Genotype-phenotype self-labeling using orthogonal genetic storage and genetic compilation machinery

Abstract

A modified sporulating bacteria may comprise a nucleic acid cassette having a silent promotor that inhibits transcription by the modified sporulating bacteria. The nucleic acid cassette may include a nucleic acid sequence including a gene of interest that encodes a protein of interest. The nucleic acid cassette may include a nucleic acid sequence encoding a loading peptide that incorporates into a coat of a spore. The modified sporulating bacteria may comprise a pre-spore having the nucleic acid sequence having the gene of interest that encodes the protein of interest. A modified spore may be formed comprising a spore body containing the nucleic acid cassette, a spore coat, and a protein of interest derived from the gene of interest inserted into the spore coat made by exogenous cell-free biosynthesis components.

Description

GENOTYPE-PHENOTYPE SELF-LABELING USING ORTHOGONAL GENETIC STORAGE AND GENETIC COMPILATION MACHINERY CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This patent application claims priority to U.S. Provisional Application No. 63 / 694,074 filed September 12, 2024, which provisional is incorporated herein by specific reference in its entirety. SEQUENCE LISTING

[0002] The instant application contains a Sequence Listing which has been submitted via Patent Center and is hereby incorporated by reference in its entirety. Said .xml copy, created on September 09, 2025, is named C619910001US02, and is 72,534 bytes in size. BACKGROUND Field:

[0003] The present disclosure relates to modified sporulating bacteria for use in generating modified spores presenting a protein of interest and carrying a gene of interest. the present disclosure also relates to methods of forming the modified sporulating bacteria and modified spore, as well as methods of using the same. Description of Related Art:

[0004] A hurdle in all biomolecular engineering or directed evolution efforts is how to effectively measure or assess the performance of a genetic part or product while maintaining a genotype-phenotype link, which includes the genetic information and protein or other molecule produced therefrom. Tools for creating and maintaining a genotype- phenotype link while screening or selecting for improved variants are very important, and tool selection requires careful consideration of several constraints. These constraints are inherent qualities of every screening tool and include but are not limited to: expression limits on the ability of a screening tool to correctly produce the desired genetic product; library generation and diversification limits impact the effort, time, and expense of generating and iterating on a library of variants of a genetic product; library size and maintenance limits which impact the number of genetic variants that can be reasonably generated and reliably maintained with a given tool or method; signal strength limits based on the copy number of a genetic product during screening or selection; measurement type limits on the type of measurements that a system enables; screening condition limits on the range of chemical conditions or context variables that a screening system can endure while reliably maintaining the genotype-phenotype link; and throughput limits on the rate atwhich genetic variants can be screened, expressed as (number of variants / unit of time). Every genetic screening tool has a unique cost-benefit relationship between these different constraints.

[0005] Analytical methods for characterizing binding interactions and evolving biomolecules have been developed using display technologies such as cell display and ribosome display. Cell display systems, including yeast surface display, phage display, and bacterial display, exploit the host organism to present peptides, proteins, or antibody fragments on the exterior of the cell. These systems allow high-throughput selection against target molecules; however, their performance is constrained by the physiology of the host cell. For example, cell display systems are limited in the range of proteins that can be expressed due to folding, post-translational modification, and toxicity constraints, and cannot be readily adapted for modular compilation of components. Furthermore, because they depend on relatively fragile living host organisms, they cannot be employed under extreme conditions of temperature, pressure, or solvent environment, thereby limiting their utility in certain industrial or non-native applications.

[0006] Ribosome display is a cell-free technique in which mRNA, ribosome, and nascent polypeptide are maintained in a stable ternary complex, thereby physically linking genotype and phenotype for selection. Ribosome display enables large library sizes without the need for transformation and avoids some cellular folding bottlenecks. However, ribosome display suffers from intrinsic limitations: the ribosome–mRNA–protein complexes are fragile, selections must occur under relatively mild conditions, and the system lacks the capacity for self-replication or self-diversification during the selection process. As such, ribosome display cannot autonomously generate evolutionary diversity or sustain iterative selection cycles without external intervention. Additionally, the mRNA template for ribosome display generally can only encode for one protein. Thus, the engineering of multi-gene, (i.e. epistatic), phenotypes is not possible.

[0007] Accordingly, while both cell display and ribosome display methods have been instrumental in molecular discovery, each exhibits significant shortcomings that restrict their adaptability, scalability, and robustness across environments. There remains a need for improved analytical platforms that overcome these deficiencies and expand the scope of biomolecular screening and evolution. SUMMARY

[0008] In some embodiments, a modified sporulating bacteria may comprise a nucleic acid cassette having a silent promotor that inhibits transcription by the modified sporulating bacteria. The nucleic acid cassette may have a nucleic acid sequence including a gene of interest that encodes a protein of interest. The nucleic acid cassette may have a nucleic acid sequence encoding a loading peptide that incorporates into a coat of a spore. The modified sporulating bacteria may comprise a pre-spore having the nucleic acid sequence having the gene of interest that encodes the protein of interest.

[0009] In some embodiments, a plurality of modified sporulating bacteria may be provided.

[0010] In some embodiments, a kit for forming a modified spore having a protein of interest may comprise the modified sporulating bacteria. The kit may comprise a lysis reagent that lyses the modified sporulating bacteria. The kit may comprise a polymerase that activates the silent promotor. The kit may comprise cell free biosynthesis components included but not limited to RNA polymerase, nucleotides, ribosomes, tRNA, tRNA synthetases, canonical amino acids, and non-canonical amino acids.

[0011] In some embodiments, a system for forming a modified spore may comprise a first input channel in a microfluidic system for receiving the sporulating bacteria in an aqueous medium. The system may comprise a second input channel in the microfluidic system for receiving cell free biosynthesis components in an aqueous medium. The system may comprise at least one oil channel having an oil, such that the first input channel and second input channel are fluidly coupled with the at least one oil channel having the oil. The system may comprise a fluid flow system for flowing at least one of the sporulating bacteria, cell free biosynthesis components, or oil.

[0012] In some embodiments, a droplet may comprise the modified sporulating bacteria, wherein the sporulating bacteria includes a pre-spore that is progressing to be a spore. The droplet may comprise an aqueous medium forming the droplet containing the modified sporulating bacteria.

[0013] In some embodiments, a droplet may comprise a lysed modified sporulating bacteria, wherein the nucleic acid cassette and pre-spore or spore therefrom, which contains an identical copy of the nucleic acid cassette, outside the lysed modified sporulating bacteria. The droplet may comprise an aqueous medium forming the droplet and containing the nucleic acid cassette and pre-spore or spore therefrom.

[0014] In some embodiments, a modified spore may comprise a spore body containing at least one copy of a nucleic acid cassette having a silent promotor that inhibits transcriptionby the modified sporulating bacteria. The nucleic acid cassette may have a nucleic acid sequence including a gene of interest that encodes a protein of interest. The nucleic acid cassette may have a nucleic acid sequence encoding a loading peptide that incorporates into a coat of a spore. The modified spore may comprise a spore coat. The modified spore may comprise a protein of interest derived from the gene of interest, wherein the protein of interest is inserted into the spore coat (e.g., shell).

[0015] In some embodiments, a method of forming the modified sporulating bacteria may comprise providing a nucleic acid cassette having a silent promotor that inhibits transcription by the sporulating bacteria. The nucleic acid cassette may have a nucleic acid sequence including a gene of interest that encodes a protein of interest. The nucleic acid cassette may have a nucleic acid sequence encoding a loading peptide that incorporates into a coat of a spore. The method may comprise providing a sporulating bacteria. The method may comprise introducing the nucleic acid cassette into cytoplasm of the sporulating bacteria. The method may comprise introducing the gene of interest into a pre-spore within the sporulating bacteria via natural spore-assembly and DNA-packaging mechanisms.

[0016] In some embodiments, the spores can include a copy of the nucleic acid cassette with the gene of interest, which can be introduced into the cytoplasm of vegetative cells at a transformation stage. For example, the nucleic acid cassette can be naturally placed in the spore after the initial editing event. Alternatively, the nucleic acid cassette can be added when the cells are made competent. In another alternative, electroporation can be used to introduce the nucleic acid cassette into the cytoplasm of a vegetative but sporulation- capable cell (not a pre-spore).

[0017] In some embodiments, a method of forming a modified spore may comprise providing the modified sporulating bacteria. The method may comprise lysing the modified sporulating bacteria with a lysis reagent. The method may comprise activating the silent promotor with a polymerase for the silent promotor. The method may comprise generating the protein of interest from the gene of interest using the added transcription-translation components. The method may comprise generating a modified spore having a spore coat with the protein of interest inserted therein and having the gene of interest within the spore.

[0018] In some embodiments, a method of detecting a modified spore may comprise providing the modified spore. The method may comprise providing a binding agent that binds with the protein of interest. The method may comprise binding the binding agent with the protein of interest. The method may comprise detecting the binding of the binding agentwith the protein of interest. Detection of protein-binding or enrichment may be done through bead-binding techniques, flow cytometry, or fluorescence-activated cell sorting (FACS).

[0019] In some embodiments, a method of assaying the modified spore may comprise providing the modified spore. The method may comprise providing a stimulus or stress condition to the modified spore. The method may comprise detecting an outcome of the modified spore in response to the stimulus or stress condition.

[0020] In some embodiments, a method of forming a modified sporulating bacteria may comprise providing the modified spore. The method may comprise providing a stimulus to the modified spore so as to cause production of a modified sporulating bacteria having the gene of interest as an act of or after selection.

[0021] In some embodiments, a modified sporulating bacteria may comprise a first nucleic acid cassette within cytoplasm of the sporulating bacteria, the nucleic acid cassette having a silent promotor that inhibits transcription by the sporulating bacteria. The first nucleic acid cassette may have a nucleic acid sequence including a gene of interest that encodes a protein of interest. The modified sporulating bacteria may comprise a second nucleic acid cassette within cytoplasm of the sporulating bacteria, the nucleic acid cassette having a promotor, silent or not, controlling expression of a GOI. The second nucleic acid cassette may or may not have a nucleic acid sequence encoding a loading peptide that incorporates into a coat of a spore before or after droplet encapsulation. The GOI on the second nucleic acid cassette may be expressed during sporulation to pre-load the un-lysed mother cell with a POI using a non-silent promoter or after lysis by the CFB components using a silent promoter. The modified sporulating bacteria may comprise a pre-spore having the nucleic acid sequence(s) having the gene(s) of interest that encodes the protein(s) of interest.

[0022] In some embodiments, the preloading occurs in vegetive cells with an aaRS. In some instances, the second GOI omits a loading sequence. In some instances, the loading peptide is not expressed or it is not associated with the GOI. In some aspects, the system is able to engineer a TXTL component itself, where the GOI that loads to the spore is just a reporter protein whose expression is a result of the second GOI.

[0023] In certain embodiments, the present disclosure provides an aminoacyl-tRNA synthetase (aaRS) or variant thereof that selectively couples an amino acid, analog, or non- canonical amino acid to a cognate transfer RNA (tRNA). The aaRS may include, but is not limited to, naturally occurring, recombinant, or engineered enzymes exhibitingaminoacylation activity. In one aspect, the aaRS catalyzes the activation of an amino acid in an ATP-dependent manner to generate an aminoacyl-adenylate intermediate, followed by transfer of the amino acid to the 3′ terminus of the corresponding tRNA, thereby generating an aminoacyl-tRNA competent for incorporation into a polypeptide during ribosomal translation. In some embodiments, the aaRS and its associated tRNA are orthogonal to the host translation machinery, such that the aminoacylation activity does not substantially interfere with endogenous aaRS–tRNA interactions. In other embodiments, the aaRS is encoded by a nucleic acid sequence operably linked to a promoter in an expression construct, such as a plasmid, viral vector, or other delivery vehicle, thereby enabling host cells to express the aaRS in vivo. Advantageously, provision of the aaRS permits the site-specific incorporation of natural or unnatural amino acids into target proteins, thereby enabling modification of protein structure, stability, or functionality in a controlled manner. Additional protein machinery responsible for protein transcription and translation may be engineered in this way, including but not limited to ribosomes, tRNA, and RNA polymerases.

[0024] In some embodiments, a combination of modified sporulating bacteria may comprise a first modified sporulating bacteria having a first nucleic acid cassette within the cytoplasm of the sporulating bacteria, the nucleic acid cassette having a silent promotor that inhibits transcription by the sporulating bacteria. The first nucleic acid cassette may have a nucleic acid sequence including a gene of interest that encodes a protein of interest. The first modified sporulating bacteria may comprise a pre-spore having the nucleic acid sequence having the gene of interest that encodes the protein of interest. The combination may comprise a second modified sporulating bacteria having a second nucleic acid cassette within cytoplasm of the sporulating bacteria, the nucleic acid cassette having the silent promotor. The second nucleic acid cassette may have a nucleic acid sequence encoding a loading peptide that incorporates into a coat of a spore. The second modified sporulating bacteria may comprise a pre-spore having the nucleic acid sequence having the gene of interest that encodes the protein of interest. After production of the two modified spore types, they may be incubated together and assessed for spore-spore interactions enabled by the displayed proteins of interest.

[0025] The foregoing summary is illustrative only and is not intended to be in any way limiting. In addition to the illustrative aspects, embodiments, and features described above,further aspects, embodiments, and features will become apparent by reference to the drawings and the following detailed description. BRIEF DESCRIPTION OF THE FIGURES

[0026] The foregoing and following information as well as other features of this disclosure will become more fully apparent from the following description and appended claims, taken in conjunction with the accompanying drawings. Understanding that these drawings depict only several embodiments in accordance with the disclosure and are, therefore, not to be considered limiting of its scope, the disclosure will be described with additional specificity and detail through use of the accompanying drawings.

[0027] Fig.1A illustrates a gene construct that includes a silent gene of interest (GOI) in a nucleic acid cassette having a silent promoter and a loading peptide nucleic acid (LP) region.

[0028] Fig.1B illustrates a modified sporulating bacteria comprising a nucleic acid cassette within cytoplasm of the sporulating bacterial coat.

[0029] Fig.1C illustrates a fluidic system for forming a modified spore.

[0030] Fig. 1D illustrates the reaction between the cel free biosynthesis components and the nucleic acid cassette in the pre-spore.

[0031] Fig.1E illustrates a group of possible modified spores that can be obtained.

[0032] Fig. 2 illustrates the obtained modified spore being germinated into a bacteria, which can be a sporulating bacteria.

[0033] Fig.3A illustrates a structure (Structure 3A) that includes a general architecture of an integrative plasmid for inserting heterologous DNA at a specific site in the sporulating bacteria’s genome through homologous recombination.

[0034] Fig. 3B illustrates Structure 3B, which includes a general architecture of a replicative plasmid maintaining heterologous DNA in a sporulating bacteria’s cytoplasm.

[0035] Fig. 3C illustrates Structure 3C, which includes a general architecture of the GOI- LP construct which may exist as either an N or C-terminal fusion of the two protein sequences.

[0036] Fig.3D illustrates Structure 3D that includes additional GOI-LP designs what may contain additional DNA sequences that code for linker peptides (Link) between the GOI and LP and different peptide tags (Tag) for immunochemistry applications including labeling of the target product or purification.

[0037] Fig. 3E illustrates Structure 3E that includes additional GOI construct designs that are not intended to load to the spore but merely be expressed within the sporulating cell or the droplet post-lysis. As such, the GOI is not attached to an LP sequence. The promoter may be silent, such as a T7 promoter, or not, such as a sporulation-responsive promoter, including pSscA used in pWhiskey and other natural or synthetic promoter sequences. For the sake of illustration, this was depicted as an integrative plasmid, but a replicative plasmid could also be used and be beneficial when a high-copy number of the GOI is desirable.

[0038] Fig. 4A illustrates Structure 4A, which includes a general architecture of a linear replicative plasmid for maintenance and potential diversification of heterologous DNA in a sporulating bacterium, such as Bacillus subtilis or Priestia megaterium.

[0039] Fig. 4B illustrates Structure 4B, which illustrates maintenance machinery for replication of the linear plasmid, which may be integrated into the sporulating bacteria’s genome using an integrative plasmid or plasmids.

[0040] Fig.5 illustrates flow cytometry data showing the successful loading of (Specimen 2) ST-sfGFP made in a TXTL solution and loaded to IV3 spores carrying CotY-SC003 and a negative control of (Specimen 1) wildtype spores which were also incubated with ST- sfGFP but did not form a covalent bond, which demonstrates a proof-of-concept of the invention.

[0041] Fig.6A illustrates the plasmid for pWhiskey_MjTyrRS (SEQ ID NO: 4).

[0042] Fig.6B illustrates the plasmid for pTREX2_CotY_SC003 (SEQ ID NO: 5).

[0043] Fig. 6C illustrates the plasmid for pBS0E_T7_ST_sfGFP (SEQ ID NO: 6), which includes an HHHHHH (SEQ ID NO: 7) Histidine Tag.

[0044] Fig.7 illustrates an embodiment of a sonication system that can be used for forming a modified spore.

[0045] The elements and components in the figures can be arranged in accordance with at least one of the embodiments described herein, and which arrangement may be modified in accordance with the disclosure provided herein by one of ordinary skill in the art. DETAILED DESCRIPTION

[0046] In the following detailed description, reference is made to the accompanying drawings, which form a part hereof. In the drawings, similar symbols typically identify similar components, unless context dictates otherwise. The illustrative embodiments described in the detailed description, drawings, and claims are not meant to be limiting.Other embodiments may be utilized, and other changes may be made, without departing from the spirit or scope of the subject matter presented herein. It will be readily understood that the aspects of the present disclosure, as generally described herein, and illustrated in the figures, can be arranged, substituted, combined, separated, and designed in a wide variety of different configurations, all of which are explicitly contemplated herein.

[0047] Generally, the present invention provides a system and method that creates a durable genotype-phenotype link between orthogonal genetic storage machinery (e.g., DNA, DNA Polymerase) and genetic compilation machinery (e.g., RNA polymerase, ribosomes, tRNA, tRNA synthetases, amino acids, and more) in cell-free protein synthesis systems. The invention can be operated by the following: (1) the selection of genetic material following an orthogonal transcription / translation event; (2) the use of selective pressures and conditions that would otherwise destroy the genotype-phenotype link or otherwise be impossible to use in high-throughput; (3) the maintenance and self- reproduction of genetic information in the form of DNA that may otherwise be toxic if it were to be expressed in a replicating host or require significant host-engineering efforts to enable its maintenance, compilation, and unbiased replication; (4) signal amplification of heterologous DNA in the form of multiple copies of transcription or translation products (e.g., phenotype) durably linked to the genotype; (5) self-replication of the genetic information following selection or screening; (6) sequence diversification (library generation) without a need for intermediate in vitro DNA purification, amplification, or re- transformation steps; (7) signal amplification of a gene of interest through DNA replication and the generation of multiple identical DNA templates.

