Method for preparing adipocyte-derived dedifferentiated stem cells by using centrifugation, and use thereof
A centrifugation-based method for producing adipocyte-derived induced pluripotent stem cells addresses the time inefficiency of conventional methods, achieving rapid production of pluripotent stem cells with comparable characteristics for therapeutic applications.
Patent Information
- Application Number
- PCT/KR2025/099662
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-09-11
- Filing Date
- 2025-03-12
- Publication Date
- 2026-03-19
AI Technical Summary
Conventional methods for producing adipocyte-derived induced pluripotent stem cells are time-consuming, typically taking 10 to 14 days, and result in cells with mesenchymal stem cell characteristics rather than pure adipocyte-derived induced pluripotent stem cells.
A method involving the separation of adipose tissue, enzymatic treatment, centrifugation to obtain stromal vascular fraction and adipocytes, and further centrifugation to produce pure adipose stem cells, followed by centrifugation to derive induced pluripotent stem cells, utilizing centrifugal force and specific temperature and time conditions.
The method significantly reduces production time and produces adipocyte-derived induced pluripotent stem cells with characteristics similar to those produced by conventional ceiling culture, capable of differentiating into various cell types, suitable for autologous adipose-derived stem cell therapeutics.
Smart Images

Figure KR2025099662_19032026_PF_FP_ABST
Abstract
Description
Method for producing adipocyte-derived induced pluripotent stem cells using centrifugation and the use thereof
[0001] The present invention relates to a method for producing adipocyte-derived induced pluripotent stem cells using centrifugation and the use thereof.
[0002] This invention is a study conducted with the support of the Ministry of Science and ICT (Project Name: ICT-based Radiopharmaceutical Healthcare Center Construction Project, Project No.: 731210-2025).
[0003] Stem cells are undifferentiated cells found in embryos or adults that can differentiate into various types of cells. Stem cells possess the characteristics of self-renewal and differentiation, enabling a continuous supply through self-replication and the ability to differentiate into diverse cell types. Because these characteristics allow for the replacement of diseased cells with healthy ones, stem cells are attracting attention in the field of regenerative medicine. Based on their differentiation ability, stem cells can be classified into pluripotent stem cells, which can differentiate into all cell types, and adult stem cells, which can differentiate only into specific cell types such as heart, liver, and blood cells.
[0004] Dedifferentiated fat cell-derived stem cells are induced pluripotent stem cells derived from mature fat cells; unlike adipose tissue-derived mesenchymal stem cells (ASCs), which are a heterogeneous cell population, they are a pure cell population that possesses characteristics similar to adult stem cells.
[0005] Since it was confirmed in 1986 by Sugihara et al. that adipocytes undergo delipidation in ceiling culture for culturing adipocytes, much research has been conducted on obtaining adipocyte-derived induced pluripotent stem cells (iPSCs) with stem cell characteristics from adipocytes. Most follow-up studies have been conducted by obtaining adipocyte-derived iPSCs through ceiling culture. In 2020, Li et al. proposed the possibility of obtaining adipocyte-derived iPSCs through osmotic pressure in hypertonic media and confirmed the possibility of dedifferentiation of adipocytes due to physical stress.
[0006] However, conventional technology for producing adipocyte-derived induced pluripotent stem cells involves fibroblasts that have lost their fat droplets due to gravity or osmotic pressure, and possesses the characteristics of mesenchymal stem cells. Furthermore, it takes approximately 10 to 14 days to produce induced pluripotent stem cells from adipocytes, so there is a need for a method to produce adipocyte-derived induced pluripotent stem cells in a shorter time.
[0007] To solve the above-mentioned problems, the inventors produced induced pluripotent stem cells derived from fat cells by isolating pure fat cells and applying centrifugal force to the fat cells, and completed the present invention by confirming that the characteristics of the induced pluripotent stem cells produced in this manner are similar not only to induced pluripotent stem cells cultured by the conventional ceiling culture method but also to the original fat-derived stem cells.
