thermo Fisher Scientific, Waltham, MA) for 30 minutes at 4°C. Samples were centrifuged at 13,000 x g for 10 minutes at 4°C. The supernatant from each sample was then transferred to a new microfuge tube and used as the whole cell lysate. Protein concentrations were determined by comparison with a known concentration of bovine serum albumin using a Pierce BCA Protein Assay Kit (Thermo Fisher Scientific, Waltham, MA). Thirty pg of lysate were loaded per lane into 10% Mini-PROTEAN TGX™ gel (BioRad, Hercules, CA). Next, proteins were transferred onto the PVFD transfer membrane (Thermo Fisher Scientific, Waltham, MA). Membranes were incubated with a primary antibody solution overnight and then washed. Membranes were incubated for 1 hour in a secondary antibody solution and then washed. Target antigens were finally detected using SuperSignal™ West Pico PLUS Chemiluminescent Substrate (Thermo Fisher Scientific, Waltham, MA). Images were scanned and analyzed using Imaged software. All band density values were normalized to the band density for GAPDH.

[0127] Transmission Electron Microscopy

[0128] Human samples were briefly centrifuged and washed with a PBS solution. Samples were then fixed with 2.5% glutaraldehyde overnight at 4°C. Fixed samples were processed by the Center for Biologic Imaging at the University of Pittsburgh and treated with 1 % osmium tetroxide and 1 % potassium ferricyanide for 1 hour at room temperature. Samples were washed with PBS and dehydrated in a graded series of ethanol solutions (30%, 50%, 70%, and 90% — 10 minutes each), followed by three 15-minute changes in fresh 100% ethanol. Infiltration was done with four 1 -hourchanges of EPON embedding plastic. The last change of EPON was allowed to polymerize overnight at 37 °C and then for 48 hours at 60 °C. Resin blocks were removed from the Eppendorf tubes, and 70 nm sections were placed onto copper TEM grids. Image acquisition was performed using either the JEM-101 1 or the JEM- 1400Plus transmission electron microscopes (Jeol, Peabody, MA) at 80 kV fitted with a side mount AMT 2k digital camera (Advanced Microscopy Techniques, Danvers, MA).

[0129] Caspase Assay

[0130] Caspase-3 activity was measured using the EnzChek Caspase-3 Assay Kit II (Thermo Fisher Scientific, Waltham, MA). Briefly, 50 pl of the supernatant and 50 pl of the working substrate (5 pM Z-DEVD-R1 10) were added to an individual well of a 96-well microplate and incubated for 30 minutes, according to the manufacturer’s instructions. The fluorescence signal (Ex / Em: 496 / 520 nm) was measured in an HTX microplate reader (Biotek, Winooski, VT). Caspase-3 activity was expressed as arbitrary units of fluorescence normalized by the cell number.

[0131] Reactive Oxygen Species Assay

[0132] Cells were plated in a 12-well plate. Total reactive oxygen species (ROS) in live cells was measured using the Cellular ROS Assay Kit (Abeam, Cambridge, UK). Following the manufacturer’s instructions, the fluorescence (Ex / Em = 520 / 605) was quantitatively measured on a synergy HTX microplate reader (Biotek, Winooski, VT). ROS was expressed as arbitrary units of fluorescence normalized by the cell number.

[0133] Total NAD / NADH Quantification

[0134] Cells were plated on a 12-well plate, treated with 100 pM of palmitic acid, and collected 48 hours later. Nontreated cells were used as a control. Total NAD / NADH in live cells was measured using the NAD / NADH Assay Kit (Abeam, Cambridge, UK) following the manufacturer’s instructions. Fluorescence (Ex / Em = 540 / 590) was measured on a synergy HTX microplate reader (Biotek, Winooski, VT). Total NAD / NADH was expressed as arbitrary units of fluorescence normalized by the cell number.

[0135] Insulin-Resistance Response

[0136] For measurement of the insulin-resistance response, iHep-TM6SF2-WT and iHep-TM6SF2-E167K were washed 3 times in PBS and incubated at 37°C for 3 hours in glucose-free starvation media with or without 100 nM insulin. Cells wereharvested, centrifuged for 5 minutes at 300 x g, the supernatant discarded, and the cell pellet was stored at -80°C for further analysis.