[0048] In some embodiments, the present invention overcomes limitations with Ribosome Display, mRNA display, and other forms of in vitro display technologies, such as: a. single copy number of the phenotype; b. limitations of screening or selection conditions; and c. non-self-replicating (e.g., it requires significant work to create and then sequence DNA following sorting / screening / selection with Ribosome Display).

[0049] In some embodiments, the present invention overcomes limitations with Cell-Free Protein Synthesis (CFPS), Cell-Free Transcription-Translation (TXTL), or Cell-Free Biosynthesis (CFB) in droplets, such as: a. limited to screening with measurable outputs suitable for vesicle sorting (e.g. fluorescence or absorbance); b. limited to selection conditions suitable for transcription / translation; c. non-self-replicating (e.g., it requiressignificant work to amplify and then sequence DNA following sorting / screening / selection). The use of the terms CFPS, TXTL, and CFB can be interchangeable herein.

[0050] In some embodiments, the CFB system can provide advantages, such as those described herein. The advantages can be considered as follows.

[0051] Expression is an advantage. The inherent modularity of in vitro CFB enabled by the selective addition of any genetic machinery makes it, as a class of systems, the most diverse and capable of modular protein expression.

[0052] Library generation and diversification limits are improved. CFB can use simple circular or linear DNA fragments that can be easily made and edited for library generation and diversification.

[0053] Library size limits are improved for certain phenotypes. CFB can enable small reaction sizes and enable product screening by encapsulation in droplets or using ribosome- display, both of which can enable libraries of >10^7 with relative ease. The utility of these method, however, is dependent on a compatible phenotypic screen.

[0054] In some embodiments, screenable phenotypes and screening methods are improved. For example, the present invention provides an improvement over in-droplet screening by enabling the screening of protein-protein interactions between the assembled POI spore and a target protein using FACS. In comparison to ribosome-display, the present invention enables screening of epistatic phenotypes.

[0055] Signal strength limits are improved. Copy number of common CFB platforms like ribosome-display and droplets can vary from single to millions of copies of the genetic product, depending on reaction size. These limits can constrain what types of proteins can be evolved using these different platforms. For example, it is difficult to use ribosome- display to discern between enzyme variants with low turnover numbers.

[0056] Cycle times are improved. The DNA molecules used in most CFB systems are often non-replicating and serve only as a template for transcription. Consequently, tedious and time-consuming reverse transcription, DNA isolation, and / or amplification steps are required following traditional high-throughput CFB experiments.

[0057] In some embodiments, the present invention provides for obtaining a protein of interest loaded spore (e.g., POI spore) having in its coat a protein of interest (POI) obtained from a silent gene of interest (GOI). The POI spore can be used in high-throughput screening, sorting, and even selection of self-replicating genetic material following in vitro compilation of the genetic product. The present methods leverage the unique physiologicalproperties of bacterial spores, in vitro transcription-translation systems (CFB), and microfluidic droplet encapsulation to couple orthogonal genetic storage and genetic compilation machinery, creating a durable genotype-phenotype link in high-throughput. The novel combination of these technologies enables the assembly of discrete, self-labeled, and self-reproducing particles (e.g., POI spore) using orthogonal genetic storage and genetic compilation machinery. Once assembled, these POI spore particles can then be used in a variety of screening or selection conditions for phenotype assessments, testing qualities including binding, stability, and function in a range of conditions that are inaccessible to ribosome display or droplet sorting.

[0058] Figs. 1A-1E illustrate exemplary embodiments of a system and method for generating a POI spore that includes the POI embedded in the spore coat and a GOI within the spore. The POI spore can be used in methods for high-throughput screening, sorting, and selection of self-replicating genetic material following in vitro compilation of the genetic product into the POI spore, which also contains the genetic information of the GOI. The methods leverage the unique physiological properties of bacterial spores, in vitro transcription-translation systems, and microfluidic droplet encapsulation to couple orthogonal genetic storage and genetic compilation machinery. The resulting POI spore is a durable genotype-phenotype link, which can be generated in a high-throughput process. The combination of these technologies enables the assembly of discrete, self-labeled, and self-reproducing POI spore particles using orthogonal genetic storage and genetic compilation machinery. Once assembled, these POI spore particles can then be used in a variety of screening or selection conditions for phenotype assessments, testing qualities including binding, stability, and function in a range of conditions that are inaccessible to ribosome display, droplet sorting, and other in vitro display technologies.

[0059] Fig. 1A illustrates a gene construct 100 that includes a silent gene of interest 106 (GOI) in a nucleic acid cassette 102 having a silent promoter 104 (e.g., T7 promotor, which is silent within bacteria or sporulating bacteria mother cell) and a loading peptide nucleic acid 108 (LP) region. Accordingly, a genetic construct carrying the GOI-LP fusion under control of a silent promoter is made for expression and maintenance in a sporulating bacteria. The gene construct 100 can be a nucleic acid cassette 102 as shown in Fig. 1A (e.g., genetic cassette).

[0060] Fig. 1B illustrates a modified sporulating bacteria 110 comprising a nucleic acid cassette 102 within cytoplasm 112 of the sporulating bacteria coat 114. The nucleic acidcassette 102 can have: a silent promotor 104 that inhibits transcription by the sporulating bacteria; a nucleic acid sequence including a gene of interest 106 that encodes a protein of interest; and a nucleic acid sequence encoding a loading peptide (e.g., loading peptide nucleic acid 108), as shown in Fig. 1A, which incorporates into a coat of a spore. The modified sporulating bacteria 110 also includes a pre-spore 116 having the nucleic acid sequence having the gene of interest 106 that encodes the protein of interest.

[0061] Fig. 1B also illustrates a population of sporulating bacteria 120. The nucleic acid cassette 102 is transformed into a population of sporulating bacteria 120. Sporulation is induced, during which at least two copies of the nucleic acid cassette 102 are present in the cytoplasm 112 of the modified sporulating bacteria 110 (e.g., a bacteria cell). One nucleic acid cassette 102 in the cytoplasm 112, and one nucleic acid cassette 102 in the pre-spore 116. Also shown are other non-modified sporulating bacteria 124.

[0062] In some embodiments, The nucleic acid cassette 102 can be referred to as a silent GOI cassette, which is a nucleic acid that can be introduced (e.g., transformation, transfection) into a bacteria capable of sporulation. The silent GOI cassette can be in the cytoplasm of the sporulating bacteria, which also has a pre-spore therein that also has the silent GOI cassette. The silent GOI cassette may or may not integrate into the genome of the sporulating bacteria; however, the silent GOI cassette can be retained in the sporulating bacteria. Once the silent GOI cassette is in the sporulating bacteria, silent DNA replication begins and sporulation can be induced when desired. In part, sporulation can begin once the silent GOI cassette is within the sporulating bacteria by selecting a sporulating bacteria in which sporulation is imminent, can be induced, or is already beginning.

[0063] In some embodiments, the modified sporulating bacteria includes the silent promoter as a T7 promotor, which is activated by a T7 polymerase or other cognate promoter-polymerase system.

[0064] In some embodiments, the silent promoter is activated by a polymerase that is not natural in the sporulating bacteria.

[0065] In some embodiments, the loading peptide has a peptide sequence that incorporates into a coat of a spore that results from the pre-spore.

[0066] In some embodiments, the pre-spore includes at least one copy of the nucleic acid cassette.

[0067] In some embodiments, a composition can include a plurality of the modified sporulating bacteria as modified as described here.

[0068] Fig. 1C illustrates a fluidic system 130 for forming a modified spore. The fluidic system 130 can include a first input channel 132 from a first input reservoir 134 for receiving the modified sporulating bacteria 110 in an aqueous medium 136. The fluidic system 130 also includes a second input channel 138 from a second input reservoir 140 for receiving cell free biosynthesis components 142 in an aqueous medium 144.

[0069] The fluidic system 130 also includes at least one oil channel 146 from an oil reservoir 148 having an oil 150. As shown, the first input channel 132 and second input channel are fluidly coupled at a first junction 152 so that the modified sporulating bacteria 110 mixes with the cell free biosynthesis components 142 in an aqueous mixture 156. Downstream from the first junction 142, a mixing channel 158 extends until a second junction 160 with the at least one oil channel 146 having the oil 150. The mixing of the first input channel 132 and second input channel 138 occurs in the mixing channel 158.

[0070] Downstream from the second junction 160, a droplet channel 162 extends to an outlet 164. The outlet can flow into a reaction vessel 149, where the reactions can occur between the nucleic acids and the cell free biosynthesis components 142. The droplet channel 162 allows for the formation of a droplet 161 having the modified sporulating bacteria 110. The droplet 161 allows for a lysis reagent of the cell free biosynthesis components 154 to lyse the modified sporulating bacteria 110 to release the pre-spore 116 within the droplet 161. Then, the cell free biosynthesis components 154 utilize the nucleic acid cassette and to produce the protein of interest 170 encoded by the nucleic acid cassette 102, which is inserted into the coat 172 of the modified spore 174 that is formed, as illustrated and described in Fig.1D. The reactions usually occur in the reaction vessel 149 as the droplets 161 may be in channel 162 for 1-6 seconds. The droplets 161 can be incubated in the reaction vessel 149 for up to 6 hours (e.g., 1 hour to 6 hours), which allows formation of the POA and its locating into the coat of the spore.

[0071] Additionally, Fig. 1C shows a fluid flow system on a substrate 129 for flowing at least one of the sporulating bacteria, cell free biosynthesis components, or oil. The fluid flow system can include at least one pump 182, and optionally, at least one pump for each fluid reservoir. The pump can control the flow rate of the fluids through the fluidic system. In some aspects, the channels can be microchannels. The pumps 182 can also be connected to the oil reservoirs 148 or oil lines having the oil 150.

[0072] A collection system 190 can also be included in the system. The collection system 190 can collect the modified spores 174.

[0073] In some embodiments, the droplet channel 162 can be used as a reaction channel or include a portion that is a reaction channel. Alternatively, a separate reaction channel can be downstream of the droplet channel 162.. The droplet channel 162 can be configured to receive the sporulating bacteria and cell free biosynthesis components in the aqueous medium into the oil, so as to form a droplet of the aqueous medium having the sporulating bacteria and cell free biosynthesis components. The reaction channel is the portion where the reactions occur, from lysis of the modified sporulating bacteria to the formation of the modified spore.

[0074] Fig. 7 shows an embodiment of a sonication system 700 that can be used for preparing the modified spores as described herein. The sonication system 700 includes a sonicator 702, which can include or be attached to a sonication chamber 704 having an oil / water composition 706 with the cell free biosynthesis components 142 as well as the modified sporulating bacteria 110 that then is in a droplet 161 before lysing to reveal the pre-spore 116, which is then processed into the modified spore 174.

[0075] Fig. 1D illustrates the reaction between the cell-free biosynthesis components 154 and the nucleic acid cassette 102 in the pre-spore 116. As shown, the Cell-Free Transcription-Translation (TXTL) components of the cell free biosynthesis components 142 translating the gene of interest (GOI) into the protein of interest 170 having a coat binding portion 171. The coat binding portion 171 inserts into the coat 172 so that the protein of interest 170 presents on the coat surface of the modified spore 174.

[0076] Fig.1E illustrates a group of possible modified spores that can be obtained. As such, he modified spores can be obtained as a spore-displayed library 194. The spore-displayed library 194 is evaluated or screened for the desired phenotype. Bead-binding, FACS, enzymatic assays, and other treatments or screens could be applied to the population to select for the desired phenotype.

[0077] Fig. 2 illustrates the obtained modified spore 174 being germinated into a bacteria 197, which can then be sporulated again 198. Following screening and / or as an act of selection itself, selected modified spores 174 can be germinated back into vegetative bacteria cells 198 containing the library DNA, such as the nucleic acid cassette 102.

[0078] The sporulating bacteria 198 can then be transfected with the nucleic acid cassette 102 to have two copies. During becoming a sporulating bacteria 198, one of the copies of the nucleic acid cassette 102 goes into the pre-spore 116. Accordingly, the protocol can beperformed again, and in iterations to obtain modified sporulating bacteria and modified spores.

[0079] In some embodiments, iterative rounds of evolution can be performed without the need for tedious DNA extraction, amplification, or sequencing. Moreover, in vivo diversification tools can be used to diversify from “winning” sequences following each round of screening or selection.

[0080] The sporulating bacteria (e.g., mother cells) are introduced into a microfluidic device within an aqueous solution into one arm. A second arm of the microfluidic device can receive cell free transcription-translation (TXTL) components or CFB components that can be used in a CFB process. For example, the CFB components can include a lysis reagent, a promoter specific polymerase that operates with the silent promotor on the silent GOI cassette. In a specific example, the silent promotor can be a T7 promotor, and the T7 polymerase can be included in the CFB components. Accordingly, the CFB components can include a silent promoter polymerase. Additionally, custom CFB components can include the amino acids and other components useful for forming a protein from the silent GOI cassette.

[0081] Additionally, the microfluidic device can include at least one more arm that includes an oil, so when the arms intersect, water in oil droplet can be formed. The water in oil droplet includes the contents of the lysed sporulating mother cell that is lysed by the lysis reagent. Once the sporulating bacteria mother cell is lysed, the T7 promotor and T7 polymerase start transcription of the GOI. The GOI encodes for the POI, and the POI is produced. The GOI includes a region therein that encodes for a protein segment (e.g., LP) that inserts into the coat of the spore. Such a coat inserting protein segment can be tailored for the spore, and examples are included in the incorporated manuscripts and / or patents or patent applications included herewith.

[0082] The spore is also created from the pre-spore during this time to include a coat and a spore body containing the silent GOI cassette or GOI thereof.

[0083] Once the spore is created and the POI is produced from the GOI, the coat inserting protein segment (e.g., LP) inserts into the coat of the spore, and the POI spore is obtained. The POI spore can then be used to provide the genotype-phenotype link as described herein. Such a POI spore can be assayed with protein binding or enzyme assays to identify the phenotype of the protein, which then can be used to assess the GOI therein, thus providing the genotype-phenotype link.

[0084] In some embodiments, Fig.1A illustrates a genetic construct that is shown to carry the gene of interest (GOI), which is inserted into the sporulating (e.g., endospore-forming) bacteria genome where it is reliably maintained. In other embodiments, the GOI may be on a replicative plasmid and transformed into the sporulating bacteria where the GOI is maintained as an independent chromosome with high fidelity during several cycles of vegetative growth and sporulation. The GOI exists as a fusion to a loading peptide (LP), which serves as the coat inserting protein segment. Notably, the LP can be a full protein, portion of protein, or any peptide having sufficient amino acids to insert into the spore coat. The LP is defined as a spore coat protein, spore coat protein fragment, or other peptide sequence that enables loading of the genetic product encoded by the GOI into the coat of the spore following genetic compilation. The genetic construct enables the insertion of a “library” of GOI variants to be introduced to a population of the sporulating bacteria and enables library sizes of 104-10variants. That is, any reasonable number of silent GOI cassettes can be used, which are loaded into different sporulating bacteria.

[0085] As shown in Fig.1A, the GOI may be under control of a tightly regulated promoter system, such as a T7 promoter, to reduce background expression levels during vegetative growth and sporulation. That is, the silent promotor is selected so that the promotor is not initiated and no gene product is formed until the silent GOI cassette is introduced to the proper promoter for that silent promoter. As such, the T7 polymerase can be used with the T7 promoter, but other promotor-polymerase combinations can be used. This is especially useful for toxic genetic products or for when orthogonal compilation machinery is needed to create the GOI. The nucleic acid includes the spore coat protein (SCP) that inserts into a coat of a spore. The SCP may be considered to be a LP.

[0086] The nucleic acid construct of the silent GOI cassette may or may not include a linker sequence between the GOI and LP, and other sequences encoding motifs, such as a poly- histidine tag or other tags that can be used for immunodetection, protein purification, or functional chemistries.

[0087] The genetic construct(s) of the silent GOI cassettes may include additional motifs and parts (e.g., on the same plasmid, a different plasmid, or elsewhere in the genome) to enable amplification of the coding DNA using rolling circle amplification techniques, such as CADGE or similar techniques (see, Abil, 2022). These constructs may include genes necessary for isothermal rolling circle amplification components including, but not limitedto, DNA polymerase(s), terminal proteins, single-stranded DNA binding proteins, double- stranded DNA binding proteins, and an origin(s) of replication.

[0088] In some embodiments, the recombinant genetic construct of the silent GOI cassettes may include or be accompanied elsewhere in the sporulating bacteria additional machinery to enable inducible in vivo mutagenesis of the GOI.

[0089] In some embodiments, the recombinant genetic construct may or may not carry an antibiotic selection marker or auxotrophic marker to enable selection, ensuring maintenance of the GOI in a population of cells.

[0090] The loading peptide (LP) may include a whole spore coat protein, spore coat protein fragment, or other genetic part.

[0091] As shown in Fig. 1A, the GOI-LP coding DNA sequence may be under control of a tightly regulated promoter system such as a T7 promoter to reduce background expression levels during vegetative growth and sporulation. This is especially useful for toxic genetic products or for when orthogonal compilation machinery is needed to create the GOI. The GOI-LP construct may or may not include a linker sequence between the GOI and LP and other sequences encoding motifs such as a poly-histidine tag or other tags that can be used for immunodetection, protein purification, or functional chemistries.

[0092] In some embodiments, the GOI-LP genetic construct may contain additional genetic motifs or be accompanied by additional genetic constructs (on the same plasmid, a different plasmid, or elsewhere in the genome) to enable amplification of the coding DNA using isothermal amplification (Abil, 2022). These constructs may include genes or components (i.e. sequences) necessary for isothermal rolling circle amplification including, but not limited to, DNA polymerase(s), terminal proteins, single-stranded DNA binding proteins, double-stranded DNA binding proteins, and an origin(s) of replication.