[0008] Therefore, the objective of the present invention is to
[0009] (a) A step of separating adipose tissue from an individual;
[0010] (b) a step of washing and enzymatically treating the separated adipose tissue; and
[0011] (c) a step of centrifuging the enzyme-treated tissue from step (b) above to obtain a stromal vascular fraction (SVF) and adipocytes;
[0012] (d) a step of obtaining pure adipose stem cells by centrifuging SVF; and
[0013] (e) a step of producing induced pluripotent stem cells by centrifuging the pure fat cells obtained in step (d) above;
[0014] The present invention provides a method for manufacturing adipocyte-derived induced pluripotent stem cells comprising
[0015] Terms used in this specification are for illustrative purposes only and should not be interpreted as intended to be limiting. Terms used in singular samples of the specification are for illustrative purposes only and should not be interpreted as intended to be limiting. Singular expressions include plural expressions unless the context clearly indicates otherwise. In this specification, terms such as "comprising" or "having" are intended to indicate the existence of the features, numbers, steps, actions, components, parts, or combinations thereof described in the specification, and should be understood as not precluding the existence or addition of one or more other features, numbers, steps, actions, components, parts, or combinations thereof.
[0016] Furthermore, unless otherwise defined, all terms used herein, including technical or scientific terms, have the same meaning as generally understood by those skilled in the art to which the embodiments pertain. Terms such as those defined in commonly used dictionaries should be interpreted as having a meaning consistent with their meaning in the context of the relevant technology, and should not be interpreted in an ideal or overly formal sense unless explicitly defined in this application.
[0017] In the case of duplicate content or terms in this invention, their description has been omitted to avoid excessive complexity in this specification.
[0018]
[0019] To achieve the above objective, one aspect of the present invention provides a method for producing adipocyte-derived induced pluripotent stem cells comprising the following steps:
[0020] (a) A step of separating adipose tissue from an individual;
[0021] (b) a step of washing and enzymatically treating the separated adipose tissue; and
[0022] (c) a step of centrifuging the enzyme-treated tissue from step (b) above to obtain the stromal vascular fraction (SVF) and adipocytes;
[0023] (d) a step of obtaining pure adipose stem cells by centrifuging SVF; and
[0024] (e) A step of producing induced pluripotent stem cells by centrifuging the pure fat cells obtained in step (d) above.
[0025] The term "stem cell" as used in the present invention refers to a cell that possesses the ability to self-replicate and differentiate into two or more different types of cells. Stem cells can be classified according to their differentiation ability into totipotent stem cells, pluripotent stem cells, and multipotent stem cells.
[0026] The term "adipocyte-derived induced pluripotent stem cells" as used in this invention refers to cells extracted from adipose tissue that have been reverted back to stem cells through dedifferentiation technology. These stem cells possess multipotential and can differentiate into various types of cells, and can be utilized for tissue regeneration and the repair of damaged organs.
[0027] The term "centrifugation" as used in this invention refers to an experimental technique that separates constituent components based on density differences by rotating a sample at high speed. During the centrifugation process, large and heavy components move outward due to centrifugal force, while light and small components move inward. In this invention, centrifugation is performed under various temperature, centrifugal force, and time conditions to dedifferentiate adipocytes and enable the acquisition of multipotential.
[0028] In a method for producing adipocyte-derived induced pluripotent stem cells according to one embodiment of the present invention, the centrifugation of step (e) may be performed at a temperature of 0°C to 40°C, preferably at 4°C to 25°C, but is not limited thereto.
[0029] In addition, in a method for producing adipocyte-derived induced pluripotent stem cells according to one embodiment of the present invention, the centrifugation in step (e) may be performed with a centrifugal force of 10x g to 1000x g, preferably with a centrifugal force of 100x g to 600x g, but is not limited thereto.
[0030] In addition, in a method for producing adipocyte-derived induced pluripotent stem cells according to one embodiment of the present invention, the centrifugation of step (e) may be performed for 1 minute to 120 minutes, preferably for 5 minutes to 60 minutes, but is not limited thereto.
[0031] Such temperature, centrifugal force, and execution time are not individual, and two or more conditions can be set and executed simultaneously.
[0032]
[0033] The adipocyte-derived induced pluripotent stem cells according to the present invention can differentiate into different types of cells, for example, adipocytes, chondrocytes, osteocytes, neurons, ligament cells, or tenocytes, but are not limited thereto.
[0034] In this invention, "differentiation" generally refers to the phenomenon in which a relatively simple limit separates into two or more qualitatively different subsystems. Specifically, it refers to the phenomenon in which the structure or function of cells becomes specialized during growth through cell division and proliferation; that is, it refers to the phenomenon in which the form or function of biological cells, tissues, etc., changes in order to perform the tasks assigned to each. Relatively speaking, "undifferentiated" refers to a state in which the aforementioned differentiation has not occurred and which still retains the characteristics of a stem cell.
