Engineered regulatory splice elements for gene therapies

Abstract

Provided are nucleic acids comprising an engineered tissue-specific exon / intron cassette that comprise a first nucleotide sequence comprising at least one exon specifically expressed in a dorsal root ganglion (DRG) neuron, optionally comprising an engineered start codon, an engineered non-sense mutation or an engineered an out-of-frame indel, and optionally comprising a second nucleotide sequence, wherein the first sequence and the second sequence are operably linked to a promoter and / or optionally other regulatory elements such that the first and second sequences are expressed in a cell comprising the nucleic acid; vectors comprising the nucleic acids; cells comprising the nucleic acids; and methods for their use in modulating the expression of the nucleic acid of interest.

Description

ENGINEERED REGULATORY SPLICE ELEMENTS FOR GENE THERAPIES

[0001] The disclosure is being filed along with a Sequence Listing in ST.26 XML format. The Sequence Listing is provided as a file titled “30663_WO” created 23 June 2025 and is 119 kilobytes in size. The Sequence Listing information in the ST.26 XML format is incorporated herein by reference in its entirety. TECHNICAL FIELD

[0002] The disclosure generally relates to biology and medicine, and more particularly it relates to engineered regulatory splice elements for use in the field of gene therapy, as well as compositions and methods including the same for improving off-target side effects. BACKGROUND

[0003] Gene therapy, such as viral vector-delivered gene therapy, has tremendous promise for the treatment of human diseases. Important concerns when designing such gene therapies are to ensure that transgenes are only delivered to the intended cell type and to mitigate side effects and toxicity when transgenes are delivered to and expressed in non-target cell types. Among the strategies to overcome off-target effects are the use of different viral coat proteins or the use of cell- and tissue-specific minimal promoters.

[0004] The ability to selectively target transgene expression to specific cell types in the nervous system is limited and relies on the use of cis-regulatory promoters and enhancer elements of highly cell type-specific genes to regulate expression of reporter and / or effector genes delivered by adeno-associated virus (AAV) or lentiviral constructs. For example, in the retina, AAV-based constructs using L / M cone opsin (Ye et al. (2016) Hum Gene Ther 27(l):72- 82) or mdRlbpl (Pellissier et al. (2014) Mol Ther Methods Clin Dev 1:14009) promoters targeted rod photoreceptors and Muller glia, respectively, with reasonably high specificity. Synapsin I (Glover et al. (2002) Mol Ther 5(5 Pt 1):509-516; and Kiigler et al. (2003) Gene Therapy 10(4):337-347) and CamKII promoters (Dittgen et al. (2004) Proc Natl Acad Sci USA 101(52):18206-18211) drove pan-neuronal and excitatory neuron-specific expression, respectively, in cortex. In a few cases, the use of promoters of highly cell type-specific neuropeptides, such as MCH, achieved cell type-specific expression when used in viral vectors (van den Pol et al. (2004) Neuron 42(4):635-652).

[0005] Even more limited is the ability to turn off or reduce transgene expression in a selected cell or tissue type of the nervous system, while simultaneously delivering to other tissues or cell types of the nervous system. For example, there are no viral vectors that allow delivery to central nervous system (CNS) neurons while avoiding expression in peripheral dorsal root ganglia (DRG) neurons.

[0006] Intl. Patent Application Publication No. WO 2021 / 077017 describes alternative splicing to induce photoreceptor-specific gene expression in the retina and neuron-specific gene expression in the brain. Intl. Patent Application Publication No. WO 2021 / 077017 also describes a neuronal intron sequence with a neuron-specific exon that selectively expresses green fluorescent protein (GFP) in neurons and discloses a photoreceptor intron sequence with a photoreceptor-specific exon that selectively expresses GFP in photoreceptors. Intl. Patent Application No. WO 2021 / 077017, however, does not describe any DRG-specific exons that are preferentially expressed in DRG neurons. BRIEF SUMMARY

[0007] In one aspect, the disclosure provides tissue-specific exon / intron nucleic acid sequences engineered to selectively express or reduce expression of transgene(s) in specific cells or tissues (e.g., without limitation in peripheral neurons such as DRG neurons).

[0008] In one aspect, the disclosure provides nucleic acids comprising an engineered DRG- specific exon. In one aspect, the nucleic acids comprise an engineered DRG-specific exon operably linked to a regulatory element comprising a promoter and operably linked to a transgene (e.g., encoding a product from a gene of interest (GOI)). In some embodiments, the engineered DRG-specific exon comprises an out-of-frame indel and / or a nonsense mutation engineered to reduce or inhibit the expression of the operably linked transgene in DRG neurons, while permitting expression of the transgene in other neurons and / or cell types. In some embodiments, the engineered DRG-specific exon comprises a transcription and a translation element(s) (e.g., a start codon and a Kozak sequence), which are engineered to facilitate expression of the operably linked transgene specifically in DRG neurons, while preventing expression of the transgene in other neurons and / or cell types.

[0009] In one aspect, the disclosure provides nucleic acids comprising a DRG-specific exon wherein the DRG-specific exon comprises an engineered start codon, an engineered stop codon, or an engineered frameshift mutation.

[0010] In non-limiting embodiments, the specific exon comprises an engineered stop codon or an engineered frameshift mutation.

[0011] In non-limiting embodiments, the DRG-specific exon comprises an engineered start codon.

[0012] In non-limiting embodiments, the nucleic acids further comprise at a 5' end a flanking sequence 1 and at a 3' end a flanking sequence 2. In non-limiting embodiments, the flanking sequence 1 comprises a first splicing donor sequence and a first splicing acceptor sequence. In non-limiting embodiments, the flanking sequence 2 comprises a second splicing donor sequence and a second splicing acceptor sequence.

[0013] In non-limiting embodiments, the nucleic acids comprise in 5' to 3' order: (A) a flanking sequence 1 comprising a first splicing donor sequence and a first splicing acceptor sequence; (B) a DRG-specific exon comprising an engineered start codon, an engineered stop codon, or an engineered frameshift mutation; and (C) a flanking sequence 2 comprising a second splicing donor sequence and a second splicing acceptor sequence.

[0014] In non-limiting embodiments, the flanking sequence 1 comprises a flanking exon 1 and a flanking intron 1.

[0015] In non-limiting embodiments, the flanking sequence 2 comprises a flanking exon 2 and a flanking intron 2.

[0016] In non-limiting embodiments, the DRG-specific exon comprising an engineered start codon, an engineered stop codon, or an engineered frameshift mutation, is derived from a non- engineered exon that comprises ENSG00000175216.14_36 from gene CKAP5 (SEQ ID NO:79); ENSG00000066032.18_40 from gene CTNNA2 (SEQ ID NO:80), ENSG00000144868.13_9 gene TMEM108 (SEQ ID NO:81), or ENSG00000188316.13_6 from gene ENO4 (SEQ ID NO:82).

[0017] In non-limiting embodiments, the DRG-specific exon, comprising an engineered start codon, an engineered stop codon, or an engineered frameshift mutation, is derived from a non- engineered exon that consists essentially of ENSG00000175216.14_36 from gene CKAP5 (SEQ ID NO:79); ENSG00000066032.18_40 from gene CTNNA2 (SEQ ID NO:80), ENSG00000144868.13_9 gene TMEM108 (SEQ ID NO:81), or ENSG00000188316.13_6 from gene ENO4 (SEQ ID NO:82).

[0018] In non-limiting embodiments, the specific exon, comprising an engineered start codon, an engineered stop codon, or an engineered frameshift mutation, is derived from a non- engineered exon that consists of ENSG00000175216.14_36 from gene CKAP5 (SEQ ID NO:79); ENSG00000066032.18_40 from gene CTNNA2 (SEQ ID NO:80), ENSG00000144868.13_9 gene TMEM108 (SEQ ID NO:81), or ENSG00000188316.13_6 from gene ENO4 (SEQ ID NO:82).

[0019] In non-limiting embodiments, the nucleic acids further comprise a start codon immediately to the 5’ of the flanking sequence 1 and the DRG-specific exon comprises an engineered frameshift mutation.

[0020] In non-limiting embodiments, the DRG-specific exon comprising an engineered frameshift mutation comprises SEQ ID NO:23, SEQ ID NO:27, SEQ ID NO:83, SEQ ID NO:31, SEQ ID NO:35 or SEQ ID NO:84.

[0021] In non-limiting embodiments, the DRG-specific exon comprising an engineered frameshift mutation consists essentially of SEQ ID NO:23, SEQ ID NO:27, SEQ ID NO:83, SEQ ID NO:31, SEQ ID NO:35 or SEQ ID NO:84.

[0022] In non-limiting embodiments, the DRG-specific exon comprising an engineered frameshift mutation consists of SEQ ID NO:23, SEQ ID NO:27, SEQ ID NO:83, SEQ ID NO:31, SEQ ID NO:35 or SEQ ID NO:84.

[0023] In non-limiting embodiments, the DRG-specific exon comprising an engineered start codon further comprises a Kozak sequence operably linked to the engineered start codon.

[0024] In non-limiting embodiments, the DRG-specific exon comprising an engineered start codon comprises SEQ ID NO:40.

[0025] In non-limiting embodiments, the DRG-specific exon comprising an engineered start codon consists essentially of SEQ ID NO:40.

[0026] In non-limiting embodiments, the DRG-specific exon comprising an engineered start codon consists of SEQ ID NO:40.

[0027] In non-limiting embodiments, the nucleic acids further comprise at a 5’ end an expression control element comprising a promoter.

[0028] In non-limiting embodiments, the nucleic acids further comprise at a 3’ end a transgene sequence encoding a gene product.

[0029] In one aspect, the disclosure provides a nucleic acid sequence, wherein the nucleic acid comprises in 5' to 3' order:(A) an expression control element comprising a promoter, (B) a flanking sequence 1 comprising a first splicing donor sequence and a first splicing acceptor sequence, wherein the flanking sequence 1 comprises a flanking exon 1 and a flanking intron 1; (C) a DRG-specific exon comprising an engineered start codon, an engineered stop codon, or an engineered frameshift mutation; (D) a flanking sequence 2 comprising a second splicing donor sequence and a second splicing acceptor sequence, wherein the flanking sequence 2 comprises a flanking exon 2 and a flanking intron 2; and (E) a (trans)gene sequence encoding a product, wherein the expression control element is operably linked to and directs expression of (B), (C), (D) and (E).

[0030] In non-limiting embodiments, sequences (B), (C) and (D) are a nucleotide sequence that is at least 90% identical to or 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% identical to SEQ ID NO:22, 24 or 25 (the sequences of exon ENSG00000175216.14_36 from gene CKAP5).

[0031] In non-limiting embodiments, sequences (B), (C) and (D) are a nucleotide sequence that is at least 90% identical to or 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% identical to SEQ ID NO:26, 28 or 29 [the sequences of exon ENSG00000188316.13_6 from gene ENO4].

[0032] In non-limiting embodiments, sequences (B), (C) and (D) are a nucleotide sequence that is at least 90% identical to or 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% identical to SEQ ID NO:30, 32 or 33 [the sequences of exon ENSG00000066032.18_40 from gene CTNNA2].

[0033] In non-limiting embodiments, sequences (B), (C) and (D) are a nucleotide sequence that is at least 90% identical to or 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% identical to SEQ ID NO:34, 36 or 37 [the sequences of exon ENSG00000144868.13_9 gene TMEM108].

[0034] In non-limiting embodiments, sequences (B), (C) and (D) are a nucleotide sequence that comprises SEQ ID NO:22, 24 or 25 [the sequences of exon ENSG00000175216.14_36 from gene CKAP5] (the cassette without a target gene).

[0035] In non-limiting embodiments, sequences (B), (C) and (D) are a nucleotide sequencethat consists of SEQ ID NO:22, 24 or 25 sequences of exon ENSG00000175216.14_36 from gene CKAP5] (the cassette without a target gene).

[0036] In non-limiting embodiments, sequences (B), (C) and (D) are a nucleotide sequence that comprises SEQ ID NO:26, 28 or 29 [the sequences of exon ENSG00000188316.13_6 from gene ENO4] (the cassette without a target gene).

[0037] In non-limiting embodiments, sequences (B), (C) and (D) are a nucleotide sequence that consists of SEQ ID NO:26, 28 or 29 [the sequences of exon ENSG00000188316.13_6 from gene ENO4] (the cassette without a target gene).

[0038] In non-limiting embodiments, sequences (B), (C) and (D) are a nucleotide sequence that comprises SEQ ID NO:30, 32 or 33 [the sequences of exon ENSG00000066032.18_40 from gene CTNNA2] (the cassette without a target gene).

[0039] In non-limiting embodiments, sequences (B), (C) and (D) are a nucleotide sequence that consists of SEQ ID NO:30, 32 or 33 [the sequences of exon ENSG00000066032.18_40 from gene CTNNA2] (the cassette without a target gene).

[0040] In non-limiting embodiments, sequences (B), (C) and (D) are a nucleotide sequence that comprises SEQ ID NO:34, 36 or 37 [the sequences of exon ENSG00000144868.13_9 gene TMEM108] (the cassette without a target gene) (the cassette without a target gene).

[0041] In non-limiting embodiments, sequences (B), (C) and (D) are a nucleotide sequence that consists of SEQ ID NO:34, 36 or 37 [the sequences of exon ENSG00000144868.13_9 gene TMEM108] (the cassette without a target gene) (the cassette without a target gene).

[0042] In non-limiting embodiments, sequences (B), (C) and (D) are a nucleotide sequence that is at least 90% identical to or 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% identical to SEQ ID NO:39 (the sequences of exon ENSG00000175216.14_36 from gene CKAP5) ON.

[0043] In non-limiting embodiments, sequences (B), (C) and (D) are a nucleotide sequence that comprises SEQ ID NO:39. In non-limiting embodiments, sequences (B), (C) and (D) are a nucleotide sequence that consists of SEQ ID NO:39.

[0044] In non-limiting embodiments of the nucleic acids, the flanking sequence 1 comprises a splicing factor binding site of SEQ ID NO:1, 2, 3, 4, 5, 6, 21, or combination thereof.

[0045] In non-limiting embodiments of the nucleic acids, the flanking sequence 2 comprises a splicing factor binding site of SEQ ID NO:1, 2, 3, 4, 5, 6, 21, or combination thereof.

[0046] In non-limiting embodiments of the nucleic acids, the transgene is GBA1, PGRN,TREM2, a gene editing enzyme (e.g., limitation a Cas family member or other), ApoE / ApoE2, HTT, MAPT, SNCA, C9orf72 or SOD1.

[0047] In non-limiting embodiments of the nucleic acids, the expression of the transgene in DRG neuron is reduced compared to a nucleic acid without the DRG-specific exon.

[0048] In non-limiting embodiments, the nucleic acids further comprise a nucleotide sequence encoding a proteolytic cleavage sequence (e.g., a self-cleavage peptide sequence) inserted between the flanking sequence 2 and the transgene sequence.

[0049] In non-limiting embodiments, the proteolytic cleavage sequence is a nucleotide sequence encoding a proteolytic cleavage peptide T2A of SEQ ID NO:85, P2A of SEQ ID NO:86, E2A of SEQ ID NO:87, or F2A of SEQ ID NO:88. In non-limiting embodiments of the nucleic acids, the proteolytic cleavage sequence is P2A cleavage sequence (SEQ ID NO:38).