[0093] In some embodiments, the GOI-LP genetic construct may be accompanied by additional genetic constructs or contain additional motifs and parts (on the same plasmid, a different plasmid, or elsewhere in the genome) to carry genetic information for a secondary library of a complementary gene(s) of interest. Such iterations would enable what is commonly referred to as a “library-on-library” approach in which a library of variants are screened in a library of contexts. The GOI-LP construct may include additional machinery to enable inducible in vivo mutagenesis of the GOI Also, the GOI-LP construct may or may not carry an antibiotic selection marker or auxotrophic marker to enable selection, ensuring maintenance of the GOI in a population of cells.

[0094] A variety of spore coat proteins may be utilized, including but not limited to CgeA, CotA, CotB, CotC, CotD, CotE, CotF, CotG, CotH, CotI, CotJA, CotJB, CotJC, CotM, CotO, CotP, CotR, CotS, CotT, CotU, CotV, CotW, CotX, CotY, CotZ, CoxA, GerQ, SafA, SpsA, SpsB, SpsC, SpsD, SpsE, SpsF, SpsG, SpsI, SpsJ, SpsK, SpsL, YaaH, YeeK, YmaG, YsnD, YsxE, YtxO, and YxeE.

[0095] A variety of native gene sequences associated with germination may be deleted or modified to prevent or slow spore-germination within the droplet, including cotH, cotG, cotB, cotE, cotT, cwlD, cwlJ, gerAA, gerAB, gerAC, gerD, gerBA, gerBC, gerBB, gerKA, gerKB, gerKC, gerKD, gerE, gerM, gerQ, gerT, pdaA, pdaB, sleB, spoVAC, spoVAD, spoVAE, sscA, and ypeB.

[0096] Sources for linear plasmids may include various phages such as Phi29, Bam35, SP01, SP82, B103, TP21-L, PBC1, and GA-1.

[0097] Spore coat fragments can be defined as any subset or fraction of a full spore coat protein sequence consisting of 10 or more amino acids.

[0098] Additionally, other genetic parts that could enable loading of the spore by the genetic product can be included. For example, SpyCatcher-SpyTag and variations thereof, cohesin-dockerin system, UNAA click chemistries, or the like can be included in the system. Anything that can form a strong molecular interaction, but preferably a covalent bond, can be used for loading the POI into the spore coat.

[0099] In some embodiments, a population of cells carrying the GOI library (or single GOI) can be grown, and sporulation can be induced as known in the art. During sporulation, two copies of the genome or two or more copies of a replicative plasmid are produced, which is shown by the sporulating bacteria having the GOI in the cytoplasm and in the pre-spore. One copy is sequestered to the forespore of the bacteria where it is enclosed within the concentric layers of the spore, including the proteinaceous coat of the bacterial spore (e.g., see circle in sporulating bacteria having the GOI nucleic acid).

[0100] In some embodiments, sporulation may be induced using the host bacteria’s inherent starvation or stress response. In other iterations, the host strain may have synthetic sporulation machinery that enables induction of sporulation in response to the addition of a small molecule or other controllable signal. The sporulation protocol can be tailored to the specific type of sporulating bacteria.

[0101] In some embodiments, it may be desirable to use a host strain of sporulating bacteria that is germination deficient or exceptionally germination proficient. Thus, use ofstrains carrying deletions with any single or combination of deletions, perturbations, or additional copies of the identified genes described herein or otherwise known may also be advantageous.

[0102] Individual sporulating cells (mother cells) are encapsulated in droplets with exogenous reagents to lyse the mother cell and enable in vitro DNA amplification, transcription and / or translation.

[0103] In some embodiments, the CFB components can include a lysis reagent, such as a lysozyme, autolysins, or others, which can break open the sporulating bacteria mother cell without damaging the nearly complete protein coat of the endospore or the cytoplasmic DNA (e.g. mother cell chromosome and / or replicative plasmid).

[0104] In some embodiments, the CFB components can include DNA amplification machinery that can include rolling circle amplification components including, but not limited to, DNA polymerase(s), terminal proteins, single-stranded DNA binding proteins, double-stranded DNA binding proteins, and replicon proteins.

[0105] In some embodiments, the CFB components can include exogenous genetic compilation machinery, which can include any component or reagent involved in transcription, translation, and / or post-translational protein modification. These can include substances from a cell lysate, supplemented cell lysate, or completely reconstituted system (PURE CFB).

[0106] During operation of the protocol in the microfluidic device, lysis of the sporulating bacteria occurs within the droplet (water in oil), which releases the cytoplasmic DNA and the young spore within the droplet. Then, the exogenous CFB system reads the cytoplasmic DNA and creates the genetic product, which is the POI having the LP region inserted into the spore coat (e.g., POI spore). The genetic product is the POI spore, which is a result of the: (1) coding DNA sequence (e.g., a copy of which is stored in the spore); and (2) the orthogonal compilation machinery that is introduced to the droplet by the microfluidic device.

[0107] In some embodiments, this system and process differs significantly from previous work in spore-display as compilation of the GOI into a genetic product is independent of the sporulating bacteria’s machinery. This removes the need for significant genome engineering efforts in several applications of this technique. The genetic product is loaded to the spore surface because of the spore-display process that is now happeningin the droplet, which can be considered an “expanded” mother cell that includes the droplet and all it contains.

[0108] The fully formed POI spore is made inside the droplet and carries the genetic information (e.g., genotype) in the form of DNA within its core and the genetic product POI (e.g., phenotype) on the spore coat surface. Thus, the spore assembly establishes and maintains the genotype-phenotype link. The POI spores can be removed from the droplets and used in fluorescence activated cell sorting, binding assays, sorting assays, even after being exposed to extremes in pH, temperature, solvents, salts, or the like. Additionally, the POI spore can be re-encapsulated in a drop or microsphere to be screened in non-CFB conditions. This is useful for screening activity of enzymes after exposure to or within extremes of biochemical conditions.

[0109] Figs. 3A-3D illustrate genetic devices and architecture for modifying the sporulating bacteria for use in this invention. Fig.3A illustrates a structure (Structure 3A) that includes a general architecture of an integrative plasmid for inserting heterologous DNA at a specific site in the sporulating bacteria’s genome through homologous recombination. Replication in E. coli for cloning is enabled by an E. coli-compatible origin of replication (OriR, EcoR), homologous recombination into the genome of sporulating bacteria is enabled by the presence of two homology-fragment arms for the desired locus of integration (HOMO1 and HOMO2). Selection for strains containing the DNA is enabled by a selectable marker (SM). Linearization of the plasmid before transformation into the sporulating bacteria using natural transformation, electroporation, or other transformation methods is carried out by a restriction enzyme at the unique cut site opposite of the SM and GOI-LP sequences.

[0110] Fig. 3B illustrates Structure 3B, which includes a general architecture of a replicative plasmid maintaining heterologous DNA in a sporulating bacteria’s cytoplasm. Replication is enabled by a sporulating bacteria’s native plasmids’ origin of replication (BacR), such as those from the native plasmids of Bacillus subtilis, Priestia megaterium, or other sporulating bacteria. Similarly, it also contains an OriR (e.g., EcoR) for cloning in E. coli, SM, and the GOI-LP sequence.

[0111] Fig.3C illustrates Structure 3C, which includes a general architecture of the GOI-LP construct which may exist as either an N or C-terminal fusion of the two protein sequences.

[0112] Fig. 3D illustrates Structure 3D that includes additional GOI-LP designs what may contain additional DNA sequences that code for linker peptides (Link) between the GOI and LP and different peptide tags (Tag) for immunochemistry applications including labeling of the target product or purification.

[0113] In some embodiments, the formation of the POI spore alleviates protein folding issues common to ribosome-display, while enabling phenotypic selection by molecule binding to the POI. The use of orthogonal genetic compilation machinery within a droplet (e.g., as an expanded mother cell) for spore-display of the genetic product has several advantages, such as: (1) the genetic product (e.g. POI) can fold freely as a soluble molecule within the droplet before loading to the spore; (2) the surface-display of multiple copies of the genetic product POI enables signal amplification; and the use of molecule binding as a screen with the added benefit that (3) following binding / sorting, the selected spore population is self-reproducing and can be germinated and grown for additional rounds of selection, mutagenesis, or sequencing. This enables rapid design-build-test cycles. Accordingly, the POI spore can be germinated and grown into a bacteria, which can be induced to be a sporulating bacteria as described.

[0114] Figs. 4A-4B illustrate genetic devices and architecture for in vivo library diversification with this invention. Fig. 4A illustrates Structure 4A, which includes a general architecture of a linear replicative plasmid for maintenance and potential diversification of heterologous DNA in a sporulating bacterium, such as Bacillus subtilis or Priestia megaterium. It contains, at a minimum, two terminal origins of replication (Left Ori and Right Ori), a selectable marker (SM), and a GOI-LP cassette. The sequences used for Left Ori and right Ori may be derived from any non-native phage or native phage of sporulating bacteria such as Phi29, Bam35, SP01, SP82, B103, TP21, PBC1, and GA-1, or other phage with linear ssDNA or dsDNA genome.

[0115] Fig. 4B illustrates Structure 4B, which illustrates maintenance machinery for replication of the linear plasmid, which may be integrated into the sporulating bacteria’s genome using an integrative plasmid or plasmids. The general architecture mimics that of standard replicative plasmid (Fig.3A, Structure 3A), but carries at least five genes required for both high-fidelity and mutagenic replication of the library plasmid. These include: (1) Terminal Protein: DNA coding for a terminal protein capable of initiation replication of the linear plasmid with a cognate DNA polymerase, (2) DNA Polymerase: a high-fidelity WT DNA polymerase that is compatible with the Terminal Protein under transcriptionalregulation by an inducible promoter, (3) DNA Polymerase’: a highly-mutagenic mutant DNA polymerase that is compatible with the Terminal Protein under transcriptional regulation by an orthogonal inducible promoter to that of the WT DNA Polymerase, (4) single-stranded DNA binding protein (ssDBP) that aids in DNA replication, and (5) double-stranded DNA binding protein (dsDBP) that play a role in DNA protection. The sequences used for the terminal proteins, DNA polymerases, ssDBP, and dsDBP may be derived from any sporulating bacteria or non-native or native phage of sporulating bacteria such as Bacillus subtilis, Bacillus cereus, Priestia megaterium, Phi29, Bam35, SP01, SP82, B103, TP21, PBC1, and GA-1, or other phage with linear ssDNA or dsDNA genome.

[0116] In some embodiments, use of the linear plasmid and switchable DNA polymerase system enables rapid diversification of any GOI within a population of cells by the addition of the inducer molecule corresponding to DNA Polymerase’. At other times, a library which has already been generated is able to maintain its existing sequences with high fidelity by the addition of the inducer molecule corresponding to the WT DNA Polymerase and exclusion of the inducer molecule corresponding to DNA Polymerase’.

[0117] In some embodiments, the present invention alleviates protein folding issues common to ribosome-display while enabling phenotypic selection by molecule binding. The use of orthogonal genetic compilation machinery within a droplet as an expanded mother cell for spore-display of the genetic product has several advantages. (1) the genetic product (e.g. protein) can fold freely as a soluble molecule within the droplet before loading to the spore, (2) the surface-display of multiple copies of the genetic product enables signal amplification and the use of molecule binding as a screen with the added benefit that (3) following binding / sorting, the selected spore population is self-reproducing and can be germinated and grown for additional rounds of selection, mutagenesis, or sequencing. This enables rapid design-build-test cycles. The POI spore can be used in conditions with selective pressures or other stimuli that would destroy the genotype-phenotype link or otherwise be impossible to use in high-throughput. The inherent stability of the bacterial spores, which can survive extremes in temperature, pH, and solvents as well as exposure to proteases, nucleases, and other relevant challenges, enables phenotype selection in more diverse conditions than ribosome display or singular droplet encapsulation of CFB systems.

[0118] In some embodiments, the present invention provides for silent maintenance and replication of genetic material. Using a silent GOI cassette, in which the GOI is never expressed in the vegetative bacteria or sporulating mother cell, enables the self-replicationof genetic material that is only ever compiled by the exogenous compilation machinery within the droplet. This is useful when (1) the genetic product may be toxic to the host cell or when (2) exogenous compilation machinery is necessary for product formation.

[0119] In some embodiments, the POI spore can be used in assays or protocols that have selective pressures and conditions that could destroy the genotype-phenotype link or otherwise be impossible to use in high-throughput. The inherent stability of the bacterial spores of the POI spore is an improvement in the field. The POI spore can survive extremes in temperature, pH, and solvents, as well as exposure to proteases, nucleases, and other relevant challenges. This enables phenotype selection with the POI spore in more diverse conditions than ribosome display or singular droplet encapsulation of CFB systems.

[0120] In certain embodiments, the invention recognizes that nucleic acids are susceptible to degradation when subjected to adverse environmental conditions. For example, nucleic acid molecules may undergo fragmentation, depurination, or other chemical modifications when exposed to elevated temperatures, freeze-thaw cycling, mechanical shear stress, or extremes of pH. Similarly, nucleic acids may be degraded in the presence of reactive oxygen species, metal ions, or nucleases naturally present in biological samples. In some embodiments, nucleic acid degradation may be accelerated by prolonged storage under suboptimal humidity, ultraviolet light exposure, or ionic imbalances in storage or transport buffers. The invention accordingly provides compositions, devices, and methods configured to mitigate such degradation, including by stabilizing the nucleic acid against physical, chemical, and enzymatic stress, thereby preserving integrity and function during collection, storage, processing, and downstream analytical or therapeutic applications. The spore encapsulation described herein avoids nucleic acid degradation.

[0121] In certain embodiments, nucleic acids are susceptible to degradation under elevated hydrostatic pressure. For example, degradation may occur at pressures greater than about 50 megapascals (MPa), including within a range of from about 50 MPa to about 200 MPa, from about 200 MPa to about 500 MPa, from about 500 MPa to about 1,000 MPa, or greater than about 1,000 MPa. Exposure of nucleic acids to such pressure conditions may result in structural perturbation, such as helix unwinding, denaturation, helix-coil transitions, or irreversible fragmentation. In certain embodiments, the effect of pressure on nucleic acid stability is exacerbated by additional stressors, including but not limited to elevated temperature, oxidative conditions, nuclease activity, or mechanical shear forces. The invention accordingly provides compositions, devices, and methods configured tomitigate pressure-induced degradation and to preserve the structural and functional integrity of nucleic acids during storage, transport, or processing. The spore encapsulation described herein avoids nucleic acid degradation at elevated pressures.

[0122] In some embodiments, the POI spore can be used in genetic code expansion, which is a field of study in biomolecular engineering that enables the incorporation of non- canonical amino acids (NCAAs) into proteins. For context, the biological genetic code uses 64 codons to code for 20 amino acids and 3 stop codons. Genetic code expansion takes advantage of the inherent redundancy in this system to reassign some codons to NCAAs and enable their programmable incorporation into proteins. The expanded chemistries of NCAAs have many use cases including but not limited to protein-drug conjugates, modifying or improving enzyme function, improving enzyme stability, site-specific immobilization, and studying and engineering the effect of post-translational modifications on enzyme function. Some applications of genetic code expansion can require the use of a recoded organism such as the recently developed E. coli strain Syn61, which was recoded to replace every instance of three codons (TCG, TCA, and TAG) with synonymous codons. The recoding of Syn61 was a costly, multi-year effort, and a similar project for recoding the genome of S. cerevisiae has been ongoing for more than 17 years and still is not complete. These systems can enable studying and production of proteins with NCAAs, but they have innate limitations. Accordingly, the GOI can encode for NCAAs and the POI can include the NCAAs. Thus, the POI spore can include NCAAs without the requirement of recoding the entirety of the sporulating bacteria’s genome. Here, the protein of interest can be designed to include the NCAAs, and then the gene of interest nucleic acid sequence can be determined to produce such a protein of interest. Then, the gene of interest can be included in a nucleic acid cassette as described herein.

[0123] Moreover, a requirement for transmembrane uptake of the NCAAs or metabolic synthesis of the desired NCAA limits what NCAAs can be reliably used in cellular systems. The need for expression and use of orthogonal / novel aminoacyl-tRNA synthetases for each NCAA of interest creates bespoke engineering challenges for each NCAA in each host. Off-target incorporation of the NCAA can be toxic to the host strain. Truncation or mis-translation of the protein product due to competitive compilation machinery can inhibit production of the desired genetic product. However, the present technology and the resulting POI spore can overcome these deficiencies by removing theneed to recode a host organism’s genome, engineer in vivo NCAA synthesis, or engineer membrane transport of an NCAA.

[0124] Reconstituted CFB systems, such as variations of the E. coli PURE system enable a simple, robust tool for genetic code expansion. They do not suffer from the limitations presented by using a cellular host, and their modularity obviates the need for large-scale genome engineering campaigns. However, these systems lack self-replication and suffer from the same measurement and screening drawbacks of traditional ribosome- display and droplet encapsulation of CFB systems.

[0125] In some embodiments, the sporulating bacteria with the silent GOI cassette enables the reassignment of any codon within the GOI without the need for expensive and slow whole-genome engineering of the host strain. Following screening or selection, the POI spore can be germinated for rapid sequencing, mutagenesis, or additional screening. Meanwhile, any variation of genetic compilation machinery needed for NCAA- incorporation can be added to the exogenous reagents to be encapsulated in the droplet. Thus, new recoding strategies, any NCAA, and any amino-acyl tRNA synthetase could be used for genetic code expansion and high-throughput prototyping with relative ease. As such, the nucleic acid cassette can be tailed for any protein product. Also, the CFB systems can include any NCAA reagents and the requisite amino-acyl tRNA synthetase. The target protein of interest can be removed from the spore coat and purified and used for any purpose.

[0126] In an example, the RuBisCo enzyme that can catalyze carbon capture in photosynthetic organisms requires several post-translational modifications (PTMs) for optimal function. Modifying these PTMs in a controllable manner to enhance function or stability of RuBisCo could enable identification of RuBisCo variants that could greatly enhance photosynthesis and aid in agriculture, carbon capture, and synthetic enzyme cascades. Using the recoded E. coli or yeast to engineer NCAAs into RuBisCo could work for some NCAAs (e.g., RuBisCo has been successfully expressed in a highly-engineered strain of E. coli), but the system would still suffer from the limitations of cellular hosts. Regarding ribosome-display, the RuBisCo of plants is a large hexadecamer (16-unit) enzyme, and the RuBisCo of red algae is a dimer, and neither could be easily used with ribosome-display. Additionally, the low turnover rate of RuBisCo (~3 / s) would make distinguishing changes in catalytic properties between single enzymes very difficult. Meanwhile, a droplet encapsulated CFB system would be limited by what selectivepressures could be applied. Using the method, any NCAA could be incorporated into the RuBisCo enzyme as a POI introduced into a POI spore, and diverse selective pressures could be applied to study the effects of NCAAs / PTMs in a high-throughput manner.