[0137] Human Cytokine Antibody Array

[0138] The Human Cytokine Antibody Array (Abeam, Cambridge, UK) was used for the simultaneous detection of cytokines and chemokines in cellular supernatants, according to the manufacturer’s recommendations. Briefly, 1 mL of cell cultured supernatant was added to the membranes and incubated overnight at 4 °C on a rocking platform shaker. The membranes were then washed and incubated in biotin- conjugated anti-cytokines. HRP-conjugated streptavidin was added to the arrays and incubated for 2 hours at room temperature. The membrane arrays were developed with chemiluminescence detection reagents, and images were scanned and analyzed using Imaged software. All band density values were normalized to the band density for the positive control on each membrane.

[0139] Fatty Acid Uptake Assay

[0140] Fatty acid uptake was measured using the Fatty Acid Uptake Assay Kit (Abeam, Cambridge, UK) according to the manufacturer’s instructions. Briefly, iHep- TM6SF2-WT and iHep-TM6SF2-E167K were washed 3 times in PBS and incubated at 37°C for 1 hour in glucose-free starvation media. Following serum starvation, cells were treated with 10 pL of 10X test compound working solution in each well, and the plates were incubated at 37°C for 30 minutes. The 2X solution of quenched Uptake Reaction Mix was prepared by adding 200 pL of the 100X Extracellular Quenching Solution stock and 100 pL of the 200X Fluorescent Fatty Acid Probe to 9.7 mL of prewarmed Fatty Acid Uptake Assay Buffer. Next, 100 pL of prewarmed 2X Uptake Reaction Mix were added to all wells, and fluorescence measurements began immediately of all wells in kinetic mode at 37°C every 15 minutes for a total of 60 minutes. The fluorescence signal (Ex / Em = 488 / 523 nm) was measured using an HTX microplate reader (Biotek, Winooski, VT). Fatty acid uptake was expressed as arbitrary units of fluorescence normalized by the cell number.

[0141] Statistical Analysis

[0142] For statistical analysis, means between two groups were compared by t test. Since data for continuous variables were not normally distributed, p-values (p) were determined using an unpaired, two-tailed Welch’s t-test with 95% confidence.Data are reported as mean ± SD, and p-values < 0.05 were considered statistically significant. Statistical analyses were performed using GraphPad Prism version 9.3.0. Results

[0143] Generation of human iPSCs and introduction of the TM6SF2-E167K variant

[0144] First, we assessed the incidence of TM6SF2 rs58542926 C>T p.Glul 67Lys frequency in healthy subjects and ESLD patients. We focused on the TM6SF2 rs58542926 C>T variant in donors and explanted human cirrhotic livers with ESLD due to MASH, as robust GWAS have linked this variant to a spectrum of liver diseases, as well as increased risk of mortality in the general population. The TM6SF2-E167K variant was present in less than 1 % of healthy individuals and 1.8% of patients with MASH-associated ESLD (FIG. 1A). This analysis shows that the TM6SF2-E167K variant was present at a low frequency in the small (healthy n=123; ESLD n=50) cohort analyzed and its frequency was maintained in ESLD.

[0145] Next, we identified human fibroblasts carrying the major allele TM6SF2 rs58542926:C without the presence of other variants predictive of liver disease (MBOAT7 rs641738, TM6SF2 rs58542926, GCKR rs780094, HSD17B13 rs72613567, MTARC1 rs2642438; FIG. 1 B). After genotyping, human fibroblasts were reprogrammed into iPSCs as previously described. The resulting human iPSC line (iPSC-TM6SF2-WT) was single nucleotide edited using CRISPR-Cas9 to carry the TM6SF2-E167K variant (iPSC-TM6SF2-E167K). The resulting iPSCs (iPSC-TM6SF2- WT and iPSC-TM6SF2-E167K) were cultured for >10 passages before characterization and validation studies were performed. Successful single base editing was confirmed by Sanger sequencing and showed the presence of the gene variant for TM6SF2 rs58542926 C>T (FIG. 1 B). To evaluate potential off-target effects of the designed sgRNA, cleavage efficiency targeting the TM6SF2 locus was assessed in HepG2 cells and found that mutations were specifically induced at the targeted site. Additionally, to further validate that there were no off-target effects, iPSC-TM6SF2- E167K were sequenced upstream and downstream, and no off-target effects were observed in either the gRNA.