[0050] In non-limiting embodiments, the nucleic acids further comprise a nucleotide sequence encoding an internal ribosome entry site (IRES) sequence inserted between the flanking sequence 2 and the transgene sequence.

[0051] In non-limiting embodiments, the transgene sequence is a codon-optimized sequence.

[0052] In non-limiting embodiments, a nucleic acids further comprise: (A’) a first AAV ITR or a reverse complementary sequence thereto inserted before the expression control element of (A); (F) a post-transcriptional regulatory element inserted after the transgene sequence encoding the gene product of (E); (G) a polyadenylation signal inserted after the post-transcriptional regulatory element (F); and / or (H) a second AAV ITR or a reverse complementary sequence thereto inserted after the polyadenylation signal (G).

[0053] In one aspect, the disclosure provides a vector comprising any one of the nucleic acids herein.

[0054] In non-limiting embodiments, the vector is a recombinant adeno-associated virus (rAAV) vector.

[0055] In one aspect, the disclosure provides a rAAV comprising the rAAV vector comprising any one of the nucleic acids herein and an AAV capsid protein. In non-limiting embodiments, the AAV capsid protein is AAV6 or AAV9 capsid protein. In non-limiting embodiments, the AAV6 capsid protein comprises SEQ ID NO:19. In non-limiting embodiments, the AAV9 capsid protein comprises SEQ ID NO:20.

[0056] In one aspect, the disclosure provides a pharmaceutical composition comprising any one of the nucleic acids herein, a vector comprising any one of the nucleic acids herein, or arAAV comprising any one of the nucleic herein, and a pharmaceutically acceptable carrier.

[0057] In one aspect, the disclosure provides a method of treating a CNS disease or disorder in an individual in need thereof comprising administering to the individual a therapeutically effective amount of any one of the nucleic acids herein, a vector comprising any one of the nucleic acids herein, or a rAAV comprising any one of the nucleic acids herein, or a pharmaceutical composition comprising any of these.

[0058] In one aspect, the disclosure provides a method of reducing a transgene expression in a DRG neuron during a treatment of a CNS disease or disorder, comprising administering to an individual in need thereof a therapeutically effective amount any one of the nucleic acids herein, a vector comprising any one of the nucleic acids herein, or a rAAV comprising any one of the nucleic acids herein, or a pharmaceutical composition comprising any of these, wherein the transgene expression is reduced in a DRG neuron.

[0059] In non-limiting embodiments, administering comprises intra-cisterna magna (ICM), intracerebroventricular (ICV), intraparenchymal (IP), or intravenous (IV) administration.

[0060] In one aspect, the disclosure provides any one of the nucleic acids herein, a vector comprising any one of the nucleic acids herein, or a rAAV comprising any one of the nucleic acids herein, or a pharmaceutical composition comprising any of these for use in therapy.

[0061] In one aspect, the disclosure provides any one of the nucleic acids herein, a vector comprising any one of the nucleic acids herein, or a rAAV comprising any one of the nucleic acids herein, or a pharmaceutical composition comprising any of these for use in treating a CNS disease or disorder.

[0062] In one aspect, the disclosure provides use of any one of the nucleic acids herein, a vector comprising any one of the nucleic acids herein, or a rAAV comprising any one of the nucleic acids herein, or a pharmaceutical composition comprising any of these in the manufacture of a medicament for treatment of a CNS disease or disorder. BRIEF DESCRIPTION OF THE DRAWINGS

[0063] The advantages, effects, features and objects other than those set forth above will become more readily apparent when consideration is given to the detailed description below. Such detailed description refers to the following drawing(s), where:

[0064] Figure 1A shows a schematic of one embodiment of an engineered ‘DRG OFFcassette’ design. To design DRG OFF the DRG-specific exon is modified to include a frameshift mutation. Flanking exon 1 and a flanking intron 1 are referred to as flanking sequence 1. Flanking exon 2 and a flanking intron 2 are referred to as flanking sequence 2. The flanking sequence 1 comprises a first splicing donor sequence and a first splicing acceptor sequence. The flanking sequence 2 comprises a second splicing donor sequence and a second splicing acceptor sequence. A start codon (e.g., ATG) is added immediately before the flanking exon 1. Figure 1B shows a schematic of the expected splicing outcomes in vivo of the DRG- specific cassette from Figure 1A.

[0065] Figure 2A shows a schematic of one embodiment of an engineered ‘DRG ON cassette’ design. To design the DRG ON cassette, a Kozak sequence and a start codon (e.g., GCCACCATG; SEQ ID NO:41) is inserted in the DRG-specific exon in the middle or near the 3' end of the exon. Flanking exon 1 and a flanking intron 1 are referred to as flanking sequence 1. Flanking exon 2 and a flanking intron 2 are referred to as flanking sequence 2. The flanking sequence 1 comprises a first splicing donor sequence and a first splicing acceptor sequence. The flanking sequence 2 comprises a second splicing donor sequence and a second splicing acceptor sequence. In the DRG ON cassette, there is no start ATG codon immediately in front of the flanking exon 1. Figure 2B shows a schematic of the expected splicing outcomes in vivo of the DRG cassette from Figure 2A.

[0066] Figure 3A is gene model showing a portion of the gene including a tissue-specific exon and adjacent upstream and downstream introns and exons. Figure 3B shows a schematic representation of an intron minimization strategy indicating portions of the adjacent upstream and downstream introns and exons retained in an engineered cassette. In one non-limiting embodiment, the tissue-specific exon in Figure 3A is a DRG-specific exon, and the engineered construct in Figure 3B is a DRG-specific cassette. Flanking exon 1 and a flanking intron 1 are referred to as flanking sequence 1. Flanking exon 2 and a flanking intron 2 are referred to as flanking sequence 2. The flanking sequence 1 comprises a first splicing donor sequence and a first splicing acceptor sequence. The flanking sequence 2 comprises a second splicing donor sequence and a second splicing acceptor sequence.

[0067] Figure 4A shows a schematic representation of the cloning site of a DRG OFF cassette with a transgene cloned in an rAAV. Figure 4B shows a schematic representation of the cloning site of a DRG OFF cassette with EGFP transgene cloned in an rAAV. In Figure 4A and Figure 4B, flanking exon 1 and a flanking intron 1 are referred to as flanking sequence 1. Flankingexon 2 and a flanking intron 2 are referred flanking sequence 2. The flanking sequence 1 comprises a first splicing donor sequence and a first splicing acceptor sequence. The flanking sequence 2 comprises a second splicing donor sequence and a second splicing acceptor sequence.

[0068] Figure 5 shows a schematic map of one embodiment of an exemplary rAAV vector comprising a DRG OFF cassette and a transgene.

[0069] Figure 6 shows a schematic map of one embodiment of an exemplary rAAV vector comprising a DRG ON cassette and a transgene.

[0070] Figure 7A and Figure 7B show transgene protein expression from a DRG OFF cassette. Figure 7A shows DRG detargeting of the transgene (i.e., GFP) in mice. GFP expression is visible as brown staining in the panel labeled “Standard GFP control.” Figure 7B shows expression of the transgene (e.g., GFP) from the DRG OFF cassette in the mouse brain. GFP expression is visible as brown staining in various panels. DETAILED DESCRIPTION

[0071] In certain aspects, provided are nucleic acids comprising DRG-specific exons comprising an engineered start codon, an engineered stop codon or an engineered frameshift mutation, as well as DRG-specific cassettes and DRG-specific expression constructs comprising the same for use, for example, in vectors and viruses for gene therapies, and methods for their design.

[0072] In some embodiments, the methods to design such nucleic acids include integrated bioinformatic and experimental methodology for identifying, designing, and testing of DRG- specific expression sequences. The nucleic acid sequences comprise an engineered DRG- specific exon and permit control of the tissues in which a transgene is operably linked to an engineered DRG-specific exon is expressed. In non-limiting embodiments, these nucleic acids are inserted in AAV vectors and rAAV, and their controlled expression provides a precision delivery with safety and efficacy in gene therapies. In one embodiment (e.g. “DRG OFF Cassette”), the DRG-specific expression sequences are designed to reduce or eliminate transgene expression (e.g., AAV-delivered transgene expression in DRG neurons).

[0073] In some embodiments, the nucleic acids herein are engineered to comprise DRG- specific exons and undergo alternative splicing for preferential exon expression in DRG neurons. By operably linking a DRG-specific exon(s) to a transgene of interest, it can beensured that a vector carrying this transgene will preferentially express the transgene in the desired cell type. The nucleic acids comprising engineered DRG-specific exons and expression constructs herein can be combined with other methods and strategies of controlling vector delivery and transgene expression in gene therapy. For example, tissue-specific microRNA (miRNA) binding sites could be added to the vector to control expression via target miRNA binding. Alternatively, a tissue specific promoter could be used in combination with the DRG-specific exons.

[0074] In some embodiments, nucleic acids are provided that comprise engineered sequences of DRG-specific exon, wherein the DRG-specific exon comprises an engineered start codon, an engineered stop codon, or an engineered frameshift mutation engineered in an alternately spliced exons, which are preferentially expressed in human DRG neurons. A DRG-specific exon sequence and flanking nucleotide sequences are used to engineer nucleic acid sequences that are DRG-specific cassettes. In one embodiment, DRG-specific cassettes are engineered as a “DRG OFF cassette.” To create a “DRG OFF cassette,” in some embodiments +1 or +2 bases are incorporated into the DRG-specific exon, causing a reading frame change, which can also introduce a stop codon(s). In some embodiments, these DRG-specific cassettes serve as a regulatory element that can be incorporated in a vector comprising a transgene of interest, for example, a rAAV vector comprising a therapeutic gene of interest. In embodiments where the DRG-specific cassette is a “DRG OFF cassette” and is operably linked to a transgene comprised in a rAAV vector, the transgene expression is reduced or eliminated specifically in DRG neurons.

[0075] Splicing of pre-mRNA is a known a biological process that generates mature messenger RNA (mRNA). Splicing is the processing of a newly synthesized messenger RNA transcript. During splicing, introns are removed and exons are joined together (ligated) to form mature mRNA molecule containing a complete open reading frame that is decoded and translated into a protein. For nuclear-encoded genes, splicing takes place within the nucleus either co-transcriptionally or immediately after transcription. The molecular mechanism of RNA splicing has been extensively described, for example, in Pagani et al. (2004) Nat. Rev. Genetics 5:389-396; Clancy et al. (2011) Nat. Ed. 1(1):31; Cheng et al. (2014) Mol. Gen. Genom. 286(5-6):395-410; Taggart et al. (2012) Nat. Struc. Mol. Biol. 19(7):719-722. One skilled in the art is familiar with the mechanism and required sequence elements and splicing factors for RNA splicing.

[0076] Alternative splicing is a of pre-mRNA splicing that generates mRNA variants / isoforms. Alternative splicing is a regulated process during gene expression that could result in a single gene coding for multiple protein variants. See, Marasco & Kornbihtt (2023) Nat. Rev. Mol. Cell Biol.24:242-254, and references therein.

[0077] Proteins translated from alternatively spliced mRNAs may contain differences in their amino acid sequence and, often, in their biological functions. Alternative splicing allows the human genome to direct the synthesis of many more proteins than would be expected from its 20,000 protein-coding genes. Alternative splicing is sometimes termed differential splicing.

[0078] Alternative splicing occurs as a normal phenomenon in eukaryotes, where it greatly increases the biodiversity of proteins that can be encoded by the genome; in humans, ~95% of multi-exonic genes are alternatively spliced. There are numerous modes of alternative splicing observed, of which exon skipping is common. In this mode, a particular exon may be included in mRNAs under some conditions or in particular tissues or cell types, and / or omitted from the mRNA in others. The regulation of alternative splicing is also described in the art, for example, in Douglas et al. (2003) Ann. Rev. Biochem. 72(1):291-336; Pan et al. (2008) Nat. Gen. 40(12):1413-1415; Martin et al. (2005) Nat. Rev. 6(5):386-398; Skotheim et al. (2007) Int. J. Biochem. Cell Biol.39(7-8):1432-1449.

[0079] Abnormal variations in splicing are also implicated in disease; a large proportion of human genetic disorders result from splicing variants. Abnormally spliced variants are also thought to contribute to the development of cancer, and splicing factor genes are frequently mutated in different types of cancer.

[0080] During splicing, an intron sequence is spliced or removed, and exons are joined. An “intron” is any nucleotide sequence within a gene that typically is removed by RNA splicing during maturation of the final RNA product. Intron refers to both the DNA sequence within a gene and the corresponding sequence in RNA transcripts. Sequences that are joined together in the final mature RNA after RNA splicing are exons, and exons typically encode protein sequences. Exon refers to both the DNA sequence within a gene and the corresponding sequence in RNA transcripts. It is also well understood that exons of genes that do not encode a protein are as bona fide exons as exons of genes that encode protein. Furthermore, at mRNA 5' and 3' ends, exons can include untranslated regions that may never encode an amino acid stretch. As such, “exon” is a portion of a gene that is included in the final spliced mRNA, whereas introns are portions that are absent from the mature RNA. See, The National HumanGenome Research Institute, National of Health (NIH). Due to the different modes of alternative splicing, in particular in the selection of alternative 5' or 3' splice sites, a portion of an intron may become part of an exon and vice versa.

[0081] Introns are found in the genes of most organisms and many viruses. Introns can be located in a wide range of genes, including those that generate proteins, ribosomal RNA (rRNA), and transfer RNA (tRNA). When proteins are generated from intron-containing genes, RNA splicing takes place as part of the RNA processing pathway and introns are removed by RNA splicing either shortly after or concurrent with transcription (see, e.g., Tilgner et al. (2012) Gen. Res.22(9):1616-1625).

[0082] Within introns, a donor sequence (typically at the 5' end of the intron), a branch sequence (typically near the 3' end of the intron) and an acceptor sequence (typically at the 3' end of the intron) are required for splicing. The splice donor sequence includes an almost invariant sequence GU at the 5' end of the intron, within a larger, less highly conserved region. The splice acceptor sequence at the 3' end of the intron terminates the intron with an almost invariant AG sequence. Upstream (5'-ward in the intron) from the AG there is a region high in pyrimidines (C and U), or polypyrimidine tract. Further upstream from the polypyrimidine tract is the branchpoint, which includes an adenine nucleotide involved in lariat formation (Clancy (2008) Nat. Ed.1(1):31; and Black (2003) Ann. Rev. Biochem.72(1):291-336). The consensus sequence for an intron (in IUPAC nucleic acid notation) is:G-G-[cut]-G-U-R-A-G-U (donor site) ... intron sequence ... Y-U-R-A-C (branch sequence 20-50 nucleotides upstream of acceptor site) ... Y-rich-N-C-A-G-[cut]-G (acceptor site) (“Molecular Biology of the Cell,” 2012 Journal Citation Reports. Web of Science (Science ed.). Thomson Reuters. 2013). However, it is noted that the specific sequence of intronic splicing elements and the number of nucleotides between the branchpoint and the nearest 3’ acceptor sequence affects splice site selection (Taggart et al. (2012) Nat. Struct. Mol. Biol.1907):719-721; and Corvelo et al. (2010) PLoS Comp. Biol. 6(11)). Also, point mutations in the underlying DNA or errors during transcription can activate a cryptic splice sequence in part of the transcript that usually is not spliced. This results in a mature messenger RNA with a missing section of an exon. In this way, a point mutation, which might otherwise affect a single amino acid, can manifest as a deletion or truncation in the final protein.