[0127] In some embodiments, the POI spore can be used in rapid generation and screening of proteins. Antibodies and vaccines made using species-specific CFB systems could have improved properties over alternatives. Humanized antibodies are of high-value. This method could enable the study and production of antibodies and other proteins made in CFB systems engineered to mimic human glycosylation patterns. Here, a protein-binder such as a nanobody could be used as the POI and generated with CFB-enabled glycosylation patterns. This POI spore then could then be screened against a therapeutic target to identify optimal binders that are a result of the DNA sequence and glycosylation machinery that did not have to be expressed from the same genome. The proteins could then be used as therapeutics. Accordingly, the POI can be a protein-binder or antigen, which can be used to engineer and formulate a therapeutic.

[0128] In some embodiments, incorporation of unnatural amino acids (UNAA) into antibodies and other protein-binders can enable site-specific conjugation with small- molecules to create powerful hybrid drugs. Existing NCAA systems are constrained in several ways: which NCAA s can be used, AA-tRNA synthetase reliability, and recoding strategies are all limiting and / or require significant effort to modify. However, the present system offers a way to completely remove these barriers and / or significantly improve them. Here, the nucleic acid cassette can be tailored with a gene of interest with a sequence that uses NCAA. Use of the POI spore also uniquely enables more complex high-throughput stability challenges for antibody libraries, enabling exposure to proteases, extreme pH, long-term storage conditions, and other important variables.

[0129] In some embodiments, the sporulating bacteria can be any sporulating bacteria. Also, the sporulating bacteria may be substituted with other unique microorganisms and viruses, or combinations thereof which enable the fundamental concept of a pre-packaging of genetic information by a cell into a particle that is then decorated by a POI made by exogenous genetic compilation machinery reading a copy of the enclosed genetic information.

[0130] In some embodiments, the present invention can utilize cell-free transcription-translation (e.g., CFB) systems, which enable in vitro production of genetic products (e.g., RNA or proteins) based on the genetic information stored in DNA andgenetic compilation machinery (e.g., RNA polymerases, ribosomes, tRNA, aminoacyl- tRNA synthetases, amino acids, post-translational modification machinery, and more) in cell-lysates or reconstituted compilation systems. CFB systems enable rapid prototyping of DNA parts, and can be used to quickly express and test protein homologs, promoter libraries, or other genetic parts or products. The in vitro nature of CFB systems broadens the use-range of biological compilation machinery, which is normally inhibited by the many constraints placed on a replicating cell. For example, enzymes that produce toxic compounds can be produced in relatively high concentrations using cell-free protein synthesis (CFPS). CFB can also be used to lower the barrier of entry for genetic code expansion, enabling the incorporation of non-canonical or unnatural amino acids into proteins without complex whole-genome recoding efforts.

[0131] The DNA molecules used in most CFB systems are often non-replicating and serve only as a template for transcription. Consequently, tedious and time-consuming DNA isolation and amplification steps are required following high-throughput CFB experiments.

[0132] A hurdle in all biomolecular engineering efforts is how to measure or assess the performance of a genetic part or product – the phenotype. The many use cases of biomolecules make many measurement types relevant to CFB systems, where the product can be used in molecule binding, molecular stability, and / or molecule function assays. Molecule binding can include: protein-protein binding, protein-molecule binding, RNA binding, DNA binding, and other combinations of molecule-affinity measurements commonly used in biomolecular engineering. Non-binding is also an important measurement. For example, in antibody engineering, it is common to include both positive selection (binding to a specific target molecule) and negative selection (binding to off- target molecules) in design-build-test cycles. These measurements are often expressed as Kd or Km. Molecule stability assays can measure the stability of proteins or nucleotide polymers in time at different temperatures, different chemical conditions, or when exposed to unique stressors, such as proteases, relevant in both antibody and enzyme engineering efforts. Molecule function assays can provide or enable an enzyme to convert a substrate to a specific measurable product(s). An additional phenotype could be the ability of a DNA sequence to code for a specific genetic product when read by specific genetic compilation machinery. This could enable the engineering of compilation machinery itself. A specific example would be using a variant of this method to engineer amino-acyl tRNA synthetasesfor NCAA-selectivity by (1) encoding a library of tRNA synthetases in the sporulating bacteria that when encapsulated in the vesicle (2) are assessed by their ability to correctly insert an NCAA into a reporter protein such as green-fluorescent protein which only loads onto the spore when correctly translated.

[0133] In ribosome display, a modified mRNA template traps the coding mRNA, the reading ribosome, and the translated protein product as a singular genetic unit with a genotype-phenotype link. Ribosome display has been used to great effect in engineering antibodies and even some enzymes through complex chemicals assays or compartmentalization approaches. The phenotype-genotype link of ribosome display enables simple yet powerful screening methods for binding proteins which is why it has seen widespread adoption in peptide engineering.

[0134] In some embodiments, the present invention overcomes the following problems with ribosome display assays. With the present invention, most proteins can be prepared. However, not all proteins can be successfully ribosome displayed due to protein folding limitations. The present invention can utilize multimeric proteins. While ribosome display creates only one copy of a genetic product per copy of mRNA, the present invention can create multiple copies of genetic product per copy of mRNA. Ribosome-displayed products cannot be exposed to proteases, nucleases, solvents, pH extremes, or other chemical conditions that would damage and break the link between the mRNA (e.g. genetic information) and the protein product; however, the products of the present invention can be exposed to such conditions without breaking the link between the DNA (e.g. genetic information) and protein product. Ribosome-display is not self-replicating, whereas the present invention can provide a product that is self-replicating.

[0135] Droplet encapsulation of CFB systems on microfluidic chips enables high- throughput generation of discrete CFB reactions made by the encapsulation of a single DNA molecule within a cell lysate or reconstituted CFB droplet. The genetic product is then synthesized by the in vitro compilation machinery and is maintained within the droplet along with its coding DNA and the machinery that made it. The genotype-phenotype link is established by the co-encapsulation of the coding DNA and the genetic product within the same droplet and is maintained as long as the droplet retains its integrity. In comparison to ribosome display, CFB droplets have some advantages including (1) signal amplification by creating multiple copies of the genetic product and (2) reduced construct design limitation (no need to tether the translated protein to a ribosome). However, the need tomeasure the phenotype within the droplet creates several new limitations that are again rooted in phenotype assessment or measurement.

[0136] In some embodiments, the present invention provides a gene product of a spore having protein of interest loaded on the spore, which can be measured or assessed by binding assays with the protein of interest. However, in droplet encapsulation, the droplets must either be sorted using on-chip sorters or fluorescence-activated cell sorters, which requires the phenotypic output must be tied to either a fluorescent or UV-VIS reporting system within the droplet. Accordingly, engineering genetic products with no inherent, and differentiating, fluorescent or UV-VIS properties of their own require bespoke reporting systems. This often limits the use of droplets to screening for enzymes that have commercially available reporters. Droplets cannot be used to engineer protein binding in high-throughput like in ribosome display. Having the spore with the protein of interest in the coat and surface-accessible improves measurement and assessment options.

[0137] Additionally, maintenance of the droplet is limiting. The droplet cannot be “re-opened” to add an exogenous substrate, protease, solvent or other relevant engineering factor after the initial encapsulation event while maintaining the genotype-phenotype link. Note, some methods exist to modify droplets after an initial encapsulation but these are tedious and require special equipment and microfluidic chip designs. Thus, protein function can only be tested in conditions that are amenable to the essential initial CFB function of compilation, confining these systems to cytoplasm-like conditions of pH, salt concentrations, no solvents, no toxic substrates, no proteases, etc. Also, the droplet is not self-replicating. Following screening or sorting, the DNA must be isolated and amplified before subsequent analysis and continued propagation. These additional steps can introduce biases and distort sequencing data.

[0138] In some embodiments, the present system provides for modular compilation of the nucleic acid allows for insertion of any gene of interest that encodes any protein of interest, whether with canonical, non-canonical, unnatural, or other amino acids.

[0139] In some embodiments, the present system provides for self-replication, as the spores can self-replicate into bacteria, then to sporulating bacteria, that produce more spores.

[0140] In some embodiments, the present system provides for self-diversification. That is, the nucleic acid construct present in the vegetative cell can be induced to mutate the GOI sequence to expand the library and incorporate new sequences. This can eliminatetedious PCR and cloning steps for library generation, replacing these labor-intensive techniques with a vegetative growth period in which an inducer-molecule within the growth media activates an orthogonal error-prone DNA polymerase that acts only on the GOI-LP sequence to perform in vivo mutagenesis on a DNA construct that will be compiled in vitro (4.A & 4.B).

[0141] In some embodiments, the system allows for upscaling and enlargement. As such, the system could be configured for generating a throughput of greater than 107spores a day.

[0142] In some embodiments, the system allows for high throughput binding assays. A “high-throughput binding assay” is an experimental format designed to rapidly test thousands of interactions — e.g., protein–ligand binding, nucleic acid–protein binding, or drug–target binding — in parallel.

[0143] In some embodiments, a modified sporulating bacteria may include a nucleic acid cassette within the cytoplasm of the sporulating bacteria, where the nucleic acid cassette may have a silent promoter that may inhibit transcription by the sporulating bacteria. The nucleic acid cassette may have a nucleic acid sequence that may include a gene of interest that may encode a protein of interest. The nucleic acid cassette may also include a nucleic acid sequence that may encode a loading peptide that may incorporate into a coat of a spore. The sporulating bacteria may include a pre-spore that may include the nucleic acid sequence having the gene of interest that may encode the protein of interest. The silent promoter may be a T7 promoter that may be activated by a T7 polymerase or another cognate promoter-polymerase system. The silent promoter may be activated by a polymerase that may not be endogenous to the sporulating bacteria. The loading peptide may include a peptide sequence that may incorporate into a coat of a spore that may result from the pre-spore. The pre-spore may include at least one copy of the nucleic acid cassette. A plurality of modified sporulating bacteria as described may be included.

[0144] In some embodiments, a kit for forming a modified spore having a protein of interest may include the modified sporulating bacteria, a lysis reagent that may lyse the modified sporulating bacteria, a polymerase that may activate the silent promoter, and cell- free biosynthesis components. The kit may include a T7 promoter and T7 polymerase. The kit may include non-canonical amino acids that may be configured for incorporation into a protein. The kit may also include unnatural amino acids that may be configured for incorporation into a protein.

[0145] In some embodiments, a system for forming a modified spore may include a first input into a microfluidic system that may receive the sporulating bacteria in an aqueous medium and a second input into the microfluidic system that may receive cell-free biosynthesis components in an aqueous medium. The system may have at least one channel containing an oil, where the first input and the second input may be fluidly coupled with the at least one channel containing the oil. The system may have a fluid flow system that may flow at least one of the sporulating bacteria, cell-free biosynthesis components, or oil. The system may further include a reaction channel that may receive the sporulating bacteria and cell-free biosynthesis components in the aqueous medium into the oil to form a droplet of the aqueous medium containing the sporulating bacteria and cell-free biosynthesis components. The system may include the modified sporulating bacteria, where the sporulating bacteria may include a pre-spore that may progress to a spore, and may also include a lysis reagent. The system may further include a polymerase that may activate the silent promoter and components that may form a protein.

[0146] In some embodiments, a droplet may be provided that may include the modified sporulating bacteria, where the sporulating bacteria may include a pre-spore that may be progressing to become a spore, and an aqueous medium may form the droplet containing the modified sporulating bacteria. The droplet may further include a lysis reagent, a polymerase that may activate the silent promoter, and cell-free biosynthesis components for forming a protein. Another embodiment may provide a droplet that may include a lysed modified sporulating bacteria, where the nucleic acid cassette and pre-spore or spore derived therefrom may be located outside the lysed modified sporulating bacteria, with an aqueous medium forming the droplet and containing the nucleic acid cassette and pre-spore or spore. The droplet may be within an oil.

[0147] In some embodiments, an aqueous medium may include water and a lysed modified sporulating bacteria in the water, where the nucleic acid cassette and pre-spore or spore derived therefrom may be outside the lysed modified sporulating bacteria. The aqueous medium may include at least one of a lysis reagent or a polymerase that may activate the silent promoter and may further include cell-free biosynthesis components for forming a protein.

[0148] In some embodiments, a modified spore may include a spore body containing at least one copy of the nucleic acid sequence encoding a gene of interest, a spore coat, and a protein of interest derived from the gene of interest, where the protein ofinterest may be inserted into the spore coat. The protein of interest may include a loading peptide that may load the protein of interest into the spore coat. The modified spore may include a plurality of the protein of interest inserted into the spore coat. The modified spore may include the nucleic acid cassette having the nucleic acid sequence including a gene of interest that may encode the protein of interest, where the protein of interest may include or may omit the loading peptide.

[0149] In some embodiments, a method for forming a modified sporulating bacteria may include providing a nucleic acid cassette having a silent promoter that may inhibit transcription by the sporulating bacteria, a nucleic acid sequence including a gene of interest that may encode a protein of interest, and a nucleic acid sequence encoding a loading peptide that may incorporate into a coat of a spore. The method may include providing a sporulating bacteria, introducing the nucleic acid cassette into the cytoplasm of the sporulating bacteria, and introducing the gene of interest into a pre-spore within the sporulating bacteria. The pre-spore may include the nucleic acid cassette.

[0150] In some embodiments, a method for forming a modified spore may include providing the modified sporulating bacteria, lysing the modified sporulating bacteria with a lysis reagent, activating the silent promoter with a polymerase for the silent promoter, generating the protein of interest from the gene of interest, and generating a modified spore having a spore coat with the protein of interest inserted therein and having the gene of interest within the spore. The method may include introducing the modified sporulating bacteria into an aqueous medium having the lysis reagent, polymerase, and protein-forming amino acids, and generating the modified spore in the aqueous medium. The method may include introducing the modified sporulating bacteria into a first input of a microfluidic system, introducing the lysis reagent, polymerase, and protein-forming amino acids into a second input of the microfluidic system, combining the modified sporulating bacteria with the lysis reagent, polymerase, and protein-forming cell-free biosynthesis components in a channel of the microfluidic system, and generating the modified spore in the channel of the microfluidic system. The method may include forming a droplet in oil in the channel of the microfluidic system, where the droplet may include the modified sporulating bacteria and lysis reagent, polymerase, and protein-forming cell-free biosynthesis components, lysing the modified sporulating bacteria in the droplet, and generating the modified spore in the droplet. The droplet may flow through the microfluidic system during the lysing of the modified sporulating bacteria and generation of the modified spore. The method may alsoinclude breaking the droplet to release the modified spore and harvesting the modified spore by centrifugation or filtration.

[0151] In some embodiments, a method for detecting a modified spore may include providing the modified spore, providing a binding agent that may bind with the protein of interest, binding the binding agent with the protein of interest, and detecting the binding of the binding agent with the protein of interest.

[0152] In some embodiments, a method for assaying the modified spore may include providing the modified spore, providing a stimulus or stress condition to the modified spore, and detecting an outcome of the modified spore in response to the stimulus or stress condition.

[0153] In some embodiments, a method for forming a modified sporulating bacteria may include providing the modified spore and providing a stimulus to the modified spore to cause production of a modified sporulating bacteria having the gene of interest.

[0154] In some embodiments, the gene of interest may be transcribed by exogenous transcription components into an mRNA, where the exogenous transcription components may not be from the modified sporulating bacteria. The mRNA may be translated by exogenous translation components into the protein of interest, where the exogenous translation components may not be from the modified sporulating bacteria. The exogenous components may be present in an amount greater than endogenous components of the sporulating bacteria, such as 5x, 10x, 20x, 50x, 100x, or more. The protein of interest may be a fusion protein with the loading peptide. The exogenous components may include a polymerase that may only activate the silent promoter. The modified spore may be configured with the protein of interest including an antigen that may cause an immunological response in an organism. The loading peptide may be a spore coat protein or a portion thereof. The modified sporulating bacteria may include a second nucleic acid cassette that may include or may encode for one of the protein of interest or loading peptide, and the loading peptide may chemically react with the protein of interest with or without a chemical coupling agent forming a covalent bond between them.

[0155] In some embodiments, a modified sporulating bacteria may have a first nucleic acid cassette within the cytoplasm of the sporulating bacteria, where the nucleic acid cassette may have a silent promoter that may inhibit transcription by the sporulating bacteria and a nucleic acid sequence including a gene of interest that may encode a protein of interest. The modified sporulating bacteria may further include a second nucleic acidcassette within the cytoplasm of the sporulating bacteria, where the nucleic acid cassette may have a promoter, silent or not, and a nucleic acid sequence encoding a loading peptide that may incorporate into a coat of a spore before or after droplet encapsulation. The sporulating bacteria may include a pre-spore having the nucleic acid sequence having the gene of interest that may encode the protein of interest.

[0156] In some embodiments, a combination of modified sporulating bacteria may include a first modified sporulating bacteria having a first nucleic acid cassette within the cytoplasm of the sporulating bacteria, where the nucleic acid cassette may have a silent promoter that may inhibit transcription by the sporulating bacteria and a nucleic acid sequence including a gene of interest that may encode a protein of interest, and a pre-spore having the nucleic acid sequence having the gene of interest that may encode the protein of interest. The combination may further include a second modified sporulating bacteria having a second nucleic acid cassette within the cytoplasm of the sporulating bacteria, where the nucleic acid cassette may have the silent promoter and a nucleic acid sequence encoding a loading peptide that may incorporate into a coat of a spore, and a pre-spore having the nucleic acid sequence having the gene of interest that may encode the protein of interest.

[0157] In some embodiments, a droplet may have a diameter that may range from 5 microns to about 200 microns. The modified spore may be encapsulated within an encapsulating material. Post-translation modification components may modify the protein of interest after translation.

[0158] EXPERIMENTAL

[0159] In Vitro Spore-Display Protocol

[0160] Initial Strain Engineering:

[0161] B. subtilis (∆trpC2, ∆SleB, ∆CwlJ), or another germination-impaired sporulating bacteria, is made naturally competent and transformed with linearized pTREX2_CotY_SC003. This enables the production of B. subtilis spores with surface- available SpyCatcher, this strain is called B. subtilis IV1.

[0162] Strain IV1 may or may not be further transformed with additional vectors such as pWhiskey_MjTyrRS that enable pre-loading of the vegetative cell with a POI for the engineering of epistatic phenotypes. These strains are referred to as B. subtilis IV2. Also, see Fig.3E.