[0146] Human iPSC-TM6SF2-WT and iPSC-TM6SF2-E167K showed normal pluripotent morphology, consisting of compact colonies with distinct borders, as seen in human embryonic stem cells (hESCs), expressed NANOG, SSEA4, OCT4, and TRA-1 -60, and exhibited mRNA expression of pluripotency markers (Lin28A, SOX2, Nanog, and OCT4) comparable to that of control human iPSCs (FIG. 1C). EBs derivedfrom human iPSC-TM6SF2-WT and iPSC-TM6SF2-E167K lines formed all three germ layers (FIG. 1 D), as assessed by the spontaneous expression of ectodermal (SOX1 and Otx-2), mesodermal (Brachyury and HAND-1 ), and endodermal (SOX17 and GATA-4) markers (FIG. 1 D). Both human iPSC-TM6SF2-WT and iPSC-TM6SF2- E167K cells exhibited a normal karyotype (FIG. 1 E).

[0147] Hepatocyte-directed differentiation of human iPSC-TM6SF2-WT and iPSC- TM6SF2-E167K

[0148] We proceeded to differentiate the human iPSC-TM6SF2-WT and iPSC- TM6SF2-E167K toward hepatocytes using our previously published protocol (FIG. 2A). Cells were cultured with a combination of activin A, bone morphogenetic protein 4 (BMP4), and fibroblast growth factor (FGF)-2 to induce definitive endoderm. After verifying the presence of the endoderm marker SOX17 (FIGS. 2B-2C), cells were cultured for 10 days in the presence of dimethyl sulfoxide (DMSO) and human hepatocyte growth factor (hHGF) to induce hepatocyte specificity. Following differentiation, both human iPSC-TM6SF2-WT and iPSC-TM6SF2-E167K developed characteristics of hepatocytes, including expression of the adult isoform of HNF4a and human albumin. Expression of AFP, an immature hepatocyte marker, was not observed (FIGS. 2B-2C). Both cell lines (human iHeps-TM6SF2-WT and iHeps- TM6SF2-E167K) expressed critical hepatocyte-specific transcripts, including HNF4a, forkhead box protein A2 (FOXA2), forkhead box protein A1 (FOXA1 ), hepatocyte nuclear factor 1 alpha (HNF1 a), CCAAT enhancer binding protein alpha (CEBPA), retinoid X receptor (RXR), liver X receptor (LXR), peroxisome proliferator-activated receptor alpha (PPARa), sterol regulatory element-binding transcription factor 1 (SREBPI c), acetyl-CoA carboxylase (ACC), fatty acid synthase (FASN), and epidermal growth factor receptor (EGFR), at levels comparable to those found in human adult hepatocytes (FIGS. 2D-2F).

[0149] TM6SF2 E167K variant induces protein loss-of-function and modifies lipid accumulation in human iHeps

[0150] We next studied TM6SF2 transcript and protein expression. We found that TM6SF2 transcript levels were not significantly different between human iHeps- TM6SF2-WT, iHeps-TM6SF2-E167K, human liver tissue, or isolated human adult ESLD hepatocytes (FIGS. 3A-3C). However, when protein expression was analyzed, iHeps-TM6SF2-E167K showed significantly reduced expression when compared to iHeps-TM6SF2-WT (FIGS. 3A-3C). A hallmark of MASLD progression, especially inindividuals carrying the TM6SF2-E167K variant, is disruption of lipid and cholesterol regulation. Thus, we investigated the effect of the TM6SF2-E167K variant on intracellular and extracellular lipid accumulation by Nile red and Perilipin-2 staining. We observed a significant increase in the concentration of intracellular lipids in iHep- TM6SF2-E167K when compared to iHep-TM6SF2-WT (FIGS. 3D-3E). Next, we determined the impact of the TM6SF2-E167K variant on cholesterol transporters, such as ApoBl OO and VLDL, and found that intracellular ApoBl OO protein expression and total cholesterol was significantly increased (FIG. 3F) while extracellular secretion of ApoB100 and VLDL was significantly reduced in iHeps-TM6SF2-E167K (FIG. 3G). We also measured levels of intracellular total cholesterol and other lipoprotein transporters, such as HDL, and found no significant differences.

