Inhibin subunit beta e-related double stranded oligonucleotide compositions and methods relating thereto

WO2026055502A3PCT designated stage Publication Date: 2026-04-16WAVE LIFE SCI LTD +15
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/045166
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2025-03-06
Filing Date
2025-09-05
Publication Date
2026-04-16

AI Technical Summary

Technical Problem

There is a need for alternative treatment methods for metabolic disorders such as obesity, cardiovascular disease, diabetes, and hypertension, as current treatments like diet and exercise are inadequate.

Method used

The use of double-stranded oligonucleotides, specifically SSR-0108051, SSR-0108323, and SSR-0108321, targeting inhibin subunit beta E (INHBE) expression to prevent or treat associated conditions by administering a dsRNAi composition.

Benefits of technology

The dsRNAi agents effectively reduce body fat, improve glucose control, and enhance metabolic health by targeting INHBE, reducing fat mass while maintaining muscle mass, and preventing rebound weight gain.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025045166_16042026_PF_FP_ABST
    Figure US2025045166_16042026_PF_FP_ABST
Patent Text Reader

Abstract

The present disclosure provides human inhibin subunit beta E (INHBE) gene-targeting double stranded oligonucleotides, compositions, and methods of using the same, either alone or in combination with additional therapeutics, for preventing and / or treating various INHBE-related disorders, including maintenance of weight loss achieved. In some embodiments, the provided double stranded oligonucleotides comprise certain chemistry modifications, e.g., stereospecific internucleotidic linkage modifications, and have unexpected advantageous properties.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] 088290.0210

[0002] INHIBIN SUBUNIT BETA E-RELATED DOUBLE STRANDED OLIGONUCLEOTIDE COMPOSITIONS AND METHODS RELATING THERETO

[0003] RELATED APPLICATIONS

[0004] This application claims the benefit of priority' to United States Provisional Application Nos. 63 / 691,262. filed September 5, 2024; 63 / 713,955, filed October 30, 2024; and 63 / 768,125. filed March 6, 2025. This application is related to and incorporates herein by reference in its entirety7International Application No. PCT / US2025 / 028679, filed May 9, 2025.

[0005] TECHNICAL FIELD

[0006] Among other things, the present disclosure provides double stranded (ds) oligonucleotides, compositions and methods (e.g., of preparation, use, etc.) thereof. In some embodiments, provided technologies are useful for preventing and / or treating various conditions, disorders, or diseases associated with inhibin subunit beta E (INHBE) expression.

[0007] BACKGROUND

[0008] Metabolic disorders, e.g., metabolic syndrome, and related diseases, e.g., obesity, cardiovascular disease, diabetes, and hypertension are an increasing medical concern. Typical treatment for such disorders and diseases involves targeted approaches and / or changes in diet and lifestyle, e.g., increased physical activity. Particularly, treatment for obesity7, which is a disorder involving excess body fat, entails exercise and a healthy, balanced diet leading to weight loss. There exists, however, a need for alternate treatment methods for metabolic diseases, particularly7weight loss.

[0009] Double stranded (ds) oligonucleotides are useful in various applications, e.g., therapeutic, diagnostic, and / or research applications. Inhibin subunit beta E (INHBE), which is primarily expressed in the liver, has been linked with both body mass index and insulin resistance. As such, ds oligonucleotides targeting disorders or diseases associated with expression of INHBE can be useful treatment of such conditions including metabolic disorders, e.g., metabolic syndrome, and related diseases, e.g., obesity, cardiovascular disease, diabetes, and hypertension.

[0010] SUMMARY

[0011] In some embodiments, the present disclosure provides a method for preventing or treating a INHBE-associated condition by administering a dsRNAi composition.

[0012] 1

[0013] 12579081V1 088290.0210

[0014] In some embodiments, an oligonucleotide or oligonucleotide composition is useful for the manufacture of a medicament for prevention or treatment of an INHBE-associated condition, disorder, or disease, such as metabolic disorders, e.g., metabolic syndrome, and related diseases, e.g., obesity, cardiovascular disease, diabetes, and hypertension, in a subject in need thereof.

[0015] Various INHBE-associated conditions, disorders, or diseases may be prevented and / or treated utilizing provided technologies (e.g.. oligonucleotide, compositions, methods, etc.). In some embodiments, a condition, disorder, or disease is a metabolic disorder, e.g., metabolic syndrome, or related disease, e.g., obesity, cardiovascular disease, diabetes, or hypertension.

[0016] In a first aspect of the invention, the oligonucleotide described herein is or relates to SSR-0108051 having or comprising the structure of

[0017] 5’-[GalNAc3C12oyl][nC6o]pmU[Ssp]mCpmUpmUpmUpmCp[fl2r]CpmAp[fl2r]Up [H2r]Up[fl2r]CpmUpmGpmCpmCpmGpmUpmCpmUpmU[Ssp]mA-3’, or a salt form, e g., a pharmaceutically acceptable salt form, thereof, wherein: [GalNAc3C12oyl] is or represents tn-antennary GalNAc with C12 linker; [nC6o] is or represents 6-aminohexanol; p is or represents phosphate linkage (PO); mU is or represents 2’-O-methyluridine;

[0018] [Ssp] is or represents Np phosphorothioate linkage ( p-PS): mC is or represents 2’-O-methylcytidine;

[0019] [fl2r] C is or represents 2’-fluoro-2’-deoxy cytidine; mA is or represents 2’-G-methyladenosine;

[0020] [H2r]U is or represents 2’ -fluoro-2’ -deoxyuridine; and mG is or represents 2'-<9-mcthylguanosine.

[0021] In an exemplary embodiment, the invention relates to an oligonucleotide having or comprising the sequence of pmU[Ssp]mCpmUpmUpmUpmCp[fl2r]CpmAp[fl2r]Up[fl2r]Up[fl2r]CpmUpmGpmCpmCp mGpmUpmCpmUpmU[Ssp]mA or mU[Ssp]mCpmUpmUpmUpmCp[fl2r]CpmAp[fl2r]Up[fl2r]Up[fl2r]CpmUpmGpmCpmCpm GpmUpmCpmUpmU[Ssp]mA, optionally having or comprising a carbohydrate ligand, e.g., a mono-GalNAc, a bis-GalNAc, a tri-GalNAc, a mannose derivative, a galactose derivative, a glucose sugar derivative, other saccharide derivatives or combinations thereof conjugated to,

[0022] 2

[0023] 12579081V1 088290.0210 e.g., the 5’-end thereof, optionally via a linker, e.g., [GalNAc3C12oyl] or [GalNAc3C12oyl][nC6o], In some embodiments, an oligonucleotide delivers mU[Ssp]mCpmUpmUpmUpmCp[fl2r]CpmAp[fl2r]Up[fl2r]Up[fl2r]CpmUpmGpmCpmCpm GpmUpmCpmUpmU[Ssp]mA to a subject. In some embodiments, a method comprises delivering to a subject mU[Ssp]mCpmUpmUpmUpmCp[fl2r]CpmAp[fl2r]Up[fl2r]Up[112r]CpmUpmGpmCpmCpm GpmUpmCpmUpmU[Ssp]mA and

[0024] [cp][tz][d5m]U[Ssp][fl2r]A[Rsp]mA[n001S][fl2r]GpmAp[fl2r]CpmGpmGpmCpmA[n001R] [H2r]GpmApmAp[fl2r]UpmGp[fl2r]GpmApmApmApmGpmA[Ssp]mU[Ssp]mU. In some embodiments, the two oligonucleotides form a double-stranded oligonucleotide agent. Those skilled in the art reading the present disclosure appreciate that unless indicated otherwise, description of oligonucleotides are from 5’ to 3’, and unless indicated otherwise, nucleosides are connected by linkages as typically in natural DNA and RNA: linkage phosphorus of a linkage is bonded to an oxygen atom that is bonded to a 5 ’-carbon of a nucleoside, and an oxygen atom that is bonded to a 3’-carbon of a nucleoside. See. e.g., Formula I-a and Formula I-b.

[0025] In some embodiments, the present disclosure provides an oligonucleotide, or a composition or preparation comprising an oligonucleotide, wherein the oligonucleotide is an oligonucleotide of Formula I, wherein each zig-zag line between phosphorus and oxygen independently represent the bond between the phosphorus and the oxygen.

[0026] 3

[0027] 12579081V1 088290.0210

[0028] 4

[0029] 12579081V1 088290.0210

[0030] Formula I-b

[0031] In some embodiments, an oligonucleotide composition, e.g., a SSR-0108051 composition or preparation, comprises an oligonucleotide of Formula I-a or Formula I-b. In some embodiments, an oligonucleotide composition, e.g., a SSR-0108051 composition or preparation, comprises the corresponding acid of the oligonucleotide of Formula I-a in which each of Na is replaced with H (the "formula I Acid Oligonucleotide”). In some embodiments, an oligonucleotide is the Formula I Acid Oligonucleotide or a salt thereof. In some

[0032] 5

[0033] 12579081V1 088290.0210 embodiments, an oligonucleotide is the Formula I Acid Oligonucleotide or a pharmaceutically acceptable salt thereof. In some embodiments, a composition, e.g., a SSR-0108051 composition or preparation, comprises the Formula I Acid Oligonucleotide or a salt thereof. In some embodiments, a composition, e.g., a SSR-0108051 composition or preparation, comprises the Formula I Acid Oligonucleotide or a pharmaceutically acceptable salt thereof. In some embodiments, a composition comprises two or more salts of the Formula I Acid Oligonucleotide. In some embodiments, a composition comprises two or more pharmaceutically acceptable salts of the Formula I Acid Oligonucleotide. In some embodiments, the Formula I Acid Oligonucleotide or a salt thereof forms a duplex wi th another oligonucleotide.

[0034] In a second aspect of the invention, the present disclosure provides oligonucleotides comprising 4-phosphono-l,2,3-triazol-l-yl. In some embodiments, an oligonucleotide described herein is or relates to SSR-0108323 having or comprising the structure of

[0035] 5'-[cp][tz] [d5m]U[Ssp] [fl2r]A[Rsp]mA[n001S][fl2r]GpmAp[fl2r]CpmGpmGpmCpmA [nOOIR] [H2r]GpmApmAp[fl2r]UpmGp[fl2r]GpmApmApmApmGpmA[Ssp]mU[Ssp]mU-3’, or a salt form, e.g., a pharmaceutically acceptable salt form, thereof, wherein:

[0036] [cp] is or represents capping phosphate;

[0037] [tz] is or represents l#-l,2,3-triazole (1,4 linkage);

[0038] [d5m]U is or represents 5’-deoxy-2’-O-methyluridine;

[0039] [Ssp] is or represents <Sp phosphorothioate linkage (Sp-PS);

[0040] [fl2r] A is or represents 2’ -fluoro-2’ -deoxy adenosine;

[0041] [RspJ is or represents Rp phosphorothioate linkage (Ap-PS): mA is or represents 2’-O-methyladenosine;

[0042] [nOOlS] is or represents Sp A-(l,3-dimethylimidazolidin-2-ylidene)phosphoramidate linkage (Sp-PN);

[0043] [H2r]G is or represents 2?-fluoro-2?-deoxy guanosine; p represents phosphate linkage (PO);

[0044] [112r]C is or represents 2’-fluoro-2’-deoxycytidine; mG is or represents 2’-(9-methylguanosine; mC is or represents 2?-(9-methylcytidine;

[0045] [nOOIR] is or represents Rp N-(l,3-dimethylimidazolidin-2-ylidene)phosphoramidate linkage ( / ?p-PN);

[0046] 6

[0047] 12579081V1 088290.0210

[0048] [fl2r]U is or represents 2’-fluoro-2’-deoxyuridine; and mU is or represents 2'-<9-methylundine. and wherein

[0049] [cp] [tz] together constitutes [ptz] which is or represents (1 / 7-1, 2,3-triazol-4- yl)phosphonate.

[0050] In some embodiments, the present disclosure provides an oligonucleotide, or a composition or preparation comprising an oligonucleotide, wherein the oligonucleotide is an oligonucleotide of Formula Il-a or Formula Il-b, wherein zig-zag lines represent the linkage between phosphorus to the oxygen at 5' in the following intemucleotide linkage.

[0051] Formula Il-a

[0052] 7

[0053] 12579081V1 088290.0210

[0054] Formula Il-b

[0055] In some embodiments, an oligonucleotide composition, e.g., a SSR-0108323 composition or preparation, comprises an oligonucleotide of Formula Il-a or Formula Il-b. In some embodiments, an oligonucleotide composition, e.g., a SSR-0108323 composition or preparation, comprises the corresponding acid of the oligonucleotide of Formula Il-a in which each of Na is replaced with H (the “Formula II Acid Oligonucleotide”). In some embodiments, an oligonucleotide is the Formula II Acid Oligonucleotide or a salt thereof. In some embodiments, an oligonucleotide is the Formula II Acid Oligonucleotide or a pharmaceutically acceptable salt thereof. In some embodiments, a composition, e.g., a SSR-0108323 composition or preparation, comprises the Formula II Acid Oligonucleotide or a salt thereof. In some embodiments, a composition, e.g., a SSR-0108323 composition or preparation, comprises the Formula II Acid Oligonucleotide or a pharmaceutically acceptable salt thereof. In some embodiments, a composition comprises two or more salts of the Formula II Acid

[0056] 8

[0057] 12579081V1 088290.0210

[0058] Oligonucleotide. In some embodiments, a composition comprises two or more pharmaceutically acceptable salts of the Formula II Acid Oligonucleotide. In some embodiments, the Formula II Acid Oligonucleotide or a salt thereof forms a duplex with another oligonucleotide, e.g., the Formula I Acid Oligonucleotide or a salt thereof.

[0059] In a third aspect of the invention, the oligonucleotide described herein is or relates to SSR-0108321 having or comprising the structure of

[0060] 5 ’-[ vped5m] U[S sp] [ fl2 r] A[Rsp]mA[n001 S] [fl2r] GpmAp | fl 2 r | CpmGpmGpmCpmA [nOO 1 R] [fl 2r] GpmApmAp[fl2r] UpmGp [fl 2r] Gpm ApmApmApmGpmA[ Ssp] mU[Ssp] mU-3 ’ , or a salt form, e.g., a pharmaceutically acceptable salt form thereof, wherein

[0061] [vped5m]U is or represents 5’-(£)-vinylphosphonate-5’-deoxy-2’-0-methyluridine;

[0062] [Ssp] is or represents Sp phosphorothioate linkage fS'p-PS):

[0063] [H2r]A is or represents 2’ -11 uoro-2’ -deoxy adenosine;

[0064] [Rsp] is or represents Ap phosphorothioate linkage ( p-PS): mA is or represents 2’-(9-methyladenosine;

[0065] [nOOlS] is or represents Sp A-(l,3-dimethylimidazolidin-2-ylidene)phosphoramidate linkage (Sp-PN);

[0066] [f!2r]G is or represents 2’ -fluoro-2’ -deoxy guanosine; p is or represents phosphate linkage (PO); mA is or represents 2’-O-methyladenosine;

[0067] [112r]C is or represents 2’-fluoro-2’-deoxy cytidine; mG is or represents 2’-( -methylguanosine; mC is or represents 2’-( -methylcytidine;

[0068] [nOOIR] is or represents R N-(l,3-dimethylimidazolidin-2-ylidene)phosphoramidate linkage (7 p-PN): and

[0069] [H2r]U is or represents 2’ -11 uoro-2’ -deoxy uridine, and mU represents 2’-O- methyluridine.

[0070] In a fourth aspect of the invention, the double-stranded RNAi (dsRNAi) agent described herein is capable of, e.g., directing target-specific RNA interference, and comprises, or consists of, or consists essentially of, a guide strand (e.g., an antisense strand), and a passenger strand (e.g., a sense strand), wherein the guide strand is or comprises the oligonucleotide SSR- 0108323 and the passenger strand is or comprises the oligonucleotide SSR-0108051, thereby constituting DSR-0104292. In an exemplary embodiment, the dsRNAi agent comprises the

[0071] 9

[0072] 12579081V1 088290.0210 guide strand according to the second aspect (e.g., SSR-0108323) and the passenger strand according to the first aspect (e.g., SSR-0108051), thereby constituting DSR-0104292. In some embodiments, the present disclosure provides an oligonucleotide agent, wherein the oligonucleotide agent is an oligonucleotide agent of Formula Ill-a or Formula Ill-b.

[0073] 10

[0074] 1257908 Ivl 088290.0210

[0075] Formula Ill-a

[0076] 11

[0077] 1257908 Ivl 088290.0210

[0078] 12

[0079] 12579081V1 088290.0210

[0080] Formula Ill-b In some embodiments, an oligonucleotide composition, e.g., a DSR-0104292 composition or preparation, comprises an oligonucleotide agent of Formula Ill-a or Formula Ill-b. In some embodiments, an oligonucleotide composition, e.g.. a DSR-0104292 composition or preparation, comprises the corresponding acid agent of the oligonucleotide agent of Formula Ill-a in which acid agent each of Na is replaced with H (the “Formula III Acid Oligonucleotide Agent'’). In some embodiments, an oligonucleotide agent is the Formula III Acid Oligonucleotide Agent or a salt thereof. In some embodiments, an oligonucleotide agent is the Formula III Acid Oligonucleotide Agent or a pharmaceutically acceptable salt thereof. In some embodiments, a composition, e.g., a DSR-0104292 composition or preparation, comprises the Formula III Acid Oligonucleotide Agent or a salt thereof. In some embodiments, a composition, e.g.. a DSR-0104292 composition or preparation, comprises the

[0081] 13

[0082] 12579081V1 088290.0210

[0083] Formula III Acid Oligonucleotide Agent or a pharmaceutically acceptable salt thereof. In some embodiments, a composition comprises two or more salts of the Formula III Acid Oligonucleotide Agent. In some embodiments, a composition comprises two or more pharmaceutically acceptable salts of the Formula III Acid Oligonucleotide Agent.

[0084] In a fifth aspect of the invention, the dsRNAi agent described herein is capable of, e.g., directing target-specific RNA interference, and comprises, or consists of, or consists essentially of, a guide strand (e.g.. an antisense strand), and a passenger strand (e.g.. a sense strand), wherein the guide strand is or comprises the oligonucleotide SSR-0108321 and the passenger strand is or comprises the oligonucleotide SSR-0108051, thereby constituting DSR-0104290. In an exemplary embodiment, the dsRNAi agent comprises the guide strand according to the third aspect (e.g., SSR-0108321) and the passenger strand according to the first aspect (e.g., SSR-0108051), thereby constituting DSR-0104290.

[0085] In a sixth aspect of the invention, the invention relates to a method of preparing the dsRNAi agent according to the fourth aspect or the fifth aspect of the invention, the method comprising the steps of: i) combining a guide strand and passenger strand in a mixing vessel and mixing the guide strand and passenger strand to form a dsRNAi oligonucleotide solution, wherein the dsRNAi oligonucleotide solution comprises a dsRNAi oligonucleotide; ii) filtering the dsRNAi oligonucleotide solution through a filter, resulting in filtrate; iii) lyophilizing the filtrate to form a lyophilized product; and iv)isolating a dsRNAi oligonucleotide from the lyophilized product, wherein the dsRNAi oligonucleotide is the dsRNAi agent. In an exemplary embodiment, the step i) further comprises determining the presence of the dsRNAi oligonucleotide in the dsRNAi oligonucleotide solution by UPLC. In an exemplary embodiment, the guide strand and passenger strand are combined in the mixing vessel in equal molar quantities. In an exemplary’ embodiment, a freeze drying tray is used for lyophilizing the filtrate in the step iii)

[0086] In a seventh aspect of the invention, the invention relates to a method for preventing, ameliorating, or treating an INHBE-related disorder, disease, or condition in a subject in need thereof, comprising administering to the subject an effective amount of the dsRNAi agent according to the fourth aspect or the fifth aspect of the invention.

[0087] In an eighth aspect of the invention, the invention relates to a method for preventing, ameliorating, or treating an INHBE-related disorder, disease, or condition in a subject in need thereof, comprising: administering to the subject an effective amount of the dsRNAi agent according to the fourth aspect or the fifth aspect of the invention; and performing bariatric surgery’ on the subject.