[0035] The method of differentiating stem cells can be performed according to conventionally known methods and is not particularly limited. For example, it is preferable to use a method of differentiating the stem cells into adipocytes by culturing them in a medium containing dexamethasone, indomethacin, insulin, and IBMX (3-isobutyl-1-methylxanthine); a method of differentiating the stem cells into chondrocytes by culturing them in a medium containing dexamethasone, BMP-6 (bone morphogenetic protein 6), TGF (β-growth factor beta), ascorbic acid, and L-proline; or a method of differentiating the stem cells into osteocytes by culturing them in a medium containing dexamethasone, ascorbic acid, β-glycophosphate (β- and ascorbic acid-2-phosphate).
[0036] The adipocyte-derived induced pluripotent stem cells of the present invention not only show no difference from or superior to adipocyte-derived mesenchymal stem cells and adipocyte-derived induced pluripotent stem cells of the ceiling culture method in terms of surface antigen expression, cell differentiation ability, and cell viability, but can also differentiate into various types of cells such as adipocytes, chondrocytes, osteocytes, neurons, ligament cells, or tenocytes, so they can be utilized as cell therapeutic agents and tissue regeneration compositions for the purpose of tissue regeneration in the future.
[0037] A method for producing adipocyte-derived induced pluripotent stem cells using centrifugation according to one embodiment of the present invention, and the adipocyte-derived induced pluripotent stem cells produced using the same, can be usefully utilized in the field of autologous adipose-derived stem cell therapeutics by significantly shortening the production period compared to adipocyte-derived induced pluripotent stem cells produced by the conventional ceiling culture method.
[0038] FIG. 1 is a schematic diagram illustrating a method for producing adipocyte-derived induced pluripotent stem cells using centrifugation according to one embodiment of the present invention.
[0039] Figure 2 is a figure showing the degree of contamination of fat cells isolated from adipose tissue, confirmed through flow cytometry after staining the fat cells.
[0040] Figure 3 is a figure showing the cell membrane and cell nucleus of an adipocyte stained to confirm and trace the origin of adipocyte-derived induced pluripotent stem cells.
[0041] Figure 4 is a figure confirming whether adipocyte-derived induced pluripotent stem cells were produced under centrifugation conditions at 4℃.
[0042] Figure 5 is a figure confirming whether adipocyte-derived induced pluripotent stem cells were produced under centrifugation conditions at 15℃.
[0043] Figure 6 is a figure confirming whether adipocyte-derived induced pluripotent stem cells were produced under centrifugation conditions at 25℃.
[0044] Figure 7 is a figure comparing surface antigen expression by cell type through flow cytometry for adipose-derived mesenchymal stem cells (ASC), adipose-derived induced pluripotent stem cells (quick Dedifferentiated Adipocyte, qDA) obtained by centrifugation according to an embodiment of the present invention, and adipose-derived induced pluripotent stem cells (Dedifferentiated Adipocyte, DA) obtained by ceiling culture, in order to confirm whether the adipose-derived induced pluripotent stem cells obtained by centrifugation according to an embodiment of the present invention possess the characteristics of adipose-derived induced pluripotent stem cells.
[0045] Figure 8 is a figure comparing the growth rates by cell type for ASC, qDA, and DA to confirm whether adipocyte-derived induced pluripotent stem cells obtained by centrifugation according to one embodiment of the present invention possess the characteristics of adipocyte-derived induced pluripotent stem cells.
[0046] Figure 9 is a figure comparing the adipocyte differentiation ability by cell type for ASC, qDA, and DA to confirm whether adipocyte-derived induced pluripotent stem cells obtained by centrifugation according to an embodiment of the present invention possess the characteristics of adipocyte-derived induced pluripotent stem cells.
[0047] Figure 10 is a figure comparing the adipocyte differentiation ability by cell type for ASC, qDA, and DA to confirm whether adipocyte-derived induced pluripotent stem cells obtained by centrifugation according to one embodiment of the present invention possess the characteristics of adipocyte-derived induced pluripotent stem cells.
[0048] Figure 11 is a figure comparing the differentiation into adipocytes (top) and osteocytes (bottom) for ASC, qDA, and DA to confirm whether adipocyte-derived induced pluripotent stem cells using centrifugation according to one embodiment of the present invention possess the characteristics of adipocyte-derived induced pluripotent stem cells.