[0151] Global transcriptomic characterization of iHeps-TM6SF2-E167K revealed modified lipid metabolism.

[0152] Human livers undergo profound transcriptional and metabolic changes throughout the development of liver disease, and TM6SF2-E167K appears to influence disease progression. We analyzed the transcriptomic signature of TM6SF2- E167K using RNA-seq. Differential expression analysis revealed an up-regulation of 153 genes and down-regulation of 267 genes. Pathway enrichment analysis indicated an increase in the expression of genes related to cholesterol, fatty acid, and glucose metabolism in iHep-TM6SF2-E167K when compared to iHep-TM6SF2-WT. The up- regulated pathways observed in gene set enrichment analysis (GSEA) are listed in Table 1 , below.Table 1

[0153] T o further corroborate the transcriptomic analysis, we performed a focused RNA array. Of the 56 up-regulated genes, we observed an enrichment for genes associated with fatty acid oxidation (PPARGC1 A, ACOX1 , ACSM3), uptake of fatty acids (CD36), lipid transportation (CPT1 A, CPT2), and glucose metabolism (SLC2A2, SLC2A4) in iHep-TM6SF2-E167K. Further pathway analyses unveiled elevated activities related to the transport, flow, removal, and oxidation of lipids, fatty acids, and cholesterol. We confirmed our RNA-seq findings using qPCR, focusing specifically on the most important pathways highlighted by our differential expression and GSEA analysis (Fatty acid oxidation - ACOX1 , PPARGC1 A; Fatty uptake - CD36; Lipid synthesis and transportation - ACSS2, VAMP7; Steroid hormone biosynthesis - SULT 1 E1 ; Fatty acid elongation - ELOVL6; Cholesterol metabolism - APOH).

[0154] For all genes, we observed a significant increase in iHep-TM6SF2-E167K when compared to iHep-TM6SF2-WT, confirming our RNA-seq results. We also performed a comparison to transcriptomic data from population studies and confirmed at least five common pathways related to cholesterol metabolism, synthesis and metabolism of fatty acids, and synthesis of steroids.

[0155] As we observed an up-regulation of gene expression related to glucose metabolism in our fatty liver metabolism RNA array, we evaluated insulin resistance in iHep-TM6SF2-E167K. The signaling pathway leading to AKT activation is disrupted when insulin resistance is present in hepatocytes, resulting in decreased phospho- AKT. Phospho-AKT is crucial in mediating the metabolic actions of insulin. Although there was an up-regulation in glucose metabolism, no significant change was observed in phospho-AKT protein levels in our iHep-TM6SF2-E167K, suggesting no insulin resistance iHep-TM6SF2-E167K when compared to iHep-TM6SF2-WT.

[0156] TM6SF2 E167K variant modifies lipid metabolism in human iHeps

[0157] To understand what is leading to lipid accumulation in iHep-TM6SF2- E167K, we investigated lipid synthesis, uptake, and degradation. To evaluate fatty acid uptake, we used a fluorescent long-chain fatty acid analogue and determined the uptake kinetics in live cells. We did not observe any difference in fatty acid uptake when comparing both groups. To assess the effect of the TM6SF2 mutation on lipid metabolism, we performed detailed global lipidomic analysis. Pathway enrichment analysis indicated an overrepresentation of lipids in pathways related to fatty acid synthesis and degradation. Moreover, iHep-TM6SF2-E167K showed significant upregulation of the majority of intracellular lipid classes, including triglycerides (TG), phospholipids (PS, PC, PE, PI, LPC), bile acids (tauroluthocholic acid, glycocholic acid, 12-Oxochenodeoxycholic acid), glycerol lipids (DG), free fatty acids, lysophospholipids (LPE, LNAPE, LPG), and sphingolipids (SM, SPH, CER) when compared to iHep-TM6SF2-WT. These types of lipids are normally observed in the lipid droplet core (neutral lipids including TGs) and the outer phospholipid monolayer (PC and PS, among others).