[0088] 14

[0089] 12579081V1 088290.0210

[0090] In a ninth aspect of the invention, the invention relates to a method for preventing, ameliorating, or treating an INHBE-related disorder, disease, or condition in a subject in need thereof, comprising: administering to the subject an effective amount of the dsRNAi agent according to the fourth aspect or the fifth aspect of the invention; and administering a second agent to the subject, wherein the second agent is selected from: a gastric and / or pancreatic lipase inhibitor; a norepinephrine agonist, a gamma-aminobutyric acid agonist, and / or a glutamate antagonist; an opioid receptor antagonist, a dopamine and norepinephnne reuptake inhibitor; a glucagon-like peptide 1 (GLP-1) agonist; an melanocortin-4 receptor (MC4R) agonist; a gastric inhibitory' polypeptide (GIP)ZGLP-l dual agonist; insulin; sulfonylurea; meglitinide; biguanide; thiazolidinedione; an alpha-glucosidase inhibitor; a SGLT2 inhibitor; a DPP4 inhibitor; a HMG-CoA reductase inhibitor, statins; a PCSK.9 inhibitor; an ApoC3 inhibitor; an ANGPTL3 inhibitor; an ATP citrate lyase; ezetimide; an Lp(a) inhibitor; an LPL activator; and combinations thereof. In an exemplary embodiment, the second agent is a GLP- 1 receptor agonist (GLP-1 agonist), e.g., exenatide, dulaglutide, liraglutide, tirzepatide, or semaglutide. In an exemplary embodiment, the second agent is semaglutide. In an exemplary embodiment, the dsRNAi agent according to the fourth aspect or the fifth aspect of the invention and the second agent (e.g., semaglutide) are administered to the subject concurrently or sequentially. In an exemplary embodiment, the second agent is administered before the dsRNAi agent is administered to the subject, and said administration of the second agent continues upon said administration of the dsRNAi agent is administered to the subject. In an exemplary embodiment, the second agent is administered before the dsRNAi agent is administered to the subject, and said administration of the second agent terminates upon said administration of the dsRNAi agent to the subject. In an exemplary embodiment, the second agent is administered to the subject daily. In an exemplary embodiment, the amount of the second agent administered to the subject is reduced relative to a reference dose of the second agent administered in the absence of the dsRNAi agent. In an exemplary' embodiment, bariatric surgery is performed on the subject before the dsRNAi agent according to the fourth aspect or the fifth aspect of the invention is administered to the subject. In an exemplary embodiment, the dsRNAi agent according to the fourth aspect or the fifth aspect of the invention is administered every six months, or annually, after the subject has been administered the second agent or has undergone bariatric surgery'. In an exemplary' embodiment, the subject loses substantially more body weight, e.g., double the body weight, compared to when the subject is administered the second agent alone. In an exemplary embodiment, the subject does not undergo rebound body weight gain which is, or would be, expected when the subject is

[0091] 15

[0092] 12579081V1 088290.0210 administered the second agent alone, e.g.. without being administered the dsRNAi agent according to the fourth aspect or the fifth aspect of the invention is administered to the subject.

[0093] In an exemplary embodiment of the seventh, eighth, or ninth aspect of the invention, said prevention, amelioration, or treatment of an INHBE-related disorder, disease, or condition is selected from: improving glucose control; increasing lean body mass; reducing fat mass; treating obesity, e.g., abdominal obesity; treating diabetes, e.g., type 2 diabetes, e.g.. type 2 diabetes secondary to obesity; treating insulin resistance; coronary artery disease, e.g.. coronary artery disease secondary to obesity; treating chronic kidney disease; treating liver issues associated with increased fat mass, obesity, and / or diabetes; treating a metabolic disorder, e.g., a metabolic disease or dysregulation associated with obesity, type 2 diabetes, and / or coronary artery disease; treating an elevated triglyceride level; treating a lipodystrophy; treating liver inflammation; treating fatty liver disease; treating hypercholesterolemia; treating an elevated liver enzyme; treating nonalcoholic steatohepatitis (NASH); treating a cardiovascular disease; treating cardiomyopathy; treating high blood pressure; treating heart failure; and inducing lipolysis (fat-burning) while preserving muscle mass. In an exemplary’ embodiment, the dsRNAi agent according to the fourth aspect or the fifth aspect of the invention is administered, e.g., every six months or annually. In an exemplary embodiment, the dsRNAi agent according to the fourth aspect or the fifth aspect of the invention is administered, e.g., subcutaneously. In an exemplary embodiment, the subject maintains at least, e g., 50%, 60%, 75%, 90%, or 95% of its pre-administration skeletal muscle mass. In an exemplary embodiment, the subject loses the body weight without loss of muscle mass or without substantial loss of muscle mass. In an exemplary embodiment, wherein said loss of the body weight is accompanied by a reduction in fat mass or a substantial reduction in fat mass, and wherein said reduction in fat mass is a reduction in visceral fat mass. In an exemplary embodiment, said effects on the subject's muscle mass and fat mass are consistent with the protective effects of heterozygous INHBE loss-of-function (LoF) mutations, whereby, optionally, a healthy metabolic profile of the subject is maintained. In an exemplary’ embodiment, said subject is a mammal, e.g., a human. In an exemplary embodiment, infiltration of activated macrophages in visceral adipose is decreased, e.g., by at least 50%, e.g., up to 68% compared to PBS treatment. In an exemplary embodiment, said decreasing the infiltration of activated macrophages in visceral adipose leads to a strong suppression of adipose fibrosis.

[0094] BRIEF DESCRPTION OF THE DRAWINGS

[0095] Figure 1 depicts evaluation of an exemplary' siRNA of the present disclosure plus

[0096] 16

[0097] 12579081V1 088290.0210 semaglutide on the body weight in the groups of mice as described in Example 3.

[0098] Figures 2A-2B. Figure 2A depicts evaluation of an exemplary siRNA of the present disclosure on the body weight in the groups of mice as described in Example 4. Tissue weights (white adipose tissues, quadriceps, tibialis anterior, and the gastrocnemius) are depicted in Figure 2B.

[0099] Figures 3 and 4 depict evaluation of an exemplary’ siRNA of the present disclosure plus semaglutide on the body weight in the groups of mice as described in Example 6 (Groups Nos. 1, 2 and 6 in Figure 3; Group No. 5 in Figure 4).

[0100] Figure 5 depicts evaluation of an exemplary siRNA of the present disclosure on the body weight in the groups of mice as described in Example 11.

[0101] Figure 6A depicts evaluation of an exemplary siRNA of the present disclosure on chronic inflammation in epididymal white adipose tissue as described in Example 5. Data are means ± SEM of 4-5 mice. Each dot represents an individual mouse. One-way ANOVA with Tukey multiple comparison test.

[0102] Figure 6B depicts mean ±SEM of percent stain-positive area, calculated from F4 / 80- stained sections from mice (n=6), using HALO image analysis platform as described in Example 5. Each dot represents an individual mouse. Kruskal -Wallis test with Dunn’s multiple comparison test. *p<0.05.

[0103] Figure 6C depicts mean ±SEM of percent stain-positive area, calculated from CD11c- stained sections from mice (n=6), using HALO image analysis platform as described in Example 5. Each dot represents an individual mouse. One-way ANOVA with Tukey multiple comparison test. ***P<0.001, *P<0.05.

[0104] Figure 6D depicts mean ±SEM of percent stain-positive area, calculated from CD 163- stained sections from mice (n=6), using HALO image analysis platform as described in Example 5. Each dot represents an individual mouse. One-way ANOVA with Tukey multiple comparison test.

[0105] Figure 6E depicts mean ±SEM of percent stain-positive area, calculated from Trichrome-stained sections from mice (n=6), using HALO image analysis platform as described in Example 5. Each dot represents an individual mouse. One-way ANOVA with Tukey multiple comparison test.

[0106] Figure 7A depicts the upregulated Gene Ontology' (GO) enrichment analysis of the inguinal (subcutaneous) gene pathway regulation in Example 13 at 2, 28, and 70 days.

[0107] Figure 7B depicts the upregulation of genes responding to insulin at 2, 28. and 70 days.

[0108] Figure 7C depicts the upregulation of genes in adaptive thermogenesis (beiging of

[0109] 17

[0110] 12579081V1 088290.0210 white adipose) in Example 13 at 2, 28, and 70 days.

[0111] Figure 7D depicts the downregulation of pathways related to adipose remodeling and fibrosis in Example 13 at 2, 28, and 70 days.

[0112] Figure 7E depicts the upregulation of pathways related to utilization of fatty acid for energy production in Example 13 at 2, 28, and 70 days.

[0113] Figure 7F depicts the upregulation of genes involved in cellular respiration in Example 13 at 2. 28. and 70 days.

[0114] Figure 7G depicts the upregulation of genes involved in lipid catabolic process in Example 13 at 2, 28, and 70 days.

[0115] Figure 7H depicts the upregulation of pathways related to short-term adaptation to carbohydrate metabolism in Example 13 at 2, 28, and 70 days.

[0116] Figure 71 depicts the upregulation of genes involved in carbohydrate metabolic process in Example 13 at 2, 28, and 70 days.

[0117] Figure 7J depicts the upregulation of genes involved in the response to insulin in Example 13 at 2. 28, and 70 days.

[0118] Figure 7K depicts the upregulation of pathways related thermogenesis in Example 13 at 2, 28, and 70 days

[0119] Figure 7L depicts the upregulation of genes related to adipocytes differentiation in Example 13 at 2, 28, and 70 days.

[0120] Figure 7M depicts the upregulation of genes related to adaptive thermogenesis in Example 13 at 2, 28, and 70 days.

[0121] Figure 7N depicts the mesenteric downregulated GO enrichment of mesenteric adipose gene pathway regulation in Example 13 at 2, 28, and 70 days.

[0122] Figure 70 depicts the upregulation of pathways in glucose utilization, thermogenesis, and lipid metabolism in Example 13 at 2, 28, and 70 days.

[0123] Figure 7P depicts the downregulation of genes controlling innate immunity in Example 13 at 2, 28, and 70 days.

[0124] Figure 7Q depicts the downregulation of genes controlling cytokine release in Example 13 at 2, 28, and 70 days.

[0125] Figure 7R depicts the downregulation of genes controlling extracellular matrix remodeling (fibrosis) in Example 13 at 2, 28, and 70 days.

[0126] Figure 8A depicts the % mRNA expression in Example 13 of leptin, Slc2a4 (Glut4), and Ppargcla genes in inguinal white adipose of mice measured by qPCR.

[0127] Figure SB depicts the % mRNA expression in Example 13 of leptin, Slc2a4 (Glut4),

[0128] 18

[0129] 12579081V1 088290.0210 and Ppargcla genes in mesenteric white adipose of mice measured by qPCR.

[0130] Figure 8C depicts the % mRNA expression in Example 13 of Fasn, Srebfl, Irsl. Adrb3, and Acsll genes in inguinal white adipose of mice measured by qPCR.

[0131] Figure 8D depicts the % mRNA expression in Example 13 of Fasn, Srebfl, Irsl, Adrb3, and Acsll genes in mesenteric white adipose of mice measured by qPCR.

[0132] Figure 8E depicts the % mRNA expression in Example 13 of Mogatl, Pparg, Cptlb, Dgatl, and Thrsp genes in inguinal white adipose of mice measured by qPCR.

[0133] Figure 8F depicts the % mRNA expression in Example 13 of Mogatl, Pparg, Cptlb, Dgatl, and Thrsp genes in mesenteric white adipose of mice measured by qPCR.

[0134] DETAILED DESCRIPTION OF CERTAIN EMBODIMENTS

[0135] Technologies of the present disclosure may be understood more readily by reference to the following detailed description of certain embodiments.

[0136] Definitions

[0137] As used herein, the following definitions shall apply unless otherwise indicated. For purposes of this disclosure, the chemical elements are identified in accordance with the Periodic Table of the Elements, CAS version, Handbook of Chemistry and Physics, 75th Ed. Additionally, general principles of organic chemistry are described in "Organic Chemistry", Thomas Sorrell, University' Science Books, Sausalito: 1999, and "March's Advanced Organic Chemistry", 5th Ed.. Ed.: Smith, M.B. and March, J.. John Wiley & Sons, New York: 2001.

[0138] Unless otherwise specified, description of oligonucleotides and elements thereof (e.g., base sequence, sugar modifications, intemucleotidic linkages, linkage phosphorus stereochemistry', patterns thereof, etc.) is from 5‘ to 3’. As those skilled in the art will appreciate, in some embodiments, oligonucleotides may be provided and / or utilized as salts, particularly pharmaceutically acceptable salts, e.g., sodium salts. Unless otherwise indicated, oligonucleotides include various forms of the oligonucleotides. As those skilled in the art will also appreciate, in some embodiments, individual oligonucleotides within a composition maybe considered to be of the same constitution and / or structure even though, within such composition (e.g., a liquid composition), particular such oligonucleotides might be in different salt(s) (and may be dissolved and the oligonucleotide chain may exist as an anion form when, e.g., in a liquid composition) at a particular moment in time. For example, those skilled in the art will appreciate that, at a given pH. individual intemucleotidic linkages along an oligonucleotide chain may be in an acid (H) form, or in one of a plurality of possible salts (e.g.. a sodium salt, or a salt of a different cation, depending on which ions might be present in the

[0139] 19

[0140] 12579081V1 088290.0210 preparation or composition), and will understand that, so long as their acid forms (e.g., replacing all cations, if any, with H+) are of the same constitution and / or structure, such individual oligonucleotides may properly be considered to be of the same constitution and / or structure.

[0141] One of skill in the art will appreciate that synthetic methods of the present disclosure provide for a degree of control during the synthesis of an oligonucleotide strand such that each nucleotide unit of the oligonucleotide strand can be designed and / or selected in advance to have a particular stereochemistry at the linkage phosphorus and / or a particular modification at the linkage phosphorus, and / or a particular base, and / or a particular sugar. In some embodiments, an oligonucleotide strand is designed and / or selected in advance to have a particular combination of stereocenters at the linkage phosphorus. In some embodiments, an oligonucleotide strand is designed and / or determined to have a particular combination of modifications at the linkage phosphorus. In some embodiments, an oligonucleotide strand is designed and / or selected to have a particular combination of bases. In some embodiments, an oligonucleotide strand is designed and / or selected to have a particular combination of one or more of the above structural characteristics. In some embodiments, the present disclosure provides compositions comprising or consisting of a plurality of oligonucleotide molecules (e.g., chirally controlled oligonucleotide compositions). In some embodiments, all such molecules are of the same type (i.e., are structurally identical to one another). In some embodiments, however, provided compositions comprise a plurality of oligonucleotides of different types, typically in pre-determined relative amounts.

[0142] As those skilled in the art will appreciate, methods and compositions described herein relating to provided compounds (e.g., ds oligonucleotides) generally also apply to pharmaceutically acceptable salts of such compounds.

[0143] Description of Certain Embodiments

[0144] Double stranded oligonucleotides are useful tools for a wide variety’ of applications. For example, ds oligonucleotides targeting INHBE (e g., NCBI Gene ID: 345275 for human INHBE and related sequences from other organisms) from are useful in therapeutic, diagnostic, and research applications, including the treatment of a variety of INHBE-associated conditions, disorders, and diseases, including but not limited to metabolic disorders, e.g.. metabolic syndrome, and related diseases, e.g., obesity, cardiovascular disease, diabetes, and hypertension. The use of naturally occurring nucleic acids (e.g., unmodified DNA or RNA) is

[0145] 20

[0146] 12579081V1 088290.0210 limited, for example, by their susceptibility' to endo- and exo-nucleases. As such, various synthetic counterparts have been developed to circumvent these shortcomings and / or to further improve various properties and activities. These include synthetic oligonucleotides that contain chemical modifications, e.g., base modifications, sugar modifications, backbone modifications, etc., which, among other things, render these molecules less susceptible to degradation and improve other properties and / or activities. From a structural point of view, modifications to intemucleotidic linkages can introduce chirality and / or alter charge, and certain properties may be affected by configurations of linkage phosphorus atoms of oligonucleotides. For example, binding affinity7, sequence specific binding to complementary7RNA, stability against nucleases, cleavage of target nucleic acids, delivery, pharmacokinetics, etc., can be affected by, inter aha, chirality7and / or charge of backbone linkage atoms.

[0147] INHBE

[0148] In some embodiments, INHBE refers to a gene or a gene product thereof (including but not limited to, a nucleic acid, including but not limited to a DNA or RNA, a transcript, a protein encoded thereby; can be from any form of INHBE, e.g., wide- t pe or mutant alleles) from any species. In some embodiments, it refers to the gene and product thereof in human. In some embodiments, it refers to the gene and product thereof in a non-human primate. Various INHBE sequences, including variants thereof, from human, mouse, rat, monkey, etc., are readily available to those of skill in the art. In some embodiments, INHBE is a human or mouse INHBE, which is wild-ty pe or mutant. It has been reported that INHBE can have a number of functions. Various technologies, e.g.. assays, cells, animal models, etc., have also been reported and can be utilized for characterization and / or assessment of provided technologies (e.g., oligonucleotides, compositions, methods, etc.) in accordance with the present disclosure.

[0149] In some embodiments, a INHBE gene, transcript (e.g., mRNA before or after splicing), or protein variant or isoform comprises a mutation. In some embodiments, a INHBE gene, transcript or protein is or a transcription or translation product of an alternatively spliced variant or isoform.

[0150] INHBE-Associated Conditions, disorders, or diseases

[0151] Various conditions, disorders, or diseases are reported to be associated with INHBE. Generally, a disease, disorder, or condition is associated with ttINHBE if the presence, level, activity7, and / or form of INHBE and / or products (e.g., transcripts, encoded proteins, etc.) thereof correlates with incidence of and / or susceptibility to the disease, disorder, or condition (e.g., across a relevant population). In some embodiments, a condition, disorder, or disease

[0152] 21

[0153] 12579081V1 088290.0210 associated with INHBE may be treated and / or prevented by reducing expression, level and / or activity of INHBE transcripts and / or proteins.

[0154] Various INHBE-associated conditions, disorders, or diseases are reported. In some embodiments, an INHBE-associated condition, disorder, or disease is that finds use in connection with the compositions and methods disclosed herein include, but are not limited to: improving glucose control: increasing lean body mass: reducing fat mass; a metabolic disorder; diabetes, e.g.. type 2 diabetes; insulin resistance; obesity; elevated triglyceride level; lipodystrophy; liver inflammation; fatty liver disease; hypercholesterolemia; an elevated liver enzyme; nonalcoholic steatohepatitis (NASH); a cardiovascular disease; coronary' artery' disease; cardiomyopathy; high blood pressure; heart failure; chronic kidney disease; and liver issues associated with increased fat mass, obesity, and / or diabetes.

[0155] Among other things, provided technologies are useful for treating or preventing a condition, disorder, or disease associated with INHBE, including, but not limited to, improving glucose control; increasing lean body mass; reducing fat mass; obesity, e.g., abdominal obesity'; a metabolic disorder; diabetes, e.g., type 2 diabetes; insulin resistance; coronary artery disease; chronic kidney disease; elevated triglyceride level; lipodystrophy; liver inflammation; fatty liver disease; hypercholesterolemia; an elevated liver enzyme; nonalcoholic steatohepatitis (NASH); a cardiovascular disease; coronary' artery disease; cardiomyopathy; high blood pressure; heart failure; chronic kidney disease; inducing lipolysis (fat-burning) while preserving muscle mass: and liver issues associated with increased fat mass, obesity, and / or diabetes.

[0156] In some embodiments, treatment or prevention with provided technologies reduces rate of INHBE production and reduces or halts or reverses accumulation of INHBE. In some embodiments, treatment or prevention with provided technologies increases the rate of weight loss or otherwise allows for control of body weight.

[0157] As appreciated by those skilled in the art, mechanisms, genotypes, symptoms, biomarkers, etc. of such conditions, disorders, or diseases may be utilized in accordance with the present disclosure to characterize / assess provided technologies.

[0158] Table 1. Example Double Stranded Oligonucleotides Targeting INHBE

[0159] 22

[0160] 12579081V1 088290.0210

[0161] Table 1A. Example Double Stranded Oligonucleotides Targeting INHBE

[0162] 23

[0163] 12579081V1 088290.0210

[0164] Table IB. Examples of Guide Sequences Targeting INHBE

[0165] 24

[0166] 12579081V1 088290.0210

[0167] Table 1C. Examples of Passenger Sequences Targeting INHBE

[0168] Table ID Table IE

[0169] Notes:

[0170] HELM notations, due to their length, may be divided into multiple lines in Table 1 (e.g., Tables 1A, IB, and 1C). As appreciated by those skilled in the art, nucleoside units are

[0171] 25

[0172] 12579081V1 088290.0210 unmodified unless otherwise indicated (e.g., with m, [H2r], etc.); linkages, unless otherwise indicated, are natural phosphate linkages; and acidic / basic groups may independently exist in their salts. If an intemucleotidic linkage is not specified, the intemucleotidic linkage is a natural phosphate linkage. A natural DNA sugar may also be indicated with "‘d” as in d(G), d(A), d(C), d(T), etc., and a natural phosphate linkage may be indicated with “p” in Table 1. Oligonucleotides in Table 1 are described using various features of Hierarchical Editing

[0173] Language for Macromolecules (HELM), which is described in, e.g.. Zhang. T. et al. J Chem Inf Model. 2012 Oct 22:52(10): 2796-806 and Milton, J. et al. J Chem Inf Model. 2017 Jun

[0174] 26;57(6): 1233-1239, which are incorporated herein by reference. As described in Zhang et al., 2012 and Milton et al.. 2017, connections between oligonucleotides, linker moieties, GalNAc moieties. etc. may be indicated in HELM, for example, as the following: CHEM1,RNA1.1:R1- 1 :R1, wherein CHEMI is, e.g., a first linker or moiety, RNA1 is an oligonucleotide, and 1:R1- 1:R1 indicates that CHEMI is linked via a first attachment point to a first attachment point on a first monomer of RNA1, as described herein (see, e.g., below). A double-stranded oligonucleotide may be indicated in HELM, for example, as the following: RNA1, wherein RNA1 is, e.g., a first oligonucleotide strand of a double-stranded oligonucleotide, and RNA2, wherein RNA2 is, e.g., a second oligonucleotide strand of the double-stranded oligonucleotide.