[0163] Strains IV1 / IV2 are then prepared for electroporation and transformed with pBS0E_T7_ST_sfGFP (in other iterations, the sfGFP be replaced with any cargo protein or combination of reporter proteins). This creates strain IV3, which is then ready for in vitro spore-display using a microfluidic device.

[0164] Microfluidic Protocol:

[0165] Strain IV3 is sporulated using a standard resuspension protocol with difco sporulation media (DSM) or other method of initiating sporulation.

[0166] After 12, 14, 16, 18, or 20 hours following resuspension, the sporulating mother cells are visually inspected by microscopy and checked for the formation of phase- bright endospores. When >10, 15, 20, or 50% of the population has phase bright endospores, the cells are harvested by centrifugation.

[0167] The cells are resuspended in PBS (pH = 7.6) at an OD600 of 0.000001, 0.00001, 0.0001, 0.001, or 0.01 to create a “spore solution” which acts as one of the aqueous phases in the microfluidic device. The amount of dilution determines how many cells enter each droplet and how many empty droplets are formed.

[0168] A second aqueous solution, called the “TXTL Solution,” is prepared containing transcription-translation components [including T7 polymerase, ribosomes, NTPs, amino acids, etc.] This may be prepared by cell-lysis and supplementation or purchased from a vendor. The solution also contains 0.1, 1, or 5 mg / mL lysozyme and 1- 100 µm of cephalosporin or other cell-wall-targeting antibiotic to prevent outgrowth by any germinating spores.

[0169] The two aqueous solutions are mixed in the microfluidic device and encapsulated within oil-bound droplets. The relative flow rates of the two aqueous phases are controlled such that ~10% of the mixed aqueous phase is the spore solution and ~90% is the TXTL solution.

[0170] The droplets are incubated at 15 – 37 °C for 1 – 6 hours to enable protein production while the spores remain phase bright.

[0171] The emulsion is broken by the addition of a chemical de-emulsifier and the spores, which now have the established genotype-phenotype link, are harvested by centrifugation. The spores are washed thoroughly to remove any amino acids or other TXTL components that may act as germinants.

[0172] For the ST-sfGFP constructs or other fluorescent reporters, the spores can be immediately assessed using flow cytometry or FACS. For applications where bindingof the POI is to be assessed, the spores can then be washed to remove any non-specific protein interactions and assessed using bead-binding, immunostaining, and / or FACS.

[0173] Fig. 5 illustrates flow cytometry data showing the successful loading of (Specimen 2) ST-sfGFP made in a TXTL solution and loaded to IV3 spores carrying CotY- SC003 and a negative control of (Specimen 1) wildtype spores which were also incubated with ST-sfGFP but did not form a covalent bond, which demonstrates a proof-of-concept of the invention.

[0174] Fig.6A illustrates the plasmid for pWhiskey_MjTyrRS.

[0175] Fig.6B illustrates the plasmid for pTREX2_CotY_SC003.

[0176] Fig.6C illustrates the plasmid for pBS0E_T7_ST_sfGFP.

[0177] SEQUENCES

[0178] The following nucleic acids can be used in the present invention. The nucleic acid cassettes pBM100, pBM200, and pMB300 shown here are native plasmids to the sporulating bacterium, Priestia megaterium. These are whole plasmid sequences that include the Origins of Replication (OriR) regions.

[0179] pBM100: NC_010008.2 (SEQ ID NO: 1) GATCATTTTGCCGATTATGTTTCAATCAGAAAGTTGTGTTCGATTTCGGACAGATATTTTGAATATTTAT ATTCAACTGTTAACTAAAACTGTCTGCAAATTAATCAATGTCTCTAGTAAAATTCCGATTTTATACCCAC TCCTATTTTCATCAATAGGACATGATATAATAAAAAAGAACGGAGATTGAGGCCTCCGTTCTCTTGGTTGTACTTGTTGCAATAGTACGTTTATTTGGTTACGTATATTATAGCAAGTACTCCAACAAAAAATCAATCGTTGGAGGAATTTAGAAATGAATGGAATTATCAAAACAATAAAAACAACGCAATATGCTCAAATACATAACG CGCCATTACAAACGGACCTGGAGGACTTGCGGTCTATCGGTCTATTAAGTCATATTATGAGCTTAGGTGA AGGTTGGACGATTAGGAAGACCCAGTTACAAAACAAATTTTCTCGTAGAAATGTAGACGCTGCTTGGAAG GAATTAGCTATTAAACAATACGCTGTCGGTTTTAGCGCATATGTTGACGGAAAAAAAGATTATTTTTACGCCGTATCAGATATTCCGATTTCGCAAGCTAATTTCGAATTGCTTGTCATTGAACAAATAAATCTCTTACAATCGCAAGGTAAAAACGTCATGACGTTAAGCGTGATACAACATTCGCCACTTGAAATCACTGAAAAAATA TCTGATGTACAAAATGTACATCAGATACAAAATAAGCAAATTTCTTCTGATGTACGTTCTGTACAACACA GTGTGTACAACACAGAACGTACACCTATAAATAAAAAAGAAACAAATGAAAAATTAACAAATGAAAAAAT TAGTAGTAGTCCACGTGATTTTATTGATGATAAATTACGAGAAAAATATAATAATGTACCTTTCGACGAAGTGAAAAGTGAAATGCTTAACGATACTGTAATCGTTGATACGAATAAGCAATATAAATCACTATTAGAATACCGTCTTAAACATTGGAAACCGAAGCAAACAAAAAGGAAACGTGTAGTACGTAATGCACGTAAAGAAAT GGTTCCAAAGTGGCTACAAACAAATGATGAAAATGCAGTAGCAGAAGATCTTCCAGTGAATAATGATTTT GAAGCTGAAAAGGAAAAAATGAAGGCGGAGCTTATGCAATTAGATGCAGAATTAAAAGCAGGTAATCGTT AATAAATATTGAATTACACCTACAAAAGCGAGAGCGAACGAGGTGAAGAACGTGTCAGAAAACGAACGCGCATATTGGAATCATGAAGTAGCTGAACAACTTGACATAGGTACAAGCACATTAAGAAAATGGTGCTTAGAATTGGAAGAGAACGAGTACGTGTTCTCTAAAGGCGAACAAGAAAGCCGAGCTTTTTTAAAACGTGATATT GATGTTTTAATGAACATGAAAAATGAAATACGAAATAAGAAAAAATCACTCAAAGATGCGGCTAAAATCGCGTTAGAAAAGGCAAGAACGGGGGTCGTTCTCGTAGAACAAGAACAGGAACAAGCACCCCCCGTTCCCGT CGAACAAGCACAGCCGATGTTCACCTTGGAGGACATGCGGAACATTGTACGTGAAGAGCTACAGGAACAA GCTAAAGCACGTGAGAACGAACGAGATAAAGCACTAATGGGTGTCATGCGTGAATTACAGGATGTAAAAA AAATGATAGCTGCTTCTCAAGAGGTAAGTAAAAAAAAATGGTGGGAGTTTTGGAAAACCTAATTTTTTTAGAAATCTTGAGTGCAATATAGTTTAATACATCTTGAGCAACTTCAATGGAGTATTATCAACAACATGTAATAGGTTATTTCATAATACAGAGAAGAAGTTTTATTAAAAAATGATACCTTCAAGGTGTATCTTTTTTTGT AGCATGGTATATAGCATATAATATTTTCCCTTTATGTCTGTTATATAGGCAATTACAAAGTTTTCTTAAA GATAAGGTCAAGTGGGATGCAATTTTCGAGATTGTTATTGATAGATACTATAAATTACGTAAGTAATTAT GTATTATCAAAGCTGCTTTTTTTCTCCTGTTTTGTTTGTATGATGAATGGGGGAGACGGCGGCAAGGATGAAGGTATAAGAAAAGCCCTCAAGATTTGTTGAGGGCTTTTCTTACATGTTTGGTTGATTATAGCTACTGTGGTAAAGAGCTTGCTTTTTTCAATGTATTCCTGAACAAGGTTGAACAAATAGCTTTGGGAATAAATAAGT GGTTGGAAAAGTTGTGGGTTATTTAAAAAATAGATAAATAACAGGGAGACGAGAAATGATCCTTTAAAAA CGATTTATTAAATTCATCTTTTCTTAATGTTTGTAAGGGAGAATAAGTCAAAAAGACCTGTAGTTGTGTG ACTACAGATCTTGTCTCTTAATAACTGTGGGAGTAGATTGGATTCGCTCCTACAATTACCTCGTTCCCCCGTTCAGTCTTTTTTAAGAAAGCTTGACCCCTTTCTTCTGGACTGATATTAAGAGCGTCAAACAGCTTGTCATACGTGTCCATTGTCACGTTGCTGTTCCCGCCCTCTACACGAGAGATTGTTTTTTGTGTTGTATTAGCC ATTAAAGCAAGGTCATCTTGTGATATGCCTTTGCTCATACGCTTCTCTAGGATTAGTTGCCCGAAGATAG AGGCTGTACTGCCAAATAAAGATTTGTGCAACTCAGGATTTTTAGCCTTCACCATTTCCCTACCTAAATT CCGTAGGTTTGCCATGAAAAATCATCTCCTTATAGCTTATTGGTAGAGGTCATCAAAATATTTACGGTAATCATCGAAATGTGCCCTTACTTGTTTAAACACCTCGTACGTTTCCTGCATGTTTTCATCTGTTGGGTCATCGTTATCTCCTTCTTTCCCTTCTTTTTCGAAAGGATTCACTAAACAATAGAAAAGTTGGTTAGTATCAGG ATGATATTTAGGGAAGAAGGTAGCACGAAAATGCCAATTTAATCGCTCGACGCTTAATCGTAACTCATAA ATTGGTTCTGCACGTAATGCCTTAATAGCCTTTGGACGTAAAGTGTACTCTACTCCGTCAATTGGGTCTG TTGTTAATTCAAACCCTACGAAGAAATGATTTCCCTCTGCGTCTCTACCTCTAGGTGGTAATTGAGCTTTGGGAACAGTCGCTAGTGCATCCATTGCTTTAGTGATAAACCCGATTTTGATTAAGGAATCTTTGGCGGGGTCTTCAAATAACATAGACATGTAATCCGTCATCTGATCTACACCTTTTAAATCGGGTAATGAGATAACCT CTGCTACTATATTTACCATACATCATATCATATAATACCTAAATTGTGAAAAAATTTAAGGCGTATATGA CGTTTCCCCCCTTTGATGTAAAATTAACGCCTTTTACAGCGATATATAAATTTTAATATAAAAAATTAAA AAAAGGGGAAAAACTTCCTTTTTAATTAAGTGAGATAAAAAGATTAAAATGGTGTTTTTTTATGCAGGTATTTCAAGCGCGTTATTCACAGAAACGTTGTTAAATCAACAATGTATAAAAAGATGCATAATCAAGAAAACTCTTCTTTCTGCGAGCCCTTGCCTCCCAAGGTTTCTTTTTTGTGGTGGGTTCCGGAAAGAGTGTTTATGT AAACTAGCTTTGTATATCGTATACATACCCAAATGTTTCTTATCTAGTAAAAGAATGGTGATATAATTAT AAATAGATCTACACAGGGAGTAAGAATATGATGAATCCAAAAGAAAAGCAAAGTTCCAAATTTAGCGTTG TGTTTAAGTCCTACGAACAATTTTTGAAGAAGATTTTAAATATGTTCTTTACTAGATGATATTTCATACA AAAAAGGCTTTTAAGAAATATAACACTTAAAAGCTTTTTTTGGTGCCTATAAGCTGTTTTATGTTAACTA GAAAGAAATATATAAACATATACATAGCACTTTTTATTGATTAAAAAGCTGAGTACATTAGTTCTCAGCT TTCTTTATCTTTATCGTTATTTTCAATTAGCGTAAACAAATCGTCCAACGTTACATCAAAATACATCATC AATTTAGCTAGTAAACTGGCTGGTATTCGTCTGTTATTCATATCACGGTTGTTCGCCAAATCGTTTATTG TATCGCGTCTTTCATTGATTTCTTCAGATAATTTCCTTACAGAAATGTCTTGCTCTTCTAAATATTTTTTTAGATGACATTGCAATTTTACGTTCTCCAAAATTGACCTCCTTCTCAAAAAAATTCAATATTTTATTGACCTTTCATTATGTAAGATGCTATATTTATGTTAACAATTTGACACGTTTAACGTGCCGATAACTGAATTGTTTATTCCATTTATTTTAACATATGGGAGCTGATTCAAATGGAAAAAGCTGAAAAATTGTTAGTGGGGATC GAAAATGTTTTAGGCATGGCTAATGAACTTTTTGACGAGGTAGCACGTTTGAAACAAGTCGAGGAGGAGT GTAAAATCCTAAAAGAAAAATTGTTTTTGACCCAATTTACACGCTCGGAAAAAGAAGTGTTTGAACTCGC ACTTGACAGTCTTTCATCTTCAAAAATGGCTGAATGGCTATTCAAAGAACGGAGCACAATTTCACAACAACGTAAGGATATTTGCAAAAAATTAGGCGTTAAAAATATCAAAGAAGCAGTACAAAAATTTCAAAACCTTCACCAAGAACCGCAACAAGAAATCCACCAAGAATCACCACAAAAACTCGTAAACATTTCATAAAAAATGAA AAAAGCGTATCGACAGCAGGTGCCCACGAGGGGAATCAGCCACCTAAATAGTTGAAAATATGGAATATTT TTAGGGGGTTGAAGGGACATTGCAAACGTTTTCAGTGTACCCACTGGAAAAAATCGTGGTATCACGGTTA AGCTAGGCTCTGCCTAGCCTAGCACAGTATGTGATAGCAAAAACCCCTTATGCTCTTTCGAAGAAATAACGGATTAATTTCCAGTTACTATTTTTTTTGAAAAAAGGAGTTGGTTTTTTTGGATATTATTATTCGCAATATCGGCAAAGAATACGTCAAAGCAATTGATGAAAAAGCGAAGGCATTGAACATGTCTCGCAATGAATTTTT GAACAGATATTTAATCGGATACGCACATCATCGGGAAGCACTTGGGAGGGAAGACCGACTGGAAAAGTTT CTTAATGAAACACAACAGCAAATGTTAGCTTTCACAATGCTAATGGATATGATGACAGATACTTTACGAG AATTAAGTGGATTGGACGATGATGAATCGTAATCATATGACGGTTTTTTTATTTAAGGGTCTTCTGAAACACGAGGCAATACAGCAAACGTACGAAAATCGCCTGTATTTGATTTTTGATGTGTCGGAAGATAAATAATTGCCTTATCATTAAAAACGTCATATAAGGCAATATGGAA