[0158] Fatty acid synthesis is a complex and highly regulated process essential for the production of fatty acids, which serve as building blocks for various lipids and play critical roles in energy metabolism and cellular function. We performed stable isotope tracing experiments using uniformly labeled glucose as the substrate and measured the isotopologues of various medium and long chain fatty acids, including palmitate, stearate, myristate, palmitoleate, and cis-9-oleate. Our results showed a significant increase in the fraction of high-mass isotopologues derived from glucose for all of the aforementioned fatty acids in iHep-TM6SF2-E167K. In addition, we performed isotopologue spectral analysis (ISA) to estimate the contribution of glucose to cytosolic acetyl-CoA. The major building block for fatty acid synthesis is acetyl-CoA.One of the major sources of acetyl-CoA is glycolysis, in which glucose is broken into pyruvate, enters the TCA cycle, and generates acetyl-CoA. This acetyl-CoA forms long-chain fatty acids that are incorporated into triacyglycerol, phospholipids, and cholesterol esters in hepatocytes, which are stored in lipid droplets. Our results from the tracing experiments suggest that there is significantly higher production of acetyl- CoA contributing to fatty acid synthesis in iHep-TM6SF2-E167K cells when compared to iHep-TM6SF2-WT.

[0159] Human livers undergo profound transcriptional and metabolic changes throughout the development of liver disease. RNA-seq analysis revealed that iHep- TM6SF2-E167K cells show upregulation of genes involved in cholesterol, fatty acid, and glucose metabolism compared to iHep-TM6SF2-WT.

[0160] Global lipidomics demonstrated increased levels of lipids related to fatty acid synthesis and degradation. Tracing experiments showed a significant increase in the fraction of high-mass isotopologues derived from glucose for all the fatty acids in iHep-TM6SF2-E167K. The major building block for fatty acid synthesis is acetyl- CoA. One of the major sources of acetyl-CoA is glycolysis, in which glucose is broken into pyruvate, enters the TCA cycle, and generates acetyl-CoA. This acetyl-CoA forms long-chain fatty acids that are incorporated into triacylglycerol, phospholipids, and cholesterol esters in hepatocytes, which are stored in lipid droplets. Our results from the tracing experiments suggest that there is significantly higher production of acetyl- CoA contributing to fatty acid synthesis in iHep-TM6SF2-E167K cells when compared to iHep-TM6SF2-WT.

[0161] Taken together, the glucose tracing and global lipidomics analysis significantly support our hypothesis that E167K mutation alters lipid synthesis.

[0162] Characterization of iHeps-TM6SF2-E167K revealed cellular stress.

[0163] Excessive accumulation of lipids in hepatocytes can lead to ER stress, as the ER is unable to properly process and fold proteins or metabolize lipids, and the activation of inflammatory signaling pathways. By performing a multiplex protein detection approach, we observed increases in pro-inflammatory cytokines (IL-6, IL-8) and chemokines (MIP-113) along with elevated TIMP-2 (indicator of fibrogenesis) in iHep-TM6SF2-E167K (FIGS. 4A-4C). This suggests a pivotal role of the TM6SF2- E167K mutation in promoting hepatic inflammation and fibrogenesis. As cellular stress may result in ROS production, we evaluated ROS accumulation and observed a significant increase in iHep-TM6SF2-E167K when compared to controls (FIG. 4D).Additionally, intracellular cholesterol accumulation can lead to an increase in betaoxidation. We confirmed increased NADH, a product of beta-oxidation, in iHep- TM6SF2-E167K (FIG. 4D). To understand if E167K increased hepatocyte death, we measured Caspase-3 levels and found a significant increase in Caspase-3 levels in iHep-TM6SF2-E167K cells (FIG. 4D). This observation suggests a potential enhancement in apoptotic activity associated with the TM6SF2-E167K variant.