[0175] Various moieties and modifications (e.g., intemucleotidic linkages, sugars, nucleobases, etc.) are described in the present disclosure including the below: m: 2’-OMe (sugar is 2'-(?-methylribose);

[0176] [fl2r]: 2’-F (sugar is 2’-fluoro-2’-deoxyribose);

[0177] PO or p: phosphodiester or phosphate;

[0178] PS or [sp] : phosphorothioate;

[0179] Rp or [Rsp]: phosphorothioate in the Rp configuration;

[0180] .S'p or [Ssp] : phosphorothioate in the Sp configuration; -dimethylimidazolidin-2-ylidene)phosphoramidate);

[0181] [n001R]: nOOl in 7?p configuration;

[0182] [n001S]: nOOl in Sp configuration;

[0183] 26

[0184] 12579081V1 088290.0210 o

[0185] [ptz] : , (17 / -l,2,3-triazol-4-yl)phosphonate or 4-phosphono-l,2,3-triazol-l- yl, bonded to 5’-carbon of the 5’-end nucleoside;

[0186] [d5m]: 5'-deoxy-2'-G-methylribose;

[0187] [vped5m] : 5 ’ -(£)-viny Iphosph onate-5 ’ -deoxy -2 ’ -O-methylribose;

[0188] [GalNAc3C12oyl]: triantennary GalNAc with C12 linker.

[0189] (O bonded to linkage phosphorus); [GalNAc3C12oyl][nC6o] conjugated to the 5’-end of an oligonucleotide:

[0190] = oligonucleotide chain

[0191] 27

[0192] 1257908 Ivl 088290.0210

[0193] [nC6o]: NH (CH2)6_linker (C6 linker, C6 amine linker or C6 amino linker), connected to one moiety, e.g.. CHEM2 (e.g., [GalNAc3C12oyl]), through -NH- (e.g.. forming an amide group -C(O)-NH-), and, in various cases, the 5’-end of the oligonucleotide chain through a linkage (e.g., if the 5 ’-end of an oligonucleotide contains p, through a phosphate linkage (the end -CH2- bonded to an oxygen atom which is bonded to linkage phosphorus); if the 5’-end of an oligonucleotide contains [sp], through a phosphorothioate linkage (the end -CH2- bonded to an oxygen atom which is bonded to linkage phosphorus). [nC6o] may also be properly considered as 6-aminohexanol wherein, as indicated, its amino group forms an amide and its hydroxy forms a linkage such as a phosphate linkage.

[0194] Production of Oligonucleotides and Compositions

[0195] Various methods can be utilized for production of oligonucleotides and compositions and can be utilized in accordance with the present disclosure. For example, traditional phosphoramidite chemistry can be utilized to prepare stereorandom oligonucleotides and compositions, and certain reagents and chirally controlled technologies can be utilized to prepare chirally controlled oligonucleotide compositions, e.g., as described in US 9394333, US 9744183, US 9605019, US 9598458, US 9982257, US 10160969, US 10479995, US 2020 / 0056173, US 2018 / 0216107, US 2019 / 0127733, US 10450568, US 2019 / 0077817, US 2019 / 0249173. US 2019 / 0375774, WO 2018 / 223056, WO 2018 / 223073, WO 2018 / 223081, WO 2018 / 237194, WO 2019 / 032607, WO 2019 / 055951. WO 2019 / 075357, WO 2019 / 200185, WO 2019 / 217784, WO 2019 / 032612, and / or WO 2020 / 191252, the reagents and methods of each of which is incorporated herein by reference.

[0196] In some embodiments, chirally controlled / stereoselective preparation of oligonucleotides and compositions thereof comprise utilization of a chiral auxiliary, e.g., as part of monomeric phosphoramidites. Examples of such chiral auxiliary reagents and phosphoramidites are described in US 9394333, US 9744183, US 9605019, US 9598458, US 9982257, US 10160969, US 10479995, US 2020 / 0056173, US 2018 / 0216107, US 2019 / 0127733. US 10450568, US 2019 / 0077817, US 2019 / 0249173, US 2019 / 0375774. WO 2018 / 223056, WO 2018 / 223073, WO 2018 / 223081, WO 2018 / 237194, WO 2019 / 032607, WO 2019 / 055951, WO 2019 / 075357, WO 2019 / 200185, WO 2019 / 217784, WO 2019 / 032612, and / or WO 2020 / 191252, the chiral auxiliary' reagents and phosphoramidites of each of which are independently incorporated herein by reference. In some embodiments, a chiral auxiliaries). In

[0197] 28

[0198] 12579081V1 088290.0210 some embodiments, a chiral auxiliary is In some embodiments, a chiral auxiliary is In some embodiments, a chiral auxiliary comprises -SO2RAU, wherein RAUis an optionally substituted group selected from C1-20 aliphatic, C1-20 heteroaliphatic having 1-10 heteroatoms, C6-20 ary l, C6-20 arylaliphatic, C6-20 arylheteroaliphatic having 1-10 heteroatoms, 5-20 membered heteroaryl having 1-10 heteroatoms, and 3-20 membered heterocyclyl having 1-10 heteroatoms. In some embodiments, a chiral In some embodiments, RAUis optionally substituted aryl. In some embodiments, RAUis optionally substituted phenyl. In some embodiments. RAUis optionally substituted C1-6 aliphatic. In some embodiments, a chiral auxiliary is (PSM chiral auxiliaries). In some embodiments, utilization of such chiral auxiliaries, e.g., preparation, phosphorami dites comprising such chiral auxiliaries, intermediate oligonucleotides comprising such auxiliaries (which auxiliaries are typically bonded to linkage phosphorus through -O- of -OH, and -NH- are optionally capped, e.g., by -C(O)R), protection, removal, etc., is described in US 9394333. US 9744183. US 9605019, US 9598458, US 9982257, US

[0199] 10160969, US 10479995, US 2020 / 0056173, US 2018 / 0216107, US 2019 / 0127733, US

[0200] 10450568, US 2019 / 0077817, US 2019 / 0249173, US 2019 / 0375774, WO 2018 / 223056, WO 2018 / 223073, WO 2018 / 223081, WO 2018 / 237194. WO 2019 / 032607, WO 2019 / 055951, WO 2019 / 075357, WO 2019 / 200185, WO 2019 / 217784, WO 2019 / 032612. and / or WO 2020 / 191252 and incorporated herein by reference.

[0201] In some embodiments, chirally controlled preparation technologies, including oligonucleotide synthesis cycles, reagents and conditions are described in US 9394333, US 9744183. US 9605019. US 9598458. US 9982257. US 10160969, US 10479995, US 2020 / 0056173, US 2018 / 0216107, US 2019 / 0127733, US 10450568, US 2019 / 0077817, US 2019 / 0249173, US 2019 / 0375774, WO 2018 / 223056, WO 2018 / 223073, WO 2018 / 223081, WO 2018 / 237194, WO 2019 / 032607, WO 2019 / 055951, WO 2019 / 075357, WO 2019 / 200185, WO 2019 / 217784, WO 2019 / 032612, and / or WO 2020 / 191252, the oligonucleotide synthesis methods, cycles, reagents and conditions of each of which are independently incorporated herein by reference.

[0202] 29

[0203] 12579081V1 088290.0210

[0204] Once synthesized, ds oligonucleotides targeting INHBE and compositions are typically further purified. Suitable purification technologies are widely known and practiced by those skilled in the art, including but not limited to those described in US 9394333, US 9744183, US 9605019, US 9598458, US 9982257, US 10160969, US 10479995, US 2020 / 0056173, US 2018 / 0216107, US 2019 / 0127733, US 10450568, US 2019 / 0077817, US 2019 / 0249173, US 2019 / 0375774. WO 2018 / 223056, WO 2018 / 223073, WO 2018 / 223081, WO 2018 / 237194, WO 2019 / 032607, WO 2019 / 055951, WO 2019 / 075357. WO 2019 / 200185, WO 2019 / 217784, WO 2019 / 032612, and / or WO 2020 / 191252, the purification technologies of each of which are independently incorporated herein by reference.

[0205] In some embodiments, a cycle comprises or consists of coupling, capping, modification and deblocking. In some embodiments, a cycle comprises or consists of coupling, capping, modification, capping and deblocking. These steps are typically performed in the order they are listed, but in some embodiments, as appreciated by those skilled in the art, the order of certain steps, e.g., capping and modification, may be altered. If desired, one or more steps maybe repeated to improve conversion, yield and / or purity as those skilled in the art often perform in syntheses. For example, in some embodiments, coupling may be repeated; in some embodiments, modification (e.g., oxidation to install =0, sulfurization to install =S, etc.) may be repeated; in some embodiments, coupling is repeated after modification which can convert a P(III) linkage to a P(V) linkage which can be more stable under certain circumstances, and coupling is routinely followed by modification to convert newly formed P(III) linkages to P(V) linkages. In some embodiments, when steps are repeated, different conditions may be employed (e.g., concentration, temperature, reagent, time, etc.).

[0206] In some embodiments, oligonucleotides are linked to a solid support. In some embodiments, a solid support is a support for oligonucleotide synthesis. In some embodiments, a solid support comprises glass. In some embodiments, a solid support is CPG (controlled pore glass). In some embodiments, a solid support is polymer. In some embodiments, a solid support is polystyrene. In some embodiments, the solid support is Highly Crosslinked Polystyrene (HCP). In some embodiments, the solid support is hybrid support of Controlled Pore Glass (CPG) and Highly Cross-linked Polystyrene (HCP). In some embodiments, a solid support is a metal foam. In some embodiments, a solid support is a resin. In some embodiments, oligonucleotides are cleaved from a solid support.

[0207] Technologies for formulating provided oligonucleotides and / or preparing pharmaceutical compositions, e.g.. for administration to subjects via various routes, are readily available in the art and can be utilized in accordance with the present disclosure, e.g., those

[0208] 30

[0209] 12579081V1 088290.0210 described in US 9394333, US 9744183, US 9605019, US 9598458, US 9982257, US 10160969, US 10479995, US 2020 / 0056173. US 2018 / 0216107, US 2019 / 0127733, US 10450568, US 2019 / 0077817, US 2019 / 0249173, US 2019 / 0375774, WO 2018 / 223056, WO 2018 / 223073, WO 2018 / 223081, WO 2018 / 237194, WO 2019 / 032607, WO 2019 / 055951, WO 2019 / 075357, WO 2019 / 200185, WO 2019 / 217784, WO 2019 / 032612, and / or WO 2020 / 191252.

[0210] In some embodiments, provided oligonucleotides are manufactured with high stereoselectivity. In some embodiments, oligonucleotides are of high purity. In some embodiments, oligonucleotides are of high stereochemical purity. In some embodiments, oligonucleotides are of high diastereomeric purity' with respect to chiral linkage phosphorus. In some embodiments, diastereopurity of each linkage phosphorus in an oligonucleotide is independently about or at least about DS, wherein DS is about 85% or more. In some embodiments, DS is about 90% or more. In some embodiments, DS is about 95% or more. In some embodiments, DS is about 95%-100%. In some embodiments, DS is about 90% or more independently for each chiral linkage phosphorus. In some embodiments, DS is about 95% or more independently for each chiral linkage phosphorus. In some embodiments, DS is about 96% or more independently for each chiral linkage phosphorus. In some embodiments, DS is about 97% or more independently for each chiral linkage phosphorus. In some embodiments, DS is about 98% or more independently for each chiral linkage phosphorus. In some embodiments, DS is about 99% or more independently for each chiral linkage phosphorus. In some embodiments, diastereopurity of an oligonucleotide in a composition is about or at least about (DS)nc, wherein DS is about 85% or more, and nc is the number of linkage phosphorus in an oligonucleotide. In some embodiments. DS is about 90%, 91%, 92%, 93%, 94%, 95%, 96%. 97%. 98%. 99% or 99.5% or more. In some embodiments, DS is about 95% or more. In some embodiments, DS is about 96% or more. In some embodiments, DS is about 97% or more. In some embodiments, DS is about 98% or more. In some embodiments, DS is about 99% or more. In some embodiments, nc is about 1-30 (e.g., 1-20, 1-25, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22. 23. 24, 25, 26, 27, 28, 29, 30, etc.).

[0211] Characterization and Assessment

[0212] In some embodiments, properties and / or activities of ds oligonucleotides targeting INHBE and compositions thereof can be characterized and / or assessed using various technologies available to those skilled in the art. e.g., biochemical assays (e.g., RNase H assays), cell based assays, animal models, clinical trials, etc.

[0213] 31

[0214] 12579081V1 088290.0210

[0215] In particular embodiments, the purity of the oligonucleotides of the present disclosure is analyzed by Linear Ion Trap Mass Spectrometry (LTQ) and Ultra Performance Liquid Chromatography (UPLC). In certain embodiments, the oligonucleotides of the present disclosure have a UPLC purity of at least about 25%, at least about 40%, at least about 50%, or at least about 70%. In alternative embodiments, the oligonucleotides of the present disclosure have a UPLC purity of from about 20% to about 100%, from about 30% to about 90%. from about 40% to about 80%. or from about 50% to about 75%.

[0216] Methods of Preparing dsRNAi Agents

[0217] The dsRNAi agents of the present disclosure can be formed by an annealing process. This process begins by combining a guide strand and passenger strand in a mixing vessel and mixing the guide strand and passenger strand to form a dsRNAi agent solution. In certain embodiments, the guide strand and passenger strand are combined in the mixing vessel in equal molar quantities. In particular embodiments, the dsRNAi agent solution comprises a dsRNAi agent. The formation of the dsRNAi agent is confirmed by UPLC. In certain embodiments, UPLC additionally confirms there are no excess single oligonucleotide strands in the dsRNAi agent solution.

[0218] The dsRNAi agent solution is then filtered through a filter, resulting in filtrate. In certain embodiments, the filter is a 0.2-micron filter. The filtrate is lyophilized to form a lyophilized product, and the dsRNAi agent is isolated from the lyophilized product. In particular embodiments, a freeze drying tray is used for lyophilization. In certain embodiments, the resulting dsRNAi agent is white or off-white and a solid powder.

[0219] Treatment of INHBE-Associated Conditions, disorders, or diseases

[0220] In some embodiments, the present disclosure provides a ds oligonucleotide targeting INHBE, which targets INHBE and directs target-specific knockdown of INHBE. In some embodiments, the present disclosure provides methods for preventing and / or treating INHBE- associated conditions, disorders, or diseases using provided ds oligonucleotides targeting INHBE and compositions thereof. In some embodiments, the present disclosure provides oligonucleotides and compositions thereof for use as medicaments, e g., for INHBE-associated conditions, disorders, or diseases. In some embodiments, the present disclosure provides oligonucleotides and compositions thereof for use in the treatment of INHBE-associated conditions, disorders, or diseases. In some embodiments, the present disclosure provides oligonucleotides and compositions thereof for the manufacture of medicaments for the treatment of INHBE-associated conditions, disorders, or diseases.

[0221] 32

[0222] 12579081V1 088290.0210

[0223] In some embodiments, the present disclosure provides a method for treating and / or ameliorating one or more symptoms associated with an INHBE-associated condition, disorder, or disease in a mammal in need thereof, the method comprising administering to the mammal a therapeutically effective amount of a ds oligonucleotide targeting INHBE or a composition thereof. In some embodiments, the present disclosure provides a method for reducing susceptibility to an INHBE-associated condition, disorder, or disease in a mammal in need thereof, the method comprising: administering to the mammal a therapeutically effective amount of a ds oligonucleotide targeting INHBE or a composition thereof. In some embodiments, the present disclosure provides a method for preventing or delaying the onset of an INHBE-associated condition, disorder, or disease in a mammal in need thereof, the method comprising: administering to the mammal a therapeutically effective amount of a ds oligonucleotide targeting INHBE or a composition thereof. In some embodiments, the present disclosure provides a method for treating and / or ameliorating one or more symptoms associated with an INHBE-associated condition, disorder, or disease in a mammal in need thereof, the method comprising: administering to the mammal a therapeutically effective amount of a nucleic acid-lipid particle comprising a ds oligonucleotide targeting INHBE. In some embodiments, the present disclosure provides a method for reducing susceptibility to an INHBE-associated condition, disorder, or disease in a mammal in need thereof, the method comprising: administering to the mammal a therapeutically effective amount of a nucleic acid- lipid particle comprising a ds oligonucleotide targeting INHBE. In some embodiments, the present disclosure provides a method for preventing or delaying the onset of an INHBE- associated condition, disorder, or disease in a mammal in need thereof, the method comprising: administering to the mammal a therapeutically effective amount of a nucleic acid-lipid particle comprising a ds oligonucleotide targeting INHBE. In some embodiments, a mammal is a human. In some embodiments, a mammal is susceptible to, afflicted with and / or suffering from an INHBE-associated condition, disorder, or disease. In some embodiments, an INHBE- associated condition, disorder, or disease includes, but is not limited to, improving glucose control; increasing lean body mass; reducing fat mass; a metabolic disorder, e.g., a metabolic disease or dysregulation associated with obesity, type 2 diabetes, and / or coronary artery disease; diabetes, e.g., type 2 diabetes; insulin resistance; obesity; elevated triglyceride level; lipodystrophy; liver inflammation; fatty7liver disease; hypercholesterolemia; an elevated liver enzyme; nonalcoholic steatohepatitis (NASH); a cardiovascular disease; coronary artery disease; cardiomyopathy; high blood pressure; heart failure; chronic kidney disease; and liver issues associated with increased fat mass, obesity, and / or diabetes. In an exemplary

[0224] 33

[0225] 12579081V1 088290.0210 embodiment, infiltration of activated macrophages in visceral adipose is decreased, e.g., by at least 50%, e.g., up to 68% compared to PBS treatment. In an exemplary embodiment, said decreasing the infiltration of activated macrophages in visceral adipose leads to a strong suppression of adipose fibrosis.

[0226] In some embodiments, provided oligonucleotides and compositions are useful for preventing, treating, and / or improving: glucose control; increasing lean body mass; reducing fat mass; obesity, e.g., abdominal obesity; a metabolic disorder; diabetes, e.g., type 2 diabetes; insulin resistance; coronary artery disease; chronic kidney disease; elevated triglyceride level; lipodystrophy; liver inflammation; fatty liver disease; hypercholesterolemia; an elevated liver enzyme; nonalcoholic steatohepatitis (NASH); a cardiovascular disease; coronary artery disease; cardiomyopathy; high blood pressure; heart failure; chronic kidney disease; inducing lipolysis (fat-burning) while preserving muscle mass; and liver issues associated with increased fat mass, obesity, and / or diabetes.

[0227] In some embodiments, the provided ds oligonucleotides targeting INHBE and compositions may be optionally utilized in combination with one or more other therapeutic agents. In certain embodiments, the provided ds oligonucleotides and compositions thereof are used in combination with one or more of the following: a gastric and / or pancreatic lipase inhibitor; a norepinephrine agonist, a gamma-aminobutyric acid agonist, and / or a glutamate antagonist; an opioid receptor antagonist, a dopamine and norepinephrine reuptake inhibitor; a glucagon-like peptide 1 (GLP- 1) agonist; an melanocortin-4 receptor (MC4R) agonist; a gastric inhibitory polypeptide (GIP)ZGLP-l dual agonist; insulin; sulfonylurea; meglitinide; biguanide; thiazolidinedione; an alpha-glucosidase inhibitor; a SGLT2 inhibitor; a DPP4 inhibitor; aHMG-CoA reductase inhibitor, statins; a PCSK9 inhibitor; an ApoC3 inhibitor; an ANGPTL3 inhibitor; an ATP citrate lyase; ezetimide; an Lp(a) inhibitor; an LPL activator; and combinations thereof.

[0228] Administration of Oligonucleotides and Compositions

[0229] Many delivery methods, regimen, etc. can be utilized in accordance with the present disclosure for administering provided ds oligonucleotides and compositions thereof (typically pharmaceutical compositions for therapeutic purposes), including various technologies known in the art.

[0230] In some embodiments, an oligonucleotide composition, e.g., a ds oligonucleotide targeting INHBE composition, is administered at a dose and / or frequency lower than that of an otherwise comparable reference oligonucleotide composition and has comparable or improved

[0231] 34

[0232] 12579081V1 088290.0210 effects. In some embodiments, a chirally controlled oligonucleotide composition is administered at a dose and / or frequency lower than that of a comparable, otherwise identical stereorandom reference oligonucleotide composition and with comparable or improved effects, e.g., in improving the knockdown of the target transcript.

[0233] In some embodiments, the present disclosure recognizes that properties and activities, e.g., knockdown activity, stability, toxicity, etc. of oligonucleotides and compositions thereof can be modulated and optimized by chemical modifications and / or stereochemistry. In some embodiments, the present disclosure provides methods for optimizing oligonucleotide properties and / or activities through chemical modifications and / or stereochemistry. In some embodiments, the present disclosure provides oligonucleotides and compositions thereof with improved properties and / or activities. Without wishing to be bound by any theory, due to, e.g., their better activity, stability, delivery, distribution, toxicity, pharmacokinetic, pharmacodynamics and / or efficacy profiles, Applicant notes that provided oligonucleotides and compositions thereof in some embodiments can be administered at lower dosage and / or reduced frequency to achieve comparable or better efficacy, and in some embodiments can be administered at higher dosage and / or increased frequency to provide enhanced effects.

[0234] In some embodiments, the present disclosure provides, in a method of administering an oligonucleotide composition comprising a plurality' of oligonucleotides sharing a common base sequence, the improvement comprising administering an oligonucleotide comprising a plurality of oligonucleotides that is characterized by improved delivery relative to a reference oligonucleotide composition of the same common base sequence.