[0083] Processing of eukaryotic pre-mRNAs is a complex process that requires a multitude of sequences, signals and protein factors to achieve appropriate mRNA splicing. Exondefinition by the spliceosome requires more the canonical splicing sequences which define intron-exon boundaries. For example, one such additional signal is provided by cis-acting regulatory enhancer and silencer sequences. Exonic splicing enhancers (ESE), exonic splicing silencers (ESS), intronic splicing enhancers (ISE) and intron splicing silencers (ISS) have been identified which either repress or enhance usage of splice donor sequence or splice acceptor sequence, depending on their site and mode of action (Yeo et al. (2004) Proc. Natl. Acad. Sci. U.S.A. 101(44):15700-15705). Binding of specific proteins (trans-acting factors) to these regulatory sequences directs the splicing process, either promoting or inhibiting usage of particular splice sites and thus modulating the ratio of splicing products (Scamborova et al. (2004) Mol. Cell. Biol. 2(5j):1855-1869; Hovhannisyan & Carstens (2005) Mol. Cell. Biol. 25(l):250-263; and Minovitsky et al. (2005) Nucleic Acids Res.330:714-724).

[0084] Nucleic Acids: DRG-Specific Exons, DRG-Specific Cassettes and DRG-Specific Expression Constructs

[0085] DRG-specific exons can be identified by any suitable method. In non-limiting embodiments, DRG-specific exon sequences are identified by analyses of mRNA in cells. These analyses include, without limitation, transcriptome analyses using genome-wide methodologies, including without limitation RNA sequencing (RNA-seq) and microarrays. In non-limiting embodiments, DRG-specific exon sequences are identified by proteomic analyses, including analyses based on liquid chromatography coupled to tandem mass spectrometry (LC-MS / MS).

[0086] Table 1: Non-limiting embodiments of DRG specific exons and difference in expression. Gene Name Exon_id Log2 Fold Log2 Fold Log2 Fold Average h h h li L 2 F ld erCKAP5 ENSG00000 -2.07 -19.99 -20.47 -14.18 175216.14_CKAP5 AATTATGTATCGCACTTATAGGAT (SEQ ID NO:79) CTNNA2 ACAGGAGTTCAGAGCACTTTCACTACCTTTTATGAGGTAGATTGTG ATGTCATAGATGGGGGCAGGGCTAGTCAACTTTCTACCCACCTCCC AACCTGTGCTGAGGGAGCTCCGATCGGGAGTGGAAGCAGTGATTC CTCCATG (SEQ ID NO:80) TMEM108 ACAGAATCATGAATAAACTGGAGGATAAGCAGGACCAGATGATACC ATGAAGAGAAGTTTACAGGCCCTCTATTGCCAACTGTTAA (SEQ ID NO:81) ENO4 GGAGGAAGGATACTATTACAGAGAAACCTATTGCGCCTGCAGAGC CTGTTGAGCCTGTACTCAGTGGCAGTATGGCCATAGGGGCCGTGTC ACTAGCTGTTGCCAAAGCCTGTGCCATGCTGCTTAATAAACCTCTG TACTTAAATATCGCTCTACTGAAGCACAATCAG (SEQ ID NO:82)

[0088] In some embodiments, a nucleic acid herein comprises a DRG-specific exon, wherein the DRG-specific exon comprises an engineered start codon, an engineered stop codon, or an engineered frameshift mutation. In non-limiting embodiments, the DRG-specific exon comprises an engineered stop codon or an engineered frameshift mutation. In non-limiting embodiments, the DRG-specific exon comprises an engineered start codon.

[0089] In some embodiments, a nucleic acid herein comprises an engineered DRG-specific exon inserted between a flanking sequence 1, which comprises at least a portion of an upstream exon linked to at least a portion of an upstream intron and a flanking sequence 2, which comprises at least a portion of a downstream intron linked to at least a portion of a downstream exon. In some embodiments, the flanking sequence 1 comprises a first splicing donor sequence and a first splicing acceptor sequence. In some embodiments, the flanking sequence 2 comprises a second splicing donor sequence and a second splicing acceptor sequence. In some embodiments, a flanking sequence 1 and / or a flanking sequence 2 further comprises intronicsplicing silencers or intronic splicing and / or exonic splicing silencers or intronic splicing enhancers, and / or any splicing factor binding site(s).

[0090] A non-limited example of a nucleotide sequence of a nucleic acid herein is shown in Figure 3B. In some embodiments, a DRG-specific cassette comprises nucleotide sequences from 5' to 3': optionally a regulatory element comprising a promoter; a flanking sequence 1 comprising a flanking exon 1 and a flanking intron 1; an engineered DRG-specific exon; a flanking sequence 2 comprising a flanking intron 2; and a flanking exon 2; wherein flanking sequence 1 comprises a first splicing donor sequence and a first splicing acceptor sequence (e.g., constitutive splice donor sequence, a branch sequence, and / or an alternative splice acceptor sequence); wherein the flanking exon 1 is designed from an upstream exon sequence or a fragment thereof and comprises consecutive nucleotides from the 3' end of the exon immediately upstream from the DRG exon; wherein the flanking intron 1 is designed from the intron immediately upstream from the DRG exon or a fragment of the intron, and comprises consecutive nucleotides from the 5' end of the upstream intron sequence and consecutive nucleotides from the 3' end of the upstream intron sequence, lacks any number of internal intron nucleotides so long as the flanking sequence 1 comprises a splice donor sequence, a branch site, and an alternative splice acceptor sequence, such that the DRG-specific exon is spliced specifically in DRG neurons; the engineered DRG-specific exon is based on a naturally occurring DRG-specific exon (e.g., without limitation an exon listed in Table 1), wherein flanking sequence 2 comprises a second splicing donor sequence and a second splicing acceptor sequence (e.g., alternative splice donor sequence, a branch sequence, and / or a constitutive splice acceptor sequence), wherein the flanking intron 2, which is designed from an intron immediately downstream from the DRG-specific exon or a fragment thereof; wherein the flanking intron 2 comprises consecutive nucleotides from the 5' end of the downstream intron sequence and consecutive nucleotides from the 3' end of the downstream intron sequence, and lacks any number of internal intron nucleotides so long as the flanking sequence 2 comprises an alternative splice donor sequence, a branch sequence, a splice acceptor sequence such that the DRG-specific exon is spliced specifically in DRG neurons; and wherein the flanking exon 2, which is designed from an exon immediately downstream from the DRG exon or a fragment thereof and comprises consecutive nucleotides from the 5' end of the exon immediately downstream from the DRG exon.

[0091] In addition to a DRG-specific as identified in Example 1, the design encompasses upstream exon-intron splicing junction(s), DRG alternative exon-intron splicing junctions, and downstream exon-intron splicing junction(s). In embodiments where the DRG- specific cassettes are intended for insertion into an expression vector, the synthesis and insertion constraints limit the length of the DRG-specific cassette. For example, when the vector is rAAV vector, the DRG-specific cassette is no more than around 1400 nucleotides. In embodiments where the DRG-specific cassette is inserted in a different expression vector and / or there are no limits on the length of the DRG-specific cassette, the size of the flanking intron and fragments of the upstream and / or downstream exons could be longer than exemplified in the design in Figure 3B.

[0092] To ensure the presence of the exon-intron splicing sequence junction in flanking sequence 1, a fragment from the 3' end of the exon immediately upstream from the DRG- specific exon (flanking exon 1) is also included. The included upstream exon fragment is of any suitable length, so long as an exon-intron splicing junction is included (e.g., as shown in Figure 3A). The upstream exon fragment can be of any suitable length, so long as the exon- intron splicing junction is retained, and the overall DRG-specific cassette length can be cloned in an expression vector.

[0093] To ensure the presence of the exon-intron splicing sequence in flanking sequence 2, a fragment from the 5’end of the exon immediately downstream from the DRG-specific exon (flanking exon 2) is also included. In some embodiments, the included downstream exon fragment was 60 bp as shown in Figure 3A. The upstream exon fragment can be of any suitable length, so long as the exon-intron splicing junction is retained, and the overall DRG-specific cassette length can be cloned in an expression vector.

[0094] To ensure the max 1400 bp size, a sequence minimization strategy was employed to design minimized sequences. Each flanking sequence comprises a flanking exon and a flanking intron. Each “flanking intron” (i.e., flanking intron 1 and flanking intron 2) in the DRG-specific cassette comprises 2 parts: a fragment of the full-length intron adjacent to the 5' splice site and a fragment of the full-length intron adjacent to the 3' splice site. In one approach of designing the minimized flanking introns, a number of nucleotides was removed from the center of the flanking intron(s), which are immediately upstream and / or downstream from the DRG-specific exon, such that the final length of the DRG-specific cassette is less than 1400 bp. If the flanking introns are sufficiently short in length, the entire intron was included. In another approach, anumber of nucleotides from the center of DRG-specific exon sequence was removed. Nucleotides are removed from the center of the DRG-specific exon and / or the flanking introns, and / or the flanking exons so long as flanking sequence 1 comprises a first splicing donor sequence and a first splicing acceptor sequence, and flanking sequence 2 comprises a second splicing donor sequence and a second splicing acceptor sequence (i.e., the splice sequences necessary for DRG-specific splicing are retained).

[0095] Figures 3A and 3B provide a visual representation of the design strategy. Figure 3A shows a gene model showing a portion of the gene including a tissue-specific exon and adjacent upstream and downstream introns and exons. Figure 3B shows a schematic representation of an intron minimization strategy indicating portions of the adjacent upstream and downstream introns and exons retained in the engineered cassette.

[0096] In certain aspects, the disclosure provides a DRG-specific cassette comprising the following nucleic acid sequences in 5' to 3' order: (A) a flanking sequence 1 comprising a first splicing donor sequence and a first splicing acceptor sequence; (B) a DRG-specific exon comprising an engineered start codon, an engineered stop codon, or an engineered frameshift mutation; and (C) a flanking sequence 2 comprising a second splicing donor sequence and a second splicing acceptor sequence.

[0097] In non-limiting embodiments, the flanking sequence 1 comprises a flanking exon 1 and a flanking intron 1. In non-limiting embodiments, the flanking sequence 2 comprises a flanking exon 2 and a flanking intron 2.

[0098] In non-limiting embodiments, the DRG-specific exon comprises ENSG00000175216.14_36 from gene CKAP5 (SEQ ID NO:79); ENSG00000066032.18_40 from gene CTNNA2 (SEQ ID NO:80), ENSG00000144868.13_9 gene TMEM108 (SEQ ID NO:81), or ENSG00000188316.13_6 from gene ENO4 (SEQ ID NO:82).

[0099] In non-limiting embodiments, the nucleic acids further comprise a start codon immediately to the 5' of the flanking sequence 1 and the DRG-specific exon comprises an engineered frameshift mutation.

[0100] In non-limiting embodiments, the DRG-specific exon comprising an engineered frameshift mutation comprises SEQ ID NO:23, SEQ ID NO:27, SEQ ID NO:83, SEQ ID NO:31, SEQ ID NO:35 or SEQ ID NO:84.

[0101] In non-limiting embodiments, the specific exon comprising an engineered start codon further comprises a Kozak sequence operably linked to the engineered start codon. In non-limiting embodiments, the DRG-specific exon comprising an engineered start codon comprises SEQ ID NO:40.

[0102] In non-limiting embodiments, a nucleic acid herein further comprises at its 5' end an expression control element comprising a promoter. In non-limiting embodiments, a nucleic acid herein further comprises at its 3' end a transgene sequence encoding a gene product.

[0103] In some embodiments, a DRG-specific expression construct is a nucleic acid comprising an engineered DRG-specific exon, a transgene encoding a gene product and also comprises a regulatory element comprising a promoter and a start codon. In some embodiments, the start codon can be upstream from the first intron sequence. In some embodiments, the transgene of interest is downstream of the second intron sequence. In some embodiments, the transgene of interest is downstream of the second exon sequence.

[0104] In some embodiments, a start codon is located upstream from the DRG-specific exon. In some embodiments, the start codon can be ATG. In some embodiments, the DRG-specific expression construct further comprises a 5' untranslated region (5'UTR). In some embodiments, the start codon can be preceded by a 5'UTR. In some embodiments, the 5'UTR can be positioned between the promoter and the start codon.

[0105] In some embodiments, the DRG-specific expression construct further comprises a polyadenylation signal. In some embodiments, the nucleic acid sequences disclosed herein comprise a 3' untranslated region (3'UTR). In some embodiments, the polyadenylation signal can be preceded by a 3'UTR. In some embodiments, the 3'UTR can be positioned between the transgene and the polyadenylation signal.

[0106] In some embodiments, a nucleic acid comprises an engineered DRG-specific exon comprising an engineered nucleotide change (e.g., a frameshift and / premature stop codon). Such engineered frameshift and / or premature stop codon leads to the unproductive translation of the transgene in the DRG-specific construct.

[0107] In some embodiments, a DRG-specific cassette is a DRG ON cassette, as the DRG- specific exon is spliced-in in frame with a downstream (e.g., transgene) sequence. The splicing incorporation of a DRG-specific exon into mature mRNA may result in a reading frameshift when the mRNA is translated in the DRG neuron. In embodiments, where the nucleotide sequence is a “DRG ON-cassette”, the nucleic acid includes a nucleotide sequence, for exampleand without limitation, a Kozak initiates translation of the transgene in the correct reading frame. In some embodiments, the Kozak sequence is inserted near the 3' end of the DRG-specific exon. In some embodiments, the Kozak sequence is operably linked to a start codon. In some embodiments, the Kozak sequence and the start codon are inserted at position 12 nucleotides from the 3' end of the DRG-specific exon. See, Figure 3A and Figure 3B and Example 2 for the design.

[0108] A frameshift mutation is a deletion or insertion of a DNA sequence that shifts the way the coding sequence is read. The insertion or deletion can change the reading frame, resulting in a completely different translation product as compared to a wild-type version of the DNA sequence. For example, the frameshift mutation can be the insertion of N*3+l base pairs (e.g., +1, +4, +7, etc.), the insertion of N*3+2 base pairs (e.g., +2, +5, +8, etc.), the deletion of N*3- l base pairs (e.g., -1, -4, -7, etc.), the deletion of N*3-2 base pairs (e.g., -2, -5, -7, etc.) or any combination thereof that leads to reading frame that is not a multiple of 3.

[0109] In some embodiments, a DRG-specific expression construct is a nucleic acid that comprises one or more exon splicing enhancer sequences. Splicing enhancer sequences confer DRG specificity during exon splicing. In some embodiments, the specific splicing enhancer sequences are not known. For exon splicing to occur, a DRG neuron must express the specific splicing factors (e.g., proteins that bind to RNA) that can induce the splicing of a DRG-specific exon sequence. As long as the expression construct can be delivered to the DRG neurons, the splicing machinery in DRG neurons splices the mRNA. In some embodiments, the DRG- specific expression sequence is spliced in a DRG neuron.