[0180] pBM200: NC_010009.2 (SEQ ID NO: 2) GGATCCGTCAGTAGTTTTTTCTCTGATTTATAGAAAGAGACAGAATGGTTAGTCGCATAATTTATGATATGTAAAGTAATTACAAGTGTTTGGACAAGTGCTGATATTATAAAAATTTTATTAACTTTGATTGATATAGTAAGAGTACATAACTTAAAAACAGAAAAAGACTACTTCTTTCCAGTCAAAAGAAGTAGTCTTTTTCTGTTA CGTAATTGGGTTTCATGAGTGATGCCTCATTGCATCTTGGGTAGTTTGCTCAATTTATCAATAACTTATG TATTAAAAGAAAAACCCACCTGATTTGTCAGAGGTGGATTTTTCTTTTAGAAAATCTACATATGATTAGT TTACTCTAACTATTGTCTTTTATTCCTAATAGGCAAGTTACCTAAAGGAAAATAAGGGCATATGATGTATTTCGAATAATTTTCGTCTTACACTTAGAATCCTTTTAGTTTCATTTTTCACCTTCATAATTTACAAAGTCAAAAAAAAGAAAAAACAATCTGTATTGGAAGACAGATTGTTTTTTCTTTTAAATGAGAGATGGCTTTATC GAAGTCGCATTCCTAGAGCCTTCTCTAATAATATTCAAAATCTTTTCAGATAATGAATTCCAATAAAATC CATTATACTAACTAAACATATATATAATATACATCTAAAAAAACAGAAAAACTCCCAGGCGGCAGGGAGT TTTTCTGTTTTTTAACAACTGCAAATCCGTTCGGGAGGGTAACTGATCTACTGGGATTCAATGTTATGGTTCATTCATTCTATGTAAAATAATCTAAATGGTTTATATATATCTACAACAATCCTATTATTTTTACCAGTCCAGAGTATAGGCGAGCATTTTAATTTTTTATGCATATCTTAGAAGTATTAAGCATATACGGGGGTGAAA ATATGGGCTTTGGCGGTTGCGGTTATGGCGGATATGGTTACGGCGGAGGCGGCAGTGGTTTTGGCAGTGG TTTTGCTTTAATTATTGTCCTCTTTATTCTATTAATTATTATCGGGGCTTCTTGTTTCGGCGGCTTTGGT GGAGGATGCTAATCATTAAATCTAATTTGTTTAAAAAAAGTTAGCTAGATGCTAGCTTTTTTTATTTTTGGATGAAAATTCATTTTCAATCAATGGGGGCTAGCCTTTATACAAGGTACGAGTCGTATTTTTCAAGAAACCCACTTAAAAAATCTCCACTCTTTTCTCCTTGTATAAAGACTTTCGGCAGGTTTGAATCTCTCGCCAAGC CGACATACCCAAAACGAAGGATATGGGAATCGGCTTGTTTAAGCAAGTATACCTGCCGAACCGCCAGCTC GGCCGTACAAAAGTGCTCATCTTACTCCAAGGTAAGCAACGCACTTAAAAACATAAGAAGCCAGCCTCTA CCCCAAAACAAAGGGGGAGATAAGCTGCGTTGTCAATGGTAAGCGGACCGTAGGGAGCATTAAGGAATTG ACAATGTCACTACACCAAAGACCCTCTTGGCACTCAAACAAACGAGTTTGTTTGACGCCAACCGGCGAGGGAGCCCCCTCAAAGTTTTGAGGGGGTTGGGGGTGTTTGTACAAGCCATTCCAAAGGAGCTTTCCTTTGGC AGGTGTGGACAGCGTCCGCGGTTTGGCTCCCCCTTGAAAAGGGGGCTGGGGGGATTGTTATGCCTAGCAT AACCAAGCTCAATTGGGTACCAATTGTAGAGCTTGCCTTATTCCGACTGTTTGGTGTATTATGGAAGCAT ACAGCTGGAATTTTACACCAAGTTCACCACGTTCAGTAGGTGAACATAAGGAGGAATAAAGGGATGAGCGAGACGAAAGGCGAGCGTAGGAACGAGCCTAAACAGGTGAAGTTCCGTGTTACTGAAGAGGAATTCGAACGGCTATCGTTGATGGCGGATAACGTAGGAATGACGGTGCCTGCCTTTGTGAAAGCAAAGGCACAGGGTACC CGTGTACGACAGCCGAAGATCAATCGTGAGGGTGCTCTGGCCATCGCGAAGGAATTGCGTGCTGTGGGTA CCAATGTGAACCAGATTGCGAGATGGTGCAATGCACGAGACATTGAACAATTAAGTGAACAGGAGCTTGA GAGATTGGTATACAATCTCGACGAAATTAAAAAGGGATTGGCTGCAGCATGGCAACAATTAAGCTGAGTACGACGAAAAATGCCAATGCGTTACTGAAGTACGCTGAGAAGCGCGCTGAGGTGTCAAATTCACTTGATTGTGATGTGGACTATGTAAGAAACCAATTTAAAGCTACAAGGGAAATATGGGGCAAGAACGGCGGTATACAA GCCCATCATGTCATTCAGTCGTTTAAACCAGATGAAGTGGATTCCCACCAAGCCAATGAAATTGGATTAC AACTGGCTGAGAAGTTGGCAAAAGGTTATGAGGTGGCCGTCTATACGCACACGGATAAAGATCATATCCA TAACCACATCGTGATTAATGCGGTGAACTATGAAGATGGCCGGAAGTTTCATGCCCATGGCCAAGAGACGATTGACCGTTTTCGCGAAGCAAGTGATGAACTGTGTAAGGAAAATGGCCTTTCCATTGTAGAAGAGCGCTCGGCGGATGTTCGCTACACATTAGCTGAACAGTCATTACTTGAAAAAGGTGAGTCTAGTTGGAAGGATGA AATTCGGACGGCCATCGATCAAGCGAAGGAGCAGACAGCTAGTTTTGAAGAGTTTCAGGAACATTTAAAA GAGCAGGGCGTCCAAGCAACTTTAAGAGGCAAAAACATCACGTATGAGCATCTAGAATCGAATAAAAAGG TACGTGGCATGAAATTAGGGTTGGCGTACGAAAAGGAGACGATTTTACATGGCTTTGAAAGACAAGTTACAAGAGAAAGAGAGACAAGAAATTCAGCAGCCACAGCAGAAAGAGGAGATACAACAGTTACAGCAGTTATATCAGGAGATGATCTTACGTCTCAGAACGACAGAGGGCTATCTCTCGACGTTCCTGAAAGAAAACATGAAC AAAGAGATGATGATCGAACAAGAGCTCGAACAGATCAAACAGACGAGCCAAGACGTGCAGCAGGAAATGA GCTTAACTTCGATGACATTGCTCAGCAAATTAGAGAACGACATCGTAACACACAAGCAGTATACAAACGA AACTTTGGCCGAGATGAAGACGGCCATCAGAGTGCTACAGAACGATCTGAAAAAGAACCAGGACTTTCTGAGCAACGAGTTCCAAGCAAACAATCAAGTGATCAAGGACGAGCTAGAGAAGATCAACAACAACCTGGGGAGCAAGTTCGACAGCTTGAGCGCGACAGCGAAGGCAGAACTCAGCGAGGTCGAAAAAAACAGCAAGACTAT GATCTCGAACGCTAAGTTAGGGGTTGTGTTTAATGGCTGGTTAGATTGGGTGAAATACGGAGCTGGCGCA GCTGTCTTTATGGTACCTATGTTTTTCTTGTTCAAATGGTTCTTTGGTTTATTTGGTATTAATCTAGGAT AATAGATAAGGCTTTTATAAAATTAGTTGAAAAACTGCGAAAAGAGTAGAAAAAAAGGGAAATTATTGATAGTGTTGAATGTAGTATAAATGAGAAAAACCGCCCATGCTTTGGTCGGCAGGCGGTTTCTCAAAAACAGAAAGGGAATGGGTCCCTTATATACATATTTATGTACATATTCTATCATAAGGGGCTGGTTCCTGCCATATA AGGAGAGGAATTAGTTTGGAAAACAACAAAAATAATATTGTGAATTTGGAAAAAAAACTTGCTGAAGCGG AAAAAAAGGCAAGATTAAAAGATTTCAAAAATAAATCATATTCATCAGAAGAAGTCTCTGATATTCAAAG ATCATTATTAGATCTAATGCAGGAAATTACAGGTGAAAAACATTTTATCGGTAAGGAAAAGGATATTTTT GCAGGGGAGCCGTTTAATCAAACTATGCATAGAAATTTAGATTTGTTGACTAGAATAAATTATTTAACAA CTGCTGAGGAAAGCTTTTTGTTTAGAATTCAAGCTTATTTAGAGTTTAAAAGTAATGTTATTATTTGCAG AGAAGACAAATTTAAAAAGAAACGTAATAATGTTGTAGATGATGATTATGAGCTTCCTAAGGCAGCAACA GTTTCAGAAATTGCAGAAATGATTGGTAAGTCTAGGGAAAAAACTTCTTTAATTATGAATTCTTTAAAGA AAAAAGAGATTTTATTAAATCCTGAAGGTGCAGGACAAGTTAGTGAAAATGGTCGTTCTGTAAGCCCTAGAACGTGGATTGTAAATCCTTATATTATGATTTGTGCTCCGCGTAAAAACGAAGTTAAGTTAGATAAATTAACAATGAGATTATTTCAGCATTCTTTAAAAAACCTTAAAGATCCGAATGGAAAAAAAGTAAATTTGCCAGTTAGATTTTTTTAATAATGATTTTAGATCGTATCAAAAATGATACGGTCTTTTTTAAGCATTTGGATTTT TTTAGGTGTGACGAAAAGGTCACAAAACTACCCTAAAGTGTGACGAAAAGGTCACACCCCAAAAACCTTG ACAAACCCAGTCATACCAAGGGCTCATCGGGGTTTGTTAACTTTCTCTCTATTATCACTATTATTTATTA GCAATTCGCTGATAGAATTGCAAGGATCTTTTTATACTTTTTTTCGTTTAAAAAAAGTAGCCTAAAGGCTAAAAAAACCGTCTCAAGACGGTCATCTTTTAATTTAAAAAAACTACTCAATCAATTTGAGTAGTTTAATCTAGCCATATTTGCCACCATTTCTTTTTAGCTTGATCTTTTGACAAGCTAGTAGCCATTTCTTTTTGTGAT TCTTGAACTTCCCTCAATGTTGTAATTAATGTCTTATCTCGTTGTTCTAAACTATCTTTTATGTATGCCT CTTGTTTTAGAAATTGTTTCTTAAAGTCCTCTTGCTGTTTTTCTATAATCTCATTTTGATTTTTTACTAA CTGTTTTAACTCGTCTAATTCAGACATAACGGTTGTGACGTGTTTCGATATAACCGTTATGTCTTCTGTTGTAGCAGTTATATCCGTTATATCGGTTGTGTCCGTCATAACTTTATCTTTTATAATTTCTTTTACAGCCTTGGGAACAGTCATGCCTTTTTCATTTTTTAAAACGATTAATTCTTTAAATAAATTTATATCATCTTGTGA AAACAAGAGTTGTCCTTGCTGATTACGTTTAAAGTTATAACCATATTCTTCAAAAAGTAAATAATATTTT TTGACAGTTGAAGTAGTAACTCCAATAGCTCTTGCTAATCCTTCTACTTTTTCATAGAATTCCATGTACA TATTAGTTATAACCTCCAATTTATTTAGGATTATAACCAGTATAACACCATCTTGATTTAAAAATCTTTAGAATTCATTAGGGAGAAATGATAAGAACAATTTTAATACTTGTTTCGTACTTATCAAATTTAATAAGTACGAAACAAGTATCAAAGACTTTTTTTAAAGTTGAAGGGATGCTGTACTAGATCTCTATAAATAATTAAAAC TGAAATATCAGGACCAACATTACAAATTTTAATATCTATAATCTCAAAATTATTATTTTGAAGAAAGTCA CGCAATCGTTCTTCATATTTATCCAATGTGGTCGTTAAAACATGAATCTTTAATGTCCTAGAATTACCTA ACATAAGATCATACACTTCTTTCTATATTTGTCGTATATTACAGTGTATGGAGCTTGTACAGAATGGAAACTGCAGTTTATATCTTTTTCTTTTATAAAAAGGATATATCTAAAGATGATTAATGTTTTTAACAAAATAAAAAGCTACCTCGCCAGTGGAAGCGAGGTAGCTCATAAATAGGGTTCATACGTTGAAATTTGTAAAAAATA GTCTGATTATTAATATATCATATTCACATGGAAGATCAATTATGTGGAGTGTTTAGCATATGAATAAAAG GTGCGCTTTTTATTCATCTATTTGTCACTCAGCCCGAGAGGAAACGTTGATAAATCAAGGATGTATAAAA AGCTGCATACTCCGGAAAAAGAACCCTCGGCGGAACCGTTCTGCGACAAGGGTTCTTTTTTGGGTTGTGTTCCGGAAAGAGTGATTATGTTAACTACCTTTGTATATCATATACAGCATAAAAAGAGAAAAAACTACCTTGGTTAGAAGATAGTTTTCTCTACATACATTTGGTGTTAGGACGATGTTTTGTGACATCATCAGTATTTTG TTCTAATTATTTTTGTTTTATTAATTTTGAAGATTCACTTAGTAATGAGTAGCAATATATATTAAAGGCT GCTTTTAGTTCATTTTATCGGTTGGATAGTTCACTTAAAGTGAGCTAATAAACATAATTTATTTGGTAAC TAATTATAATCTTTATCTTAATTCTTTTCATAATTACAAAACTGTATTTGCTAACAATGCTATATAAATTTCTAAGTTTTCTTGTAATCCTTCTAATTGTGTCTTTAGGTTTTCTAACTGGGATTCTAAAATCAATATGCCAAGAGTTATGTCCTCAATAGATCTTGTTAAATCATCTGCTCTATCGAATTGATCTTCATCAAATGCTTC TGATCGTTCTATAGCTCTTCTTCGAAGAAGGAGAACACCACCGATCAACGCCTCATAGGTATCCCTAATC TGTCTACTTACGCTCCTAATGTCACGTACTGTCGAGAGGAGATTGATGATCAACGTTTGTTGGGTTTGTG TAATTGGTGGCAGAGGAGTTGGAGTTGGAGGAGTTGGAGGAGCAACAGGGGCAGCAGGGGCTCCTGCTAC ATTAAAAAATGCATTTTCACTTGTTAATATGTTATTACTATTAGTTAGTAATTTTCTCATTAATTGTTGA CTTCTATTTAAAAGATTCTCGATTTCTTTAAATGTTCTTTGGCTTTGTTTAGTTTCAAATGTAATTCTTT TAAACAATTCATTAATATCTAGCTCTTGGCGCTTACGATTTTGTTTTTTACAATTACCCATTTTCAATAT TTCCCCCTTTTTGCTCTAATTCCTAAAAGTTGTTCTGCTAATTTTTCATTTTTTCCCAGAAGTTTTTCAA TACTTTCAATTCGGTTATTTTCACTTTTAAGCAATTTAATTAAGTCTCTAATATCTGAATCTTCATCGTGGTATTTTTTACAATTACCCATTTTTAAATTACCTCCATTGATCAATTTTCAGATGAATGTAACAGGATTTTTGATAGCCTTGCTATACTTGTCCTTCTTACGTTCACCATCTTTTGGGTTGTAATAAGATTTATATATGCTTATTACTTCTATTCTCTGTATTATATTTGCTAATAGAAAAAGTGTTTGTATGCTTGTCCTATGATATTG ATAATATTATAGAAAACAGCCTTTAGAAGTAACTATTTCTAAAGGCTGTTTGGTTCTTATAATATTCATT ATGTTAACTACCTTTGTATATCGTATACAGCTTAAAAACAGAAAAAACTACTGGCCATGCTCTCCAGTAG TTTTTTCTGTGACATAATTAGAAGTTAGTCTAGATGCCTTTAGACATCTTGAGTAGTTTGCTCAAGTTCGTAAGAACTTATGTCTAATCAGTAGTTTTTTCTTCATGAGATATAGCAACTTCATCTTTATAGTCAAAATCTGCTTTTTGACTGATTTTCCCTTCTTCAAAGATTACTTGGAATCTAATCTTTCTAATATTGTCCCAAGAT CCTCTACCAAATAGAAATGGATTCATTTCATAAGTTCCAGTTCCTTTTCTAATCATAATCCCTTCTTTAA CAAGCTTATTGATGTTGTTATTTAAACTTTGAACTGTATTAAACCCCAATTCTTCAGCCATTTGTTTTTT TATGTATGCATTTAAAACAACGATGTTATCATAGGCCATTCTTTTTAGAAGAACATTTAATGTCTTCTGAATACCACTTGATAGGTTATTTATCTGTAAGATATTATCTAAATAAATTTTTACGTAATCAGGTTCTTTGGAAACGTATGATTCTTCGATATGTCTTTGAAATAGCTTTTCTCCATCATCATTAGTAACTGTTTCTTTAAC TTCCTTATTGATTTTTTTTCTTTGTGTATCTCCGATTAAGTCCTTTTCCCAATCTTTCAAATTCACACCT CTTTTATATTATAATTTATAATCTGTATCGTATTATAAAAATTAGATAATTTCAAGGTGTTTTGTTATAA TTTATAATCTATTTCAGATTATAAATTATAACAAATATGATTATGATCTGTAACGTATGTGATTATAATTTATAATAAATACGATTATAGTTTATAACGTATACGATTATAGTTAATTCAAAGAAATGTTGTTATATCAATGTTTATAGAGTTTTATCTCTTCTTTTCTTTTATTTTATGTACATGTTTTTTTGTGTTGTTTTACTGGAT TCTGGAAAGAGGTATTATGTTAACTAACTTGTATATGATATACAGCTTAAAAAAACGAAAAACCAACCTC TGAGTCCTAAAGGTTGGTTTTTCTGCTCTTGGAGAAGAGATTCGTGTTGGACATTGGATGCCTCACGGCG TCATGAGTAGTTTGCTTAAGAAATAAAATTTTATTCCTAATAGGCAAGTTACCTAATCAATAACAAAAACATACAGTGTAGGAAGAATAATTTAGACTATGGAATGAATAACTCTTAACCTCCGTTTTTTTGCACCTCCTTGATTTATATAGCTAAAGATAGAAAAACCTATCTCTTCTTAGACAAAAGAGATAGGTTTTTCTGTTGCAG AATTTAGTTGTATGAGTCGATGCCCGTATACATCTTGAGTAGTTTGCTCCAATTATTTTTGTATTATTCA TCTGGACAATTTGCTTAGTAATGGGCAGCAACATATATTATGTATGACAAATACCACAACTCTTACTCTA TTTTCATCCTTTGTAAGGATGGCAAACAGCCCATGAATTAATTCATGGGCTTCTTTCTAGTAGCAATATATGAACTAGAGACCTATTTGAAGAGCAAGGAGGTTGCTCAATATTATAGTATGCAAAGTAATGAAAAAGGTTTGGACAAGCGTTCATTTTATCTAAGTTTTCTACTATTTCATACAGCCTAAAAACAGAAAAAACTACT