[0164] Finally, we found an increased number of spherical mitochondria (FIG. 4E; yellow arrow) among human hepatocytes ESLD-E167K and iHep-TM6SF2-E167K when compared to control human hepatocytes ESLD-WT and iHep-TM6SF2-WT. Maintenance of the mitochondrial genome is essential for proper cellular function, thus, we analyzed expression of important mitochondrial genes: mitochondrial cytochrome b (mtCYB), mitochondrial cytochrome c oxidase subunit I (mtCO1 ), mitochondrial cytochrome c oxidase subunit III (mtCO3), and mitochondrial ATP synthase subunit 6 (mtATF6). These genes are found in the mitochondrial DNA and ensure proper energy production (mtATF6), regulation of metabolic pathways (mtCO1 , mtCYB), and maintenance of mitochondrial integrity (mtCO3). As expected, these genes were significantly lower in iHEP-TM6SF2-E167K when compared to iHep- TM6SF2-WT (FIGS. 4E-4F).

[0165] TM6SF2-E167K confers ER stress to iHeps that is alleviated by facilitating protein folding.

[0166] We analyzed genes indicative of ER and mitochondrial stress, such as X- box binding protein 1 (XBP1 ), a transcription factor that plays a key role in ER stress, and heat shock protein family A (Hsp70) member 5 (HSPA5), a chaperone protein in the ER that helps fold and assemble proteins and is highly expressed during stress. We found that both XBP1 and HSPA5 proteins, as assessed by immunofluorescence, were increased in iHep-TM6SF2-E167K to levels observed in human hepatocytes freshly isolated from livers with ESLD and carrying the TM6SF2-E167K variant (FIGS. 5A-5B). This observation was corroborated by western blot for XBP1 s (FIG. 5A), but qPCR didn’t show any difference between both groups. For HSPA5, the increase in iHep-TM6SF2-E167K was also observed by qPCR and western blot (FIG. 5B). To further support our findings, we evaluated other ER stress markers, CHOP and ATF4, both of which were increased in iHep-TM6SF2-E167K when compared with iHep- TM6SF2-WT (FIGS. 5C-5D). We did not observe any differences in ER location, but a significant increase in Golgi area and ER fluorescence intensity was observed iniHep-TM6SF2-E167K (FIGS. 5E-5H). Taken together, these data demonstrate that alterations in lipid synthesis driven by the TM6SF2-E167K variant can increase ER stress.

[0167] The ER is essential for the folding and trafficking of proteins that enter the secretory pathway. The main characteristic of ER stress is often protein misfolding leading to cell death. Thus, we reasoned that alleviating protein misfolding induced by TM6SF2-E167K variant could improve cell function. 4-Phenylbutyric acid (4-PBA) is an aromatic fatty acid that has been investigated for improving protein misfolding and ER stress. Studies have shown that TM6SF2 E167K mutation results in a misfolded protein, accelerated protein degradation, and reduced protein levels, contributing to the observed phenotypes. After treating iHep-TM6SF2-E167K cells with this compound, we observed a significant decrease in ATF4 and HSPA5 protein levels compared to untreated cells. To understand if this reduction influenced lipid secretion, we tested VLDL levels and observed a significant increase in VLDL secretion in treated iHep-TM6SF2-E167K compared to untreated cells. No differences in ATF4, HSPA5, or VLDL secretion were observed between treated and untreated iHep-TM6SF2-WT (FIGS. 5I-5K). This suggests that treating protein misfolding induced by TM6SF2- E167K can lead to reductions in ER stress and lipid accumulation.Discussion

[0168] There is increasing evidence that TM6SF2 plays a significant role in the metabolic processing of hepatic lipids. Lipotoxicity within the liver can trigger inflammation, oxidative stress, and cellular injury, ultimately contributing to the development of MASLD. MASLD is marked by an abundance of fat accumulating in the liver and encompasses a spectrum of conditions, ranging from simple fat accumulation (steatosis) to more severe disorders like MASH. As this allele is relatively rare in primary tissue, researchers have invested in animal studies. However, these mice don't accurately reflect the consequences of genetic mutation. Moreover, the mouse and human TM6SF2 proteins are only 78% identical. We generated iHep- TM6SF2-E167K to create an accurate model to study the impact of TM6SF2 rs58542926 on hepatocyte function. In this study, we generated iPSCs from a healthy individual, followed by CRISPR / Cas9 gene editing to introduce the variant. Induced hepatocytes demonstrated an upregulation in lipid accumulation, total cholesterol, intracellular ApoB100, ER and mitochondria stress markers, ROS, beta-oxidation, apoptosis markers, pro-inflammatory molecules, and fatty acid biosynthesis pathways.