[0110] In some embodiments of the DRG-specific expression construct, the DRG-specific exon sequence is operably linked to upstream and downstream flanking sequences (e.g., flanking sequence 1 and a flanking sequence 2), which allow DRG-specific splicing of the DRG exon sequence. In some embodiments, the flanking sequence 1 and flanking sequence 2 comprise one or more introns. In some embodiments, the flanking sequence 1 and flanking sequence 2 comprise one or more exons (e.g., an upstream and / or a downstream exon). In some embodiments, the flanking sequence 1 and flanking sequence 2 comprise one or more exon splicing enhancer sequences. The nucleotide sequences of the DRG-specific expression construct that flank the DRG-specific exon sequence can be of any length that includes the necessary splice elements, and can be determined by one of ordinary skill in the art. In some embodiments, the flanking sequence 1 comprises a flanking exon 1 and a flanking intron 1, andthe flanking sequence 2 comprises a intron 2 and a flanking exon 2. In some embodiments, the sequences flanking the DRG-specific exon cassette can be about 10, 15, 20, 25, 30, 35, 40, 45, 55, 60, 65, 70, 75, 80, 85, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350 or more nucleotides in length, so long as the length of the entire DRG-specific expression construct does not exceed a number of nucleotides that permits its cloning in an expression vector. For example, the size of the DRG-specific expression construct is no more than about 1400 nucleotides in length in embodiments where the expression is a rAAV vector. The intron sequence on either side of the DRG-specific exon can be the same or different length. In some embodiments, common splicing elements or sequences (e.g., splicing enhancer sequences) are present in the sequences of the DRG-specific expression sequence that flank the DRG-specific exon sequence and are responsible for exon splicing. While the splice donor sequences, branch sequence(s), and splice acceptor sequences (e.g., constitutive splice donor (CSD), constitutive splice acceptor (ASA), alternative splice donor (ASD), alternative splice acceptor (CSA), and branch (B)) are important for the process of exon splicing, other sequences (e.g., exonic splicing enhancers, exonic splicing silencers, intronic splicing enhancers, and intron splicing silencers (ISS)) are important for conferring DRG neuron specificity. In some embodiments, CSD and CSA can be replaced by other “common” or “constitutive” splicing donor / acceptor sequences.

[0111] In some embodiments, the DRG-specific exon does not comprise a premature stop codon in a canonically spliced reading frame.

[0112] In some embodiments, the DRG-specific exon is spliced in-frame to the start codon of the transgene upon introducing the nucleic acid construct to DRG neurons. In these embodiments, the transgene is productively translated and a functional product is produced in the DRG neurons. In some embodiments, where the DRG-specific exon sequence comprises a frameshift and / or a stop codon, even if the DRG-specific exon sequence is spliced in-frame to the start codon and the transgene upon introducing the nucleic acid construct to DRG neurons, the frameshift and / or a stop codon results in a non-productive transgene translation and / or mutated or terminated protein product in the DRG neurons.

[0113] In some embodiments provided is a nucleic acid, which is a DRG-specific expression construct comprising in 5' to 3' order: (A) an expression control element comprising a promoter;(B) a flanking sequence 1 comprising a first splicing donor sequence and a first splicing acceptor sequence, wherein the flanking sequence 1 comprises a flanking exon 1 and a flanking intron 1; (C) a DRG-specific exon comprising an engineered start codon, an engineered stop codon, or an engineered frameshift mutation; (D) a flanking sequence 2 comprising a second splicing donor sequence and a second splicing acceptor sequence, wherein the flanking sequence 2 comprises a flanking exon 2 and a flanking intron 2; (E) a (trans)gene sequence encoding a gene product, wherein the expression control element is operably linked to and directs expression of (B), (C), (D) and (E).

[0114] In non-limiting embodiments, sequences (B), (C) and (D) are a nucleotide sequence that is at least 90% identical to or 90%, 91%, 92%, 93%, 94, 95%, 96%, 97%, 98%, 99%, 100% identical to SEQ ID NO:22, 24 or 25 (the sequences of exon ENSG00000175216.14_36 from gene CKAP5).

[0115] In non-limiting embodiments, sequences (B), (C) and (D) are a nucleotide sequence that is at least 90% identical to or 90%, 91%, 92%, 93%, 94, 95%, 96%, 97%, 98%, 99%, 100% identical to SEQ ID NO:26, 28 or 29 [the sequences of exon ENSG00000188316.13_6 from gene ENO4].

[0116] In non-limiting embodiments, sequences (B), (C) and (D) are a nucleotide sequence that is at least 90% identical to or 90%, 91%, 92%, 93%, 94, 95%, 96%, 97%, 98%, 99%, 100% identical to SEQ ID NO:30, 32 or 33 [the sequences of exon ENSG00000066032.18_40 from gene CTNNA2].

[0117] In non-limiting embodiments, sequences (B), (C) and (D) are a nucleotide sequence that is at least 90% identical to or 90%, 91%, 92%, 93%, 94, 95%, 96%, 97%, 98%, 99%, 100% identical to SEQ ID NO:34, 36 or 37 [the sequences of exon ENSG00000144868.13_9 gene TMEM108].

[0118] In non-limiting embodiments of the nucleic acids, the flanking sequence 1 comprises a splicing factor binding site of SEQ ID NO:1, 2, 3, 4, 5, 6, 21, or combination thereof.

[0119] In non-limiting embodiments of the nucleic acids, the flanking sequence 2 comprises a splicing factor binding site of SEQ ID NO:1, 2, 3, 4, 5, 6, 21, or combination thereof.

[0120] In non-limiting embodiments of nucleic acids, the transgene is GBA1, PGRN, TREM2, a gene editing enzyme (Cas family or other), ApoE / ApoE2, HTT, MAPT, SNCA, C9orf72 or SOD1.

[0121] In non-limiting embodiments of the nucleic acids, the expression of the transgene in DRG neuron is reduced compared to a nucleic acid without the DRG-specific exon.

[0122] In non-limiting embodiments, the nucleic acids further comprise a nucleotide sequence encoding a proteolytic cleavage sequence (e.g., a self-cleavage peptide sequence) inserted between the flanking sequence 2 and the transgene sequence. In non-limiting embodiments of the nucleic acids, the proteolytic cleavage sequence is P2A cleavage sequence (SEQ ID NO:38) or T2A cleavage sequence.

[0123] In non-limiting embodiments, the nucleic acids further comprise a nucleotide sequence encoding an internal ribosome entry site (IRES) sequence inserted between the flanking sequence 2 and the transgene.

[0124] In non-limiting embodiments, the transgene is a codon-optimized nucleotide sequence.

[0125] In non-limiting embodiments, the nucleic acids further comprise: (A') a first AAV ITR or a reverse complementary sequence thereto inserted before the expression control element of (A); (F) a post-transcriptional regulatory element inserted after the transgene (E); (G) a polyadenylation signal inserted after the post-transcriptional regulatory element (F); and / or (H) a second AAV ITR or a reverse complementary sequence thereto inserted after the polyadenylation signal (G).

[0126] Summarized below are embodiments of the sequence elements of the DRG-specific cassettes and constructs herein. These sequence elements are operably linked such that a promoter drives RNA production of the DRG-specific cassette and the transgene.

[0127] Table 2: Sequence elements in nucleic acids of DRG cassettes and constructs. See also, Figures 1A, 1B, 2A, 2B, 3A and 3B. Necessary Sequence Elements ic• Flanking sequence 1: o at least a portion of anexon linked too at least a portion of an upstream intron, which length can be 5, 3) T,other sequence elements to improve expression (e.g., expression from a vector) detailed below in Table 3.

[0129] Table 3: Non-limiting embodiments of additional sequence elements DRG cassettes and constructs. Other Sequence Elements S n El m nt N m r T N n Limitin Ex m l e, r,T2A EGRGSLLTCGDVEENPGP (SEQ ID NO:85); P2A ATNFSLLKQAGDVEENPGP (SEQ ID NO:86); E2A QCTNYALLKLAGDVESNPGP (SEQ ID NO:87); and F2A VKQTLNFDLLKLAGDVESNPGP (SEQ ID NO:88).

[0131] In some embodiments, the acids herein comprise specific sequences of functional motifs. Functional motifs analysis was carried out by RBPmap, a bioinformatics tool that predicts and maps binding sites of a wide range of different RNA binding proteins (RBPs). 165 motifs of 145 different RBPs were included in the RBPmap database, and to search for binding sites in the flanking introns of each construct, FASTA files of flanking introns were provided to RBPmap. Non-limiting examples sequence of functional motifs identified in flanking introns include as follows: Splicing factor FUS binding sites, sequences CGCGC (SEQ ID NO:1) / GGGGG (SEQ ID NO:2); Splicing factor RBFOX1 binding sites, composed of sequences WGCAUGM (SEQ ID NO:3); Splicing factor RBFOX2 binding sites, composed of sequences GCAUG (SEQ ID NO:4); Splicing factor PTBP3 binding sites, composed of sequences CUUUCU (SEQ ID NO:5); or Splicing factor NOVA1 binding sites, composed of sequences AUCAC (SEQ ID NO:6) / UUCAUAA (SEQ ID NO:21).

[0132] Table 4: Non-limiting embodiments of nucleotide sequences comprising embodiments of engineered DRG-specific exons and DRG OFF cassettes. SEQ Name and Sequence ID Length A c a g g t g c a c t a g at att g c a c t c a A c gt g T tt a tt c tt c tt g a a A c c c C c t g a a A C A TC C A G C A A A G T T G A T A A C A A T g C A A A C CC A A A T G c A C C C T A T T tc G A A C T C G AT T A C T T G A T T T g G G A A C C C G AG T C A a A A T T A T T T T T a A T T G C T T G C A TT A A T C A A T G C G a A A A T A G T G A T AT T A T G T G G T C A a cCapitalized = 5'UTR up to start codon; Italicized and underlined = flanking Exon1; Bold and double underlined = flanking Intron 1; Italicized = differential exon with insertion for out of frame; Bold = flanking intron 2; Underlined = flanking exon 2; Double Underlined = P2A sequence; and Boxed position shows engineered portion of the exon.

[0134] Table 5: Non-limiting embodiments of nucleotide sequences comprising an embodiment of an engineered DRG-specific exon and DRG ON cassette. SEQ Name Sequence c c gt g tc cg a g tt tt tt g g c a gt c tt c tt g a aItalicized and underlined = flanking Exon1; Bold and double underlined = flanking Intron 1; Italicized = differential exon with insertion for out of frame; Bold = flanking intron 2; Underlined = flanking Exon 2; Double Underlined = P2A sequence; and Boxed position shows engineered portion of the exon.

[0136] In non-limiting embodiments, the nucleic acids comprising DRG-specific expression constructs are used in any compositions and / or methods of rAAV therapy where DRG toxicity due to the rAVV is a concern. Some embodiments include intracisternal magna-delivered rAAV carrying a therapeutic protein. Some embodiments include intrathecal-delivered AAV therapiescarrying a therapeutic protein. Other contemplate any cerebrospinal fluid route of rAVV administration. The AAV delivered therapeutic gene / protein could include GBA1, GRN, or other proteins of interest for treating diseases of the central nervous system. Some non-limiting embodiments include diseases include Parkinson’s disease with GBA1 mutations, or frontotemporal dementia with GRN mutations.

[0137] Transgenes

[0138] In some embodiments, the gene of interest (GOI) is downstream of the DRG-specific expression sequence. In some embodiments, the GOI is in-frame with the reading frame after the DRG-specific exon is spliced in. In some embodiments, the GOI is out-of-frame with the reading frame after the DRG-specific exon is spliced in. In some embodiments, the GOI can be a therapeutic agent or a detectable moiety. Examples of detectable moieties include, but are not limited to, fluorescein for fluorescence, HA tag, Gst-tag, EGFP-tag, FLAG™ tag or biotin. In some embodiments, the therapeutic agent can be an enzyme, a hormone, a polypeptide, an antibody, a drug, a chemotherapeutic agent, a toxin, or an oligonucleotide. In certain embodiments, the gene sequence is a transgene encoding a GOI. In some embodiments, the nucleotide sequence for the transgene is a codon-optimized for expression in mammalian cells, including, without limitation, human cells. In some embodiments, the nucleotide sequence for the transgene is also a 25% CpG-minimized sequence.

[0139] A transgene can be codon-optimized and / or CpG minimized and / or CpG depleted. While a CpG depleted nucleotide sequence has 100% of CpG sites eliminated / removed, a CpG minimized nucleotide sequence has < 100% of CpG sites eliminated / removed. For example, a CpG minimized nucleotide sequence can have from about 1% to about 99%, from about 10% to about 90%, from about 20% to about 80%, from about 30% to about 70%, from about 40% to about 60% or about 50% CpG sites removed. Alternatively, a CpG minimized nucleotide sequence can have from about 5% to about 10%, about 10% to about 20%, about 20% to about 30%, about 40% to about 50%, about 50% to about 60%, about 60% to about 70%, about 70% to about 80%, about 80% to about 90%, or about 90% to about 99% CpG eliminated / removed. Alternatively, a CpG minimized nucleotide sequence can have about 1%, about 5%, about 10% about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95% or about 99% CpG sites eliminated / removed.

[0140] In some embodiments, the is not the gene of the corresponding DRG exon. For example, if the DRG exon is ENSG00000066032.18_40 from gene CTNNA2 or the engineered DRG exon is based on the same, the sequence of the transgene in the DRG cassette does not encode CTNNA2; if the DRG exon is ENSG00000175216.14_36 from gene CKAP5 or the engineered DRG exon is based on the same, the sequence of the transgene in the DRG cassette does not encode CAKP5.

[0141] In some embodiments the transgene is a nucleic acid sequence encoding a short RNA molecule (e.g., RNA editing nucleotide, RNA ribozyme, CRISPR guide RNAs, or synthetic micro RNAs).

[0142] Vectors

[0143] In certain embodiments, the DRG-specific constructs are comprised in a vector suitable for delivery and expression of the DRG-specific sequences. Vectors include, for example, nucleic acid vectors, such as viral vectors (such as adenoviruses ("Ad"), adeno- associated viruses (AAV), and retroviruses, including lentiviruses), liposomes and other lipid- containing complexes, and other macromolecular complexes capable of mediating delivery of a polynucleotide to a host cell. Vectors can also comprise other components to further modulate the delivery and / or expression of the gene of interest, for example, or that otherwise provides beneficial properties to the targeted cells. A wide variety of vectors is known to those skilled in the art and is generally available.

[0144] In some embodiments, the DRG-specific cassette comprises a promoter. The promoter can be any promoter. The promoter can be ubiquitous or cell type specific as the splicing regulation is independent of the promoter. In some embodiments, the promoter is operatively linked to 5'UTR. In some embodiments, the promoter is operatively linked to a start codon. In some embodiments, the promoter can be regulatable. In some embodiments, the promoter is constitutively active. In some embodiments, the promoter is constitutively active and drive transcription to levels higher than what is possible with neuron-specific promoters.

[0145] Promoters can also direct expression in a temporal-dependent manner including but not limited to cell-cycle dependent or developmental stage-dependent. Gene specific or tissue promoters can be used. Such promoters allow DRG-specific expression or expression tied to specific pathways. Any promoter that is active in mammalian cells can be used. In some embodiments, promoters are bidirectional.