[0049] The following examples are solely for the purpose of explaining the invention more specifically, and it will be obvious to those skilled in the art that the scope of the invention is not limited by these examples according to the gist of the invention.
[0050]
[0051] Prior to the examples, a schematic diagram of a method for producing adipocyte-derived induced pluripotent stem cells using centrifugation according to the present invention is shown in FIG. 1.
[0052]
[0053] Example 1. Acquisition and mincing of white adipose tissue
[0054] 53.01±2.11g of white adipose tissue was separated from the inguinal region of 8 male mice (3879±322g) of the 30-week-old C57BL / 6J DIO strain and washed in cold Dulbecco phosphate-buffered saline (DPBS) until no foreign matter was removed. The washed white adipose tissue was placed in a 35mm Petri dish, lightly moistened with Dispase solution, and cut into pieces smaller than 1mm using curved scissors.
[0055]
[0056] Example 2. Enzymatic treatment of white adipose tissue
[0057] Collagenase I was dissolved in Dispase solution at a concentration of 300 unit / ml, and then 20 ml of the enzyme solution and minced white adipose tissue were added. The mixture was then reacted in a 37°C shaking incubator at 120 rpm for 30–40 minutes, after which an equal volume of growth medium (DMEM / F-12, 10% FBS, 1X Glutamate, 10 mM HEPES, 1% Anti-anti) was added to stop the enzyme reaction. Subsequently, the mixture was filtered through a 100 µm sieve to remove any undissolved tissue.
[0058]
[0059] Example 3. Separation of stromal vascular fraction (SVF) and adipocytes
[0060] After digestion, white adipose tissue filtered through a sieve was centrifuged at 4°C and 300g for 3 minutes. The adipocytes in the supernatant were transferred to a new test tube. Then, 2 ml of RBC lysis buffer was added to the SVF pellet at the bottom of the test tube and reacted for 2 minutes to remove any remaining red blood cells in the SVF. 10 ml of DPBS was added to the SVF and centrifuged at 4°C and 300g for 3 minutes, after which the supernatant was discarded. 5 ml of DPBS was added to the SVF pellet and centrifuged at 300g for 3 minutes to wash away the RBS lysis buffer. After discarding the supernatant, the SVF pellet was suspended in growth medium (DMEM / F-12, 10% FBS, 1X Glutamate, 10mM HEPES, 1% Anti-anti) and subcultured to obtain mesenchymal stem cells.
[0061]
[0062] Example 4. Confirmation of fat cell contamination level
[0063] Adipocytes isolated from adipose tissue were centrifuged three times for 3 minutes at 300g at 4℃ with 10ml of growth medium added to remove fibroblasts and other cells that may have contaminated the adipocytes. 100μl of adipocytes were used as a sample and stained with BODIPY FL C16, an adipose-specific staining agent, at a concentration of 1:2000, and with CD44, a surface antigen specific to mesenchymal stem cells, at a concentration of 1:50. The results of the analysis using a flow cytometer are shown in Figure 2.
[0064] As shown in Figure 2, 99.8±0.2% of the adipocytes were detected stained with BODIPY FL C16, an adipocyte-specific staining agent, and 0.775±0.475% of CD44, a surface antigen specific to mesenchymal stem cells, were detected, confirming that the purity of the adipocytes was extremely high.
[0065]
[0066] Example 5. Production of adipocyte-derived induced pluripotent stem cells via ceiling culture and centrifugation
[0067] Adipocytes with confirmed purity were divided into two groups. For the first group, adipocytes were placed in a 12.5T flask filled with growth medium using conventional technology and induced pluripotent stem cells were produced by ceiling culture for 14 days. For the second group, adipocytes were suspended in a test tube in 10ml of growth medium, centrifuged at 4℃ and 300g for 5 minutes, the supernatant was removed, and the pellet at the bottom of the test tube was resuspended in culture medium and subcultured in a 60mm Petri dish to produce adipocyte-derived induced pluripotent stem cells.
[0068]
[0069] Example 6. Tracing the origin of adipocyte-derived induced pluripotent stem cells and confirming the range of conditions under which adipocyte-derived induced pluripotent stem cells are produced
[0070] To confirm and trace the origin of adipocyte-derived induced pluripotent stem cells, the cell membranes of adipocytes with confirmed purity were stained using a 4μM PKH26 red fluorescent cell linker kit, and the cell nuclei were stained using a Hoechst 33342 Staining Kit, as shown in Figure 3.