[0181] pBM300: NC_010010.2 (SEQ ID NO: 3) AATTGACATCTATTTCAAGGGCTTCGTTCATCTAAATCAAGACATTGTTTTCCTTTCACCAGGGAGACAGTGTCTTTTTTGTGTTCCTTAAAGGAGAAGATGAACAGATGAACAAGATATTGACTTGCTATTTAAAAGATGTAGATACCTTCAATGGACGATTAAAATGGTTATGGCAACAAAAAGCTACCCTTCGTACAAAAAAAGACG AATTTCTGGAAACACTCCGTACTTATTTTAAACAACAACAACTAGCCTTACATAAAGAATTTCCTAAAAA ACGAATGGAAATGTTAGATTACGTAATTTATAATCTTGTAGCTACGGGTATTCAAGCGATCCGTTCAGAA ACACTGATGAAAAAATTTAACGCATCTAAAAGTACGGTTTCTCGTTTTGTGAAATCATTAAAAGATACACCCTTTATACTTGTGGCACGTTACATTAAAGAAGATACAACAGGTGCTCACCCTGACAGCTATGTATTTGTCCTTAAAAACCATAAGAATTTTAATCGAATTTGCGATGAGATCTTTTTTGCACATGATACAACAGGTGTA CAAACGCTTCACCAAGAAGAAATGACAACTCCTGTGACAACTCCTGTGACAACTCCTGAACGTGCTGAAA ACGTTGATACAGCAAGCTTAGAGAGCGAAAAAACGTCCAATGCCTTTATTAACCTTGATTTACCTGTAAA TCATATTAATAATCATTTAATGTCTGTTTCACAGTCATTCGCTTATATCAAAGGTGTGCCTAAAAAAGTG AATCAAGTGTACACAAGTAAATATGGACATCAGTTAAAAGATTTCTATAGTCGCGTTCAGAATGCTGCAAAAGCTGTAAAACGAGATACAGAGATTGAGATTATCAAAGAGCAAGTACATGAAGTAGCTTATACAGCCAT TGTAGGCTTAGATAAATATGTCCATGAGGCTAATCATAAGGGTACTACCCTATCACTAGATGAAATGTGC CGTCTTGTTTATCAAATTGCTTATAATCAATTTACAAATCTACTAAAAGGGAATAAAGAAGATCAAACAT CTAAGTCAGACATACATACAAAAGCTGAAACAGCAGCACTATTTACGCCTAAACATATCATCCGTAAGGAATTAGTTCCTGCTTGGTTACAAGCTGAACAGCAGCAAAAAGAGTGTACACAAGAAAAAGCTATCTCTATGGATCAACAGCTTGAAATAATCCAATTAAAACAAGATTTAGGGCAAGAGTTAACGCGAGAAGAAGAAAGCT TACTACAAGAGCACAGTTCTACGTACAGTTCGTTAGAAATGGCACAGTTGAAACAGGATATAGGAAAAGC ACTAAACCTAGAGGAGCAAGCTTTACTGCGTCAGCATGATCAGTTGAAAGACACAGCTTCCTAATTAAAA TGTGCAGAAATCCCTTAGAAGCTAAAGTATTAATAGAGTAGGTTTATTTAAAATATATTCCTAAATAATAAATGTCTAAATAGGAAGGGGGGATCTTACCCTCCCTTGCTTTAAAAGTACACCCTAAAACAATCACCTATAGCGGAAAATTTGAATACTGTGGGAAAGACTATCAAATTAAATCCAGGGGGAGCACAATGTGACAAAACT ATTCGCTATCAATGCAGGGGAGTCCCTTTTTGCCGTTGCGAAAGCAGAGAACGAAGAAGAAGTCATTACT ATTCTTGTTAACCGTGAACTAGAAGAACAAGAGGATTTTGGTATTAGAGCGCATATTGATGATTTTTCGA TTGAAGGGCTGTATGGTGATTTCTTTCGTGATGAAAAGGGGTCATTTATCGAGAGTCACATTTTAGACTATCCTCGCCATATAAGAAAAATGAGCACTAAAGAGCGTCAAACCTATATCCAATCACATGTTGAAAAGAACGCTAGAGCCTTTTGGAAAGAGCATCCGTTCTATGCGGATCTCTACTTGCGAGAAGTCAAAAAGTATGAGG CTGTAGAGAAAGAGGGAGGAAATGTGTTCCGTCCGCATTTTTCGGAGGAATTTTATTTTAATACGGCCAA ATTAATTATTACTGGAACGGATTGGTACGGGAAAGATGTTCAAATCATTGAAATCGACTTAACCGACCGT AATTACCAGCTTATTTTTGAACTTACTTTAGAGGAATAAGCGCCGAGGGGGTTTTATTCCTCTCTTTATATAAATGAATCTTAGAAGCAAAACAGGACGTCTACCATGGTTGAAAAACTATTAAACTTATTAGACAGTTTAGAGGCAAAAGCCCACAAAGTCCTTGATGCTATTCACGCATTGAATGTATAGTCAGATGGCTTTCTAACA GTGAAAAGTGAACAAGCGGAAAGACTGATTGTTTATGTATTAGAGGAAGCGATAAATACTTTGAGTACAT TCAAGATGCAGGTATTTTCATGGACTACGCGAATAAAGAGACAAGCCAAAGTAAATTAATTTCGACAATT AGACAAGCTATTGAGAATGAATGGAAAGGCTCGATTCAAACTAGCCTGACATTTAGCTAAAGGAGTTGTCACAAGTGGACATTATTCTTCAAGCAAAAACGTTGGAAAAGAAACATCCTTTTCATTCCTGGGTGTGGGGTTGTCCCTCATGTGGCGAAAAAGTCTCTTCTCAGAAGGAAGGCGTGTACTATCAAGTAATTGGGAAAGGTT TTATTGACCAAAGGATTGTCTATACAGCTTGTTCTGTCGCCTGTGTGGAAGAGAAAATCGGAAGTATCGT TGAAATCTTGTATATCCAAACCAAACACGGAGGGCGCGGGATGTATCATAATAAGCTACACCCTATATCC TCAAGGGAATTTTACGAGTTTTGCAAACATATCAACATCATCAAAGATTATTAGAGAAGGGTATTGAAAAGAATGTTGCCACTGAAAATTCGAGCTATTTAAACGAGTTTTCTTTTAGAAGATGGATTAATGATAGGTTATGTTTATTTAGAACTATGTTCTAAATAAACAATTACTGAAAATCTACTCATGAGGAGCACAGCTTCAGAC GAATCAAAATACCCTAAAAGGACTTCATAGTATGGTTAAAGCTAAAAACAAGCGATTAAATTTGAACAGC AAGACAGAACTAAAAAACGTCTTCGGACGATTTCTACAAACAGAAGCCAGGGACCTGAATTGGGTATGTA ATAGCCTTATAATCCCTTTTTATTTTCTTAAGGTTTTATATTAACTTTAAGTTAATTTGCTCTTAGAAAG GTCTTTGAGGTTTGTACAGCCACTAAAAAGCCTTTTTTAAAAAATCAGCACTTGTACAAGCAATCACCTC TTTTCTTTGATTCTCATTTAATATAAAGAATCAAAGAAAAGAGGTGATTGAAATAGGTAACTATACTGGT GATGTATCTATTCCACGATTTACTGATATTGTATTGTAATATCAGTCATGAAACCTTGATACGTAAAAGA AAAACTCCTTTAGCAGTAGAGAGTTTTTTTAAGATTACAGAATGTAAATTATATAAACTAAAAATGCTAA TATCTATATATAAATAAAAGACATCTAATCCTGTTTGCTTTTATTAGCCAAATATCGAGCATATTGAATCATGTTCTTTACTACATTCAATTCACCATTACTGGTGATAGGAGTACCTGGTCTCCAATTAACTTCAAAAAGCCATAATTTGTTTTCTTTATCAAGTCCTACATCAAGTCCTAACTCGTCAAATAGTACATCTTCATATAGAGACTCAAAATGGTTAGAAAACTGTAGGGCAAATTGTTCGAGATGTTTTTGGATATTATAGTAGTTATCA CTAAATTCCTGTTTTAAAAAGATGTCGGTAAAGCAAGTATAACCGCCGTTACCTAGATTTGATACAATAC TTCCCTTTCTACCTATTCTTGGATATATTGAGGTAATTACCCAATTTCCATTTCCATCTTTTTGCACATG TAGTCTAAAATCATATACATTTCCAGATTTTATTTTGCATGTTATAAACTTCTGAACTAAGTAAGTACCCTCGCTTATCTGACTCTCGATAAACTCTATTAGTTGGTTTTCACTAAGTTTTAACTTTTGTTCGTTTTTACTAATCTCATAATAATTATCCGTTTTCTCTACAAAGAAGATACCTGCCCCTTTATGTCCAGATAAAGGTTT TACGATTATTTTTTTATAGCGTTCAACCATATCTAACAAGACCTTATAACTAGTTAGTTTTGAAGTAGGA ATAAGATACTGGGTAAATTTCTTAGCCTGATTCACCTTATTATAAACGGTTAATTTATCACCAACGGAGT GACTAGTGAATGGGATAATCTTGCTTAATTCATGAGTTATTTTTGCCATTTTATCGTTTACAGGGGCGCTAGCATTATAAATAACATCAGGGTAAGAATATTTTCTCTCAACCCATTTGCCTTTTTCGTAGGCCATTCCTAAAATAACTTTTTTTTTCAAATCCACCTTCCCTGGAGTGAAATAAAAAAAGTCTATTCCTTCACCTTTGG CAACTATAGCAAAAGCATAAGCTTTTTTTGCATTTATTGGGTCTTTACGATGATGAAGCATGCCGATTAA AGTCATAAAAACCATCCTTTCCCTTACTCTTAATTGTTTAGGTATATTCATTAATTTCATATATTATTTG TTTTTGATGAACCCTGGTTGTCCTTTTTTTATATCATAGATTAAGAGAAGGAAATATATGTATTTTATATGATGAAATCTTAGGATAGGATGATAGATGTTTATGGATACTATTGTACTTATTGAAACAAATAAATCTGGATCGAGTAGAGAAGCAATTAAAGCAGCAAACAAACTTAATTTCTTTACGGTTTTGTTAACTCGCAGAAAA AAATTTCTTGAGGAACGAAATGAATTCCCAGATGTACATCAAATGATTTTCACTGATACAAACGATTATA ATAATTTAGTTACAATAATAAAAAAGTTAAAAAAGGAAGGGAAAAATATACAAGGGATTTTTAGTTTTAT CGATCCTTTTGTTTATGTAGCTGCATGTTTATCAAAGAAGTTCTGTCAAAGTTCTGTGTCCACTGAAGCAATCTATCATATGGAAGACAAAATATTGACTCGTAATGTACTTAAGGACACACCAATTTCACTTAATTATTTAATTTACAAACCAACAGAATCACTTTCATCTTTTCTTAAAGCTGAAGAAATAAATTTTCCTCTTATCGT GAAGTCCCCCAAATCAACAGGATCAAAAGATGTATTATTGGCAAAGGATAAAACTGAGTTACATTCATCT ATGAAAACTCTTTTAAAAAAATTACCCGATGAAGAAATTTTACTTGAGGAATATGTGGATGGACCCCAGT ACTTAATTGAGGTGTTAGTCCATAATGGAAAGATTTATATTATTGCTGTGATTGAACAGGAGATCACAATTTTCAAACGTTTTATCGTCACAGGTTATTCTTTATTAGGAGAATTAAATGATAGACTATATCATAGTCTTTTCGATGCTGTCAGTTCTATTATACAAGCTTTTGATATGAAAAATGGAGCTTGTCATCTTGAGTTACGTA GAGCAAATGATGGTTGGAAATTAATTGAGATAAATCCAAGAATATCAGGCGGAGCTATGAATCGTATGAT TGAAATTGGACATGGAATTAACTTAGTAAAGGAAACTATGCAGTTAATGTTAGGAAATGAACCTTCCTTG ACTAAAAATCACTATAAATATGTATACGCTCATTATTTAACAGTCCATTCTAAAGGAAAACTAATTAAAGTTATAGGAAAAGAACGTAGTTCTAATTATCCGGGGGTGGAAGAAGTTTATATAAAACCAAGAAAAGGGGCGATTCTAAGGCCACCTACCTCAATGGGTCATCGATATGGATATATTTTAACATCATCACATTATAAAAAA GAGGCTAAAAAAATGGCTTTAGAAGCAGCAAAAGAAATTTCTTTTGAAATTGAACCAACAGATGCAACAT AAAGGTGCAGACTGTCAGATCTAAACAACGAGGACAGAAAAAAACGCTTTTATACCATTTCTAAAATGAA AGATCAATGCCTCCAATTAAACATAATAGATAAAATAAAGGATTCAACAAATAAAAAAAACATTGGCTGA GACTTAGTCAATGTTTTTTTATATGGATAGATATTGTTCAAGCCTTAGAACAAACCAAAAGTAAAAAACG TTTTCGTACTGTTAACCAAGGATCTGAATTAAACATCTAATCTCCTTAATTGCCTTAAGGCGATTTGATA TCAGCTTCAAGCTGATTAGCTTCTAGAAAGGGGGATTTTAAGCCTGTAGAGCTGTGCCCAAGTGAGTTTA AAATTTCTCTGAGGCTCTCACCTAAAAATGGAAAAAGATAGAATCTAACTAGTTTTGTATAGATTATTCA TGTGTTCCTTAGAAAACTTATTAAACTAAAGGGCCTGATTGTGGAAGAAGGAATTGGATACATTATGTTATAAAAAAGTTAGTTTAAACCTCGGTGAAGCGTATAATAAGTAAGCACAAATTTACTTTTAGTAAAGGTTTTACAGAAACAATTCACTGTCCTTGACACTTCTTTCAACTGGTGAATTACTTTCATTAAAGGCTGTTTTTTTAATGAAGTAAATCTTTTTGTTTTAGGGTTCAATTTTGTAATTGGTAACCAAATGGGGATATTTATTTTT ATGTGAATAAGTCGAAAATATATAAGGGTGAACAAAACTTTGTATATTTTCGACTTGATGCAAAAGTACC AGTTTATCATTCACAACTGTACTTGAACTCGGGCTTGGTCTGAATATAAAAAGCATTTCTTACTTGTGCA CTCCAATTTGCAAAGGCTGATTTCCATTCAGGAGTGTTAAAGAATTCATCTACAGTTTGGGTTTCAGAATGCCAAACTATAAATAGGTTGAGTGGAGCAATTCCTCCTGCCCAAATTCCATTATTTGCGTCAGTATCTTCTTCCCTTACTAATAATAAGGGTAGACCAAATTGAAAAGCCATTGAAGGTTCTACTTGTGAATAAACTGAT CCTACCCAGAATGGAGTTGATGGTGGAAGGGGTCCTGTATTGACGTCAACTGTTTGAATTTTAAAACGAC GAAGGTTTACTGCTAACATTCCATAGCTTGATGAAACTAGCCGACGAATATCAGTTAAAATGGATTCAGG ATAACTTTCGCTTAAAGGTAATGTACGCGGAAAAAGCAAAGCATTCTCAATCTCTAAAATTAGACGGTCTAGGAACCGTTGTTGGTTGTCATTTAAATGAGTTGTCGTACTTAAAAATATGGGAATACGATAAGCACGGTCAATACACTCTTGGTGTGCCGATTCTATTTTTGCTTTATTTTTACTTAAAGAGCTATTCTTATTTTTTTT CACTTTCACCTCATCTTTGTTTGAAGAGCTATTCTTATTTTTTCTCACTTTCACCTCATCTTTGTTTGAA GAGCTATTCTTATTTTTTCTCACTTTCACTTCATCCTTGTCTGAAGAGCTATACTTATCTTTTCTCACTT TCTCATCTCCTTTTTTAATATTATATAGAAAAGGAATAAGTTAGCTTGGACATATTTTATCTTTAGGTTCTTTTTTTCCCTTTTGTTTTGAGGTGTGAGGCACAGGCTGGGGGGGAATTGTCTATGCGAATAACATTTAACAACTTGAGCAAACTACTCAAGATGCAATAAAGCATCAGCTAAACATCTATATTTTACGACTAGAAAAAA CTACCTCCTCCCGATGGTAGTTTTTTTGTTTTCCATATCTAATTGCATATTTTATTAAGCCATATATTTT ACAGTATCCACGCTTGTCCAATCGCAAAGGTGTAGAGCTTCATATAATAATAATGATTAGAAAGGAGGTG ATAAAATGACCACTTTATTAGATGCTAGAACATCTCAGAATGCTAGTACTTCTAATTCTATCTCCATTCCTATTACTATCCTCTCCGCACCAGGATTATTTGGACAAGTTGGTCTTAATGTTGGGGGTGCCACTGGCCCTATCCGTACCCAATTAAGTGGCACCGTAGCTTGCCAATTACCACTTCTTCCTTTAGCAACGACTATTACAT TGATAGTTGTTAGAGGTACATCTCTTACCGATCCCGTCATTTATTCTTCAGCAGAAGCTTTAAATATAAA TCTCTTAGGACCTCAACTTTTCACATTTACTGCATCCGATTTCAATGTTCCCCCTCCAGCATCTGGGCTT TTAATTTATACTGCATTTATCGGCAGCAATATATTAGGGACAGTGAGGGTAGGCCCAGAAAGTTTTAATGCTATAGCCTATTCAGGTTAATGATATATAGAAATTCATTATAATGAAATGTTAATTCATATTTAATGCCTTGATATGTAACAGGAAAACCTACTGCTTGAGTCCAGTAGGTTTTTCCCCATCCTATGCAATAGAAGCCCC CTCAGAGAACGCTTTTCTTTATATATTCGAAAGGGAGGTAATTAAAATAGAACAATGGCTTAACCTTATT GGGAATTTTGGCTTTCCTATTGTTGTTACTTTTTATCTTCTATTACGCTTTGAAAAGAAAATAGACCATT TAACAGAAGCTATTAATAAAATAGCCACTAGTATTGAAAAAGAACAGGACAAGCAATAAATAATCGATTTATGGGCTTATTTTTTAATTAATTTCCTAGTATGAATACTGTCTAATAATTTGAGCAAACTACTCAAGATGAACGGAATCTCATCAAAAAATAAAATTGCATTACAGAAAACTTACTGTGCAGGAGCAGTAGGTTTTTCTG TTTTTAGGCTGTATATGGTATACATATTTAGTTAATATAGTGGATTTTCTCGGCGTCAAAAGCCCCTTCA ATTAATTATCGAAGGGACTTTTGATTTTAGTAGCATACTTTTAACAGCTACTCTTCTCCCAACGGCAGGC CCGACAGGCGTTAGAATAGCAATTATTAGGATATAGTGACATCAATAAAAGACTATAGTAGGTAAACACA CAAGCCATGTTCCTTCTTTTTAATAGTTATATATTATCTTACTAAAAAGAAGGTGAATATTTATGGGTAA TTCCAATAAAAGTCGTGATTTTTGTCCTCATTGTTGTTCATGTCCTTGTTGTTGTCATTGTCCAAAAGGG TCAAGAGGTCCACAAGGGCCACCAGGTGCAAGAGGATTACGAGGCCCACAGGGTGCGACAGGACCTCGAG GTTTACCAGGACCTCCTGGAATCGGTATACCTGGACCAGCCGGCGTGGCGGGTCCGCCAGGTGCAGCTGG TCCTCAAGGGCTACAAGGAGAACCAGGTCCCGCAGGTGCGCAAGGTATACAAGGTCCGATTGGACCTCAAGGACCACAGGGGGAAATTGGTCCTCAGGGAATTCAAGGAGAAATTGGCCCAGCAGGACCAGCTGGTGTGGCCGGTCCGCCAGGTGCAGCTGGTCCTCAAGGGCTACAAGGAGAACCAGGTCCCGCAGGTGCGCAAGGTATACAAGGTCCGATTGGACCTCAAGGACCACAGGGGGAAATTGGTCCTCAGGGAATTCAAGGAGAAATTGGC