[0146] Promoters can direct constitutive In some embodiments, the promoter can be any suitable promoter including without limitation a CBA promoter or a CD68 promoter or a F4 / 80 promoter. In some embodiments, the promoter is the CBA promoter and has a nucleotide sequence having at least about 90% sequence identity to SEQ ID NO:7. In other embodiments, the promoter is the CD68 promoter and has a nucleotide sequence having at least about 90% sequence identity to SEQ ID NO:8. In other embodiments, the promoter is the F4 / 80 promoter and has a nucleotide sequence having at least about 90% sequence identity to SEQ ID NO:9 (see also, Intl. Patent Application Publication No. WO 2006 / 122141). In certain embodiments, the nucleotide sequence for the promoter is SEQ ID NO:8.

[0147] In certain embodiments, provided are DRG-specific expression constructs comprising the DRG-specific cassettes described in various embodiments and further comprising at least one expression control element operably linked to a promotor. In some embodiments, the expression control element comprises a 5'UTR. In some embodiments, the expression control element comprises a 3'UTR. In some embodiments the DRG-specific expression constructs are operational on their own. In some embodiments the DRG-specific expression constructs are operational as part of a vector such as, for example and without limitation, a rAAV as further described herein. In non-limiting embodiments, the vectors comprising the DRG-specific expression constructs comprise at least one expression control element.

[0148] Expression control elements include as at least one promoter enhancer, at least one IRES, at least one transcription factor binding site, at least one repressor binding site, at least one enhancer, at least one intron splice site, at least one post-transcriptional regulatory element, at least one polyadenylation signal, or combinations thereof, and other elements that are capable of controlling expression (e.g., transcription termination signals, including but not limited to polyadenylation signals and poly-U sequences).

[0149] In some embodiments, the enhancer can be a CMVe and has a nucleotide sequence having at least about 90% sequence identity to SEQ ID NO:10. In certain embodiments, the nucleotide sequence for the enhancer is SEQ ID NO:10.

[0150] In some embodiments, the post-transcriptional regulatory element can be a WPRE and has a nucleotide sequence having at least about 90% sequence identity to SEQ ID NO:11. In certain embodiments, the nucleotide sequence for the post-transcriptional regulatory element is SEQ ID NO:11.

[0151] In some embodiments, the polyadenylation signal can be BGHpA tail and has a nucleotide sequence having at least about 90% sequence identity to SEQ ID NO:12. In certain embodiments, the nucleotide sequence for the polyadenylation signal is SEQ ID NO:12.

[0152] In some embodiments, the DRG expression constructs comprise nucleotide sequence elements that allows for the expression of the transgene. In some embodiments, the elements are one or more of an IRES, a self-cleaving peptide coding sequence such as a T2A peptide, P2A peptide, or any other 2A family self-cleaving peptide. In some embodiments, the transgene sequence is linked to the DRG expression construct via a glycine-serine linker, or other flexible linker protein.

[0153] In some embodiments, the DRG-specific expression constructs comprise least one additional nucleotide sequence for another transgene and / or an inhibitory nucleic acid.

[0154] In certain embodiments, the DRG-specific expression constructs are incorporated into a vector. In some embodiments, the vector is, for example and without limitation, a viral vector such as an rAAV vector. A rAAV vector may comprise either the “plus strand” or the “minus strand” of the rAAV vector. In some embodiments, the rAAV vector is ss (e.g., ss DNA or ss RNA). In other embodiments, the rAAV vector is ds (e.g., ds DNA or ds RNA).

[0155] To aid in expression, rAAV vectors include ITRs that flank DRG expression constructs. In some embodiments, the ITR sequences are full-length (i.e., are about 145 nt in length and contain a functional Rep binding site (RBS) and a terminal resolution site (trs)) and is the WT AAV2 ITR including a nucleotide sequence having at least about 90% sequence identity to SEQ ID NO:13 or a reverse complementary sequence thereto. In certain embodiments, the nucleotide sequence for WT AAV2 ITR is SEQ ID NO:13 or a reverse complementary sequence thereto. In other embodiments, the ITR is a modified ITR (i.e., includes an addition, deletion, substitution, etc.) and is a modified AAV2 ITR including a nucleotide sequence having at least about 90% sequence identity to SEQ ID NO:14 a reverse complementary sequence thereto. In certain embodiments, the nucleotide sequence for the modified AAV2 ITR is SEQ ID NO:13 or 14 or a reverse complementary sequence thereto.

[0156] In some embodiments, the rAAV vectors include a TRY region as described in Francois et al. (2005) J. Virol.79:11082-11094, which can be located between an ITR (e.g., a 5' ITR) and the DRG expression constructs. In some embodiments, the TRY region includes a nucleotide sequence having at least about 90% sequence identity to SEQ ID NO:15. In certain embodiments, the nucleotide sequence for the TRY region is SEQ ID NO:15.

[0157] In some embodiments, additional are included in the rAAV vector to assist in packaging the rAAV vector into capsid protein (i.e., a sequence that optimizes the size of the vector for packaging within capsid protein; a “stuffer sequence”). In some embodiments, such a stuffer sequence includes a nucleotide sequence having at least about 90% sequence identity to SEQ ID NO:16 to 18. In certain embodiments, the nucleotide sequence for the stuffer sequence is SEQ ID NO:16, 17 or 18.

[0158] rAAV vectors expressing various sequences encoding transgenes can be generated using any suitable cell line, such as HEK293 cells or Sf9 insect cells (see, e.g., Intl. Patent Application Nos. WO 2008 / 024988, 2017 / 184879 and WO 2022 / 082017). The ITR sequences flank an expression construct having a promoter / enhancer element for the transgene, a 3' poly A signal, and posttranslational signals such as the WPRE element.

[0159] rAAV

[0160] In some embodiments, rAAV are vectors comprising a nucleic acid herein encapsidated in AAV capsid protein. In some embodiments, the rAAV include a capsid protein that readily spreads through the CNS, particularly when introduced into the CSF space or directly into the brain parenchyma. Examples of capsid proteins that can cross the blood-brain barrier (BBB) include, but are not limited to, a capsid protein having an AAV6, AAV9 or AAVrh.10 serotype.

[0161] In some embodiments, the rAAV that can infect microglia via AAV6-based capsid proteins, especially AAV6TM capsid protein. In some embodiments, the AAV6TM capsid protein includes an amino acid sequence having at least about 95% sequence identity to SEQ ID NO:19. In certain embodiments, the amino acid sequence for the AAV6TM capsid protein is SEQ ID NO:19.

[0162] In some embodiments, the rAAV that can infect microglia via AAV9-based capsid proteins, especially AAV9 capsid protein. In some embodiments, the AAV9 capsid protein includes an amino acid sequence having at least about 95% sequence identity to SEQ ID NO:20. In certain embodiments, the amino acid sequence for the AAV9 capsid protein is SEQ ID NO:20.

[0163] In some embodiments, an rAAV comprises (I) an AAV vector comprising a nucleic acid sequence as described herein and (II) an AAV capsid protein, which encapsidates the AAV vector (I).

[0164] In some embodiments, the rAAV comprises:(I) a rAAV vector having, in 5' to 3' orientation, a nucleotide sequence of: (A') a first AAV ITR or a reverse complementary sequence thereto, (A) a promoter or an expression control element comprising a promoter, (B) a flanking sequence 1 comprising a first splicing donor sequence and a first splicing acceptor sequence, wherein the flanking sequence 1 comprises a flanking exon 1 and a flanking intron 1; (C) a DRG-specific exon comprising an engineered start codon, an engineered stop codon, or an engineered frameshift mutation; (D) a flanking sequence 2 comprising a second splicing donor sequence and a second splicing acceptor sequence, wherein the flanking sequence 2 comprises a flanking exon 2 and a flanking intron 2 (E') optionally a self-cleaving peptide, (E) a transgene sequence encoding a gene product, (F) a post-transcriptional regulatory element, (G) a polyadenylation signal, and (H) a second AAV ITR or a reverse complementary sequence thereto; and (II) a AAV capsid protein, which encapsidates the rAAV vector (I), wherein the AAV capsid protein is AAV6 or AAV9.

[0165] Non-limiting embodiments of rAVV sequences are disclosed in Table 6A and Table 6B.

[0166] In some embodiments, the rAAV comprises: (I) a rAAV vector having, in 5' to 3' order, a nucleotide sequence of: (A') a first AAV ITR or a reverse complementary sequence thereto, (A) a promoter or an expression control element comprising a promoter, (B) a flanking sequence 1 comprising a first splicing donor sequence and a first splicing acceptor sequence, wherein the flanking sequence 1 comprises a flanking exon 1 and a flanking intron 1; (C) a DRG-specific exon comprising an engineered start codon, an engineered stop codon, or an engineered frameshift mutation; (D) a flanking sequence 2 comprising a second splicing donor sequence and a second splicing acceptor sequence, wherein the flanking sequence 2 comprises a flanking exon 2 and a flanking intron 2;(E') optionally a self-cleaving peptide, (E) a transgene sequence encoding a gene product, (F) a post-transcriptional regulatory element, (G) a polyadenylation signal, and (H) a second AAV ITR or a reverse complementary sequence thereto; wherein sequences (B), (C) and (D) are a nucleotide sequence that is at least 90% identical to or 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% identical to SEQ ID NO:22, 24 or 25 (the sequences of exon ENSG00000175216.14_36 from gene CKAP5); sequences (B), (C) and (D) are a nucleotide sequence that is at least 90% identical to or 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% identical to SEQ ID NO:26, 28 or 29 [the sequences of exon ENSG00000188316.13_6 from gene ENO4]; sequences (B), (C) and (D) are a nucleotide sequence that is at least 90% identical to or 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% identical to SEQ ID NO:30, 32 or 33 [the sequences of exon ENSG00000066032.18_40 from gene CTNNA2]; sequences (B), (C) and (D) are a nucleotide sequence that is at least 90% identical to or 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% identical to SEQ ID NO:34, 36 or 37 [the sequences of exon ENSG00000144868.13_9 gene TMEM108]; or sequences (B), (C) and (D) are a nucleotide sequence that is at least 90% identical to or 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% identical to SEQ ID NO:39 [CKAP5 ON]; and (II) encapsidated in AAV capsid protein, wherein in some embodiments the AAV capsid is AAV6 capsid is AAV6TM capsid protein having an amino acid sequence of SEQ ID NO:19, or in some embodiments the AAV capsid is AAV capsid is AAV9 capsid protein having an amino acid sequence of SEQ ID NO:20.

[0167] Non-limiting embodiments of rAVV vector sequence elements are disclosed in Table 6A and Table 6B.

[0168] Table 6A: Vector comprising CKAP5_v0 off cassette: sequence and features. Name Sequence Position SEQ IDA_ cassette sequence shown in Table 6A is illustrated in Figure 5.

[0170] Table 6B: Vector comprising on-cassette: sequence and features. Name Sequence Position SEQ ID NO:Vector 5166- 61 Backbone 9 5191Table 6B is illustrated in Figure 6.

[0172] Table 7: DRG-specific expression constructs and splicing outcomes. Cell / DRG-Specific Expression Construct DRG-Specific Expression Construct Tissue (OFF design) (ON design) y

[0174] The nucleic acids described herein (e.g., an expression construct or a vector) or rAAVs described herein can be formulated as a pharmaceutical composition including a nucleic acid herein or rAAV and a pharmaceutically acceptable carrier. Pharmaceutical compositions can be prepared by methods well known in the art (e.g., Remington: The Science and Practice of Pharmacy, 22nded. (Pharmaceutical Press, 2013).

[0175] In some embodiments, the pharmaceutical composition can be in the form of a formulation that includes not only a rAAV herein but also one or more of (a) about 10 mM to about 30 mM TRIS buffer, (b) about 0.5 mM to about 1.5 mM MgCl2, (c) about 100 mM to about 300 mM NaCl and (d) about 0.001% (w / v) to about 0.01% (w / v) Poloxamer 188.

[0176] In some embodiments, the TRIS can be at a concentration from about 10 mM to about 30 mM. In other embodiments, the TRIS buffer can be at a concentration from about 15 mM to about 25 mM, or about 20 mM. In yet other embodiments, the TRIS buffer can be at a concentration of about 10 mM, about 11 mM, about 12 mM, about 13 mM, about 14 mM, about 15 mM, about 16 mM, about 17 mM, about 18 mM, about 19 mM, about 20 mM, about 21 mM, about 22 mM, about 23 mM, about 24 mM, about 25 mM, about 26 mM, about 27 mM, about 28 mM, about 29 mM or about 30 mM.

[0177] In some embodiments, MgCl2 can be at a concentration from about 0.5 mM to about 1.5 mM. In other embodiments, MgCl2 can be at a concentration from about 0.6 mM to about 1.4 mM, from about 0.7 mM to about 1.3 mM, from about 0.8 mM to about 1.2 mM, from about 0.9 mM to about 1.1 mM, or about 1.0 mM. In yet other embodiments, MgCl2 can be at a concentration of about 0.5 mM, about 0.6 mM, about 0.7 mM, about 0.8 mM, about 0.9 mM, about 1.0 mM, about 1.1 mM, about 1.2 mM, about 1.3 mM, about 1.4 mM or about 1.5 mM.

[0178] In some embodiments, NaCl can be at a concentration from about 100 mM to about 300 mM. In other embodiments, NaCl can be at a concentration from about 125 mM to about 275 mM, from about 150 mM to about 250 mM, from about 175 mM to about 225 mM, or about 200 mM. In yet other embodiments, NaCl can be at a concentration of about 100 mM, about 110 mM, about 120 mM, about 130 mM, about 140 mM, about 150 mM, about 160 mM, about 170 mM, about 180 mM, about 190 mM, about 200 mM, about 210 mM, about 220 mM, about 230 mM, about 240 mM, about 250 mM, about 260 mM, about 270 mM, about 280 mM, about 290 mM or about 300 mM.

[0179] In some embodiments, Poloxamer 188 can be at a concentration from about 0.001% (w / v) to about 0.01% (w / v). In other embodiments, Poloxamer 188 can be at a concentration from about 0.002% (w / v) to about 0.009% (w / v), from about 0.003% (w / v) to about 0.008% (w / v), from about 0.004% (w / v) to about 0.007% (w / v), or from about 0.005% (w / v) to about 0.006% (w / v). In yet other embodiments, the Poloxamer 188 can be at a concentration of about 0.001% (w / v), about 0.002% (w / v), about 0.003% (w / v), about 0.004% (w / v), about 0.005% (w / v), about 0.006% (w / v), about 0.007% (w / v), about 0.008% (w / v), about 0.009% (w / v) or about 0.01% (w / v).

[0180] In certain embodiments, the formulation can include a rAAV herein and (a) about 20 mM TRIS (pH 8.0), (b) about 1 mM MgCl2, (c) about 200 mM NaCl and (d) about 0.005% (w / v) Poloxamer 188.

[0181] In some embodiments, the can be a titer between about 109genome copies (GC) / kg to about 1014GC / kg (e.g., about 109GC / kg, about 1010GC / kg, about 1011GC / kg, about 1012GC / kg, about 1013GC / kg, or about 1014GC / kg). In some embodiments, the individual is administered a high titer (e.g., > 1012GC / kg of rAAV) by injection to the CSF space, especially via ICM.