[0071] In addition, adipocytes stained with PKH26 red fluorescent cell linker were suspended in 2 ml of growth medium in a 24-well plate, and the condition range of induced pluripotent stem cells produced by centrifugation was determined. Centrifugation was performed at different temperatures (4°C, 15°C, 25°C), centrifugal forces (100x g, 300x g, 600x g), and centrifugal force application times (5 min, 30 min, 60 min). After centrifugation, the adipocytes in the upper layer were removed, and the cells were cultured for 7 days in a humidified incubator at 37°C, 5% CO2. The cell nuclei were then stained separately with Hoechst 33342, and the results of confirming whether adipocyte-derived induced pluripotent stem cells were produced using a fluorescence microscope are shown in Figures 4 to 6.
[0072] As shown in Figures 4 to 6, it was confirmed that adipocyte-derived induced pluripotent stem cells were produced under all conditions when centrifuged for 5 to 60 minutes at a temperature of 4 to 25°C and a centrifugal force of 100x g to 600x g.
[0073]
[0074] Example 7. Comparison of surface antigen expression of adipose-derived mesenchymal stem cells and adipocyte-derived induced pluripotent stem cells produced by ceiling culture and centrifugation
[0075] To confirm whether adipocyte-derived induced pluripotent stem cells obtained by centrifugation according to the present invention possess the characteristics of adipocyte-derived induced pluripotent stem cells, adipose-derived mesenchymal stem cells (ASC), adipocyte-derived induced pluripotent stem cells obtained by centrifugation according to the present invention (qDA), and adipocyte-derived induced pluripotent stem cells obtained by ceiling culture (DA) were subcultured up to passage 10, and each 1x10 6 After suspending the cells in DPBS, staining each antibody at a ratio of 1:50 was performed at room temperature for 15 minutes, then washed twice with PBS, suspended in 500 µl of PBS, and flow cytometry was performed to compare surface antigen expression, and the results are shown in Figure 7.
[0076] As shown in Figure 7, it was confirmed that adipocyte-derived induced pluripotent stem cells using centrifugation according to the present invention showed no difference or superior surface antigen expression compared to adipocyte-derived mesenchymal stem cells and adipocyte-derived induced pluripotent stem cells from ceiling culture.
[0077] The antibodies used for the analysis of surface antigen expression via flow cytometry are as follows. Rat IgG2a kappa Isotype Control (eBR2a)-FITC (eBioscience™, #11-4321-80) as CD34 isotype, CD34 Monoclonal Antibody (RAM34)-FITC, (eBioscience™, #11-0341), Rat IgG2b kappa Isotype Control (eB149 / 10H5)-PE as CD44 and CD90.2 isotype. Rats with (eBioscience™, #12-4031-82), CD44 Monoclonal Antibody (IM7)-PE (eBioscience™, #12-0441-82), CD90.2 (Thy-1.2) Monoclonal Antibody (30-H12)-PE (eBioscience™, #12-0903-83), CD105 and Sca-1 isotype. IgG2a kappa Isotype Control (eBR2a)-PE (eBioscience™, #12-4321-80), Ly-6A / E (Sca-1) Monoclonal Antibody (D7)-PE (eBioscience™, #12-5981-82)
[0078]
[0079] Example 8. Comparison of cell growth rates of adipose-derived mesenchymal stem cells and adipocyte-derived induced pluripotent stem cells produced by ceiling culture and centrifugation
[0080] To confirm whether adipocyte-derived induced pluripotent stem cells obtained by centrifugation according to the present invention possess the characteristics of adipocyte-derived induced pluripotent stem cells, adipose-derived mesenchymal stem cells (ASC), adipocyte-derived induced pluripotent stem cells obtained by centrifugation according to the present invention (qDA), and adipocyte-derived induced pluripotent stem cells obtained by ceiling culture (DA) were subcultured up to passage 10, and each 1x10 3 Cell growth rates of several cells were compared in a 96-well plate on days 1, 4, 7, and 10 using the CellTiter 96® AQueous One Solution Cell Proliferation Assay (Promega, G3580), and the results are shown in Figure 8.
[0081] As shown in Fig. 8, it was confirmed that the adipocyte-derived induced pluripotent stem cells using centrifugation according to the present invention showed no difference in cell growth rate or were superior to the adipocyte-derived mesenchymal stem cells and adipocyte-derived induced pluripotent stem cells from ceiling culture.