[0235] In some embodiments, provided oligonucleotides, compositions and methods provide improved delivery. In some embodiments, provided oligonucleotides, compositions and methods provide improved cytoplasmatic delivery. In some embodiments, improved delivery is to a population of cells. In some embodiments, improved delivery is to a tissue. In some embodiments, improved delivery is to an organ. In some embodiments, improved delivery is to an organism, e.g., a patient or subject. Example structural elements (e.g., chemical modifications, stereochemistry, combinations thereof, etc ), oligonucleotides, compositions and methods that provide improved delivery are extensively described in the present disclosure.

[0236] Various dosing regimens can be utilized to administer oligonucleotides and compositions of the present disclosure. In some embodiments, multiple unit doses are administered, separated by periods of time. In some embodiments, a given composition has a recommended dosing regimen, which may involve one or more doses. In some embodiments, a dosing regimen comprises a plurality of doses each of which are separated from one another

[0237] 35

[0238] 12579081V1 088290.0210 by a time period of the same length; in some embodiments, a dosing regimen comprises a plurality of doses and at least two different time periods separating individual doses. In some embodiments, all doses within a dosing regimen are of the same unit dose amount. In some embodiments, different doses within a dosing regimen are of different amounts. In some embodiments, a dosing regimen comprises a first dose in a first dose amount, followed by one or more additional doses in a second dose amount different from the first dose amount. In some embodiments, a dosing regimen comprises a first dose in a first dose amount, followed by one or more additional doses in a second (or subsequent) dose amount that is the same as or different from the first dose (or another prior dose) amount. In some embodiments, a chirally controlled oligonucleotide composition is administered according to a dosing regimen that differs from that utilized for a non-chirally controlled (e.g., stereorandom) oligonucleotide composition of the same sequence, and / or of a different chirally controlled oligonucleotide composition of the same sequence. In some embodiments, a chirally controlled oligonucleotide composition is administered according to a dosing regimen that is reduced as compared with that of a chirally uncontrolled (e.g.. stereorandom) oligonucleotide composition of the same sequence in that it achieves a lower level of total exposure over a given unit of time, involves one or more lower unit doses, and / or includes a smaller number of doses over a given unit of time. In some embodiments, a chirally uncontrolled oligonucleotide is administered according to a dosing regimen that extends for a longer period of time than does that of a chirally uncontrolled (e.g., stereorandom) oligonucleotide composition of the same sequence Without wishing to be limited by theory, Applicant notes that in some embodiments, the shorter dosing regimen, and / or longer time periods between doses, may be due to the improved stability, bioavailability, and / or efficacy of a chirally controlled oligonucleotide composition. In some embodiments, with their improved delivery (and other properties), provided compositions can be administered in lower dosages and / or with lower frequency to achieve biological effects, for example, clinical efficacy.

[0239] Pharmaceutical Compositions

[0240] When used as therapeutics, a provided oligonucleotide, e.g., a ds oligonucleotide targeting INHBE, or oligonucleotide composition thereof is typically administered as a pharmaceutical composition. In some embodiments, the present disclosure provides pharmaceutical compositions comprising a provided compound, e.g.. an oligonucleotide, or a pharmaceutically acceptable salt thereof, and a pharmaceutical carrier. In some embodiments, for therapeutic and clinical purposes, oligonucleotides of the present disclosure are provided

[0241] 36

[0242] 12579081V1 088290.0210 as pharmaceutical compositions. As appreciated by those skilled in the art, oligonucleotides of the present disclosure can be provided in their acid, base or salt forms. In some embodiments, oligonucleotides can be in acid forms, e.g., for natural phosphate linkages, in the form of -OP(O)(OH)O-; for phosphorothioate intemucleotidic linkages, in the form of -OP(O)(SH)O-; etc. In some embodiments, ds oligonucleotides targeting INHBE can be in salts, e.g., for natural phosphate linkages, in the form of -OP(O)(ONa)O- in sodium salts; for phosphorothioate intemucleotidic linkages, in the form of -OP(O)(SNa)O- in sodium salts; etc. Unless otherwise noted, oligonucleotides of the present disclosure can exist in acid, base and / or salt forms.

[0243] In some embodiments, a pharmaceutical composition is a liquid composition. In some embodiments, a pharmaceutical composition is provided by dissolving a solid oligonucleotide composition, or diluting a concentrated oligonucleotide composition, using a suitable solvent, e.g., water or a pharmaceutically acceptable buffer. In some embodiments, liquid compositions comprise anionic forms of provided oligonucleotides and one or more cations. In some embodiments, liquid compositions have pH values in the weak acidic, about neutral, or basic range. In some embodiments, pH of a liquid composition is about a physiological pH, e.g., about 7.4.

[0244] In some embodiments, a provided oligonucleotide is formulated for administration to and / or contact with a body cell and / or tissue expressing its target. For example, in some embodiments, a provided ds oligonucleotide targeting INHBE is formulated for administration to a body cell and / or tissue expressing INHBE. In some embodiments, such a body cell and / or tissue are a neuron or a cell and / or tissue of the central nervous system. In some embodiments, broad distribution of oligonucleotides and compositions may be achieved with intraparenchymal administration, intrathecal administration, or intracerebroventricular administration.

[0245] In some embodiments, the pharmaceutical composition is formulated for intravenous injection, oral administration, buccal administration, inhalation, nasal administration, topical administration, ophthalmic administration or optic administration. In some embodiments, the pharmaceutical composition is a tablet, a pill, a capsule, a liquid, an inhalant, a nasal spray solution, a suppository, a suspension, a gel, a colloid, a dispersion, a suspension, a solution, an emulsion, an ointment, a lotion, an eye drop or an ear drop.

[0246] Other features of certain embodiments will become apparent in the course of the following descriptions of exemplary embodiments, which are given for illustration and are not intended to be limiting thereof.

[0247] 37

[0248] 12579081V1 088290.0210

[0249] EXEMPLIFICATION

[0250] Certain examples of provided technologies (compounds (oligonucleotides, reagents, etc.), compositions, methods (methods of preparation, use, assessment, etc.), are described below.

[0251] EXAMPLE 1. Oligonucleotide synthesis

[0252] Various technologies for preparing oligonucleotides and oligonucleotide compositions (both stereorandom and chirally controlled) can be utilized in accordance with the present disclosure, including, for example, methods and reagents described in U.S. 9,394,333, U.S. 9,744,183, U.S. 9,605,019, U.S. 9,598,458, U.S. 9,982,257, U.S. 10,160,969, U.S. 10,479,995, U.S. 2020 / 0056173, U.S. 2018 / 0216107, U.S. 2019 / 0127733, U.S. 10.450,568, U.S. 2019 / 0077817, U.S. 2019 / 0249173, U.S. 2019 / 0375774, U.S. 2017 / 0037399, U.S. 2018 / 0216108, WO 2018 / 223056, WO 2018 / 223073, WO 2018 / 223081, WO 2018 / 237194, WO 2019 / 032607, WO 2019 / 055951, WO 2019 / 075357, WO 2019 / 200185, WO

[0253] 2019 / 217784, WO 2019 / 032612, WO 2020 / 191252. WO 2021 / 071858, WO 2017 / 062862, WO 2018 / 067973, WO 2017 / 160741, WO 2017 / 192679. WO 2017 / 210647, WO

[0254] 2018 / 098264, WO 2022 / 099159, W02023 / 201095, and WO 2024 / 182749. The methods and reagents of each of which are incorporated herein by reference. Stereorandom and chirally controlled guide strand sequences were prepared utilizing the synthetic procedures as exemplified in above mentioned disclosures. Respective passenger strands were designed to have covalently linked GalNAc moiety as delivery vehicle at either end of sequences. Oligonucleotides with 5 ’-GalNAc modifications were synthesized by coupling C6-amino modifier linker at the 5’-end of sequence. Oligonucleotides with 3’-GalNAc moiety as delivery vehicle were synthesized by utilizing 3’-C6 amino modified support. The single strand was cleaved from CPG by using deprotection condition as exemplified in earlier disclosures. The resulting amino group containing crude oligonucleotide was purified by ion exchange chromatography on AKTA pure system using a sodium chloride gradient. Desired product was desalted and further used for conjugation with GalNAc acid. After conjugation reaction was found to be complete the material was further purified by ion exchange chromatography and desalted to achieve desired material. For introduction of PN linkages in guide and passenger strands, specific PN coupling cycles were introduced at desired positions in oligonucleotide sequence utilizing the conditions as exemplified in WO2019 / 200185.

[0255] 38

[0256] 12579081V1 088290.0210

[0257] In certain embodiments, oligonucleotides were prepared using suitable chiral auxiliaries, e.g., DPSE and PSM chiral auxiliaries. Various oligonucleotides, e.g.. those in Table 1, and compositions thereof, were prepared in accordance with the present disclosure.

[0258] Various technologies can be utilized to assess properties and / or activities of provided oligonucleotides and compositions thereof. Some such technologies are described in this Example. Those skilled in the art appreciate that many other technologies can be readily utilized. As demonstrated herein, provided oligonucleotides and compositions, among other things, can be highly active, e.g., in reducing levels of their target nucleic acids.

[0259] Abbreviation

[0260] IX reagent: TEA-3HF : TEA : H2O : DMSO = 5.0 : 1.8 : 15.5 : 77.7 (v / v / v / v)

[0261] ACN: acetonitrile

[0262] ADIH: 2-azido-l,3-dimethylimidazolium hexafluorophosphate

[0263] CMIMT: A-cyanomethylimidazolium triflate

[0264] CPG: controlled pore glass

[0265] DCM: dichloromethane, CH2CI2

[0266] DIPEA: diisopropylethylamine

[0267] DMSO: dimethylsulfoxide

[0268] DMTr: 4,4'-dimethoxytrityl

[0269] GalNAc: A'-acetylgalactosamine

[0270] HF : hydrogen fluoride

[0271] HATU: l-[bis(dimethylamino)methylene]-lE7-l,2,3-triazolo[4,5-b]pyridinium 3-oxide hexafluorophosphate

[0272] IBN: isobutyronitrile

[0273] MeCN: acetonitrile

[0274] Melm: V-methyl imidazole

[0275] PC: propylene carbonate

[0276] TCA: trichloroacetic acid

[0277] TEA: triethylamine

[0278] THF: tetrahydrofuran

[0279] XH: xanthane hy dride

[0280] General procedure for the synthesis of chiral oligos:

[0281] 39

[0282] 12579081V1 088290.0210

[0283] The automated solid-phase synthesis of chiral-oligos was performed according to the cycles shown in Table 2 (regular amidite cycle, for PO linkages (e.g., natural phosphate linkages in oligonucleotides in Table 1)), Table 3 (PSM / DPSE amidite cycle, for chiral PS linkages (e.g., phosphorothioate intemucleotidic linkages in oligonucleotides in Table 1), and Table 4 (PSM amidite cycle, for chiral PN linkages (e.g., nOOl intemucleotidic linkages in oligonucleotides in Table 1)).

[0284] Table 2. Regular amidite synthetic cycle for PO linkages step operation reagents and solvent equiv. time

[0285] 1 detritylation 3% DCA in toluene * *

[0286] , .. 0.2M Amidite in MeCN 2.5 eq.

[0287] 2 coupling „T, , _no8 mm

[0288] '&0.5M CMIMT in MeCN 13.3 eq.

[0289] 3 oxidation 50mM E in pyridine / EEO (9 / 1. v / v) 2 eq. 2 min

[0290] . _ Ac2O / 2,6-lutidine / MeCN (2 / 3 / 5,n.

[0291] 4 cap

[0292] F-2 , , . \ 25 eq. 0.8 mm v / v / v) NMI / MeCN (2 / 8. v / v)4

[0293] * Complete DMTr removal is ensured by inline UV monitoring.

[0294] Table 3. PSM / DPSE amidite synthetic cycle for chiral PS linkages step operation reagents and solvent equiv. time

[0295] 1 detritylation 3% DCA in toluene * *

[0296] _ 0 2M Amidite in MeCN 2 5 e 0.5M CMIMT in MeCN 10.2 eq.

[0297] _ . Ac2O / 2,6-lutidine / MeCN (2 / 3 / 5, .

[0298] 3 cap-1 , , . 25 eq. 0.8 mm v / v / v)

[0299] 4. su illrun •zation 0.1M XH in MeC , N , / pvridine (1 / 1. J .5 eq. 2.2 mm • v / v) z „ Ac2O / 2,6-lutidine / MeCN (2 / 3 / 5,A O.

[0300] 5 cap1-2 v / ,v / ,v .) NMI / MeCN (2: 08. v / / v \) 25 eqM. 0.8 min

[0301] * Complete DMTr removal is ensured by inline UV monitoring.

[0302] Table 4. PSM Amidite Synthetic Cycle for chiral PN linkages step operation reagents and solvent equiv. time

[0303] 1 detritylation 3% DCA in toluene * *

[0304] _ 0.2M Amidite in MeCN 2.5 eq.o

[0305] 2 coup1ling&A 0.5.-M» < r C-Mx oIMvi-Tr i 'n M , eCN 10.2 _ eq.8 1Tlin

[0306] 40

[0307] 12579081V1 088290.0210

[0308] Ac2O / 2 6-lutidine / MeCN (2 / 3 / 5

[0309] General procedure for the C&D conditions:

[0310] After completion of the synthesis, crude oligonucleotide on the solid support was treated on column with 20% DEA in MeCN (500 eq., 15min), then washed with MeCN. The CPG solid support was dried and transferred into an appropriately sized pressure-rated vessel. The CPG w as treated with DS-1 reagent (100 mL / mmol) for 3 h at 28°C, then added cone. NFL (200 mL / mmol) for 24 h at 37°C. The reaction mixture was cooled to room temperature and the CPG was separated by membrane filtration, washed with FLO. The crude material (filtrate) was analyzed by LTQ and RP-UPLC.

[0311] General procedure for the purification conditions;

[0312] The crude sense and antisense strands were purified separately by AEX chromatography. The purification run was performed using sodium hydroxide eluents. A sodium chloride gradient was used to elute the oligonucleotide from the column. The elution profile was monitored by UV spectrophotometry, and the selected fraction pool (sense or antisense strand) was then concentrated and diafiltered against purified water to remove the purification buffer by TFF. The UF / DF process proceeded as follows, the selected pool of fractions was neutralized with sodium phosphate monobasic solution and then concentrated to a target concentration. The concentrated oligonucleotide was diafiltered against purified w ater before final concentration to the target concentration and collected.

[0313] Table 5. Purity of oligonucleotides

[0314] General procedure for the annealing to form duplex:

[0315] 41

[0316] 12579081V1 088290.0210

[0317] The duplex was formed by combining equal molar quantities of the sense and antisense strands with mixing in an appropriately sized vessel. The formation of the duplex was confirmed by UPLC that there was no excess of single strands. The duplex oligonucleotide solution was filtered through a 0.2-micron filter and then placed in freeze drying tray for lyophilization. After lyophilization, the duplex was isolated as a white to off-white solid powder.

[0318] List of abbreviations

[0319] 42

[0320] 12579081V1 088290.0210

[0321] General procedure for the 5’-phosphonate deprotection conditions (25 mmole):

[0322] To prepare TMSI solution for 5 ’-phosphonate deprotection, pyridine (0.5 mL) was added to DCM (23.9 mL) and the resulting solution was cooled in ice-bath for 15 minutes. After that TMSI reagent (0.6 mL) was added to the mixture to get a bright yellow solution (total volume 25.0 mL). TMSI quenching solution (50 mL) was prepared by adding 2-Dodecane thiol (12.0 mL) and TEA (18.0 mL) in acetonitrile (18.0 mL).

[0323] After completion of the synthesis, the CPG solid support was dried and transferred into 50 mL plastic tube. Minimum amount of DCM was added to 5 '-Phosphonate containing oligonucleotide on CPG and the CPG was vortexed to get a homogenous slurry. To this homogenous slurry, the TMSI solution (10.0 mL) was added slowly and mixed well. After the addition of total TMSI solution the color of the reaction mixture turns yellow indicating excess of TMSI solution. The resulting reaction mixture was stirred for 30 minutes at room temperature. After 30 min. the support was promptly washed using excess of acetonitrile followed by addition of quenching solution ( 10.0 mL) and this process was repeated three times (Total quenching volume 30.0 mL). The total time of exposure was limited to 20 min. The CPG was rinsed thoroughly using acetonitrile and dry ing under vacuum. Afterwards, CPG was subjected to standard cleavage and deprotection condition.

[0324] Among other things, the following materials were utilized or are useful for preparing SSR-0108051 and SSR-0108323:

[0325] 43

[0326] 12579081V1 088290.0210

[0327] 44

[0328] 12579081V1 088290.0210

[0329] Example 1A. Example procedure for preparation of oligonucleotide compositions (general cycle)

[0330] In some embodiments, preparations include one or more DPSE and / or PSM cycles.

[0331] A number of oligonucleotide compositions were synthesized and assessed, including, e.g., those in the Figures and Tables.

[0332] As described and confirmed herein, technologies of the present disclosure are useful for preparing various compositions of oligonucleotides comprising various structural features at various scales (e.g., 1 pmol, 5 pmol, or 50 pmol). It is understood that certain parameters will be modified based on the scale, e.g., volumes or equivalents. In some embodiments, as confirmed herein, provided technologies, e.g., those utilizing chiral auxiliaries comprising electron-withdrawing groups (e.g., RC11comprising electron-withdrawing groups (e.g., -SO2R131, -C(O)RC1, etc.)) are particularly useful for preparing chirally controlled compositions of oligonucleotides comprising 2’-OH sugars (e.g., sugars with R2s= OH, such as sugars typically found in natural RNA), particularly when such sugars are bonded to chirally controlled intemucleotidic linkages.

[0333] The resulting oligonucleotides can undergo an annealing step to form a duplex.

[0334] Example IB. Example procedure for preparation of oligonucleotide compositions (1 pmol scale)

[0335] 45

[0336] 12579081V1 088290.0210

[0337] Certain stereopure oligonucleotides were synthesized at 1 pmol scale using a MerMadel92 synthesizer and universal CPG. In some embodiments, an amidite approach was used to incorporate GalNAc on the 5’ end. Generally, cyanoethyl amidites were used to prepare the PO linkages, DPSE amidites for the PS linkages, and PSM amidites for the PN linkages. A typical MerMadel92, 1 pmol cycle is outlined in the table below:

[0338] Approx.

[0339] Step Operation Reagents and Solvent Volume

[0340] Total Time

[0341] 1 Detritylation 3% dichloroacetic acid in toluene 5 x 225 L 6.5 min

[0342] 95 pL / 110

[0343] Double 0.1 M phosphoramidite in combinations of 6 min (per

[0344] Coupling ACN / IBN / PC / DMF and 0.5M CMIMT in ACNM, coupling) coupling)

[0345] „ 80% THF / 10% 2,64utidine / 10% acetic „„„ , „

[0346] 3 Cap 1 , , . , 200 pL 1.5 min anhydride

[0347] Oxidation 0.02M iodine in 70% THF / 20% pyridine / 10% „„„ , „

[0348] 200 pL 1.5 min

[0349] (PO) waterM

[0350] 4 Sulfurization 0.1 M xanthane hydride in 50% pyridine / 50% _ _ „ .

[0351] 200 pL 6.5 min

[0352] (PS) ACNM

[0353] PN 0.3M ADIH in ACN 200 pL 7 min

[0354] _ _ 80% THF / 10% 2,6-lutidine / 10% acetic 100 pL /

[0355] 5 Cap 2 an .hyd.r.id.e and . 16% n-met .hylimidazole in THi rF. „ 10 _0 p _L 1.5 min

[0356] The first step of deprotection was performed on the synthesizer. 200 pL of 20% diethylamine in ACN was added to the column for 3 x 6 min followed by washing with ACN and drying. CPG was transferred to a container and 250 pL of fluoride solution was added. The fluoride solution consisted of dimethylformamide, water, tri ethylamine trihydrofluoride, and triethylamine (15.5 / 3.1 / 1.0 / 1.8 volume ratio). After about 4 hours at room temperature, approximately 375 pL of 30% ammonium hydroxide was added, and the reaction incubated at 37 °C overnight. The CPG was filtered and washed with water and the filtrate collected.

[0357] The oligonucleotides were purified by anion exchange purification at room temperature. The oligonucleotide was loaded onto a column packed with Source Q15 resin after equilibration with a 20 mM sodium hydroxide in 20% acetonitrile mobile phase. The purified oligonucleotide was eluted using a mobile phase of 20 mM sodium hydroxide and 2.5 M sodium chloride in 20% acetonitrile. The desired fraction was desalted using a G-25 Sephadex column against water for injection. Desalted samples were dried, reconstituted and analyzed.

[0358] A useful protocol for GalNAc conjugation is described below as an example.

[0359] 46

[0360] 12579081V1 088290.0210

[0361] = oligonucleotide chain

[0362] For example, pre-conjugation oligonucleotide chain can be represented by the following structure.

[0363] The tri-antennary GalNAc acid (hydroxyl groups protected as -OAc) can be represented by the following structure The tri-antennary GalNAc acid (hydroxyl groups protected as -OAc) and HATU were weighed out in a 50 mL plastic tube and dissolved in anhydrous acetonitrile then DIEA was added into the tube. The resulting mixture was stirred for 10 min at 37 °C. Lyophilized pre-

[0364] 47

[0365] 1257908 Ivl 088290.0210 conjugation oligo sequence was reconstituted in water in a separate tube and the GalNAc mixture was added to the oligonucleotide solution and stirred for 60 min at 37 °C. The reaction was monitored by RP-UPLC. Reaction was complete in 1 hr. The reaction mixture was concentrated under vacuum to remove the acetonitrile and the resultant GalNAc-conjugated oligonucleotides is treated with cone, ammonia for 2 hr at 37°C. The formation of final product was confirmed by mass spectrometry and RP-UPLC. The conjugated material was purified by anion exchange chromatography and desalted using tangential flow filtration (TFF) to obtain the final product.