[0182] In other embodiments, the effective amount can be a dose ranging from about 1 x 1012vg to about 1 x 1015vg or about 1 x 1013vg to about 7 x 1014vg. In other embodiments, the dose can be about 3.5 x 1013vg, about 7.0 x 1013vg or about 1.4 x 1014vg. In yet other embodiments, the dose can be about 1 x 1014vg, about 2.0 x 1014vg, or about 4.0 x 1014vg. Alternatively, the dose can be about 2 x 1013vg, about 3 x 1013vg, about 4 x 1013vg, about 5 x 1013vg, about 6 x 1013vg, about 7 x 1013vg, about 8 x 1013vg, about 9 x 1013vg, about 1 x 1014vg, or about 2 x 1014vg. In certain embodiments, the dose is 7.0 x 1013vg or 1.4 x 1014vg.

[0183] The pharmaceutical composition can be administered by any route including, for example, intra-arterial, intradermal, intramuscular, intrathecal, intravenous (IV), intraventricular, parenteral, subcutaneous (SC) or transdermal. In some embodiments, the compositions are delivered via IV administration (e.g., systemic intravenous injection), and / or direct administration to an affected site (e.g., intracisternal magna (ICM) injection, intracerebroventricular (ICV) injection) and / or combinations thereof.

[0184] Generally, the most appropriate route of administration will depend upon a variety of factors including, but not limited to, the nature of the agent (e.g., its stability in the environment of its administration and / or intended target) and / or the condition of the individual (e.g., whether the individual is able to tolerate oral administration). In some embodiments, the nucleic acids herein, rAAV or pharmaceutical compositions are suitable for administration to the CNS of an individual by, for example, intrathecal, ICM, ICV and / or combinations thereof.

[0185] Kits

[0186] In some embodiments, the nucleic acids herein (i.e., an expression construct or a vector) or rAAVs herein can be included in a kit that includes the nucleic acids herein or rAAV and instructions for its use. In other embodiments, the kit includes the nucleic acids herein or rAAV and a package insert containing instructions for use of the kit and / or any component thereof. In yet other embodiments, the kit comprises, in a suitable container or other means for containing, the nucleic acids herein or rAAV, one or more controls, and various buffers,reagents, enzymes and other standard well known in the art. In some embodiments, the container comprises at least one vial, well, test tube, flask, bottle, syringe, or other container means, into which the nucleic acids herein, rAAV or other therapeutic oligonucleotide is placed, and in some embodiments, suitably aliquoted. In those embodiments where an additional component is provided, the kit includes additional containers into which this component is placed. The kits can also include a means for containing the nucleic acids herein or rAAV and any other reagent in close confinement for commercial sale. Such containers may include injection or blow-molded plastic containers into which the desired vials are retained. Containers and / or kits can include labeling with instructions for use and / or warnings.

[0187] In some embodiments, the kit includes the nucleic acids herein or rAAV and a pharmaceutically acceptable carrier, or a pharmaceutical composition including the nucleic acids herein, rAAV or other therapeutic oligonucleotide and instructions for treating or delaying progression of a neurodegenerative disease in an individual in need thereof.

[0188] In some embodiments, the kit includes the nucleic acids herein or rAAV and a pharmaceutically acceptable carrier or a pharmaceutical composition comprising the nucleic acids herein or rAAV and instructions for administering the nucleic acids herein or rAAV or pharmaceutical composition.

[0189] Methods of Making

[0190] Methods of making rAAVs are described, for example, in Samulski et al. (1989) J. Virol. 63:3822-3828 and Wright (2009) Hum. Gene Ther. 20:698-706. In some embodiments, the rAAV can be produced in a Baculovirus vector expression system (BEVS). Production of rAAVs using BEVS are described, for example, in Urabe et al. (2002) Hum. Gene Ther. 13:1935-1943, Smith et al. (2009) Mol. Ther. 17:1888-1896, as well as US Patent Nos. 8,945,918 and 9,879,282, and Intl. Patent Application Publication Nos. WO 2017 / 184879 and WO 2022 / 082017. Alternatively, the rAAV can be produced in human embryonic kidney (e.g., HEK293) cells (see, e.g., Intl. Patent Application Publication Nos. WO 2020 / 210689 and WO 2022 / 035900). However, the rAAV can be produced using any suitable method (e.g., using recombinant rep and cap genes).

[0191] Methods of Treatment and Uses

[0192] The nucleic acids herein comprising DRG-specific cassettes, expression constructs comprising these, vectors comprising these, rAAV or pharmaceutical compositions comprising these can be used for treating a neurological disease or disorder, particularly a disease ordisorder that could be affected by a and particularly diseases that benefit from transgene expression in a CNS neuron and reduced transgene expression in DRG neurons. Non-limiting embodiments include Alzheimers disease (AD), Parkinson’s disease (PD), Frontotemporal Dementia (FTD), Gaucher disease (GD), adult-onset leukoencephalopathy with axonal spheroids and pigmented glia (ALSP), Fragile X syndrome, or amyotrophic lateral sclerosis (ALS).

[0193] A non-limiting embodiment of a transgene is GBA1 which is associated with neurodegenerative diseases such as PD (mutation in one allele) such as PD-GBA, GD (mutation in both alleles) such as GD1 and DG2, and PD-associated diseases and disorders such as dementia with Lewy bodies (DLB).

[0194] A non-limiting embodiment of a transgene is PGRN which is associated with neurodegenerative diseases such as fronto-temporal dementia (FTD), especially FTD-GRN, neuronal ceroid lipofuscinosis (also known as GRN-related neuronal ceroid-lipofuscinosis), AD, PD.

[0195] A non-limiting embodiment of a transgene is TREM2 which is associated with neurodegenerative diseases such as AD, Adult-Onset Leukoencephalopathy with Axonal Spheroids and Pigmented Glia (ALSP) or Nasu-Hakola Disease (NHD).

[0196] The methods can include the steps described herein, and these maybe be, but not necessarily, carried out in the order as described. Moreover, individual or multiple steps may be carried out either in parallel and / or overlapping in time and / or individually or in multiply repeated steps. Furthermore, the methods may include additional, unspecified steps.

[0197] The DRG-specific cassettes, DRG-specific expression constructs, vectors (e.g., rAAV vectors), and rAAV and / or pharmaceutical compositions including the same may be used in methods to treat CNS diseases and disorders, where such methods include at least a step of administering to an individual in need of such treatment a therapeutically effective amount of the DRG-specific expression constructs herein, vectors comprising the same, rAAV comprising the same or a pharmaceutical composition comprising the same.

[0198] In some embodiments, the DRG-specific expression constructs herein, vectors comprising the same, rAAV comprising the same or a pharmaceutical composition comprising the same is administered via an IV injection. In other embodiments, DRG-specific expression constructs herein, vectors comprising the same, rAAV comprising the same or a pharmaceutical composition comprising the same is administered via an ICM injection of the individual. Inother embodiments, DRG-specific constructs herein, vectors comprising the same, rAAV comprising the same or a pharmaceutical composition comprising the same is administered via an intraparenchymal injection. In other embodiments, DRG-specific expression constructs herein, vectors comprising the same, rAAV comprising the same or a pharmaceutical composition comprising the same is administered via a subcutaneous injection. In other embodiments, DRG-specific expression constructs herein, vectors comprising the same, rAAV comprising the same or a pharmaceutical composition comprising the same is administered via a Intracerebroventricular (ICV) injection.

[0199] When a rAAV is administered, the effective amount can be a titer between about 109genome copies (GC) / kg to about 1014GC / kg (e.g., about 109GC / kg, about 1010GC / kg, about 1011GC / kg, about 1012GC / kg, about 1013GC / kg, or about 1014GC / kg). In some embodiments, the individual is administered a high titer (e.g., > 1012GC / kg of rAAV) by injection to the CSF space, especially via ICM.

[0200] In other embodiments, the effective amount can be a dose ranging from about 1 x 1012vg to about 1 x 1015vg or about 1 x 1013vg to about 7 x 1014vg. In other embodiments, the dose can be about 3.5 x 1013vg, about 7.0 x 1013vg or about 1.4 x 1014vg. In yet other embodiments, the dose can be about 1 x 1014vg, about 2.0 x 1014vg, or about 4.0 x 1014vg. Alternatively, the dose can be about 2 x 1013vg, about 3 x 1013vg, about 4 x 1013vg, about 5 x 1013vg, about 6 x 1013vg, about 7 x 1013vg, about 8 x 1013vg, about 9 x 1013vg, about 1 x 1014vg, or about 2 x 1014vg. In certain embodiments, the dose is 7.0 x 1013vg or 1.4 x 1014vg.

[0201] In some embodiments, the rAAV or composition including the same can be administered to an individual once or multiple times (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 20 or more).

[0202] In some embodiments, the individual is between the ages of about 1 month old to about 10 years old (e.g., about 1 month, 2 months, 3 months, 4, months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 13 months, 14 months, 15 months, 16 months, 17 months, 18 months, 19 months, 20 months, 21 months, 22 months, 23 months, 24 months, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, 10 years, or any age therebetween). In other embodiments, the individual is between about 10 years old to about 20 years old (e.g., about 10 years, 11 years, 12 years, 13 years, 14 years, 15 years, 16 years, 17 years, 18 years, 19 years, 20 years, or any age therebetween). In other embodiments, the individual is older than 20 years old (e.g., about 21 years, 22 years, 23 years, 24 years, 25 years,26 years, 27 years, 28 years, 29 years, 30 or any age therebetween), older than 30 years old (e.g., about 31 years, 32 years, 33 years, 34 years, 35 years, 36 years, 37 years, 38 years, 39 years, 40 years, or any age therebetween), older than 40 years old (e.g., about 41 years, 42 years, 43 years, 44 years, 45 years, 46 years, 47 years, 48 years, 49 years, 50 years, or any age therebetween), or even older than 50 years old (e.g., about 51 years, 52 years, 53 years, 54 years, 55 years, 56 years, 57 years, 58 years, 59 years, 60 years, 70 years, 80 years, 90 years, or any age therebetween).

[0203] Uses

[0204] Nucleic acids of DRG-specific expression constructs herein, vectors comprising the same, rAAV comprising the same or a pharmaceutical composition comprising the same can be used, or adapted for use, to treat an individual (e.g., a human) having or suspected of having a disease or disorder which could be affected by a transgene expression. As such, nucleic acids of DRG-specific expression constructs herein, vectors comprising the same, rAAV comprising the same or pharmaceutical compositions comprising the same are provided for use, or adapted for use, to treat an individual having or suspected of having a disease or disorder associated which could be affected by a transgene expression. Also, DRG-specific expression constructs herein, vectors comprising the same, rAAV comprising the same or a pharmaceutical compositions comprising the same are provided for use, or are adaptable for use, in the manufacture of a medicament or a pharmaceutical composition for treating a disease or disorder associated, which could be affected by a transgene expression. In some embodiments the disease or disorder is a CNS disorder that is affected by a transgene expression in a neuron in the CNS and reduced or absent expression of the transgene in DRG neurons.

[0205] Also described are DRG-specific expression constructs herein, vectors comprising the same, rAAV comprising the same or a pharmaceutical composition comprising the same for use in therapy. Furthermore, DRG-specific expression constructs herein, vectors comprising the same, rAAV comprising the same or a pharmaceutical composition comprising the same are described herein for use in the treatment of a neurological disease such as, for example, a disease or disorder which could be affected by a transgene expression.

[0206] Also described are use of DRG-specific expression constructs herein, vectors comprising the same, rAAV comprising the same or a pharmaceutical composition comprising the same in the manufacture of a medicament for the treatment of a neurological disease such as, for example, a disease or disorder which could be affected by a transgene expression.

[0207] Abbreviations

[0208] “aa” refers to amino acid(s); “AAV” refers to adeno-associated virus, “BAC” refers to bacterial artificial chromosome; “BEYS” refers to baculovirus vector expression system; “BGHpA” refers to bovine growth hormone polyA signal tail; “bp” refers to base pair(s); “CBA” refers to chicken-β actin; “CNS” refers to central nervous system; “CSF” refers to cerebrospinal fluid; “CMVe” refers to cytomegalovirus enhancer; “CpG” refers to cytosine- phosphate-guanine; “DNA” refers to deoxyribonucleic acid; “DRG” refers to dorsal root ganglion; “ds” refers to double-stranded; “ELISA” refers to enzyme-linked immunosorbent assay; “gDNA” refers to genomic DNA; “hr” refers hour(s); “ICM” refers to intra-cisterna magna; “ICV” refers to intracerebroventricular; “iPSC” refers to induced pluripotent stem cell(s); “IRES” refers to internal ribosome entry site; “ITR” refers to inverted terminal repeat; “IV” refers to intravenous; “kg” refers to kilogram(s); “min” refers to minute(s); “mL” refers to milliliter; “NHP” refers to non-human primate(s); “nt” refers to nucleotide(s); “pg” refers to picogram(s); “rAAV” refers to recombinant adeno-associated virus; “RBS” refers to Rep binding site; “RNA” refers to ribonucleic acid; “SC” refers to subcutaneous; “sec” refers to second(s); “SEM” refers to standard error of mean; “ss” refers to single-stranded; “TREM2” refers to triggering receptor expressed on myeloid cells 2 gene; “TREM2” refers to triggering receptor expressed on myeloid cells 2 protein; “trs” refers to terminal resolution site; “μL” refers to microliter; “VC” refers to vector copy(ies); “vg” refers to vector genome(s); “WPRE” refers to woodchuck hepatitis virus post-transcriptional regulatory element; “WT” refers to wild-type; and “YAC” refers to yeast artificial chromosome.

[0209] Definitions

[0210] “AAV6TM” is an AAV6TM capsid protein having at least the following 3 mutations (i.e., triple mutant) in the amino acid sequence as compared to a wild-type (WT; see, NCBI Ref. Seq. No. AAB95450.1) AAV6 capsid protein amino acid sequence: T492V, Y705F and Y731F (see, e.g., SEQ ID NO:19).

[0211] “About” means within a statistically meaningful range of a value or values such as, for example, a stated concentration, length, molecular weight, pH, sequence similarity, time frame, temperature, volume, etc. Such a value or range can be within an order of magnitude typically within 20%, more typically within 10%, and even more typically within 5% of a given value or range. The allowable variation encompassed by “about” will depend upon the particular system under study, and can be readily appreciated by one of skill in the art.

[0212] “Codon-optimized” means, with to a nucleotide sequence such as a gene of interest an alteration of codons or sequences in the gene or coding regions therein to reflect typical codon usage of a host organism (e.g., a mammal such as a human) or cell thereof without altering the polypeptide encoded by the nucleotide sequence. A codon-optimized transgene therefore is optimized for expression in a particular organism, organ, tissue or cell type, especially a mammal or mammalian organ, tissue or cell type. Alternatively, “codon- optimized” means an alteration of codons or sequences in a gene to improve protein expression as compared to a sequence that lacks the alteration by, for example, eliminating or changing sites that may be latent splice sites, stop codons, miRNA recognition sequences and the like. An entire nucleotide sequence may be codon-optimized or only one or more parts, portions or regions of a nucleotide sequence may be codon-optimized.

[0213] “CpG depleted,” with regard to a nucleotide sequence, means that all (i.e., 100%) known CpG sites are eliminated / removed in the nucleotide sequence.

[0214] “CpG minimized,” with regard to a nucleotide sequence, means that some (i.e., < 100%) CpG sites, but not all, are eliminated / removed in the nucleotide sequence.