[0082]
[0083] Example 9. Comparison of adipocyte differentiation ability between adipose-derived mesenchymal stem cells and adipocyte-derived induced pluripotent stem cells produced by ceiling culture and centrifugation
[0084] In order to confirm whether the adipocyte-derived induced pluripotent stem cells obtained by centrifugation according to the present invention possess the characteristics of adipocyte-derived induced pluripotent stem cells, adipose-derived mesenchymal stem cells (ASC), adipocyte-derived induced pluripotent stem cells obtained by centrifugation according to the present invention (qDA), and adipocyte-derived induced pluripotent stem cells obtained by ceiling culture (DA) were subcultured up to passage 10, and when the cells grew to 70% confluency, the culture dish in which the cells were growing was washed with PBS and replaced with adipocyte differentiation medium (MesenCult Adipogenic Mouse Differ Kit, Stemcell, #05507), and the cells were cultured for 14 days by replacing with new adipocyte differentiation medium every 2-3 days. Cells that had completed differentiation for 14 days were isolated from culture dishes, and total RNA was extracted using an RNA extraction kit (RNeasy Plus Mini kit, Qiuagen) according to the manufacturer's manual. Then, cDNA was synthesized using a cDNA synthesis kit (PrimeScript™ 1st strand cDNA Synthesis Kit, TAKARA, # 6110) according to the manufacturer's manual. To compare gene expression related to adipocyte differentiation, mRNA sequences of PPARγ2 (GenBank Accession number: U09138) and Adiponectin (AdipoQ, GenBank Accession number: NM_009605), which are representative gene markers of adipocytes, were identified from NCBI (https: / / www.ncbi.nlm.nih.gov / ), and oligos capable of amplifying each gene were constructed.
[0085] The nucleotide sequences for each gene marker are as follows: PPARγ2 forward primer: GATTCTCCTGTTGACCCAGAGC, PPARγ2 reverse primer: GCTGATTCCGAAGTTGGTGG, Adiponectin forward primer: GCACTGGCAAGTTCTACTGCAA, Adiponectin reverse primer: GTAGGTGAAGAGAACGGCCTTGT
[0086] Real-time RT-PCR was performed three times on each gene using 100 µg of cDNA, 1 pmole of forward primer, 1 pmole of reverse primer, and 2x SYBR of adipose-derived mesenchymal stem cells (ASC), adipocyte-derived induced pluripotent stem cells (qDA) according to the present invention and adipocyte-derived induced pluripotent stem cells (DA) from the ceiling culture method, and the adipocyte differentiation ability was compared, and the results are shown in Figures 9 to 11.
[0087] As shown in FIGS. 9 to 11, it was confirmed that adipocyte-derived induced pluripotent stem cells using centrifugation according to the present invention showed no difference in cell growth rate or were superior to adipocyte-derived mesenchymal stem cells and adipocyte-derived induced pluripotent stem cells from ceiling culture.
[0088]
[0089] Example 10. Comparison of osteocytic differentiation ability of adipose-derived mesenchymal stem cells and adipocyte-derived induced pluripotent stem cells produced by ceiling culture and centrifugation
[0090] In order to confirm whether the adipocyte-derived induced pluripotent stem cells obtained by centrifugation according to the present invention possess the characteristics of adipocyte-derived induced pluripotent stem cells, adipose-derived mesenchymal stem cells (ASC), adipocyte-derived induced pluripotent stem cells obtained by centrifugation according to the present invention (qDA), and adipocyte-derived induced pluripotent stem cells obtained by ceiling culture (DA) were subcultured up to passage 10, and when the cells grew to 70% confluency, the culture dish in which the cells were growing was washed with PBS, replaced with osteocytic differentiation medium (MesenCult Mouse Osteogenic Stimulatory Kit, Stemcell, #05504), and cultured. The adipocyte differentiation medium was replaced with a new medium every 2-3 days and differentiated for 14 days. Cells that had completed differentiation for 14 days were isolated from culture dishes, and total RNA was extracted using an RNA extraction kit (RNeasy Plus Mini kit, Qiuagen) according to the manufacturer's manual. Then, cDNA was synthesized using a cDNA synthesis kit (PrimeScript™ 1st strand cDNA Synthesis Kit, TAKARA, # 6110) according to the manufacturer's manual. To compare gene expression related to osteocytic differentiation, mRNA sequences of Osteopontin (Opn, GenBank Accession number: J04806) and Sclerostin (Sost, GenBank Accession number: NM_024449), which are representative gene markers of osteocytes, were identified from NCBI (https: / / www.ncbi.nlm.nih.gov / ), and oligos capable of amplifying each gene were constructed.