[0366] Additional chemical moieties can also be installed by coupling with phosphoramidites comprising such additional chemical moieties (and optional linkers), e.g., phosphoramidites comprising GalNAc such as those described in Example 1C. Additional technologies for preparing oligonucleotides are illustrated below as examples.

[0367] Example 1C. Example procedure for preparation of oligonucleotide compositions (50 junol scale)

[0368] Certain stereopure oligonucleotides were synthesized at 50 pmol scale using a MerMadel2 synthesizer and standard CPG. In some embodiments, an amidite approach was used to incorporate GalNAc on the 5' end. Generally, cyanoethyl amidites were used to prepare the PO linkages and DPSE amidites for the PS linkages. A typical MerMadel2. 50 pmol cycle is outlined in the table below:

[0369] Step Operation Reagents and Solvent Volume Totd Time

[0370] 4 x 4 5

[0371] 1 Detritylation 3% dichloroacetic acid in toluene ' 4-5 min

[0372] Single 0.15M phosphorami dite in combinations of 1.5 mL /

[0373] 2Coupling ACN / IBN / PC and 0.5M CMIMT in ACN 2.25 mL6 mm

[0374] Sulfurization 0. IM xanthane hydride in 50% pyridine / 50% ,T, .

[0375] (PS) ACN6 n,L 6 m,n

[0376] 80% THF / 10% 2,6-lutidine / 10% acetic 2.5 mL / . anhydride and 16% n-methylimidazole in THF 2.5 mL111111

[0377] 48

[0378] 12579081V1 088290.0210

[0379] In some embodiments, an amidite approach was used to incorporate GalNAc on the 5’ end. The GalNAc amidite. or tri-antennary GalNAc-acetyl derivative C6 phosphorami dite, can be represented by the following structure. See, e.g., W02023 / 201095 (Paragraph [001468])

[0380] The GalNAc amidite was added either as a single coupling for 8-12 minutes using a 0.2M amidite solution or a double coupling , 10 min each, using a 0.1M solution. For each coupling, 1.5 mL of GalNAc amidite and 2.25 mL of CMIMT in ACN were added.

[0381] The first step of deprotection was performed on the synthesizer. 6 mL of 20% di ethylamine in ACN was added to the column for 10 min followed by washing with ACN and drying. CPG was transferred to a tube and 5 mL of fluoride solution was added. The fluoride solution consisted of dimethylsulfoxide, water, triethylamine trihydrofluoride, and triethylamine (15.5 / 3.1 / 1.0 / 1.8 volume ratio). After about 1 hour at room temperature, approximately 10 mL of 30% ammonium hydroxide was added, and the reaction incubated at 37 °C overnight. The CPG was filtered off and washed with water and the filtrate collected.

[0382] The oligonucleotides were purified by anion exchange purification at room temperature. The oligonucleotide was loaded onto a column packed with Source Q15 resin after equilibration with 20 m sodium hydroxide in water. The purified oligonucleotide was eluted as fractions by gradient elution with a mobile phase of 20 mM sodium hydroxide and 2.5 M sodium chloride in water. Fractions were analyzed, pooled to the desired purity and desalted using a G-25 Sephadex column against water for injection. Desalted samples were dried, reconstituted and sterile filtered prior to final analysis.

[0383] 49

[0384] 1257908 Ivl 088290.0210

[0385] EXAMPLE 2. Provided Oligonucleotides and Compositions Are Active in vivo

[0386] In vivo determination of mouse INHBE siRNA activity: All animal experiments were performed at Biomedical Research Models, Ins. Dba Biomere (Worcester, MA) under an approved protocol and in compliance with Biomere’ s Institutional Animal Care and Use Committee guidelines for care and use of animals. Mice were on a 12-hour light-dark cycle. Food (LabDiet 5R58) and water were available ad libitum. Housing rooms were maintained at 20-26°C and relative humidity was 30-70%. The animals in this experiment were C57BL / 6j males, between 24-30 weeks of age. The mice were dosed at lOmg / kg with DSR-0104212 on day 0 by subcutaneous administration. There were 8 mice per group per necropsy timepoint. Animals were euthanized after overnight fasting on day 14, day 28, or day 56 by CO2 asphyxiation followed by thoracotomy and terminal blood collection. After cardiac perfusion with PBS, liver punches were harvested and flash-frozen on dry ice, and the remaining liver was flash frozen in foil using liquid nitrogen. Liver total RNA was extracted using SV96 Total RNA Isolation kit (Promega), after tissue lysis with TRIzol and bromochloropropane. cDNA production from RNA samples were performed using High-Capacity cDNA Reverse Transcription kit (Thermo Fisher) following manufacturer’s instructions and qPCR analysis performed in CFX System using iQ Multiplex Powermix (Bio-Rad). For mouse INHBE mRNA, the following qPCR assay was utilized: Thermofisher Taqman qPCR assay ID Mm03023993_ml. Mouse HPRT was used as normalizer (IDT Mm.PT.39a.22214828). Oligonucleotide accumulation in the liver was determined by hybrid ELISA, and the results are summarized in Table 6.

[0387] Table 6 shows % mouse INHBE mRNA remaining relative to PBS control in the liver 14. 28. and 56 days post dosing. N = 8. N.D.: Not determined.

[0388] 50

[0389] 12579081V1 088290.0210

[0390] EXAMPLE 3. Provided oligonucleotides are active in vivo

[0391] In vivo determination of mouse INHBE siRNA activity: All animal experiments were performed at Biomedical Research Models, Ins. Dba Biomere (Worcester, MA) under an approved protocol and in compliance with Biomere’ s Institutional Animal Care and Use Committee guidelines for care and use of animals. Mice were on a 12-hour light-dark cycle. Food (Research Diet D12492i) and water were available ad libitum. Housing rooms were

[0392] 51

[0393] 12579081V1 088290.0210 maintained at 20-26°C and relative humidity was 30-70%. The animals on study were males 34-35 weeks of age C57BL / 6NTac mice on 60% high fat diet. Mice were dosed with either 10 nmol / kg semaglutide, 10 mg / kg DSR-0104212, or both 10 nmol / kg semaglutide and 10 mg / kg DSR-0104212 by subcutaneous administration. There were seven groups for this experiment consisting of 10 mice per group, as summarized in Table 7. Group 1 was dosed with PBS on day 0, 14, 28, 42, 56, and 70. Group 2 was dosed with PBS daily for 28 days. Group 3 was dosed with 10 mg / kg DSR-0104212 on day 0. 14. 28. 42. 56. and 70. Group 4 was dosed with 10 mg / kg DSR-0104212 on day 0, 28, 56, and 70. Group 5 was dosed with 10 nmol / kg semaglutide daily for 28 days. Group 6 was dosed with 10 nmol / kg semaglutide daily for 28 days followed with 10 mg / kg DSR-0104212 on day 28, 42, 56, and 70. Group 7 was dosed with PBS on day 0 followed with 10 mg / kg DSR-0104212 on day 28, 42, 56, and 70. Food consumption and body weights were captured twice a week from the start until the end of study. Changes in the body weight relative to the control are plotted in Figure 1. Animals were euthanized on day 84 by CO2 asphyxiation followed by thoracotomy and terminal blood collection. After cardiac perfusion with PBS, liver, white adipose tissues (epidi dymal. inguinal, and mesenteric), intrascapular brown adipose tissue, quadriceps, tibialis anterior, and the gastrocnemius were collected and weighed. Liver punches were harvested and flash-frozen on dry ice, and the remaining liver were flash frozen in foil using liquid nitrogen. White adipose tissues, intrascapular brown adipose tissue, quadriceps, tibialis anterior, and the gastrocnemius were collected into 10% neutral buffered formalin. Liver total RNA was extracted using SV96 Total RNA Isolation kit (Promega), after tissue lysis with TRIzol and bromochloropropane. cDNA production from RNA samples were performed using High-Capacity cDNA Reverse Transcription kit (Thermo Fisher) following manufacturer’s instructions and qPCR analysis performed in CFX System using iQ Multiplex Powermix (Bio-Rad)). For mouse INHBE mRNA, the following qPCR assay were utilized: Thermofisher Taqman qPCR assay ID Mm03023993_ml. Mouse HPRT was used as normalizer (IDT Mm.PT.39a.22214828). Oligonucleotide accumulation in the liver is determined by hybrid ELISA. Table 8 shows % mouse INHBE mRNA remaining relative to PBS control in the liver 84 days post dosing.

[0394] Table 7. Study Design

[0395] 52

[0396] 12579081V1 088290.0210

[0397] Table 8. N = 10. N.D.: Not determined.

[0398] 53

[0399] 12579081V1 088290.0210

[0400] EXAMPLE 4. Provided Oligonucleotides and Compositions Are Active in vivo

[0401] In vivo determination of mouse INH BE siRNA activity: All animal experiments were performed at Biomedical Research Models, Ins. Dba Biomere (Worcester, MA) under an approved protocol and in compliance with Biomere’ s Institutional Animal Care and Use Committee guidelines for care and use of animals. Mice were on a 12-hour light-dark cycle. Food (Research Diet D12492i) and water were available ad libitum. Housing rooms were maintained at 20-26°C and relative humidity was 30-70%. The animals in this experiment were diet induced obesity C57BL / 6Ntac males, 25 weeks of age. There were 6 mice per group per necropsy timepoint. The mice were dosed with DSR-0104212 at 3 or 10 mg / kg on Day 0 by subcutaneous administration. Body weights were captured once a week. Changes in body weight relative to initial body weight are plotted in Figure 2A. Animals were euthanized after overnight fasting on Day 14, Day 28, or Day 56 by CO2 asphyxiation follow ed by thoracotomy and terminal blood collection. After cardiac perfusion with PBS, liver, white adipose tissues (epididymal and inguinal), quadriceps, tibialis anterior, and the gastrocnemius were collected. The white adipose tissues, quadriceps, tibialis anterior, and the gastrocnemius were all weighed post dissection. Tissue weights are depicted in Figure 2B. Liver punches were harvested and flash-frozen on dry ice, and the remaining liver was flash frozen in foil using liquid nitrogen.

[0402] 54

[0403] 12579081V1 088290.0210

[0404] Liver total RNA was extracted using SV96 Total RNA Isolation kit (Promega), after tissue lysis with TRIzol and bromochloropropane. cDNA production from RNA samples were performed using High-Capacity cDNA Reverse Transcription kit (Thermo Fisher) following the manufacturer’s instructions, and qPCR analysis was performed in CFX System using iQ Multiplex Powermix (Bio-Rad). For mouse INHBE mRNA, the following qPCR assay were utilized: Thermofisher Taqman qPCR assay ID Mm03023993_ml. Mouse HPRT was used as normalizer (IDT Mm.PT.39a.22214828). Oligonucleotide accumulation in liver was determined by hybrid ELISA. Serum lipid profile was measured at Charles River Laboratories. Serum was also collected for additional in-house analysis. Preclinical data demonstrated no loss of muscle mass and a reduction in fat mass with preferential effects on visceral fat, consistent with the profile of INHBE loss-of-function (LoF) carriers in human genetics. Table 9 shows % mouse INHBE mRNA remaining relative to PBS control in the liver 14 days, 28 days and 56 days post dosing.

[0405] Table 9. N = 6. N.D.: Not determined.

[0406] 55

[0407] 12579081V1 088290.0210

[0408] EXAMPLE 5. Quantitative assessment of chronic inflammation and fibrosis in epididymal WAT IHC was performed on formalin fixed paraffin embedded (FFPE) white adipose tissue

[0409] (WAT sections (4um thickness) obtained from the protocol as described in Example 4, using VENTANA BenchMark Ultra automated staining instrument (Ventana Medical Systems), using VENTANA reagents as mentioned. Briefly, FFPE sections were baked in 60°C oven for 1 h to deparaffmize. Epitope retrieval was accomplished with CC1 solution at 95°C for either 32 minutes or 64 minutes. Sections were incubated with different primary7antibodies: CDl lb

[0410] IHC (Abeam abl33357), CD11c IHC (CST 97585S, Lot 6), CD68 IHC (Abeam abl25212, Lot 1038168-4), CD163 (Abeam abl82422. Lot 100124-40), CD80 (Abeam ab254579. Lot 1085860-4) and F4 / 80 (CST 700078S, Lot 9) for one hour. Then, the sections were incubated with Anti-Rb HRP secondary7antibody for 16 minutes, followed by incubation with hematoxylin for 16m to help visualize nuclei and adipose tissue cell membranes. For bright field detection, slides were developed using the VENTANA ultraview Universal DAB detection kit according to the manufacturer’s instructions. After removal from the Ventana Ultra, the slides were washed in Dawn / tap water to remove LCS (liquid cover slip) and run down to xylene and coverslipped with Statlab ClearMount for viewing.

[0411] 56

[0412] 12579081V1 088290.0210

[0413] Statlab Trichrome One-Step Blue and Red Stain Kit (Statlab KTTRBPT) was used for Masson’s Tri chrome staining. FFPE slides were deparaffinized, rinsed in 100% ethanol, and then running tap water. Slides were kept overnight for 18 hours at room temperature in Bonin’ s Fixative. After 3 minute of washing in tap water, slides were immersed in Modified Mayer’s Hematoxylin for 7 minutes. After another 3-minute wash the slides were immersed in One Step Trichrome stain for 3 minutes (RT). After a 5 second wash in tap water, the slides were dehydrated and cleared and coverslipped with Permanent Mounting Media.

[0414] After staining, whole slide scanning was performed using an Axio Scan.Zl slide scanner (Zeiss, Jena, Germany). Slides were loaded into the scanner tray and scanned using a Plan-Apochromat 20x objective (Zeiss). Images were captured with a Hitachi HV-F203SCL camera with brightfield contrast. The scanned images were visualized using Zen Blue software (Zeiss). Following scanning, the images (czi files) were imported into the HALO software v3.0 (Indica Labs, Corrales, NM) for quantitative analysis. The images were first annotated manually, and nonspecific signals, folded regions, uneven areas, and tissue edge artifacts were eliminated using pen tools. The default area quantification module v2. 1.3 was selected and optimized accordingly to calculate the percentage area of positive staining for each antibody (CD68, CDl lb, CDl lc, CD163, and F4 / 80). Similarly, it categorized trichrome-stained pixels in the same manner, using the same user-defined threshold. The optimized area quantification algorithm identified and categorized each antibody-stained pixel as high, medium, or low based on a user-defined threshold. The data presented in the graph represents the summation of these three stratified pixel values, expressed as percentage of positive area for each antibody.

[0415] All IHC data were analyzed with GraphPad Prism version 9.4 and presented as means ± SEM (*P < 0.05). For multiple comparisons, analysis of variance (ANOVA) followed by the Tukey’s post hoc testing or Kruskal-Wallis test followed by Dunn’s multiple comparison test was used. All samples or animals were included in the statistical analysis.

[0416] Semiquantitative assessment of positive immunochemical reactions were made by a Board-certified veterinary pathologist. The number of brown-staining cells in each of ten high- powered (400X) microscope (Olympus BX45) fields was recorded into an Excel spreadsheet, then averaged to obtain an average for each animal. Fields from each section of tissue on each slide were counted (typically 3 sections). The group average was obtained by averaging the animals within a group.

[0417] As shown in Figure 6A, siRNA-mediated INHBE lowering according to the present disclosure decreases %CD68-positive area in DIO mouse adipocytes, wherein infiltration of activated macrophages in visceral adipose was decreased by up to 68% compared with controls.

[0418] 57

[0419] 12579081V1 088290.0210

[0420] As shown in Figure 6B, siRNA-mediated INHBE lowering according to the present disclosure decreased total macrophage recruitment in epididymal white adipose tissue (epiWAT) of DIO mice, as measured by %F4 / 80-positive area in DIO mouse epiWAT.

[0421] As shown in Figure 6C, siRNA-mediated INHBE lowering according to the present disclosure decreased pro-inflammatory macrophage recruitment in epididymal white adipose tissue (epiWAT) of DIO mice, as measured by %CD1 Ic-positive area in DIO mouse epiWAT.

[0422] As shown in Figure 6D. siRNA-mediated INHBE lowering according to the present disclosure did not affect anti-inflammatory macrophage recruitment into epididymal white adipose tissue (epiWAT) of DIO mice, as measured by %CD163-positive area in DIO mouse epiWAT.

[0423] As shown in Figure 6E. siRNA-mediated INHBE lowering according to the present disclosure decreased fibrosis in epididymal white adipose tissue (epiWAT) of DIO mice, as measured by %Trichrome-positive area in DIO mouse epiWAT. EXAMPLE 6. Evaluation of INHBE siRNA Plus Semaglutide in DIO Mice

[0424] The objective of this study is to assess the effects of INHBE siRNAs when administered in combination with semaglutide to mice with diet-induced obesity (DIO), as summarized in Table 10.

[0425] Table 10. Study Design

[0426] 58

[0427] 12579081V1 088290.0210

[0428] No. = Number; NA = Not applicable; ROA = Route of administration; PBS = Phosphate-buffered saline; SC = Subcutaneous injection; QD = once per day

[0429] Test System

[0430] Species: Mus musculus

[0431] Strain: C57BL / 6NTac with DIO

[0432] Number of animals: 60

[0433] Sex: Male

[0434] Age: 30 weeks

[0435] Source: Taconic

[0436] Animals were individually housed in clear polyethylene terephthalate (PET) cages with contact bedding in a procedure room meeting the requirements of the Guide for the Care and Use of Laboratory Animals. All animals were provided ad libitum Research Diet D12492i and filtered tap water that is acidified with IN HC1 to a targeted pH of 2.5-3.0. Animals were assigned to groups according to body weight. The test material was vortexed for at least 30 seconds prior to dosing. Doses of test material were administered by subcutaneous injection according to the Study Design table. All doses were administered at a dose volume of 10 mL / kg. Animal health checks were performed at least once daily to check for general health, mortality, and moribundity. Body weights were recorded prior to dosing, at least twice per w eek for the duration of the study, and prior to euthanasia. Food consumption was measured twice each w eek during the course of the study. Measured amounts of food w ere placed into the food hoppers. After two days, the food w as weighed again. The beginning and ending food weights were recorded. Animals will be fasted overnight (10-14 hours) prior to euthanasia. On the day prior to euthanasia, food will be removed; water will continue to be provided ad libitum. On Day 56, all study animals will be euthanized by CO2 asphyxiation followed by thoracotomy.

[0437] The data in Figure 3 represents the body weight following the treatment of DIO mice of Group Nos. 1 , 2 and 6 from day 0 to day 56 to assess the effect of weight loss by the addition of INHBE siRNA on top of semaglutide. As shown in Figure 3, it was observed that adding a single dose of the siRNA of the present disclosure at day 0 on top of semaglutide (daily) consistently doubled the weight loss effect of semaglutide (daily) alone.

[0438] The data in Figure 4 represents the body weight following the treatment of DIO mice of Group No. 5 (these animals receiving semaglutide also received a single SC dose of DSR- 0104212 on day 21 and day 28) from day 0 to day 56. As shown in Figure 4, it was observed

[0439] 59

[0440] 12579081V1 088290.0210 that the siRNA of the present disclosure suppressed body weight regain upon discontinuation of semaglutide. DIO mice given daily semaglutide regained 12% (P < 0.05) in body weight by 24 days after final dosing, whereas DIO mice given both daily semaglutide and INHBE siRNA of the present disclosure (on day 21 and day 28) regained 3.5% (P = ns) of body weight by 24 days after final dosing.

[0441] EXAMPLE 7. Evaluation of INHBE siRNA Activity in Mice

[0442] In vivo determination of mouse INHBE siRNA activity: All animal procedures were performed under IACUC guidelines. To evaluate the potency and liver exposure of provided oligonucleotides and compositions, male 39 weeks of age C57BL / 6NTac mice were dose at 1, 3 or 10 mg / kg at desired oligonucleotide concentration on day 0 by subcutaneous administration. Animals were euthanized on day 14 or day 28 (after overnight fasting) by CO2 asphyxiation followed by thoracotomy and terminal blood collection. After cardiac perfusion with PBS, liver samples were harvested and flash-frozen in dry ice. Liver total RNA was extracted using SV96 Total RNA Isolation kit (Promega), after tissue lysis with TRIzol and bromochloropropane. cDNA production from RNA samples were performed using High- Capacity cDNA Reverse Transcription kit (Thermo Fisher) following the manufacturer's instructions and qPCR analysis performed in CFX System using iQ Multiplex Powermix (BioRad). For mouse INHBE mRNA, the following qPCR assay were utilized: Thermo Fisher Mm03023993_ml. Mouse HPRT was used as normalizer (IDT Mm.PT.39a.22214828). Oligonucleotide accumulation in the liver was determined by hybrid ELISA. Table 11 shows % mouse INHBE mRNA remaining relative to PBS control in the liver 14 days and 28 days post dosing. Table 12 shows % mouse INHBE mRNA remaining relative to PBS control in the liver 84 days and 168 days post dosing.

[0443] Table 11

[0444] 60

[0445] 12579081V1 088290.0210

[0446] N = 4. N.D.: Not determined.

[0447] Table 12

[0448] 61

[0449] 12579081V1 088290.0210

[0450] N = 4. N.D.: Not determined.