[0215] “CpG site” and the like means where a cytosine (C) nucleotide is followed by a guanine (G) nucleotide in the linear sequence of bases along a 5' to 3' direction in a nucleotide sequence.

[0216] A “dorsal root ganglion (DRG),” also referred to as a “spinal ganglion” or “posterior root ganglion,” is a cluster of nerve cell bodies (a ganglion) in the posterior root of a spinal nerve. A neuron in the DRG is referred to herein as a “dorsal root ganglia (DRG) neuron.” The dorsal root ganglia contain the cell bodies of sensory neurons.

[0217] A “DRG-specific cassette” or “DRG-specific cassette” is a nucleic acid sequence which comprises an “engineered DRG neuron specific exon” and cis regulatory elements or portions thereof for preferential splicing-in of the DRG-specific exon in a population of DRG neurons. A “DRG-specific cassette” includes the following nucleic acid sequences in 5’ to 3’order:a flanking sequence 1 comprising a first splicing donor sequence and a first splicing acceptor sequence, and a flanking sequence 2 comprising a second splicing donor sequence and a second splicing acceptor sequence.

[0218] A “DRG-specific exon” is an exon nucleotide sequence that is alternatively spliced- in and present in the transcriptome of a human DRG, so that the DRG exon distinguishes the transcriptional profile of DRG from other cell types including major brain tissues. DRG exonRNA sequence is detected at significantly levels in a population of DRG tissue. In some embodiments, there is a significant difference in the “DRG exon” copy number / levels detected by transcriptome sequencing in a population of DRG tissue compared to the “DRG exon” copy number / levels in brain tissue.

[0219] A “DRG-specific expression construct” or “DRG neuron-specific expression construct” includes a “DRG-specific cassette” operably linked to a transgene.

[0220] An “engineered DRG-specific exon” or “engineered DRD-specific exon” is a DRG specific exon which also comprises an engineered nucleotide change anywhere in the exon sequence, e.g., at any internal position, at the 5’ and / or 3’ end. The engineered nucleotide change(s) comprise a nucleotide insertion(s), deletion(s) and / or change(s), compared to the naturally occurring DRG specific exon.

[0221] A “neuron” is an electrically excitable cell that processes and transmits information through electrical and chemical signals. These signals between neurons occur via synapses, specialized connections with other cells. Neurons can connect to each other to form neural networks. Neurons are the core components of the brain and spinal cord of the central nervous system (CNS), and of the ganglia of the peripheral nervous system (PNS).

[0222] “Operably linked” and the like means sequence elements are configured to perform their usual function. Thus, an expression control element (e.g., a promoter) operably linked to a desired nucleotide sequence (e.g., a transgene or an inhibitory nucleic acid) is capable of effecting expression of the desired nucleic acid. The control element need not be contiguous with the desired nucleotide sequence, so long as it functions to direct the expression thereof (i.e., maintain proper reading frame). Thus, for example, intervening untranslated, yet transcribed, sequence can be present between a promoter and the desired nucleotide sequence, and the promoter still can be considered “operably linked” to the desired nucleotide sequence.

[0223] A “recombinant adeno-associated virus,” “recombinant AAV” and “rAAV” are viral particles comprising a rAAV vector encapsidated by AAV capsid protein.

[0224] A “recombinant adeno-associated virus vector,” “recombinant AAV vector” and “rAAV vector” are a recombinant polynucleotide vector comprising one or more heterologous sequences (i.e., nucleic acid sequence not of an AAV origin) that are flanked by at least one AAV ITR sequence. Such rAAV vectors can be replicated and packaged into infectious viral particles when present in a host cell that has been infected with a suitable helper virus (or thatis expressing suitable helper functions) AAV rep and cap gene products (i.e., AAV Rep and Cap proteins).

[0225] “Recombinant” is a nucleic acid, polypeptide or other molecule or compound that is artificially synthesized (e.g., using a machine such as, for example, a solid phase nucleic acid synthesizer) or that is engineered and / or produced (i.e., sequence does not exist naturally and / or is not naturally derived from a natural source that normally produces the nucleic acid or other compound).

[0226] A “transgene” is a nucleotide sequence that is introduced into a cell and is capable of being transcribed into RNA and optionally, translated and / or expressed as protein under appropriate conditions. The transgene confers a property to a cell into which it was introduced, or otherwise leads to a therapeutic or diagnostic outcome.

[0227] A “therapeutically effective amount” is an amount of a pharmaceutical composition that is effective for producing some desired therapeutic effect, commensurate with a reasonable benefit / risk ratio, when administered in accordance with a desired treatment regimen.

[0228] A “vector” is a recombinant plasmid or recombinant virus that includes an oligonucleotide or polynucleotide to be delivered into a host cell, either in vitro or in vivo. Examples of vectors include, but are not limited to, bacterial artificial chromosome (BAC), cosmid, phagemid, plasmid, viral vector and yeast artificial chromosome (YAC).

[0229] A “viral vector” is a vector that is derived from a naturally occurring or modified virus, especially a rAAV vector or a Baculovirus vector (e.g., Autographa californica nuclear polyhedrosis (AcNPV) vector)). EXAMPLES

[0230] The following non-limiting examples are offered for purposes of illustration, not limitation.

[0231] Example 1: Bioinformatics and DRG Exon Identification

[0232] Exon discovery and design:

[0233] The Genotype-Tissue Expression (GTEx) project is aimed at constructing a comprehensive resource for the examination of DRG-specific gene expression and regulation. Samples for GTEx were gathered from 54 non-diseased tissue sites across nearly 1000 individuals. In this study, RNA-seq data from major human tissues in GTEx (including brain, nerve, blood, blood vessel, heart, lung, kidney and liver) were utilized to uncover DRG-specificalternative splicing events. Additionally, seq data from 75 human DRG samples were processed using the GTEx RNA-seq pipeline which includes: alignment (STAR), QC (RNA- SeQC), expression quantification (RSEM & RNA-SeQC) accessed at hub.docker.com / r / broadinstitute / gtex_rnaseq / and further integrated with GTEx data. No batch effect was observed following the integration of these two datasets.

[0234] To identify alternative splicing exons in DRG, the bioinformatics tool DEXSeq was employed. DEXSeq utilizes a method to assess for differential exon usage (DEU) in comparative RNA-Seq data. DEU is defined as the ratio of transcripts containing a specific exon over all transcripts from the gene. About 1600 exons were identified as DEU in DRG through the analysis of integrated GTEx and DRG data by using logFC > 1 and adj p-val < 0.05. All DRG-specific exons identified by DEXSeq were further filter by:(1) not first or last exon; (2) not belonging to differentially expressed genes; (3) literature search for additional supporting evidence of DRG specificity.

[0235] From these analyses, 1639 potential DRG-specific exons were identified. 62 DRG- specific exons were selected for engineering and downstream characterization as described in Example 2.

[0236] Four selected DRG exons are listed in Table 1.

[0237] Example 2: Design of DRG-Specific Cassettes and Expression Constructs

[0238] Among the 1639 DRG-specific exons identified in Example 1, 62 DRG-specific exons were further engineered as DRG OFF cassettes (see below) to generate a library for cloning in AAV vector for further functional characterization. In this example, the DRG OFF cassette was cloned into an rAVV vector which included the transgene EGFP. In some instances, the DRG OFF cassette is comprised in a DRG specific expression construct which comprises the transgene.

[0239] DRG cassette –general design:

[0240] In addition to a DRG-specific exon sequences as identified in Example 1, the design of the DRG-specific exon cassettes encompassed upstream exon-intron splicing junction(s), DRG alternative exon-intron splicing junctions, and downstream exon-intron splicing junction(s). As the DRG-specific cassettes are intended for insertion into an AAV vector, the synthesis and insertion constraints limited the length of the DRG cassette to no more than around 1400 nucleotides. Therefore, all exon cassettes were designed to be less than around1400 nucleotides in length. In the DRG cassette is inserted in a different expression vector and / or there are no limits on the length of the DRG cassette, the size of the flanking intron and fragments of the upstream and / or downstream exons could be longer than the exemplified in the design in Figure 3B.

[0241] To ensure that the presence of the exon-intron splicing junction, a fragment from the 3' end of the exon upstream from the DRG-specific exon (flanking exon 1) was also included. The included upstream exon fragment was 60 bp as shown in Figure 3A. The upstream exon fragment can be of any suitable length, so long as the exon-intron splicing junction is retained, in the overall DRG cassette design.

[0242] To ensure that the presence of the exon-intron splicing junction, a fragment from the 5' end of the exon downstream from the DRG-specific exon (flanking exon 2) was also included. The included downstream exon fragment was 60 bp as shown in Figure 3A. The upstream exon fragment can be of any suitable length, so long as the exon-intron splicing junction is retained, in the overall DRG cassette design.

[0243] To ensure the max 1400 bp size, an intron minimization strategy was employed. Each “flanking intron” in the DRG cassette contains 2 parts: a fragment of the full-length intron adjacent to the 5' splice site and a fragment of the full-length intron adjacent to the 3' splice site. For the V0 designs, when designing the minimized flanking introns, the minimal number of nucleotides was removed from the center of the natural introns, such that the final length of the cassette was less than 1400 bp. If the natural introns were sufficiently small, the entire intron was included. The V1 and V2 designs were derived from the V0 designs, generated by removing progressively larger portions of the intron or exon sequences, without perturbing the nucleotides immediately adjacent to the splice sites.

[0244] Figure 3A and Figure 3B provide a visual representation of the design strategy. Figure 3A is gene model showing a portion of the gene including a tissue-specific exon and adjacent upstream and downstream introns and exons. Figure 3B shows a schematic representation of an intron minimization strategy indicating portions of the adjacent upstream and downstream introns and exons retained in the engineered cassette.

[0245] Tables 2 and 3 show design elements of the DRG cassettes.

[0246] DRG OFF cassette design:

[0247] To design DRG OFF cassettes, the DRG exon was modified to include a frameshift mutation. Depending on the number of nucleotides in the tissue-specific exon, 1-2 nucleotideswere added to the DRG specific exon, to the middle portion of the exon, to ensure that if and when the exon were retained, the reading frame would shift and become out of frame. A start codon ATG was added immediately in front of the Flanking exon 1.

[0248] Figure 1A shows a representative example of a DRG OFF cassette. Figure 1B shows expected splicing results from a DRG OFF cassette in DRG neurons and brain neurons.

[0249] Table 4 lists non-limiting examples of specific DRG specific expression constructs comprising DRG OFF cassettes. The frameshift mutation ensured that when the processed mRNA is translated, no functional transgene is translated.

[0250] DRG ON cassette design:

[0251] For DRG ON cassette designs, the design is such that the retention of the DRG- specific exon in tissues allows for the downstream transgene(s) to be in-frame and translated. One design approach involved inserting appropriate translation initiation sequences, e.g. the Kozak sequence and a start codon (GCCACCATG, SEQ ID NO:41), in the DRG specific- specific exon. An insertion of a Kozak sequence and a start codon near the 3' end of the tissue- specific exon facilitates the translation of downstream transgenes with minimal additional amino acids translated from the tissue-specific exon, while preserving functional splicing sites in the exon-intron junctions. All other required sequence elements are the same between the ON and OFF designs and as described the DRG cassette – general design, and Table 1 and Table 2.

[0252] Figure 2A shows a representative example of a DRG ON cassette. Figure 2B shows expected splicing results from a DRG ON cassette in DRG neurons and brain neurons.

[0253] Table 5 lists non-limiting examples of specific sequences of DRG ON cassettes. The start codon ensures that when the processed mRNA is translated, a functional transgene is translated.

[0254] DRG expression constructs comprise a DRG cassette and an operably linked regulatory element comprising a promoter and an operably linked transgene.

[0255] Example 3: AAV Cloning and AAV Production

[0256] Among the 1639 DRG-specific exons identified in Example 1, 62 DRG-specific exons were further engineered as DRG OFF cassettes. Figure 2B shows a representative example of a DRG OFF cassette.

[0257] The library of DRG OFF cassettes synthesized as IDT “eblocks” and cloned into a rAAV vector for further functional characterization in vitro and in vivo. Figure 4B shows a schematic map of one embodiment of a DRG expression construct comprising a DRG OFF cassette (from Figure 3B) cloned in an AAV vector. In Figure 4B, the AAV ITR sequences flank the promoter / enhancer elements operably linked to the DRG OFF cassette and the transgene, a 3' poly A signal, and posttranslational signals such as the WPRE element. Specific sequences are shown in Table 6.

[0258] DRG OFF cassettes were cloned into an rAAV vector upstream of the transgene EGFP. Cloning was performed using NEBuilder® 2X HiFi Mastermix (Catalog E2621S), and assembled vectors were transformed as a pool into NEB Stable cells (Catalog C3040H). After 16 hrs of bacterial growth, the plasmid library was purified using a Qiagen Maxiprep kit (Catalog 12963). The rAAV vector library was encapsidated into AAV9 capsid protein (SEQ ID NO:20) (Virovek). The resulting AAV9 library was used for further functional characterization.

[0259] Example 4: DRG Exon Inclusion in In Vitro Stem Cells

[0260] In vitro evaluation of DRG exon cassettes was performed across multiple cellular contexts. We tested the AAV9 library in “RealDRG” nociceptors, and NGN2-iPSC derived neurons. The RealDRG cells are a model of DRG neurons, and the NGN2-iPSC derived neurons are a model of brain neurons. For the NGN2-iPSC derived neurons and “RealDRG” cells, the packaged AAV9 library was used to deliver the exon cassettes to the target cells at a multiplicity of infection of 2E6 viral genomes per cell.

[0261] Five days after the library was delivered to the cells, RNA was isolated using the Qiagen RNeasy kit, Cat.80004. We then generated cDNA using the ViloRT kit (cat 11766050). To quantify exon inclusion and splicing outcomes, for example, the frequency the DRG specific exon is included in the processed mRNA, as well as other splicing outcomes such as intron retention, we prepped a targeted nanopore library via PCR amplifying the exon cassette from the cDNA pool. This was done using hotstart Q5® polymerase from NEB (M0494S), and primers binding the 5pUTR and downstream GFP sequences. Following amplification, we performed a 1.4x AmpureXP bead clean and proceeded to nanopore sequencing according to the manufacturer’s recommendation. We prepped nanopore libraries using Native Barcoding Kit 24 V14 (SQK-NBD114.24) and sequenced on R10.4.1 flow cells (FLO-MIN114).

[0262] Bioinformatics methods:

[0263] The nanopore sequencing data was aligned to a reference file which contained the sequences of the exon cassette containing constructs using the minimap2 software. Following this the coverage was calculated across various features of the construct and the exon inclusion rate was calculated as the mean coverage across the differential exon containing the stop codon divided by mean coverage of the flanking exons.

[0264] Results: After generating the plasmid / AAV library described in Figure 4, we quantified the exon retention rate in multiple in vitro cell models. We proceeded to test the library packaged in AAV9, in NGN2-neurons (Neuron model derived from stem cells), and “RealDRG” cells (DRG neuron model system derived from stem cells). Nanopore sequencing was used to determine the inclusion rate of each exon from the library. Nanopore sequencing enabled direct quantification of the levels of exon inclusion in each cell type. Table 5 shows that a subset of the library had higher retention of the DRG specific exons in RealDRG cells, compared to the NGN2-neurons (see, Table 8).