[0169] The negative effect of intracellular lipid accumulation has been previously described. We observed an increase in lipid droplets inside iHep-TM6SF2-E167K when compared to iHep-TM6SF2-WT. Furthermore, we analyzed both intracellular and extracellular ApoB100, VLDL, and cholesterol levels. VLDL transports triglycerides from the liver to peripheral tissues, while ApoB100 is essential for the formation, stability, and function of VLDL particles. Dysregulation of VLDL and ApoB100 production and metabolism can lead to lipid disorders and contribute to conditions like MASLD. Our studies revealed a significant difference in total cholesterol, with a notable variation in the ratio between intracellular and extracellular content. A significant decrease in VLDL and ApoB100 secretion in iHep-TM6SF2- E167K accompanied by higher intracellular ApoB100 was observed. In 2019, Prill et al. demonstrated that having only one allele copy (CT) of the TM6SF2-E167K mutation is linked to an upregulation of cholesterol and fatty acid biosynthesis pathways, along with decreased ApoB100 secretion in 3D spheroid cultures of primary human mutant hepatocytes. Divergent results were found in animal models, in which the quantity of ApoB100 particles secreted by TM6SF2 KO mice remained unchanged. These conflicting findings raise questions about the extent to which results from mouse models can be extrapolated to human physiology, emphasizing the need for clinical metabolic research. Our results indicate overall cellular damage, corroborated by the upregulation of genes involved in cholesterol, fatty acid, and glucose metabolism in iHep-TM6SF2-E167K.

[0170] We also noted heightened expression of genes and proteins associated with mitochondrial dysfunction and ER stress in iHep-TM6SF2-E167K, indicating potential overall cellular damage. It is well established that HSP70, a crucial protein associated with mitochondrial and ER stress, plays a vital role in the generation, proper folding, and transportation of misfolded proteins to proteolytic enzymes within the mitochondrial matrix. Moreover, we detected irregularities in mitochondrial structure, as evidenced by transmission electron microscopy, aligning with known characteristics of ER stress. Global lipidomics analysis showed an up-regulation of important lipid classes which are related to ER stress, mitochondrial dysfunction, apoptosis, absorption and excretion of cholesterol, lipid metabolism, and the breakdown of triglycerides. Earlier studies have established that TM6SF2-E167K leads to protein misfolding, acceleration of protein degradation, and a reduction in TM6SF2 protein levels and function. To elucidate the mechanistic link between theTM6SF2-E167K variant, cellular stress, and lipid metabolism, we treated iHep- TM6SF2-E167K with an aromatic fatty acid, 4BBA, that has potential therapeutic effects against protein misfolding and ER stress. After facilitating-protein folding therapy, we observed a significant decrease in ATF4 and HSPA5 levels, two major branches of the unfolded protein response. Protein folding facilitation therapy can impact lipid metabolism, as ER stress influences lipid synthesis and storage. By alleviating the negative effects of UPR, 4-PBA can help restore ER lipid homeostasis by downregulating SREBPI c, a crucial transcription factor that regulates the expression of genes involved in lipid metabolism, such as ACC and FASN. This downregulation reduces lipid accumulation, mitigating lipotoxicity-induced ER stress, and helps maintain a balanced lipid profile. Additionally, by reducing ER stress, 4-PBA can decrease inflammatory phenotype, which is often linked to metabolic diseases and can worsen lipid metabolism disorders. The observed decrease in ER stress markers in response to 4-PBA treatment in iHep-TM6SF2-E167K highlights the therapeutic potential of targeting protein misfolding to alleviate ER stress and mitigate the detrimental effects of the TM6SF2-E167K mutation on hepatic lipid metabolism. These findings highlight one of the mechanisms by which this TM6SF2 variant increases susceptibility to liver disorders.