[0451] In vitro determination of siRNA activity in primary mouse, human, rat, and NHP hepatocytes.

[0452] For determination of siRNAs activity, siRNAs at specific concentration were gymnotically delivered to primary hepatocytes plated at 96-well plates, with 10,000 cells / well. Following 48 hours treatment, total RNA was extracted using SV96 Total RNA Isolation kit (Promega). cDNA production from RNA samples were performed using High-Capacity cDNA Reverse Transcription kit (Thermo Fisher) following manufacturer’s instructions and qPCR analysis performed in CFX System using iQ Multiplex Powermix (Bio-Rad). For mouse INHBE mRNA, the following qPCR assay were utilized: Thermo Fisher Taqman qPCR assay ID Mm03023993_ml. Mouse HPRT was used as normalizer (IDT Mm.PT.39a.22214828). For human INHBE mRNA, the following qPCR assay were utilized: Thermo Fisher Taqman qPCR assay ID Hs00368884_g I . Human SFRS9 was used as normalizer (Forward 5 TGGAATATGCCCTGCGTAAA3', Reverse 5’TGGTGCTTCTCTCAGGATAAAC’, Probe 5 ’ / 5HEX / TGGATGAC A / ZEN / CC AAATTCCGCTCTCA / 3IABkFQ / 3 ’). mRNA knockdown levels were calculated as %mRNA remaining relative to mock treatment. For Rat INHBE mRNA, the following qPCR assay were utilized: Thermo Fisher Taqman qPCR assay ID Rn00582653_ml. Rat HPRT was used as normalizer Thermo Fisher Rn01527840_ml.

[0453] For in vitro determination of siRNA activity in primary7non-human-primate (NHP) hepatocyte. siRNAs at specific concentration were gymnotically delivered to primary hepatocytes plated at 96-well plates, with 10,000 cells / well. Following 48 hours treatment, total RNA was extracted using SV96 Total RNA Isolation kit (Promega). cDNA production from RNA samples were performed using High-Capacity cDNA Reverse Transcription kit (Thermo Fisher) following manufacturer’s instructions and qPCR analysis performed in CFX System using iQ Multiplex Powermix (Bio-Rad). For NHP INHBE mRNA, the following

[0454] 62

[0455] 12579081V1 088290.0210 qPCR assay were utilized: Thermo Fisher Taqman qPCR assay ID Rh02820386_ml. NHP ACTB was used as normalizer Thermo Fisher Taqman qPCR assay ID Rh02621734_gl.

[0456] Table 13. % IC50 of knocking down mouse INHBE mRNA in primary mouse hepatocyte.

[0457] Table 14. % IC50 of knocking down mouse INHBE mRNA in primary human hepatocyte.

[0458] Table 15. % IC50 of knocking dow n mouse INHBE mRNA in primary rat hepatocyte. Table 16. % IC50 of knocking down mouse INHBE mRNA in primary human hepatocyte.

[0459] Table 17. % IC50 of knocking down NHP INHBE mRNA in primary NHP hepatocyte. EXAMPLE 8. Nomenclature, chemistry and structure of DSR-0104292

[0460] The drug substance (i.e., DSR-0104292) is a duplex of a Sense strand SSR-0108051 and an Antisense strand SSR-0108323. The Sense strand can be chemically described as the sodium salt (PS and PO) of a 3 '—►5' linked mixed PS / PO backbone 21 mer containing 2;-fluoro- 2'-deoxy- / 2 -<9-methyl ribonucleic acid oligonucleotide, containing a combination of

[0461] 63

[0462] 12579081V1 088290.0210 stereodefined <Sp phosphorothioate diester, and phosphodiester intemucleotide linkages, with a triantennarv GalNAc at the 5'end.

[0463] The Antisense strand the sodium salt (PS and PO) of a 3’-»5' linked mixed PS / PN / PO backbone 23 mer containing 2'-fluoro-2'-deoxy- / 2'-(9-methyl ribonucleic acid oligonucleotide, containing a combination of stereodefined both Rp and Sp phosphorothioate diester, stereodefined Rp and Sp A-(1.3-dimethylimidazolidin-2-ylidene)phosphoramidate diester, and phosphodiester intemucleotide linkages with a triazole phosphonate at the 5'end.

[0464] Sense Strand: SSR-0108051

[0465] 5'-[GalNAc3C12oyl] [nC6o]pmL;[Ssp]mCpmUpmUpniUpmCp[fl2r]CpmAp[fl2r]Up[fl2r]L!p [fl2r]CpmUpmGpmCpmCpmGpmUpmCpmUpmU^Ssp]mA-3' wherein:

[0466] [GalNAc3C12oyl] represents tri -an term ary GalNAc with C12 linker;

[0467] [nC6o] represents 6-aminohexanol; p represents phosphate linkage (PO); mU represents 2'-<9-methyluridine:

[0468] [Ssp] represents .S'p phosphorothioate linkage fS'p-PS): mC represents 2’-O-methylcytidine;

[0469] [fl2r] C represents 2'-fluoro-2’ -deoxy cytidine; mA represents 2'-<9-methyladenosine;

[0470] [H2r]U represents 2’-fluoro-2’-deoxyuridine; and mG represents 2'-<9-methylguanosine.

[0471] Antisense strand: SSR-0108323

[0472] 5'-[cp] [tz][d5m|lJ[Ssp][112r]A[Rsp]mA[n001S][fl2r]GpmAp[fl2r|CpmGpmGpmCpmA [nOOIR] [fl2r]GpmApmAp[fl2r]L!pmGp[fl2r]GpmApmApmApmGpmA[Ssp]mU[Ssp]mU-3' wherein:

[0473] [cp] represents capping phosphate;

[0474] [tz] represents 17f-l,2,3-triazole (1,4 linkage);

[0475] [d5m]U represents 5‘-deoxy-2’-(9-methyluridine;

[0476] [Ssp] represents <Sp phosphorothioate linkage GS'p-PS):

[0477] [fl2r] A represents 2’-fluoro-2’-deoxyadenosine;

[0478] [Rsp] represents Rp phosphorothioate linkage (7?p-PS);

[0479] 64

[0480] 12579081V1 088290.0210 mA represents 2’-(9-methyladenosine;

[0481] [nOOlS] represents Sp / V-( l.3-dimethylimidazolidm-2-ylidene)phosphoramidate linkage (Sp-PN);

[0482] [fl2r]G represents 2 ’-fluoro-2’ -deoxy guanosine; p represents phosphate linkage (PO);

[0483] [fl2r] C represents 2’ -fluoro-2’ -deoxy cytidine; mG represents 2’-(?-methylguanosine; mC represents 2’-O-methylcytidine;

[0484] [nOOIR] represents Rp N-( 1 ,3-dimethylimidazolidin-2-ylidene)phosphoramidate linkage (7?p-PN);

[0485] [f!2r]U represents 2 ’-fluoro-2 ’-deoxy uridine; and mU represents 2'-<9-methyluridine.

[0486] 65

[0487] 12579081V1 088290.0210

[0488] DSR-0104292 Sense strand drug substance has 20 intemucleotide linkages of which 18 are

[0489] Phosphodiester linkages and 2 are stereodefined Sp phosphorothioate diesters intemucleotide linkages.

[0490] DSR-0104292 Antisense strand drug substance has 22 intemucleotide linkages of which 16 are phosphodiester linkages and 6 are stereodefined intemucleotide linkages. Out of the 6 stereodefined intemucleotide linkages, 3 of which are kp phosphorothioate di esters, 1 Rp phosphorothioate diesters, 1 6’ A-(l,3-dimethylimidazolidin-2-ylidene)phosphoramidate diesters and 1 Rp A-( l .3-dimethylimidazolidin-2-yhdene)phosphoramidate diesters.

[0491] The combination of intemucleotide linkages can be illustrated with the following sequence of letters:

[0492] Sense 5'-SOOOOOOOOOOOOOOOOOOS-3'

[0493] Antisense 5'-SRnSOOOOOOnROOOOOOOOOOSS-3'

[0494] Where 'S', 'R', 'nS', 'nR', and 'O' represent Sp phosphorothioate diester, Rp phosphorothioate diester, kp A-(l,3-dimethylimidazolidin-2-ylidene)phosphoramidate diester, Rp A-f l .3- dimethylimidazolidin-2-ylidene)phosphoramidate diester, and phosphodiester linkages, respectively.

[0495] In some embodiments, a drug substance is a sodium salt.

[0496] 66

[0497] 1257908 Ivl 088290.0210

[0498] The -O- of Tri-GalNAc is bonded to linkage phosphorus of a phosphate linkage.

[0499] DSR-0104292 drug substance has the following molecular formula and molecular weight:

[0500] 67

[0501] 12579081V1 088290.0210

[0502] General Properties of DSR-0104292

[0503] EXAMPLE 9. Provided Oligonucleotides and Compositions Are Active in vivo

[0504] C57BL6 mice were placed on a high fat diet at 6 weeks of age. At approximately twenty -four weeks of age, mice received a single subcutaneous injection of PBS or the siRNA of the present disclosure at either 0.1, 0.3, 1, 3, or 10 mg / kg on day 0. Necropsy occurred on day 14. Tissues were collected, weighed, and processed per required analysis. Table 18 shows % mouse INHBE mRNA remaining relative to PBS control in the liver 14 days post dosing.

[0505] Table 18. N = 11.

[0506] 68

[0507] 12579081V1 088290.0210

[0508] EXAMPLE 10. In vitro determination of siRNA activity in primary non-human-primate (NHP) hepatocyte

[0509] For in vitro determination of siRNA activity in primary non-human-primate (NHP) hepatocyte, the siRNAs of the present disclosure at specific concentration were gymnotically delivered to primary hepatocytes plated at 96-well plates, with 10,000 cells / well. Following 48 hours treatment, total RNA was extracted using SV96 Total RNA Isolation kit (Promega). cDNA production from RNA samples were performed using High-Capacity cDNA Reverse Transcription kit (Thermo Fisher) following the manufacturer's instructions, and qPCR analysis was performed in CFX System using iQ Multiplex Powermix (Bio-Rad). For NHP INHBE mRNA, the following qPCR assay was utilized: Thermo Fisher Taqman qPCR assay ID Rh02820386_ml . NHP ACTB was used as normalizer Thermo Fisher Taqman qPCR assay ID Rh02621734_gl. Table 19 shows % IC50 of knocking down NHP INHBE mRNA in primary NHP hepatocyte.

[0510] 69

[0511] 12579081V1 088290.0210

[0512] Table 19

[0513] EXAMPLE 11. Provided oligonucleotides decrease adipocyte size in DIO mice

[0514] C57BL6 mice were fed either normal chow diet or were placed on a high fat diet at 6 weeks of age. At 23 weeks of age. lean or DIO mice received a single subcutaneous injection of l O mg / kg of the siRNA of the present disclosure (DSR-0104212) or PBS on day 0. Untreated lean mice were sacrificed on day 0; siRNA or PBS treated mice were sacrificed on day 28 (n=10 / group). Tissues were fixed in paraformaldehyde and embedded in paraffin. 4 pm tissue sections per block of each animal were stained with H&E and imaged at 10x (EC Plan-Neofluar objective with 0.30 NA) magnification with an Axio Observer. / 1 microscope (Zeiss, Germany). One representative field view of high-resolution image per animal were acquired and stored in uncompressed 24-bit color TIFF format. All images were analyzed by fully automated open-source software of ImageJ with an Adiposoft plug in for the quantification of adipocyte cellulanty in histological sections. The software can recognize the plasma membrane of adipocytes in images of H&E stained sections. The percentage of adipocytes with cell diameters that fit in each bin (0-10 pm, 10-20 pm, etc.) were graphed to compare the “binned” adipocyte size distribution in a mesenteric WAT depot dissected from mice. Figure 5 shows mean ±SEM MesWAT adipocyte diameter, calculated from H&E-stained sections, using ImageJ Adiposoft plugin. One representative field of view was analyzed per animal. Stats: Oneway AN OVA follow ed by Tukey HSD post hoc tests. As expected, PBS-treated DIO mice (day 28) displayed MesWAT adipocytes with significantly larger mean diameter (P < 0.0001) compared to age-matched lean mice (day 0). Treatment with the siRNA of the present disclosure for 4 weeks significantly suppressed the high fat diet-induced adipocyte size increase by -43% (P <0.001). This discovery supports peripheral mechanism of the siRNA of the present disclosure, which is distinct from GLP-1 agonists with central mechanism.

[0515] EXAMPLE 12. Provided Oligonucleotides and Compositions Are Active in vivo

[0516] C57BL6 mice were fed normal chow diet. At approximately 30 weeks of age, mice received a single subcutaneous injection of PBS, or 1, 3, or 10 mg / kg of either siRNA DSR- 0104292 or DSR-0104293 on day 0. Necropsy were day 14 and day 28 post injection. Tissues were collected and processed per required analysis, and the results are summarized in Table 20.

[0517] 70

[0518] 12579081V1 088290.0210

[0519] Table 20 shows % mouse INHBE mRNA remaining relative to PBS control in the liver 14 days and 28 days post dosing. N = 4.

[0520] 71

[0521] 12579081V1 088290.0210

[0522] EXAMPLE 13. In vivo determination of mouse INHBE siRNA activity; analysis metabolic pathways and genes

[0523] All animal experiments were performed at Biomedical Research Models, Ins. Dba Biomere (Worcester, MA) under an approved protocol and in compliance with Biomere’s Institutional Animal Care and Use Committee guidelines for care and use of animals. Mice were on a 12-hour light-dark cycle. Food (Research Diet D12492i or Lab Diet 5R58) and water were available ad libitum. Housing rooms were maintained at 20-26°C and relative humidity was 30-70%. The animals in this experiment were naive or diet induced obesity C57BL / 6Ntac males, 23 weeks of age. There were 10 mice per group per necropsy timepoint. The mice were dosed with DSR-0104212 at 10 mg / kg on Day 0 by subcutaneous administration. Animals were euthanized after overnight fasting on Day 0 , Day 2, Day 28 or Day 70 by CO2 asphyxiation followed by thoracotomy and terminal blood collection. After cardiac perfusion with PBS, liver, white adipose tissues (epididymal. inguinal and mesenteric), quadriceps, tibialis anterior, and the gastrocnemius are collected. The white adipose tissues, quadriceps, tibialis anterior, and the gastrocnemius were all weighed post dissection. Liver punches were harvested and flash-frozen on dry ice, and the remaining liver was flash frozen in foil using liquid nitrogen. Liver total RNA was extracted using SV96 Total RNA Isolation kit (Promega), after tissue lysis with TRIzol and bromochloropropane. cDNA production from RNA samples were performed using High-Capacity cDNA Reverse Transcription kit (Thermo Fisher) following manufacturer’s instructions and qPCR analysis performed in CFX System using iQ Multiplex Powermix (Bio-Rad). For mouse INHBE mRNA, the following qPCR assay were utilized: Thermofisher Taqman qPCR assay ID Mm03023993_ml. Mouse HPRT was used as normalizer IDT Mm.PT.39a.22214828.

[0524] 72

[0525] 12579081V1 088290.0210

[0526] Table 21 shows mouse INHBE mRNA remaining relative to PBS control in the liver predose,

[0527] 2 days, 28 days, 70 days post dosing. N = 10. N.D.: Not determined.

[0528] RNA-sequencing analysis Total RNA samples from collected tissues for RNAseq were prepared using RNeasy

[0529] Lipid Tissue Mini Kit (QIAGEN). RNAseq library7preparation and sequencing were

[0530] 73

[0531] 12579081V1 088290.0210 performed at Novogene Co (CA USA). Briefly, after total RNA was quality checked (Bioanalyzer Agilent) and quantified. 1 ug of total RNA was purified by poly-dT magnetic beads, and fragmented by divalent cations. The libraries were generated by using NEBNext® Ultra™ RNA Library Prep Kit for Illumina® (NEB, USA) according to manufacturer’s protocol. Final libraries were sized selected by AMPure XP (Beckman Coulter, Beverly), then PCR amplified, AMPure XP purified and quality-assessed on Bioanalyzer, before loading on Novaseq 6000 for pair-end 150bp read-sequencing (Illumina. USA). Only the samples with at least 20 million reads and over 6 G base data were analyzed.

[0532] RNA-seq reads were adapter- and poly(A)-trimmed with cutadapt vl.15, followed by routine pre- and post-trimming QC. Trimmed reads were aligned to the mouse reference genome GRCm38 (mmlO) using HISAT2 v2.1.0 with default parameters, and gene-level counts were obtained with featureCounts (Rsubread v2.0.1) against Ensembl gene models, assigning multi-overlapping reads to the feature with the largest overlap and requiring a minimum 1 bp read-feature overlap (other multimapping behaviors followed featureCounts defaults). Sample identifiers encoding tissue (inguinal, mesenteric), group (lean. DIO), treatment (PBS, dsr-0104212), and timepoint (ay 0, day 2, day 28, day 70) w ere parsed (stringr) to build a metadata table with ordered factors (PBS as the reference). Prior to modeling, genes were filtered to retain those with nonzero counts in all retained samples. Differential expression was carried out in DESeq2 vl.26 using the standard pipeline (median-of-ratios normalization, dispersion estimation. Wald test) with the design ~ treatment, extracting the dsr vs. PBS contrast; primary significance was defined at FDR (Benjamini-Hochberg adjusted P) < 0.05, and in some reports an additional effect-size filter of | log2(FC) | >1 | log2(FC) | >1 was applied. Gene annotation (Ensembl IDs to symbols and descriptions) was added via biomaRt (mmusculus gene ensembl). For functional interpretation, Gene Ontology Biological Process enrichment was performed with clusterProfiler (enrichGO) using org.Mm.eg.db, mapping symbols to Entrez IDs; the universe comprised all tested genes within each subset, multiple testing was controlled by BH, and reporting thresholds typically required padj < 0.01 and log2(FC) | >0.5 log2 (FC) | >0.5 Enrichment results across timepoints were merged and visualized as dot plots (ggplot2) encoding fold enrichment, adjusted P value, and gene counts, and heatmaps (pheatmap) of curated gene panels (e.g., TCA cycle, lipid storage, insulin response, angiogenesis, TGF-P response, extracellular matrix organization) were plotted on a common color scale for cross-timepoint comparability.

[0533] As shown in Figure 7 A, the upregulation of the inguinal (subcutaneous) gene pathway

[0534] 74

[0535] 12579081V1 088290.0210 regulation was examined by GO analysis at 2, 28, and 70 days.

[0536] As shown in Figure 7B, the upregulation of genes responding to insulin (z.e., insulin sensitivity) were analyzed at 2, 28, and 70 days.

[0537] As shown in Figure 7C, the upregulation of genes in adaptive thermogenesis (beiging of white adipose) were examined by GO analysis at 2, 28, and 70 days.

[0538] As shown in Figure 7D, the downregulation of pathways related to adipose remodeling and fibrosis were examined by GO analysis at 2, 28, and 70 days.

[0539] As shown in Figure 7E, the upregulation of pathways related to utilization of fatty acid for energy production were examined at 2, 28, and 70 days.

[0540] As shown in Figure 7F, the upregulation of genes involved in cellular respiration were analyzed at 2, 28, and 70 days.

[0541] As shown in Figure 7G, the upregulation of genes involved in lipid catabolic process were examined at 2, 28, and 70 days.

[0542] As shown in Figure 7H, the upregulation of pathways related to short-term adaptation to carbohydrate metabolism were analyzed at 2. 28, and 70 days.

[0543] As shown in Figure 71, the upregulation of genes involved in the carbohydrate metabolic process were analyzed at 2, 28, and 70 days.

[0544] As shown in Figure 7J, the upregulation of genes involved in the response to insulin were analyzed at 2, 28, and 70 days.

[0545] As shown in Figure 7K, the upregulation of pathways related thermogenesis were analyzed at 2, 28, and 70 days.

[0546] As show n in Figure 7L, the upregulation of genes related to adipocytes differentiation were analyzed at 2, 28, and 70 days.

[0547] As shown in Figure 7M. the upregulation of genes related to adaptive thermogenesis were examined at 2, 28, and 70 days.

[0548] As shown in Figure 7N, the GO enrichment of downregulated mesenteric adipose gene pathways was examined by GO analysis at 2, 28, and 70 days.

[0549] As shown in Figure 70, the upregulation of pathways in glucose utilization, thermogenesis, and lipid metabolism was analyzed at 2, 28, and 70 days.

[0550] As shown in Figure 7P, the downregulation of genes controlling innate immunity was analyzed at 2, 28, and 70 days.

[0551] As shown in Figure 7Q, the downregulation of genes controlling cytokine release was analyzed at 2, 28, and 70 days.

[0552] As shown in Figure 7R, the downregulation of genes controlling extracellular matrix

[0553] 75

[0554] 12579081V1 088290.0210 remodeling (fibrosis) was analyzed at 2, 28, and 70 days.

[0555] As shown in Figure 8A, the % mRNA expression of leptin, Slc2a4 (Glut4), and Ppargcla genes in inguinal white adipose of mice fed chow or a high fat diet (HFD) with PBS or DSR-014212 was measured by qPCR at 2, 28, and 70 days.

[0556] As shown in Figure 8B, the % mRNA expression of leptin, Slc2a4 (Glut4), and Ppargcla genes in mesenteric white adipose of mice fed chow or a high fat diet (HFD) with PBS or DSR-014212 was measured by qPCR at 2, 28, and 70 days.