[0091] The nucleotide sequences for each gene marker are as follows. Osteopontin forward primer: CCCGGTGAAAGTGACTGATT, Osteopontin reverse primer: GGCTTTCATTGGAATTGCTT, Sclerostin forward primer: GTGCCTCATCTGCCTACTT, Sclerostin reverse primer: GGTCTGCCTCCATTCTCC
[0092] The osteocytic differentiation ability of adipose-derived mesenchymal stem cells (ASC), adipocyte-derived induced pluripotent stem cells (qDA) according to the present invention using centrifugation, and adipocyte-derived induced pluripotent stem cells (DA) from ceiling culture was compared by performing real-time polymerase chain reaction (Real-time RT-PCR) three times on each gene using 100 µg of cDNA, 1 pmole of forward primer, 1 pmole of reverse primer, and 2x SYBR, and the results are shown in Figures 10 and 11.
[0093] As shown in FIGS. 10 to 11, it was confirmed that adipocyte-derived induced pluripotent stem cells produced by centrifugation according to the present invention showed no difference from or superior to adipocyte-derived mesenchymal stem cells and adipocyte-derived induced pluripotent stem cells produced by ceiling culture in terms of osteocytic differentiation ability.
[0094]
[0095] Foregoing, specific parts of the present invention have been described in detail. It will be apparent to those skilled in the art that such specific descriptions are merely preferred embodiments and do not limit the scope of the invention. Accordingly, the actual scope of the invention is defined by the appended claims and their equivalents.
[0096] A method for producing adipocyte-derived induced pluripotent stem cells using centrifugation according to one embodiment of the present invention, and the adipocyte-derived induced pluripotent stem cells produced using the same, can be usefully utilized in the field of autologous adipose-derived stem cell therapeutics by significantly shortening the production period compared to adipocyte-derived induced pluripotent stem cells produced by the conventional ceiling culture method, thus having industrial applicability.
Claims
1. (a) A step of separating adipose tissue from an individual; (b) a step of washing and enzymatically treating the separated adipose tissue; and (c) a step of centrifuging the enzyme-treated tissue from step (b) above to obtain a stromal vascular fraction (SVF); (d) a step of centrifuging the stromal vascular fraction to obtain pure adipocytes; and (e) a step of producing adipocyte-derived induced pluripotent stem cells by centrifuging the pure adipocytes obtained in step (d) above; A method for producing adipocyte-derived induced pluripotent stem cells comprising 2. In Paragraph 1, A method for producing adipocyte-derived induced pluripotent stem cells, characterized in that the centrifugation in step (e) above is performed at a temperature of 4°C to 25°C.
3. In Paragraph 1, A method for producing adipocyte-derived induced pluripotent stem cells, characterized in that the centrifugation in step (e) above is performed with a centrifugal force of 100x g to 600x g.
4. In Paragraph 1, A method for producing adipocyte-derived induced pluripotent stem cells, characterized in that the centrifugation in step (e) above is performed for 5 to 60 minutes.
5. In Paragraph 1, A method for producing adipocyte-derived induced pluripotent stem cells, characterized in that the centrifugation in step (e) above is performed at a temperature of 4°C to 25°C and a centrifugal force of 100x g to 600x g.
6. In Paragraph 1, A method for producing adipocyte-derived induced pluripotent stem cells, characterized in that the centrifugation in step (e) above is performed at a temperature of 4°C to 25°C for 5 to 60 minutes.
7. In Paragraph 1, A method for producing adipocyte-derived induced pluripotent stem cells, characterized in that the centrifugation in step (e) above is performed for 5 to 60 minutes with a centrifugal force of 100x g to 600x g.
8. In Paragraph 1, A method for producing adipocyte-derived induced pluripotent stem cells, characterized in that the centrifugation in step (e) above is performed at a temperature of 4°C to 25°C with a centrifugal force of 100x g to 600x g for 5 minutes to 60 minutes.
Citation Information
Patent Citations
Method for producing cell growth factors secreted from adipose-derived stem cells and mononucleated cells and the use thereof
KR100995133B1
Method for producing dedifferentiated stem cells derived from adipocytes using centrifugation and uses thereof
KR102753317B1