[0171] Although the invention has been described in detail for the purpose of illustration based on what is currently considered to be the most practical and preferred embodiments, it is to be understood that such detail is solely for that purpose and that the invention is not limited to the disclosed embodiments, but, on the contrary, is intended to cover modifications and equivalent arrangements that are within the spirit and scope of the appended claims. For example, it is to be understood that the present invention contemplates that, to the extent possible, one or more features of any embodiment can be combined with one or more features of any other embodiment.

Claims

THE INVENTION CLAIMED IS1 . A method of treating liver dysfunction in a patient, comprising administering to the patient a composition that reduces stress in the endoplasmic reticulum in an amount effective to treat the dysfunction in the patient.

2. The method of claim 1 , wherein the patient has cirrhosis.

3. The method of claim 1 , wherein the patient has non-alcoholic steatohepatitis.

4. The method of claim 1 , wherein the patient has fatty liver disease.

5. The method of claim 1 , wherein the patient has end-stage liver disease.

6. The method of claim 1 , wherein the patient has hepatitis.

7. The method of claim 1 , wherein the patient has metabolic dysfunction-associated steatotic liver disease (MASLD)8. The method of claim 1 , wherein the patient has a polymorphism in a gene encoding a transmembrane 6 superfamily 2 (TM6SF2) protein, a Patatin-like phospholipase domain-containing protein 3 (PNPLA3), and / or a protein tyrosine phosphatase receptor type D (PTPRD).

9. The method of claim 8, wherein the polymorphism is rs58542926, rs738409, and / or rs10756038.

10. The method of claim 1 , wherein the patient exhibits reduced levels of fatty acids.1 1. The method of claim 10, wherein administering the composition to the patient increases the levels of fatty acids in the patient.

12. The method of claim 1 , wherein the patient exhibits reduced levels of lipids.

13. The method of claim 13, wherein administering the composition to the patient increases the levels of lipids in the patient.

14. The method of claim 12 or claim 13, wherein the lipid is VLDL15. The method of claim 1 , wherein the composition comprises a protein folding facilitator.

16. The method of claim 15, wherein the protein folding facilitator comprises 4-phenylbutyric acid (4-PBA), or a pharmaceutically acceptable salt thereof.

17. The method of claim 1 , wherein the composition comprises a histone deacetylase (HDAC) inhibitor.

18. The method of claim 17, wherein the histone deacetylase inhibitor is one or more of vorinostat, romidepsin, belinostat, Panobinostat, entinostat, givinostat, abexinostat, tucidinostat, pracinostat, ricolinostat, valproic acid, 4- phenylbutyric acid (4-PBA), a pharmaceutically-acceptable salt of any of the foregoing, and / or any combination thereof.

19. The method of claim 18, wherein the HDAC inhibitor is 4-PBA.

20. The method of claim 1 , wherein the composition is an antioxidant.

21. The method of claim 1 , wherein the composition is ursodeoxycholic acid, tauroursodeoxycholic acid, a GLP-1 receptor agonist, vitamin C, vitamin E, 4p8c, epigallocatechin-3-gallate (EGCG), quercetin, luteolin, GSK2606414, N-acetyl cysteine, resveratrol, rapamycin, a pharmaceutically- acceptable salt of any of the foregoing, and / or any combination thereof.

22. The method of claim 1 , wherein the patient has a polymorphism in a gene that is associated with lipid metabolism.

23. The method of claim 22, wherein the polymorphism is in a gene having a sequence having at least 80%, at least 85%, at least 90%, at least 95%, and / or at least 99% sequence identity to SEQ ID NO: 12, SEQ ID NO: 14, and / or SEQ ID NO: 16.

24. The method of claim 22, wherein the gene has a sequence having at least 80%, at least 85%, at least 90%, at least 95%, and / or at least 99% sequence identity to SEQ ID NO: 13, SEQ ID NO: 15, and / or SEQ ID NO: 17.

Citation Information

Patent Citations

  • Compositions and methods for treating viral infections

    WO2020087107A1

  • Compositions and methods for treating liver disease

    WO2021076566A1