[0557] As shown in Figure 8C, the % mRNA expression of Fasn, Srebfl, Irsl, Adrb3, and Acsll genes in inguinal white adipose of mice fed chow or a high fat diet (HFD) with PBS or DSR-014212 was measured by qPCR at 2, 28, and 70 days.

[0558] As shown in Figure 8D. the % mRNA expression of Fasn, Srebfl, Irsl, Adrb3, and Acsll genes in mesenteric white adipose of mice fed chow or a high fat diet (HFD) with PBS or DSR-014212 was measured by qPCR at 2, 28, and 70 days.

[0559] As shown in Figure 8E, the % mRNA expression of Mogatl, Pparg, Cptlb, Dgatl, and Thrsp genes in inguinal white adipose of mice fed chow or a high fat diet (HFD) with PBS or DSR-014212 was measured by qPCR at 2, 28, and 70 days.

[0560] As shown in Figure 8F, the % mRNA expression of Mogatl, Pparg, Cptlb, Dgatl, and Thrsp genes in mesenteric white adipose of mice fed chow or a high fat diet (HFD) with PBS or DSR-014212 was measured by qPCR at 2, 28, and 70 days.

[0561] EXAMPLE 14. In vivo determination of rat INHBE siRNA activity

[0562] All animals were performed at Charles River Laboratories (Quebec, Canada) under approved protocol and in compliance with Charles River Laboratories Montreal ULC, Senneville Site Institutional Animal Care and Use Committee, with guidance from the USA National Research Council and the Canadian Council on Animal Care. Rats were on a 12- hour light-dark cycle. Food (Lab Diet Certified CR Rodent Diet 5CR4) and water were available ad libitum. Housing rooms were maintained at 19-25°C and relative humidity was 30-70%. The animals in this experiment were CD® Sprague Dawley IGS both males and females, 6 to 8 weeks of age. There were 20 rats per group per Day 92 necropsy and 10 rats per group per Day 183 necropsy. The rats were dosed with PBS or DSR-0104292 at 20, 100 or 400 mg / kg on Day 1, 29, 57 and 85 by subcutaneous administration. The animals will undergo exsanguination by incision from the abdominal aorta following isoflurane anesthesia on Day- 92 and Day 183. Sections from the left lateral lobe of liver 100-150 mg were collected and rinsed with PBS IX. dried on paper towel, individually weighed and transferred into uniquely

[0563] 76

[0564] 12579081V1 088290.0210 labeled protein LoBind Dnase / Rnase free polypropylene tubes, immediately snap frozen in liquid nitrogen. Liver total RNA was extracted using SV96 Total RNA Isolation kit (Promega), after tissue lysis with TRIzol and bromochloropropane. cDNA production from RNA samples were performed using High-Capacity cDNA Reverse Transcription kit (Thermo Fisher) following manufacturer’s instructions and qPCR analysis performed in CFX System using iQ Multiplex Powermix (Bio-Rad). For rat INHBE mRNA, the following qPCR assay were utilized: Thermofisher Taqman qPCR assay ID Rn00582653_ml. Rat HPRT was used as normalizer Thermofisher Taqman qPCR assay ID Rn01527840_ml. Table 22 shows % Rat INHBE mRNA remaining relative to PBS control in the Liver in day

[0565] 92 and day 183 post initial dose. N.D.: Not determined.

[0566] 77

[0567] 12579081V1 088290.0210

[0568] 78

[0569] 12579081V1 088290.0210

[0570] 79

[0571] 12579081V1 088290.0210

[0572] EXAMPLE 15. In vivo determination of non-human primates (NHP) INHBE siRNA activity

[0573] All animals were performed at Charles River Laboratories (Quebec, Canada) under approved protocol and in compliance with Charles River Laboratories Montreal ULC, Senneville Site Institutional Animal Care and Use Committee, with guidance from the USA National Research Council and the Canadian Council on Animal Care. NHPs were on a 12- hour light-dark cycle. Food (Lab Diet Certified Primate Diet 5048) were given twice daily, and water were available ad libitum. Housing rooms were maintained at 20-26°C and relative humidity was 30-70%. The animals in this experiment were Cambodian Cynomolgus monkey both males and females, 22 to 38 months old. There were 8 animals per group per Day 92 necropsy and 4 animals per group per Day 183 necropsy. The NHPs were dosed with PBS or DSR-0104292 at 30, 100 or 300 mg / kg on Day 1, 29, 57 and 85 by subcutaneous administration. After an overnight food deprivation, the animals will undergo exsanguination by incision of the axillary or femoral arteries following intravenous injection of sodium pentobarbital, unless deemed inappropriate by the Study Director and / or the clinical veterinarian. A sedative, ketamine HC1 for injection, will be administered by intramuscular inj ection before animals are transported from the animal room to the necropsy area on Day 92 and Day 183. Sections from the left lateral lobe of liver 100-150 mg were collected and rinsed with PBS IX, dried on paper towel, individually w eighed and transferred into uniquely labeled protein LoBind Dnase / Rnase free polypropylene tubes, immediately snap frozen in liquid nitrogen. Liver total RNA was extracted using SV96 Total RNA Isolation kit (Promega). after tissue lysis with TRIzol and bromochloropropane. cDNA production from RNA samples were performed using High-Capacity cDNA Reverse Transcription kit (Thermo Fisher) following manufacturer’s instructions and qPCR analysis performed in CFX System using iQ Multiplex

[0574] 80

[0575] 12579081V1 088290.0210

[0576] Powermix (Bio-Rad). For NHP INHBE mRNA, the following qPCR assay were utilized: Thermofisher Taqman qPCR assay ID Mf02820386_gl. NHP ACTB was used as normalizer Thermofisher Taqman qPCR assay ID Mf04354341_gl. Table 23 shows % NHP INHBE mRNA remaining relative to PBS control in the Liver in day

[0577] 92 and day 183 post initial dose. N.D.: Not determined.

[0578] 81

[0579] 12579081V1 088290.0210

[0580] EXAMPLE 16. In vivo determination of mouse INHBE siRNA activity

[0581] All animal experiments were performed at Biomedical Research Models, Ins. Dba Biomere (Worcester, MA) under an approved protocol and in compliance with Biomere's Institutional Animal Care and Use Committee guidelines for care and use of animals. Mice were on a 12-hour light-dark cycle. Food (Research Diet D12492i) and water were available ad libitum. Housing rooms were maintained at 20-26°C and relative humidity was 30-70%. The animals on study were males 27 weeks of age C57BL / 6NTac mice on 60% high fat diet. There were six groups for this experiment consisting of 8 animals per group. • Group 1 was dosed with PBS daily for 28 days.

[0582] • Group 2 was dosed with 10 mg / kg DSR-0104212 at day 0.

[0583] • Group 3 was dosed with 10 nmol / kg semaglutide daily for 28 days.

[0584] • Group 4 was dosed with 10 mg / kg DSR-0104212 at day 0 and 1 nmol / kg semaglutide daily for 28 days. • Group 5 was dosed with 10 mg / kg DSR-0104212 at day 0 and 3 nmol / kg semaglutide daily for 28 days.

[0585] • Group 6 was dosed with 10 mg / kg DSR-0104212 at day 0 and 10 nmol / kg semaglutide daily for 28 days.

[0586] 82

[0587] 12579081V1 088290.0210

[0588] Animals were euthanized at day 28 by CO2 asphyxiation followed by thoracotomy and terminal blood collection. After cardiac perfusion with PBS, livers were collected and weighed. Liver punches are harvested and flash-frozen on dry ice, and the remaining liver were flash frozen in foil using liquid nitrogen. Liver total RNA was extracted using SV96 Total RNA Isolation kit (Promega), after tissue lysis with TRIzol and bromochloropropane. cDNA production from RNA samples were performed using High-Capacity cDNA Reverse Transcription kit (Thermo Fisher) following manufacturer’s instructions and qPCR analysis performed in CFX System using iQ Multiplex Powermix (Bio-Rad)). For mouse INHBE rnRNA, the following qPCR assay w ere utilized: Thermofisher Taqman qPCR assay ID Mm03023993_ml. Mouse HPRT was used as normalizer IDT Mm.PT.39a.22214828.

[0589] Various technologies can be utilized in accordance with the present disclosure to assess levels of INHBE mRNA, e.g., RT-qPCR, RNA sequencing, etc., and levels of activin E protein, e.g., western blot, mass spectrometry (e.g., LC-MS / MS technologies useful for proteomics (see, e.g., Souza, et al., Mol Endocrinol. 2008 Dec; 22(12):2689-702. doi: 10.1210 / me.2008- 0290)), etc.

[0590] Table 24 shows % mouse INHBE mRNA remaining relative to PBS control in the liver 28 days post dosing. N = 8. N.D.: Not determined.

[0591] 83

[0592] 12579081V1 088290.0210

[0593] Table 25 shows the activin E in mouse serum samples. N.D.: Not determined.

[0594] EXAMPLE 17. Phase 1 Study of DSR-0104292 in Adults Living with Overweight or Obesity

[0595] A clinical study with DSR-0104292 is a Phase 1 study to assess the safety, tolerability, pharmacokinetics and pharmacodynamics of DSR-0104292 when administered subcutaneously (SC) as single ascending doses in adults who are affected by overweight or obesity. Certain useful technologies and information are available at clinicaltrials.gov; see, e.g.,

[0596] NCT06842186.

[0597] • Cohort 1: Dose 1 of DSR-0104292

[0598] 84

[0599] 12579081V1 088290.0210

[0600] • Cohort 2: Dose 2 of DSR-0104292

[0601] • Cohort 3: Dose 3 of DSR-0104292

[0602] • Cohort 4: Dose 4 of DSR-0104292

[0603] • Cohort 5: Dose 5 of DSR-0104292

[0604] Inclusion Criteria:

[0605] • Male and female participants aged 18 to 60 years

[0606] • BMI 28 to 35 kg / m2 which has been stable (±5%) for the previous 3 to 6 months (based on participant self-report or medical records)

[0607] • Healthy, in the opinion of the Investigator, as determined by prestudy medical history, physical examination, and clinical laboratory assessments

[0608] Exclusion Criteria:

[0609] • History or presence of CV disease, including heart failure (New Y ork Heart Association [NYHA] Class III or IV), myocardial infarction, angina, or clinically significant abnormal laboratory assessments

[0610] • History or presence of thyroid disorders

[0611] • Medical history or diagnosis of causes of liver disease

[0612] • Use of any siRNA agent in the prior 12 months

[0613] • Received an investigational agent within 90 days or 5 half-lives, whichever is longer, before the first dose of study drug or are in follow-up of another clinical study

[0614] Primary Outcome Measures:

[0615] • The proportion of participants with adverse events o Time frame: Day 1 through end of study

[0616] Secondary Outcome Measures:

[0617] • Maximum concentration of DSR-0104292 in plasma (Cmax) o Time frame: Day 1 through 169

[0618] • Area under the plasma concentration time curve for DSR-0104292 from time 0 to last measurable concentration (AU Clast) o Time frame: Day 1 through 169

[0619] • Change over time from baseline levels of serum activin E o Time frame: Day 1 through 169

[0620] Other Outcome Measures

[0621] Percent change of weight (kg) from baseline o Time frame: Day 1 through 169

[0622] 85

[0623] 12579081V1 088290.0210

[0624] • Body composition changes as follows: Change in body fat percentage from baseline, percent change of visceral fat (kg) from baseline, and percent change in fat-free mass (kg) from baseline o Time frame: Day 1 through 169

[0625] The clinical study is an ongoing, first-in-human clinical trial (3:1 active: placebo) evaluating DSR-0104292 in adults living with overweight or obesity and assesses safety, tolerability, pharmacokinetics, biomarkers for target engagement, body weight and composition, and metabolic health.

[0626] Cohort 2 of the clinical study, which is evaluating single 240 mg doses of DSR- 0104292. was expanded from eight to 32 individuals. This expansion was triggered by favorable safety and tolerability, as well as robust activin E reduction observed in Cohort 1 (75 mg; n=8), the lowest single dose cohort. The 240 mg dose level is predicted to be therapeutically active based on preclinical diet-induced obesity (DIO) mice data, where a single dose of INHBE GalNAc-siRNA led to potent and durable reductions of both INHBE mRNA and activin E protein and drove weight loss.

[0627] Dosing is complete for these additional participants in the expanded Cohort 2. Dosing is also underway in the Cohort 3 (400 mg).

[0628] Additional clinical trials can also be designed and conducted by those skilled in the art in accordance with the present disclosure to assess safety and efficacy of DSR-0104292.

[0629] Summary

[0630] In preclinical mouse models, the GalNAc-conjugated siRNA (GalNAc-siRNA) designed to silence the INHBE gene according to the present disclosure has demonstrated highly potent (ED50 < 1 mg / kg) and durable silencing following one, low-single-digit dose, supporting every-six-month or annual subcutaneous dosing in humans. Preclinical data also demonstrated weight loss similar to semaglutide, with no loss of muscle mass and a reduction in fat mass with preferential effects on visceral fat, consistent with the profile of INHBE loss- of-function (LoF) carriers in human genetics. These heterozygous INHBE LoF carriers, identified through multiple large human genetic databases including UK Biobank, have a favorable cardiometabolic profile, including reduced abdominal obesity and reduced odds of type 2 diabetes and coronary artery disease. In a separate study in DIO mice, when administered in combination with semaglutide, a single dose of the siRNA of the present disclosure doubled the weight loss observed with semaglutide alone and this effect was

[0631] 86

[0632] 12579081V1 088290.0210 sustained throughout the duration of the study. Treatment with the siRNA of the present disclosure upon cessation of semaglutide treatment curtailed expected rebound weight gain. The disclosure and data presented herein demonstrate the ability’ to address obesity with the siRNA of the present disclosure as a front-line monotherapy, in combination with GLP-1 agonists for further improvement of weight loss or to reduce the doses of GLP-1 agonists, or as a maintenance therapy following cessation of GLP-1 agonists.

[0633] Further Discussion and Conclusion

[0634] DSR-0104292 potently and selectively silenced INHBE mRNA in primary hepatocytes of human, NHP and rodents in the in vitro experiments. To establish a robust preclinical pharmacological characterization of INHBE mRNA silencing on obesity and associated metabolic diseases, a mouse cross-reactive sequence, DSR-0104212, was designed, based on the principle of G:U wobble base pairing in the anti-sense strand. Both DSR-0104292 and DSR-0104212 displayed similar silencing potency of INHBE mRNA in hepatocytes from human, NHP, rat and mouse in the in vitro experiments. These results are indicative of DSR- 0104212 being an appropriate mouse cross-reactive siRNA to recapitulate the in vivo pharmacology7of DSR-0104292 in preclinical, disease-relevant, efficacy models.

[0635] After a single subcutaneous dose of oligonucleotides in C57BL / 6 mice fed with 60% high fat diet (named DIO mice), DSR-0104212 demonstrated a highly potent ED50 of 0.625 mg / kg for INHBE mRNA reduction. The statistically significant body weight lowering was observed in the 3 mg / kg group after 14 days from the initial dose. Importantly, as demonstrated in several independent in vivo studies in DIO mice, this weight loss effect of DSR-0104212 was mainly driven by the loss of fat mass, while preserving muscle mass. This is particularly important for patients while losing weight and also for those who may be already in a sarcopenic state.

[0636] Furthermore, in this DIO mouse model, a single 10 mg / kg subcutaneous dose of DSR- 0104212 demonstrated similar weight loss effect as that of 10 nmol / kg daily subcutaneous injection of semaglutide (for 28 days). This study was conducted to investigate the principle of weight maintenance following the tennination of existing anti-obesity medication. In this study, semaglutide was used to investigate the potential of DSR-0104292 to prevent weight regain. Two consecutive weekly doses of 10 mg / kg DSR-0104212 right before the termination of 10 nmol / kg semaglutide curtailed the rapid weight regain caused by the withdrawal of

[0637] 87

[0638] 12579081V1 088290.0210 semaglutide. Collectively, these results indicate that DSR-0104292 can be an important addition to the cunent treatment paradigm as a new anti-obesity agent.

[0639] Additional pharmacology’ studies were conducted to deepen the understanding of the molecular mechanism and impact of INHBE mRNA silencing on metabolic dysregulation associated with obesity. Treatment with DSR-0104212 in DIO mice was associated with a significant shrinkage of visceral adipocytes enlargement, which was accompanied by a statistically significant suppression of macrophages in the inflamed mesenteric adipose tissues. An attenuation of Ml proinflammatory macrophages induced by increased adiposity in obese individuals was also observed. This overall reduction of the inflammatory state of visceral adipose tissue translated into suppression of adipose fibrosis. It is well documented that suppression of adipose inflammation and fibrosis is associated with attenuation of metabolic diseases associated with overweight or obesity.

[0640] DIO mice treated with 10 mg / kg of DSR-0104212 led to rapid and potent target engagement, determined by suppression of INHBE mRNA, as early as day 2, and sustained until day 28 after the initial administration. At day 70, the silencing effect of DSR-0104212 was not detectable. The rapid target engagement was associated with upregulation of pathways and genes involved in fatty acid and carbohydrate metabolism, lipid catabolic processes, cellular respiration and bioenergetics, responses to insulin, and adipocyte thermogenesis supporting beiging of white adipose in the inguinal subcutaneous adipose. In addition, pathways involved in adipose tissue remodeling and fibrosis were down regulated. These data are indicative of DSR-0104212 promoting energy' utilization, improved insulin sensitivity’, induction of beiging of white adipose, and reduced inflammation and fibrosis of subcutaneous adipose in DIO mice. Furthermore, the treatment with DSR-0104212 in DIO mice also significantly suppressed pathways and genes involved in innate immunity, adipose inflammation and fibrosis in mesenteric visceral adipose. However, these effects were significantly delayed as compared to the upregulation of metabolic pathways and genes in subcutaneous and visceral adipose tissues. These overall data are indicative of the rapid improvement of energy utilization and response to insulin in adipose tissues by DSR-0104212 leading to suppression of inflammatory' state of adipose tissues and stimulation of adipose tissue remodeling and lower fibrotic state of adipose tissues.

[0641] In summan'. DSR-0104292 presents as a treatment for people living with overweight or obesity' and metabolic comorbidities, for example, but not limited to, type 2 diabetes and coronary artery disease.

[0642] 88

[0643] 12579081V1 088290.0210

[0644] While various embodiments have been described and illustrated herein, those of ordinary skill in the art will readily envision a variety of other means and / or structures for performing the functions and / or obtaining the results and / or one or more of the advantages described in the present disclosure, and each of such variations and / or modifications is deemed to be included.

[0645] 89

[0646] 12579081V1

Claims

088290.0210CLAIMS1. An oligonucleotide having the structure of5’-[GalNAc3C12oyl][nC6o]pmU[SsplmCpmL:pmUpmUpmCp[fl2r]CpmAp[fl2r]Up[fl2r]Up[fl2rjCpmUpmGpmCpmCpmGpniUpmCpmLTpmU[Ssp]mA-3’ or a pharmaceutically acceptable salt form thereof, wherein:[GalNAc3C12oyl] represents tri-antennary GalNAc with C12 linker having the structure of[nC6o] represents 6-aminohexanol; p represents phosphate linkage (PO); mU represents 2’-O-methyluridine;[Ssp] represents Sp phosphorothioate linkage (Sp-PS); mC represents 2’ -O-methyl cytidine;[fl2r]C represents 2’-fluoro-2’-deoxycytidine; mA represents 2’-(9-methyladenosine;[fl2r]U represents 2’-fluoro-2’-deoxyuridine; and mG represents 2 ’-(9 -methylguanosine.

2. An oligonucleotide having the structure of5’-[cp][tz][d 5m]U[Ssp][fl2r]A[Rsp]mA[n001 S][fl2r]GpmAp[fl2r]CpmGpmGpmCpmA [n001R][fl2r]GpmApmAp[fl2r]UpmGp[fl2r]GpmApmApmApmGpmA[Ssp]mU[Ssp]mU-3’ or a pharmaceutically acceptable salt form thereof, wherein:9012579081V1088290.0210[cp] represents capping phosphate;[tz] represents IH- 1,2, 3 -triazole (1,4 linkage);[d5m]U represents 5’-deoxy-2’-O-methyluridine;[Ssp] represents Sp phosphorothioate linkage (Sp-PS);[fl2r]A represents 2 ’-fluoro-2’ -deoxy adenosine;[Rsp] represents Ap phosphorothioate linkage (Ap-PS); mA represents 2’-(9-methyladenosine;[nOOlS] represents Sp A-(l,3-dimethylimidazolidin-2-ylidene)phosphoramidate linkage (Sp- PN);[fl2r]G represents 2 ’-fluoro-2 ’-deoxy guanosine; p represents phosphate linkage (PO);[f!2r]C represents 2’-fluoro-2’-deoxycytidine; mG represents 2’-O-methylguanosine; mC represents 2’ -O-methyl cytidine;[nOOIR] represents Ap A-(l,3-dimethylimidazolidin-2-ylidene)phosphoramidate linkage (Ap- PN);[fl2r]U represents 2’-fluoro-2’-deoxyuridine; and mU represents 2’-(9-methyluridine.