[0265] Table 8: Summary of DRG exon inclusion rate from in vitro analyses. Exon RealDRG RealDRG NGN2-Neuron NGN2 Exon Exon Exon Exon Inclusion Inclusion SEM

[0266] Example 5: DRG Exon Inclusion in In Vivo Animal Models

[0267] In vivo screening in mice:

[0268] The DRG-specific AAV9 library was tested in vivo in mice. The AAV9 library was administered in five C57BI / 6 mice via intracerebroventricular injection. The animals were dosed with 1.58E11 vg per animal. One month later the mice were euthanized, with DRG, and brain tissue collected. Tissue was stored in RNALater™ and placed at -80°C until later processing to isolate RNA.

[0269] RNA was isolated using the Qiagen RNeasy kit, Cat.80004. We then generated cDNA using the ViloRT kit (cat 11766050). To quantify exon inclusion and splicing outcomes, we prepped a targeted nanopore library via PCR amplifying the exon cassette from the cDNA pool.This was done using hotstart Q5® from NEB (M0494S), and primers binding the 5pUTR and downstream GFP sequences. Following amplification, we performed a 1.4x AmpureXP bead clean and proceeded to nanopore sequencing according to the manufacturer’s recommendation. We prepped nanopore libraries using Native Barcoding Kit 24 V14 (SQK- NBD114.24) and sequenced on R10.4.1 flow cells (FLO-MIN114).

[0270] Bioinformatics methods:

[0271] The Nanopore data was aligned to the reference file using the minimap biased gtf alignment. The transcripts were assembled from the resultant bam file using StringTie. The exon coverage was calculated and plotted from the most abundant transcript. This was then used to calculate an exon inclusion rate per tissue.

[0272] Nanopore sequencing of the RNA extracted from the mouse DRG and hippocampus enabled us to quantify the inclusion rate of these exons to determine construct efficacy. From this analysis we identified four exons which were preferentially retained in both in vivo mouse DRGs, as well as “RealDRG” in vitro models (see, Table 9).

[0273] Table 9: Summary of exon inclusion rate in vivo in mice. Exon Mouse DRG Mouse Mouse Mouse Inclusion Rate DRG Hippocampus Hippocampus

[0274] In vivo screening in NHPs

[0275] To further test this DRG exon library, and validate candidates, we injected (intracisterna magna route of administration) N=2 Cynomolgus Macaques with the AAV library described above. The animals were dosed with 1.28E13 vg per animal. One month later, NHPs were sacrificed and DRG, liver, and brain tissue was collected. Tissue was stored inRNALater™ and placed at -80 ̊C until later processing to isolate RNA.

[0276] RNA was isolated using the Qiagen RNeasy kit, Cat.80004. We then generated cDNA using the ViloRT kit (cat 11766050). To quantify exon inclusion and splicing outcomes, we prepped a targeted nanopore library via PCR amplifying the exon cassette from the cDNA pool. This was done using hot start Q5® polymerase from NEB (M0494S), and primers binding theappropriate upstream and downstream exon Following amplification, we performed a 1.4x AmpureXP bead clean and proceeded to nanopore sequencing according to the manufacturer’s recommendation. We prepped nanopore libraries using Native Barcoding Kit 24 V14 (SQK-NBD114.24) and sequenced on R10.4.1 flow cells (FLO-MIN114).

[0277] Bioinformatics methods:

[0278] The nanopore data was aligned to the reference file using the minimap biased gtf alignment. The transcripts were assembled from the resultant bam file using StringTie. The exon coverage was calculated and plotted from the most abundant transcript. This was then used to calculate an exon inclusion rate per tissue.

[0279] Nanopore sequencing of the RNA extracted from various tissues enabled quantification of the exon retention rate. We observed that CKAP5_V0 exon variant was preferentially retained in the DRG, compared to multiple brain regions and the liver. This confirms that the DRG OFF cassette “CKAP5_V0” is suitable for DRG detargeting, due to its cross-species validation (see, Table 10).

[0280] Table 10: Summary of exon inclusion rate in vivo in NHPs. Exon Tissue Exon Inclusion + / - SEM (%)

[0281] Example 6: Nucleic Acids Comprising DRG OFF Cassette and Transgene Protein Levels in In Vivo Animal Models

[0282] To examine the effect of nucleic acids comprising DRG OFF detargeting cassettes on the protein level of the transgene (GFP), CKAP5 V0-V2, CTNNA2 V0, EN04 V0, and TMEM108 V0 nucleic acids were packaged into AAV9 capsids. The viruses were then administered in N=8 C57BI / 6 mice via intracerebroventricular injection. The animals were dosed with 1.5E11 vg per animal. One month later the mice were euthanized, with DRG, and brain tissue collected. Brain and DRG tissue were fixed overnight in 10% neutral buffered formalin and then placed into PBS. Following this, the DRG and brain samples were processed, embedded in paraffin, and sectioned at 4 μm. Immunohistochemistry was performed on a Bond Rx autostainer (Leica Biosystems), with anti-GFP antibody [EPR14104]. After staining,sections were dehydrated and film using a TissueTek-Prisma® and Coverslipper (Sakura). Whole slide scanning (40x) was performed on an Aperio AT2 (Leica Biosystems). The resulting immunohistochemistry images was used to examine the presence or absence of GFP protein in DRG and brain.

[0283] The immunohistochemistry images show that there was undetectable GFP protein expression in the DRGs for all DRG detargeting constructs tested (Figure 7A), and detectable GFP expression in the control mouse brain (Figure 7B).

[0284] GFP protein levels will be quantitated by ELISA assay.

Claims

CLAIMS The invention claimed is:

1. A nucleic acid comprising a dorsal root ganglion (DRG)-specific exon, wherein the DRG-specific exon comprises an engineered start codon, an engineered stop codon or an engineered frameshift mutation.

2. The nucleic acid of Claim 1, wherein the DRG-specific exon comprises an engineered stop codon or an engineered frameshift mutation.

3. The nucleic acid of Claim 1, wherein the DRG-specific exon comprises an engineered start codon.

4. The nucleic acid of any one of Claims 1-3, wherein the nucleic acid further comprises a flanking sequence 1 at the 5' end of the DRG-specific exon and a flanking sequence 2 at the 3' end of the DRG-specific exon.

5. The nucleic acid of any one of Claims 1-4, wherein the flanking sequence 1 comprises a first splicing donor sequence and a first splicing acceptor sequence.

6. The nucleic acid of any one of Claims 1-5, wherein the flanking sequence 2 comprises a second splicing donor sequence and a second splicing acceptor sequence.

7. The nucleic acid of any one of Claims 1 and 4-6, wherein the nucleic acid comprises in 5' to 3' order: (A) a flanking sequence 1 comprising a first splicing donor sequence and a first splicing acceptor sequence; (B) a DRG-specific exon comprising an engineered start codon, an engineered stop codon or an engineered frameshift mutation; and (C) a flanking sequence 2 comprising a second splicing donor sequence and a second splicing acceptor sequence.

8. The nucleic acid of any one of Claims 4-7, wherein the flanking sequence 1 comprises a flanking exon 1 and a flanking intron 1.

9. The nucleic acid of any one of Claims 4-8, wherein the flanking sequence 2 comprises a flanking exon 2 and a flanking intron 2.

10. The nucleic acid of any one of Claims 1-9, wherein the DRG-specific exon is derived from SEQ ID NO:79; SEQ ID NO:80, SEQ ID NO:81 or SEQ ID NO:

82.

11. The nucleic acid of any one of Claims 2 and 4-10 further comprising a start codon at the 5' end of the flanking sequence 1.

12. The nucleic acid of any one of Claims 2 and 4-11, wherein the DRG-specific exon comprises an engineered frameshift mutation.

13. The nucleic acid of Claim 12, wherein the DRG-specific exon comprises SEQ ID NO:23, SEQ ID NO:27, SEQ ID NO:83, SEQ ID NO:31, SEQ ID NO:35 or SEQ ID NO:

84.

14. The nucleic acid of Claim 12, wherein the DRG-specific exon consists of SEQ ID NO:23, SEQ ID NO:27, SEQ ID NO:83, SEQ ID NO:31, SEQ ID NO:35 or SEQ ID NO:

84.

15. The nucleic acid of any one of Claims 3 and 4-10, wherein the DRG-specific exon further comprises a Kozak sequence operably linked to the engineered start codon.

16. The nucleic acid of Claim 15, wherein the DRG-specific exon comprises SEQ ID NO:

40.

17. The nucleic acid of Claim 15, wherein the DRG-specific exon consists of SEQ ID NO:

40.

18. The nucleic acid of any one of Claims 1-17 further comprising at its 5' end an expression control element comprising a promoter.

19. The nucleic acid of any one of Claims 1-18 further comprising at its 3' end a transgene sequence encoding a gene product.

20. The nucleic acid of any one of Claims 1-19, wherein the nucleic acid comprises in 5' to 3' order: (A) an expression control element comprising a promoter; (B) a flanking sequence 1 comprising a first splicing donor sequence and a first splicing acceptor sequence, wherein the flanking sequence 1 comprises a flanking exon 1 and a flanking intron 1; (C) a DRG-specific exon comprising an engineered start codon, an engineered stop codon or an engineered frameshift mutation; (D) a flanking sequence 2 comprising a second splicing donor sequence and a second splicing acceptor sequence, wherein the flanking sequence 2 comprises a flanking exon 2 and a flanking intron 2; and (E) a transgene sequence encoding a gene product, wherein the expression control element directs expression of (B), (C) , (D) and (E).

21. The nucleic acid of Claim 20, wherein (B), (C) and (D) are a nucleotide sequence that is at least 90% identical to or 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% identical to SEQ ID NO:22, 24 or 25.

22. The nucleic acid of Claim 20, wherein (B), (C) and (D) are a nucleotide sequence that is at least 90% identical to or 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% identical to SEQ ID NO:26, 28 or 29.

23. The nucleic acid of Claim 20, wherein (B), (C) and (D) are a nucleotide sequence that is at least 90% identical to or 90%, 91%, 92%, 93%, 94, 95%, 96%, 97%, 98%, 99%, 100% identical to SEQ ID NO:30, 32 or 33.

24. The nucleic acid of Claim 20, (B), (C) and (D) are a nucleotide sequence that is at least 90% identical to or 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% identical to SEQ ID NO:34, 36 or 37.

25. The nucleic acid of Claim 20, wherein (B), (C) and (D) are a nucleotide sequence that consists of SEQ ID NO:22, 24 or 25.

26. The nucleic acid of Claim 20, wherein (B), (C) and (D) are a nucleotide sequence that consists of SEQ ID NO:26, 28 or 29.

27. The nucleic acid of Claim 20, wherein (B), (C) and (D) are a nucleotide sequence that consists of SEQ ID NO:30, 32 or 33.

28. The nucleic acid of Claim 20, wherein (B), (C) and (D) are a nucleotide sequence that consists of SEQ ID NO:34, 36 or 37.

29. The nucleic acid of any one of Claims 4-28, wherein the flanking sequence 1 comprises a splicing factor binding site of SEQ ID NO:1, 2, 3, 4, 5, 6, 21 or a combination thereof.

30. The nucleic acid of any one of Claims 4-29, wherein the flanking sequence 2 comprises a splicing factor binding site of SEQ ID NO:1, 2, 3, 4, 5, 6, 21 or a combination thereof.

31. The nucleic acid of any one of Claims 19-30, wherein the transgene is GBA1, PGRN, TREM2, a gene editing enzyme (Cas family or other), ApoE / ApoE2, HTT, MAPT, SNCA, C9orf72 or SOD1.

32. The nucleic acid of any one of Claims 19-31, wherein the expression of the transgene in DRG neurons is reduced as compared to a nucleic acid without the DRG-specific exon.

33. The nucleic acid of any one of 19-32, further comprising a nucleotide sequence encoding a proteolytic cleavage sequence inserted between the flanking sequence 2 and the transgene sequence.

34. The nucleic acid of Claim 33, wherein the proteolytic cleavage sequence is a nucleotide sequence encoding a proteolytic cleavage peptide T2A (SEQ ID NO:85), P2A (SEQ ID NO:86), E2A (SEQ ID NO:87) or F2A (SEQ ID NO:88).

35. The nucleic acid of any one of Claims 19-34, further comprising an internal ribosome entry site (IRES) sequence inserted between the flanking sequence 2 and the transgene sequence.

36. The nucleic acid of any one of Claims 19-35, wherein the transgene sequence is a codon-optimized sequence.

37. The nucleic acid of any one of Claims 19-36 further comprising: (A') a first AAV ITR or a reverse complementary sequence thereto inserted before the expression control element of (A); (F) a post-transcriptional regulatory element inserted after the transgene sequence encoding the gene product of (E); (G) a polyadenylation signal inserted after the post-transcriptional regulatory element (F); and / or (H) a second AAV ITR or a reverse complementary sequence thereto inserted after the polyadenylation signal (G).

38. A vector comprising the nucleic acid of any one of Claims 1-37.

39. The vector of Claim 38, wherein the vector is a recombinant adeno-associated virus (rAAV) vector.

40. A recombinant adeno-associated virus (rAAV) comprising: the rAAV vector of Claim 39; and an adeno-associated virus (AAV) capsid protein.

41. The rAAV of Claim 40, wherein AAV capsid protein is AAV6 or AAV9 capsid protein.

42. The rAAV of Claim 41, wherein the AAV6 capsid protein comprises SEQ ID NO:

19.

43. The rAAV of Claim 41, wherein the AAV9 capsid protein comprises SEQ ID NO:

20.

44. A pharmaceutical composition comprising: the nucleic acid of any one of Claims 1-37, the vector of any one of Claims 38-39, or the rAAV of any one of Claims 40-43; and a pharmaceutically acceptable carrier.

45. A method of treating a central nervous system (CNS) disease or disorder in an individual in need thereof, the method comprising the step of: administering to the individual a therapeutically effective amount of the nucleic acid of any one of Claims 1-37, the vector of any one of Claims 38-39, the rAAV of any one of Claims 40-43 or the pharmaceutical composition of Claim 44.

46. A method of reducing a transgene expression in a dorsal root ganglion (DRG) neuron during a treatment of a central nervous system (CNS) disease or disorder in an individual in need thereof, the method comprising the step of: administering to the individual a therapeutically effective amount of the nucleic acid of any one of Claims 1-37, the vector of any one of Claims 38-39, the rAAV of any one of Claims 40-43 or the pharmaceutical composition of Claim 44, wherein the transgene expression is reduced in a DRG neuron.

47. The method of Claim 45 or 46, wherein the administering comprises intra-cisterna magna (ICM), intracerebroventricular (ICV), intraparenchymal (IP) or intravenous (IV) administration.

48. The nucleic acid of any one of 1-37, the vector of any one of Claims 38-39, the rAAV of any one of Claims 40-43 or the pharmaceutical composition of Claim 44 for use in therapy.

49. The nucleic acid of any one of Claims 1-37, the vector of any one of Claims 38-39, the rAAV of any one of Claims 40-43 or the pharmaceutical composition of Claim 44 for use in treating a central nervous system (CNS) disease or disorder.

50. Use of the nucleic acid of any one of Claims 1- 37, the vector of any one of Claims 38-39, the rAAV of any one of Claims 40-43 or the pharmaceutical composition of Claim 44 in the manufacture of a medicament for treatment of a central nervous system (CNS) disease or disorder.

Images