3. The oligonucleotide of claim 2, wherein [cp][tz] represents (l / / -l,2,3-triazol-4- yl)phosphonate.

4. An oligonucleotide having the structure of5’-[vped5m] U[Ssp][fl2r]A[Rsp]mA[n()01S][fl2r]Gpm / X.p[tl2r]CpmGpmGpmCpmA [n00IR][fl2r]GpmApmAp[fl2r]UpmGp[fl2r]GpmApmApmApmGpmA[Ssp]mU[Ssp]mU-3’ or a pharmaceutically acceptable salt form thereof, wherein:[vped5m]U represents 5’-(£)-vinylphosphonate-5’-deoxy-2’-O-methyluridine;[Ssp] represents Sp phosphorothioate linkage (Sp-PS);[f!2r]A represents 2 ’-fluoro-2 ’-deoxy adenosine;[Rsp] represents Ap phosphorothioate linkage (Ap-PS); mA represents 2’-O-methyladenosine;9112579081V1088290.0210[nOOl S] represents Sp Ar-(l ^-dimethylimidazolidin-2-ylidene)phosphoramidate linkage (5p- PN);[fl2r]G represents 2 ’-fluoro-2’ -deoxy uanosine; p represents phosphate linkage (PO); mA represents 2’-(9-methyladenosine;[fl2r]C represents 2’-fluoro-2’-deoxycytidine; mG represents 2’-(9-methylguanosine; mC represents 2’-O-methylcytidine;[nOOIR] represents 7?p A-(l,3-dimethylimidazolidin-2-ylidene)phosphoramidate linkage (Rp- PN)[fl2r]U represents 2’-fluoro-2’-deoxyuridine; and mU represents 2’-O-methyluridine.

5. A double-stranded RNAi (dsRNAi) agent capable of directing target-specific RNA interference, the dsRNAi agent comprising a guide strand and a passenger strand, wherein: the guide strand is the oligonucleotide of claim 2 or claim 3; and the passenger strand is the oligonucleotide of claim 1.

6. A double-stranded RNAi (dsRNAi) agent capable of directing target-specific RNA interference, the dsRNAi agent comprising a guide strand and a passenger strand, wherein: the guide strand is the oligonucleotide of claim 4; and the passenger strand is the oligonucleotide of claim 1.

7. A method of preparing the dsRNAi agent of claim 5 or 6, the method comprising the steps of: i) combining a guide strand and passenger strand in a mixing vessel and mixing the guide strand and passenger strand to form a dsRNAi oligonucleotide solution, wherein the dsRNAi oligonucleotide solution comprises a dsRNAi oligonucleotide; ii) filtering the dsRNAi oligonucleotide solution through a filter, resulting in filtrate; ill) lyophilizing the filtrate to form a lyophilized product; and iv) isolating a dsRNAi oligonucleotide from the lyophilized product, wherein the dsRNAi oligonucleotide is the dsRNAi agent.9212579081V1088290.02108. The method of claim 7, wherein the step i) further comprises determining the presence of the dsRNAi oligonucleotide in the dsRNAi oligonucleotide solution by UPLC.

9. The method of claim 7 or 8, wherein the guide strand and passenger strand are combined in the mixing vessel in equal molar quantities.

10. The method of any of claims 7-9, wherein a freeze drying tray is used for lyophilizing the fdtrate in the step iii).

11. A method for preventing or treating an INHBE-related disorder in a subj ect in need thereof, comprising administering to the subject an effective amount of the dsRNAi agent of claim 5 or 6.

12. The method of claim 11, wherein said prevention or treatment of an INHBE-related disorder is selected from: improving glucose control; increasing lean body mass; reducing fat mass; treating obesity, e.g., abdominal obesity; treating diabetes, e.g., type 2 diabetes; treating insulin resistance; coronary artery disease; treating chronic kidney disease; treating liver issues associated with increased fat mass, obesity, and / or diabetes; treating a metabolic disorder, e.g., a metabolic disease or dysregulation associated with obesity, type 2 diabetes, and / or coronary artery disease; treating an elevated triglyceride level; treating a lipodystrophy; treating liver inflammation; treating fatty liver disease; treating hypercholesterolemia; treating an elevated liver enzyme; treating nonalcoholic steatohepatitis (NASH); treating a cardiovascular disease; treating cardiomyopathy; treating high blood pressure; treating heart failure; and inducing lipolysis (fat-burning) while preserving muscle mass.

13. The method of any of claims 11-12, wherein the method further comprises: performing bariatric surgery on the subject; and / or administering a second agent to the subject, wherein the second agent is selected from the group consisting of: a gastric and / or pancreatic lipase inhibitor; a norepinephrine agonist, a gamma-aminobutyric acid agonist, and / or a glutamate antagonist; an opioid receptor antagonist, a dopamine and norepinephrine reuptake9312579081V1088290.0210 inhibitor; a glucagon-like peptide 1 (GLP-1) agonist; an melanocortin-4 receptor (MC4R) agonist; a gastric inhibitory polypeptide (GIP) / GLP-1 dual agonist; insulin; sulfonylurea; meglitinide; biguanide; thiazolidinedione; an alpha-glucosidase inhibitor; a SGLT2 inhibitor; a DPP4 inhibitor; a HMG-CoA reductase inhibitor, statins; a PCSK9 inhibitor; an ApoC3 inhibitor; an ANGPTL3 inhibitor; an ATP citrate lyase; ezetimide; an Lp(a) inhibitor; an LPL activator; and combinations thereof.

14. The method of claim 13, wherein the second agent is a GLP-1 receptor agonist (GLP-1 agonist).

15. The method of claim 14, wherein the GLP-1 agonist is selected from the group consisting of: exenatide, dulaglutide, liraglutide, tirzepatide, and semaglutide.

16. The method of claim 15, wherein the GLP-1 agonist is semaglutide.

17. The method of any of claims 13-16, wherein the dsRNAi agent and the second agent of any of claims 13-16 (the second agent) are administered to the subject concurrently.

18. The method of any of claims 13-16, wherein the dsRNAi agent and the second agent are administered to the subject sequentially.

19. The method of claim 18, wherein the second agent is administered before the dsRNAi agent is administered to the subject, and wherein said administration of the second agent continues upon said administration of the dsRNAi agent is administered to the subject.

20. The method of claim 18, wherein the second agent is administered before the dsRNAi agent is administered to the subject, and wherein said administration of the second agent terminates upon said administration of the dsRNAi agent to the subject.

21. The method of any of claims 13-20, wherein the second agent is administered to the subject daily.9412579081V1088290.021022. The method of any of claims 13-22, wherein the amount of the second agent administered to the subject is reduced relative to a reference dose of the second agent administered in the absence of the dsRNAi agent.

23. The method of claim 13, wherein said bariatric surgery is performed on the subject before the dsRNAi agent is administered to the subject.

24. The method of any of claims 13-23, wherein the dsRNAi agent is administered every six months after the subject has been administered the second agent or has undergone said bariatric surgery.

25. The method of any of claims 13-24, wherein the dsRNAi agent is administered annually after the subject has been administered the second agent or has undergone said bariatric surgery.

26. The method of any of claims 13-25, whereby the subject loses substantially more body weight compared to when the subject is administered the second agent alone.

27. The method of claim 26, whereby the subject loses about double the body weight compared to when the subject is administered the second agent alone.

28. The method of any of claims 13-27 whereby the subject does not undergo rebound body weight gain which is expected when the subject is administered the second agent alone.

29. The method of any of claims 11-28, wherein the dsRNAi agent is administered every six months.

30. The method of any of claims 11-28, wherein the dsRNAi agent is administered annually.

31. The method of any of claims 11-28, wherein the dsRNAi agent is administered subcutaneously.9512579081V1088290.021032. The method of any of claims 11-31, whereby the subject maintains at least 50%, 60%, 75%, 90%, or 95% of its pre-administration skeletal muscle mass.

33. The method of any of claims 11-32, whereby the subject loses the body weight without loss of muscle mass or without substantial loss of muscle mass.

34. The method of claim 33, wherein said loss of the body weight is accompanied by a reduction in fat mass.

35. The method of claim 34, wherein said reduction in fat mass is a reduction in visceral fat mass.

36. The method of any of claims 33-35, wherein said effects on the subject’s muscle mass and fat mass are consistent with the protective effects of heterozygous INHBE loss-of-function (LoF) mutations.

37. The method of any of claims 11-36, whereby a healthy metabolic profile of the subject is maintained.

38. The method of any of claims 13-37, wherein the subject is administered the second agent (e.g., GLP-1 agonist) in a dosage amount that is the same as or lower than a standard dosage amount.

39. The of any of claims 11-38, wherein infiltration of activated macrophages in visceral adipose is decreased.

40. The method of claim 39, wherein infiltration of activated macrophages in visceral adipose is decreased by at least 50%.9612579081V1088290.021041 . The method of claim 39 or 40, wherein said decreased infiltration of activated macrophages in visceral adipose is associated with treating type 2 diabetes and / or coronary artery disease.

42. The method of claim 41, wherein said type 2 diabetes and / or coronary artery disease is / are secondary to obesity.

43. A method of preparing the oligonucleotide of claim 1, comprising coupling the 5’-OH group of 5'-mU[Ssp]mCpmUpmUpmUpmCp[fl2r]CpmAp[fl2r]Up [fl2r]Up[fl2r]CpmUpmGpmCpmCpmGpmUpmCpmUpmU[Ssp]mA-3' with a compound, wherein the compound44. A method of preparing the oligonucleotide of claim 1, comprising contacting 5’- mU[Ssp]mCpmUpmUpmUpmCp[fl2r]CpmAp[fl2r]Up[fl2r]Up[fl2r]CpmUpmGpmCpmCpmGpmUpmCpmUpmU[Ssp]mA-3’ thereof with a compound, wherein the compound is9712579081V1088290.021045. The method of claim 44, wherein 5’- mU[Ssp]mCpmUpmUpmUpmCp[fl2r]CpmAp[fl2r]Up[fl2r]Up[fl2r]CpmUpmGpmCpmCpmGp mUpmCpmUpmU[Ssp]mA-3’ is one or more salt forms.

46. A compound of the Formula I-a, or a pharmaceutically acceptable salt thereof.

47. A compound of the Formula I-b.

48. A compound of the Formula Il-a.

49. A compound of the Formula Il-b, or a pharmaceutically acceptable salt thereof.

50. A double-stranded RNAi (dsRNAi) agent of the Formula Ill-a, or an acid agent of the dsRNAi agent of Formula III in which acid agent each of Na is replaced with H.

51. A double-stranded RNAi (dsRNAi) agent of the Formula Ill-a, or a pharmaceutically acceptable salt thereof.52 A double-stranded RNAi (dsRNAi) agent of the Formula Ill-b.

53. A method of decreasing the infiltration of activated macrophages in visceral adipose of a subject comprising administering to the subject an effective amount of the dsRNAi agent of claim 5 or 6.

54. The method of claim 53, wherein said infiltration of activated macrophages in visceral adipose is decreased by at least 50%.

55. The method of claim 53 or 54, wherein said decreasing the infiltration of activated macrophages in visceral adipose leads to a suppression of adipose fibrosis.9812579081V1088290.021056. A method for decreasing the level of activin E protein in a subject, comprising administering to the subject an effective amount of the dsRNAi agent of claim 5 or 6.

57. A double-stranded RNAi (dsRNAi) agent capable of directing target-specific RNA interference, the dsRNAi agent comprising a guide strand and a passenger strand, wherein: the passenger strand is an oligonucleotide having the structure of5’-[GalNAc3C12oyl][nC6o]pmU[Ssp]mCpmUpmUpmUpmCp[fl2r]CpmAp[fl2r]Up[f!2r]Up[fl2r]CpmUpmGpmCpmCpmGpmUpmCpmUpmU[Ssp]mA-3’ or a pharmaceutically acceptable salt form thereof, wherein:[GalNAc3C12oyl] represents tri-antennary GalNAc with C12 linker having the structure of[nC6o] represents 6-aminohexanol; p represents phosphate linkage (PO); mU represents 2’ -O-m ethyluridine;[Ssp] represents Sp phosphorothioate linkage CS'p-PS), mC represents 2’-O-methylcytidine;[fl2r]C represents 2’-fluoro-2’-deoxycytidine; mA represents 2’ -<9-m ethyladenosine;[fl2r]U represents 2’ -fluoro-2’ -deoxyuridine; and mG represents 2’ -O-m ethylguanosine; and the guide strand is an oligonucleotide having the structure of9912579081V1088290.02105’-[cp][tz][d5m]U[Ssp][fl2r]A[Rsp]mA[n00] S][fl2r]GpmAp[fl2r]CpmGpm(}pmCpmA [n001R][fl2r]GpmApmAp[fl2r]UpmGp[fl2r]GpmApmApmApmGpmA[Ssp]mU[Ssp]mU-3’ or a pharmaceutically acceptable salt form thereof, wherein:[cp] represents capping phosphate;[tz] represents 177-1,2,3-triazole (1,4 linkage);[d5m]U represents 5’-deoxy-2’-(9-methyluridine;[Ssp] represents Sp phosphorothioate linkage (5p-PS);[fl2r]A represents 2 ’-fluoro-2’ -deoxy adenosine;[Rsp] represents Ap phosphorothioate linkage (Ap-PS); mA represents 2’-O-methyladenosine;[nOOlS] represents 5p A-(l,3-dimethylimidazolidin-2-ylidene)phosphoramidate linkage (5p- PN);[fl2r]G represents 2’-fluoro-2’-deoxyguanosine; p represents phosphate linkage (PO);[fl2r]C represents 2’-fluoro-2’-deoxycytidine; mG represents 2’-O-methylguanosine; mC represents 2’-O-methylcytidine;[nOOIR] represents Ap A-(l,3-dimethylimidazolidin-2-ylidene)phosphoramidate linkage (Ap- PN);[fl2r]U represents 2’-fluoro-2’-deoxyuridine; and mU represents 2’-O-methyluridine, wherein [cp][tz] represents (l / f-l,2,3-triazol-4-yl)phosphonate.

58. A double-stranded RNAi (dsRNAi) agent capable of directing target-specific RNA interference, the dsRNAi agent comprising a guide strand and a passenger strand, wherein: the passenger strand is an oligonucleotide having the structure ofRNAl {p.m(U)[Ssp].m(C)p.m(U)p.m(U)p.m(U)p.m(C)p.[fl2r](C)p.m(A)p.[fl2r](U)p.[fl2r](U)p.[fl2r ](C)p.m(U)p.m(G)p.m(C)p.m(C)p.m(G)p.m(U)p.m(C)p.m(U)p.m(U)[Ssp] ,m(A)} |CHEM 1 { [nC6o] } |CHEM2{[GalNAc3C12oyl]}$CHEMl,RNAl,l:Rl-l:Rl|CHEMl,CHEM2,l:R2-l:Rl$$$V2.0; and10012579081V1088290.0210 the guide strand is an oligonucleotide having the structure ofRNAl{[d5m](U)[Ssp].[fl2r](A)[Rsp].m(A)[n001S].[fl2r](G)p.m(A)p.[fl2r](C)p.m(G)p.m(G)p.m(C) p.m(A)[n001R].[fl2r](G)p.m(A)p.m(A)p.[fl2r](U)p.m(G)p.[fl2r](G)p.m(A)p.m(A)p.m(A)p.m(G)p.m (A)[Ssp].m(U)[Ssp].m(U))|CHEMl{[ptz])$CHEMl,RNAl,l:Rl-l:Rl$$$V2.0.

59. A double-stranded RNAi (dsRNAi) agent capable of directing target-specific RNA interference, the dsRNAi agent having the structure ofRNAl {p.m(U)[Ssp].m(C)p.m(U)p.m(U)p.m(U)p.m(C)p.[fl2r](C)p.m(A)p.[fl2r](U)p.[fl2r](U)p.[ fl2r](C)p.m(U)p.m(G)p.m(C)p.m(C)p.m(G)p.m(U)p.m(C)p.m(U)p.m(U)[Ssp].m(A)}|RNA2{[d5 m](U)[Ssp].[fl2r](A)[Rsp].m(A)[n001S].[fl2r](G)p.m(A)p.[fl2r](C)p.m(G)p.m(G)p.m(C)p.m(A) [n001R].[fl2r](G)p.m(A)p.m(A)p.[fl2r](U)p.m(G)p.[fl2r](G)p.m(A)p.m(A)p.m(A)p.m(G)p.m(A)[Ssp].m(U)[Ssp].m(U)}|CHEMl{[nC6o]}|CHEM2{[GalNAc3C12oyl]}|CHEM3{[ptz]}$CHEM 1,RNA1,1 :R1-1 :R1 |CHEM3,RNA2,1 :R1-1 :R1 |CHEM1,CHEM2,1 :R2-1 :R1$$$V2.O.

60. A double-stranded RNAi (dsRNAi) agent capable of directing target-specific RNA interference, the dsRNAi agent comprising a guide strand and a passenger strand, wherein: the passenger strand is an oligonucleotide having the structure of Formula I-a or Formula I-b; and the guide strand is an oligonucleotide having the structure of Formula Il-a or Formula Il-b.

61. A double-stranded RNAi (dsRNAi) agent capable of directing target-specific RNA interference, the dsRNAi agent having the structure of Formula Ill-a or Formula Ill-b.

62. A double-stranded RNAi (dsRNAi) agent capable of directing target-specific RNA interference, the dsRNAi agent comprising a guide strand and a passenger strand, wherein: the passenger strand is an oligonucleotide having the structure of10112579081V1088290.021010212579081V1088290.021010312579081V1088290.0210or10412579081V1088290.021063. A double-stranded RNAi (dsRNAi) agent capable of directing target-specific RNA interference, the dsRNAi agent having the structure of10512579081V1088290.021010612579081V1088290.0210or10712579081V1088290.021010812579081V1088290.021064. A double-stranded RNAi (dsRNAi) agent capable of directing target-specific RNA interference, the dsRNAi agent comprising a guide strand and a passenger strand, wherein: the passenger strand is an oligonucleotide having the structure of5'-O-(6-(12-(tris(((3-((3-((5-((2-(acetylamino)-2-deoxy-P-D-galactopyranosyl)oxy)-l- oxopentyl)amino)propyl)amino)-3-oxopropoxy)methyl))methyl)amino-12-oxododecanamido)hexyl phospho)-[ / V5)]-2'-O-methyl- / J-thiouridylyl-(3'^5')-2'-O-methylcytidyl-(3'^5')-2'-O- methyluridylyl-(3'— >5')-2'-O-rnethyluridylyl-(3'— >5')- 2'-<9-methyluridylyl-(3'^-5')-2'-O- methylcytidyl-(3'^5')-2'-fhioro-2'-deoxycytidylyl-(3'— >5')-2'-O-methyladenylyl-(3'— >5')-2'-fluoro- 2'-deoxyuridylyl-(3'^5')-2'-fluoro-2'-deoxyuridylyl-(3'^5')-2'-fluoro-2'-deoxycytidylyl-(3'^5')-2'- fAmethyluridylyl-(3' >5')-2'-(9-mcthylguanylyl-(3' >5')-2'-(9-methylcytidyl-(3' >5')-2'-(9-10912579081V1088290.0210 methylcytidyl -(3 '—>5 ')-2'-O-methylguanylyl-(3'^-5')-2'-O-methyluridylyl -(3 '—>5 ')-2'-0- mcthylcytidyl-(3' >5')-2'-O-methyluridylyl-(3' >5')-[ / ¥,S)]-2'-O-rncthyl- / J-thiouridylyl-(3' >5')-2'-O-methyl adenine, henicosasodium salt; and the guide strand is an oligonucleotide having the structure of[ / J6S^]-5'-(4-Phosphono-l ,2,3-triazol-l-yl)-5'-deoxy-2'-O-rnethyl- / J-thiouridylyl-(3'^5')-[ / ¥ / ^]-2'- fluoro-2'-deoxy-P-thioadenylyl-(3'^5')-[7?f59]-2'-O-methyl-P-deoxy-7’-[(l ,3-dimethylimidazolidin- 2-ylidene)amino]adenylyl-(3'—>5')-2'-fluoro-2'-deoxyguanylyl-(3'—>5')-2'-O-methyladenylyl-(3'— >5')-2'-fluoro-2'-deoxycytidylyl-(3'— >5')-2'-O-methylguanylyl-(3'^>-5')-2'-O-methylguanylyl- (3 ’ >5')-2'-t3-mcthylcytidyl-(3' >5')-[ / ¥ / ?;]-2,-O-mcthyl- / J-dcoxy - / *-[(!, 3-dimethylimidazolidin-2- ylidene)amino]adenylyl-(3'^5')-2'-fluoro-2'-deoxyguanylyl-(3'^5')-2'-<9-methyladenylyl-(3'^-5')- 2'-O-methyladenylyl-(3 >5')-2'-fluoro-2'-deoxyuridylyl-(3'— >-5')-2'-O-methylguanylyl-(3'— >5')-2'- fluoro-2'-deoxyguanylyl-(3 '^5')-2'-O-methyladenylyl-(3'^5')42'-O-methyladenylyl-(3'—>-5')-2'-(9- methyladenylyl-(3'^-5')-2'-(?-methylguanylyl-(3'^5')-[7’f59]-2'-O-methyl- / ’-thioadenylyl-(3'^5')- [Pf$]-2'-O-methyl-P-thiouridylyl-(3'— >5')-2'-O-methyluridine, docosasodium salt.11012579081V1

Citation Information

Patent Citations

  • Oligonucleotide compositions and methods thereof

    US20230392137A1

  • Double stranded oligonucleotide compositions and methods relating thereto

    US20240279658A1

  • Compositions for editing MECP2 transcripts and methods thereof

    WO2023049477A2

  • Oligonucleotide compositions and methods thereof

    WO2025213142A2