CCAGCAGGACCAGCTGGTGTGGCCGGTCCGCCAGGTGTGGCTGGTCCTCAAGGGCTACAAGGGGAACCAG GTCCCGCAGGAGCACAAGGTATACAAGGTCCGATTGGACCTCAAGGACCACAGGGGGAAATCGGTCCTCA GGGAATTCAAGGAGAAATTGGTCCAGCAGGACCAGCAGGACCAGCTGGCGTGGCCGGTCCGCCAGGTGCGGCTGGTCCTCAAGGGCCACAAGGGGAACCAGGTCCCGCAGGAGCACAAGGTATACAAGGTCCGATTGGACCTCAAGGACCACAGGGGGAAATCGGTCCTCAGGGAATTCAAGGAGAAATTGGTCCAGCAGGACCAGCAGG ACCAGCTGGCGTGGCCGGTCCGCCAGGTGCGGCTGGTCCTCAAGGGCCACAAGGGGAACCAGGTCCCGCA GGTGCGCAAGGTATACAAGGTCCGATTGGACCTCAAGGACTCCCTGGTGGTGTATTAGCTTTTGCAGACT TTTACGCTTTAATGCCACCTGATAATGCAGTACCTGTTGCACCAGGTTCGGATGTTGATTTTCCGAACGATGGACCAAACGGTGGGGCACAAATTTTCCGTACGGGTGCGGATACGTTTAATTTATCTGCAATCGGCGTGTATCAAGTATTATTCCAAGTAAGCGTGGACGAAGCAGGTCAATTGGTTTTAACTCTTAATTCGGGAGCAG GAGCTACTGAATTAGCGTATACAGTAGTCGGTCGAGCAACGGGTACGTCTCAGATCGTGGGATTAGCTCT TGTCCAAACATCCGTCGTCAATTCAATCCTTACCGTACGAAACCCTGCTTCCGAACCAACAGCACTAACC ATTACACCACTTGCTGGAGGAACAGAATCTGTTTCCGCACATTTGGTTATCACAAGATTAGCATAAATTATAAAAGCATTAAAATCCTCTTCAATGATTAATTGAAGAGGATTTTGATGTGTGATTAGTGTATTCTAAAAGGAATTAAGATGATGATTATATTAACTACCAAATAAATTATATTCATTAGCTTACTTTAAGTGAATTATC TACATAAATAAAACAAAAATAATTAGAGCAAACTACTCAAGAAGCCGTGAGGCATCAATGTATGTATAGC ACATATTGGTAACCAGAAAAATCACTGACGGAAACAGTGATTTTTCGCTTTTTTAGGGTGTATATGATAT ACAATGGTAGTTAACATAATCACTCTTTCCGGAACACAACTCAAAAAAGAACCCTTGTCGCAGAACGGTTCCGCCAAGGGTTCTTTTTCCGGAGTATGCAGCTTTTTATACATCCCTGATATGACTGCATTTATTGGATTCCCAAGTAGCAGAAATATGTATAAAAAGCGCACCTTTTATACATATGCGAAACCGTTCAAATAGTTGATT TTGTATACAAATATGATATATTAAAAGTCAGACTATTTTTTACAAATTTCAACGTAACCCTATTTTTGAA CAACCTCCCGTCCACTGCAGAGGTTGTTCTTTTATTTTGTATATATAGCAACACATTAAAAATATCCTCT AATTACAGAACGTGGTAATCTATGAATGTTTCATACTTCGGATACGTATGAACAAACCCTTACAAAAAAAGCAACCTCGTTCATTGGCCAATGCCGAGGTTGCTTTTTTTGTTTTTAATAGCTCTATTTAATCTTTTCTAATTCATTTAACATCTCATCAATAAATTGACTAATCTCTATCGTGTTGTTACTTGTAAAGCCCTCTTTAAA TGCCGTTTCTACCAAAGATTTTCTCTCTTTTTCAATCTCAACGGTTAAAGCTTCTTTTAAAATCACTTTA TGAGACTCCAATATTCCCCTCACCCATTTACTTTTAATAGCAAAACAAATACAAGGTTGAACATTCTAAA AGCGATCAACCTTGTATTTGTTTTATCTTTTTATGTTCATACAAATATTTTACAGTATACAAATGTCCTTATACAACGGAATTTTATCTTAAAATCAAAATTTGTCATACAAATTTTGATTTTAATCTTCACAGTCAAGAAAGTTTGTGATATACTTCACATATAAAGATATTAATGACTAACCAGAACACTCTTGAATGTAATATAGAA AAAGCTATTTCACTCCGATGCCAATACGATTGAAATAGCTTTTTTTATAAGGCTTTAATTATATTTACTG ACCAGAAAAACCATAGTGATAAGCATTCAACAATAAATAAATATCATAACCAGCTACCACTGCAAAAGAA ATAAGTAATAGTGTCGTTTTAAGTTTGCTCAACTTCATTTCTCCTTTTTACCGTTCTAAGTCTTGTTCCT GGCGTTTGGATTGCTTGCGGATCCCACCGACATATTGAAAAAATGATATCTGCTTCATCTTCTCCACATT TTTATCAATCCAATTCAAGGCTTTTTCCTTCCAGGCTTTCAATGTCTTATTCTCTTCTCTTAATTCATGA ACCTGCTCATTCGCCTTATCTAACTCTTCTTTTGGCACATAATCCTTTATATAACCAAGATTCATCTCCG TTAAGCTCTCATTCACTTTATTTACTTGTACAAGCTCTTTTTTCGTTTTCTCATGTTTCTGCTTCTCAAT CATTAAATCATCGCTGAGAGAGCTTATATGGGCTTTATATTGCGTATCTAGTTCTCTCTTAACCTCGTCTTTGACCTTTTCCTTTTGTTCAGCTGAAAAATCATGGACAAGCTTCTGGCGCATTTGTTTCTTGGCCTTCTCTACTTGGCCATTTTGATCCGCCACATATATCTCTAATTCTTGCCTTGTCTCACTCAAATCATGCTTTAATGCCTTATTCTCTTTCTCGTAGCGATCTACCTCGTGACTCAATGCATGGGTACGCTCATGCTCGGCCGCC AACGTTTGCTGCAGCTCTTTTGTGAGACTCATAAGCTCATGAAAATCTGCTTCTTCCACTTTCACTTTGG AACCCATGACACTCTTGGCCGCCTCTACTTCAATAGGTTGGCTACATAACTCTTCGATCCGTCTCTCGCT ACGTATCTCAACGGGTGGTGCTGCTTTCAACTCCACTAAGTTGTCCATCTGTTGAAGCTCTTTTTCCTTGTGAGCCACTAGTTGTTGCAAATGCTTTAGCTCTTTTTCTCGTTCTTGTTTCTTAAACTCATGCACACTTTTATGCTGCAGCTCGCTCGGCTCGCCACGCTCAATGTCATAGCCCCGTTTGTTCATGTAGTTATGAAAATC ATCTTGGATTCTACGTATTTTCGTTTTGCCATGGAAGTAATCTTTCGCTGCCAAGCGTCGATCCTCTGTG ATGGGCACAAAACCCACGTGCATGTTTGGCGTTGATTCATCGTTATGTACAGTGGCATATAGGATGTTCT GTTGGCCATACTTGCCGGAGATATGGTCCAGTGCTGCTTCAAAATATTTTCGCTGCTCGTCTGGCGACATCGCATGCATATACTCCGGACTGGCCGACACAAAGAACTCTGCCACTAGAACCGCATCATTCCGAATTTTTCGTTTCACACGCGCGGCCGTCATCTTCTTAATTTCTTCGTGGTACTTAATTTTATCCTCATTCACAAAGT CATAGTTTAGCACCGTTCTATTTGAATCGATGTCTTTATTTTTGCTGTTCTCTCCTTCTCGCTGGTTGTG TTTCTGGATCCCTGTTATTGCGTCTTTGTGGAACTTTTGCATGCGGATAATCCCGTATTTGGCCATCCCT CAATCCCCCATTTCGACCACCATTCATGGGTCCATCATACCACAGCTTTAGATTTGGTTTAATGTACTACACCAATTTTTCATCTCCGATAAAATTGGGAGCGCGCTCTACGAGGTGGCGGTTGGAATTCCTCCCTACGTTTGGCTTCGCCAAAAAGAAAAAAGACATCCTAAACGGATGCCCTTTTTCTTATAGACCGTGGACGCTGTC CACCACCTGCCAAAGGGAAGCCTCTTTGGAATGGCTTTTACAAACACCCCCCCCCTCAATCTTTGAGGGG GCTCCCTCGCCGGTTGGCGTCAAACAAACAGCTTTGTTTGAGTGCCAAGAGGGTTTGGGTCTAGTGCGTC TATCAACTCCTTAAATTCTCGACCTCACGATCTTGCGATTTATCGTTGACAGCCCCCTCATATTCATTCACATATCATTGGTTGGTTGATAGATAGAATGGCATGGTCAGCTTTTGCATTTGTCATTTGTTCCTCAGCGAAGATCCATATAGCAATATTGATAACGACAGCAATCAGTAGAAAACTTCTATTTTTATTAATAAAGGTTTC CTCCTTCAAGTCATAGTCACAACAAAGGCTGCCCATTATATATCCGTTTATAAGGCGGCCTTCATTGTAG GTATGCTATATGTTTACTCCAGGAATTAAGACATTATCTCTCATATGAGAATCAATCGTATATTACATTC TTTCCTTCTTCACTTAACTTTTTTAAAGATGTAAGCATATGATTTATTTCTTCATCGGAATGTCTTTCCCATGAACCTAATTCAGCTACTATTTTCAAGGGAGATTTAGATCTATAAGAACGTGTTGGGTTTCCAGGAAATTTTTTATCAGTTAAATTCGGATCATTTTCAAAATCGCCTAATGGTTCTACAATATAAATTCTTTCTTTT GAATTAGATCTTGCTAATTCAGCACCCCATTTAGCAGCGTTTAATGTTCCAGTAAAATAGATATGGTTAG ATTTTTTATCCTGATAATTGGATAAGTACAATGGTTCAAGCAGGTCTCCGATTTTCAGTTCTGCTTTGGT ACCATGAAAAAATGGACCAAGATCTAAGACATTCTTTTTGTCATTCATATAGCCACACCCCTTATACTTTTTGACTTGCGTATAACAGTATAAGGCCGGACATGAGTGGAAAAACAGTCTATAAATAATTTTCAAATAGGGTTATAATAAAAGTAGAGATTAAGGTGTTATCGGAAACAAATCATTCAAATCAAAAAAGGCTGCTAAATA TTTAGTAGCCTTTTTTGATATATTTACTTTTTATACCTATGTGACCCATGTGAAATAGTACTGTTATAAA GATATGTTAATATCGGTTCGTCGTTAATATTTCACAATTTTAATCCCTGAGAAGCTATCTCGCTTGCCAA TGCCGAGGTAGCTTTTATTTTTTTTTGATTAACCCTATTTGTGAATATCTGCTATTAGTCATACTTTGAA AGGAAGCAGGGAAAAGTCTTTTCTCGTCGAAGGTTACTGCTTGAAAGGTGGTGGCATTATGGCTGGATTT GATGAAAACGATCGTGACCCTGAGGTTGAAGCACTAATTGACCGATACCCTGAAGAAAGAGACATTTATC GTTATATGCGGGATGAGTTTGATAAAGTTTTAGATACATATGAACCTGATATTCACGATAGGGAAGTTGC TGTGAAGGCAAGCGATAAGTTTGACGTGTCTGTAGATTACGCACTTGATCTTTACACTAGGATGGTATTT AAGATTGCGGAATTTCAACAAAGACGATTCAATAAGTCAAAATAACCGACTAGAAGGCACTCTAAGGAGTGTCTTTTGTCTTGGTTGTTTTTTATATTACCCTCTTATCTAGAACGTCTGTAGGAGGATGTATAGACCTCAGATAAGCCCTTTCTCTTTGAACACCTTCCTTAAACATTCATTCACCAGTTCACTTTTAATTCCACTGTCTACATTGTCAATGATCTGTAATACATCGCTATCCAAATAAAATCCCCTAAATTCTCGCTTTGCTTTCTTC CCAGCTAACAGACGATCAATGTTATCAATCTTCTTTTTATTATTCTTTTTCATATTCGTCCTGATAATAG ATTCACTATCAATATTGCTATCCTTTTCGGGCCTATTTTTATTAACTTTTTGAATTGAACTTGCTACTTC TTTATTAGCCGTCCGAATATTTTTTTTCACCCTCTTTTGAATAGGAAATGTGCCTGTTAATTGTTTAGTAGTTTTACTATTCTTCTTGAACACTTCATCGATGTCCTTATCAAATATAGATTCATCTGTTCCTACAAAGTTATACTTGCCTTCTACACTGTCCCACTCGAAACCTAATTTCTTAATTTTTGTCTGAATAGTTCTGTCTGA AACCTCATACTTTTTGGCAAGATCATTTACCTTTAATTTTTTGTCACTAATAGCTTCAATCATGCCTCTT ACTAACATTTTAGCCCCCCACTCAATAGTTATATTACTAATTCATTTCACCTTAATTTATATTCCTTTAT GTTAGAAAATCCACCTTTAATTTTGATAGCAACTTTAACACCATTCATTGGTATTAGCCAACTGAAAAAATTTTAAGTGCTTTCTCTATTAAGTTGTTATAAAATAAAAAAAGCGTATTGGAGATTGTTTCAAACATTTTACGTCATCTAGCCTATTCCCAAAGCACAGGGAGTAGGTTTTTTATGTTCTTGGACTACTGTGGTGAAATT AGTAAAGAAGTAGTTCGTAAATGTAATTCTAACTTTTATCAGTTTTTCGATTGAATTAAAGAACTAGTTA CAAAAATGATGTATAAGTTAGTTAACATAGGTGGATTAGATTTACTTAGGTTAAACTTACGCTCGCGTTC CGCTCTTCTGATCGCTCATTTAAGTTTAACTTATGTTGAACTAATTAAAATCACAAAACAAAAACGCCTGGTGTAAATCCAGGCGTTTTTATTTTGTGGGGGTTTTTTAGAGTGAAATATTGAATAACTCCGTTATCCTTCTCTATTTCATAAAACAATGGTACTGTAATGAAATAGACTGTTTATTTTCGGCGCTTCTATGCTTGTCTT AGTTCCCAAAAAGACGAGCAAAGAAGCCTTTTTTATTTTCTGTCTCTTTTTCCTGGGCTGCCGCTGCTTC CAGTAAATGTTGTTGCTGCTGATTTTGAGATGAGCGGATATATTCCATCATTTCTTTATCGCGGCTCTCT ATATGTTTTTTCATCTGTTCAGCCTGCTTATCAAAACTGGCTTGCAACTGCTCCAGTTGCTTGCTTGTTTGCTCGCGATCCGCTCGCCTTTGTTCCTCTAATTCCCTTAAATCATTTTTAGAATCACTTAAGGCTGCCTTATACTCTTCAATTATTCCTAACAACTGCTTGTTTACCTCTTGTTGCTGTTTGAACTGATCGGCTAGCGCT CCTAAGATTTCAGGGGGGAGTGACTTTTCAGAAGTTTTCGAAGCAGTTAAAGAGCGGTTATTTTCTTCGT TTTCTGTATGCTCGTTATGTGTTCGGCTAGCGGAGCGGTTCCTTTCTGATCCCTCAACAATAGTATTTGC AGCTACTTCTAAAGAAAGATTTTTATGCTGAACGAGGAATTTTAGCTTTTGCAATGTTTCATAGTCACTATGTGTATAGTAGCGCTTTTTCTTATTGTCAGTCTTGAAATCATAACCGCTCTTTGCAAGCGCGGCAGAATATTTCCTTACATTGCTCCCGCTTAACTCTAGGAGCTTTGATATTTCATCAGAATTCATATAATCATCGTT AATAATCATTGGTGGCCTCCAATCTTATGTATTCGCCTTCCGCTCCTTAAACATCATACAGCGTTATTTT CAATAATTCGAGCAAGAGAATTTTTTTCCTTTCTTTTTTAGCTGTTTTTTGTTCTTTTTTATTCATGAAA AGTAGAACAAAAAGCTTATGCATCAATGAATATATAAATGTTTTGTATACAGTAATTTGAATTACTGTATATAAAAATTATAATAAAAGTATCAAAAAAAGGATTTTGGAGTATGGGGGAAATTTAAATAATGAAAAAAGTTGTCGGTTACGTTCGTGTATCTTCTGATTCACAAATTGAAAATACATCTATCGAAGAACAAGTGAAAAG AATTGAAGCTTATTGTATCTCCCAGGAGTGGGAATTGGTTGAAATTTTCAAGGATGAAGGTTTTTCTGGA AGTAATACGAATAGACCAGGATATAAAAAAATGATGGAGTATCTTGCAAATCATAAGGAAGAACTTGAAA GTGTTGTCGTTCTGAAAATGGATAGAGCACATAGAAATCAGCTCAACCTATTGCAATTCATTAAGGTTGA ACTTGCGGAATTAAATATGGATTTTGTGAGTATTACTGAATCTTTTGATACAAGTACCATGATAGGACGT ATGATGTTAGGGATTCTTTCTACTTTTGGAGAGTTCGAGCGAGAAGTAATAAACGAGCGGACAAAGAGCG GTAGACTTTCTACAGCTTTAAAAAATGAGTATGCAGGCGGCCAAGTTCCATATGGATATGTGGTAGAAAA TGGGGCTGTTAAGATAAATAAAGAACAGGCGGCCATTGTTAAGCGTGTATTTGATGAATTTATAGAAGGG CGAACTTGCTACCGGATTGCTAAGAATCTTAATGAGGAAGGTATTAAAACAAAAAGTAATAAGAACTGGACACCTACTACAATTAGAAGAATGTTAGATACAGAAAGCTATACAGGCTTTAATTCATATAATGGCAGCAAAGAGCAGAATGCCATCAGACAAAAAGATGTTTTTCCTAAAATCATTTCACGCCAAAAATGGAACAAGATTCATGCAGCTGTTACAGCATAAAAAAAGAACAGGAGAGCGGCTCCAGATCTTTTTTTATTCTTTATTATGC CATAAGAAAGAACTTCATCTTTATAACTACCCTTTCTGAGGTTGCTATAAGCACCTACAAGCGAATTAAC TTTAGTTTTACAGGCAACCGCTCTTTTAGCGTGGCAGGAGCGGAGCGGTTGTTGTTATTATCTGAAAATG TGTAGTTTTTCAATATATTTTGATACTATTTTATGTAGGTTACAACATATGTATAAAAAGCTGCATATTGGAGAGAAACCAACTCTTTAAGAATCCTTCTACGCCAAGGATTCTCTTTTTAATGTCTTCCGGAAAGAGACATTATGTTAACTACCTTTGTATATCATATACAGCTTGAAAAGAAAAAAACTCCTGTCGTCGGTCAGGAGC TTTTTCAGTAACGTAGCAAGATATTAAAAGTGATACCTCACGTATCTTGAGTAGTTTGTTCAAGAAAATA AAATTTATGTATAGAAAAAGAAAAAACTACTGTCACTGCTCCTGATCAATAGTTTTTTCTGCGATGAGTA GGAATTTAAATTCCGCATCAAAAAGCTTGGAGGTTTTTGAATTGCATATTTTATAGTATGTAAGATAATTAAAAGAGCTTGGACAAATATAGATATTATAAAGAAAATTTTATATTACTAAGAATCCTATTTTTACAATTTCCGATAAAGTACATTATGGTAACTAATGTTGTATAGAATATACAGCTAAAAAACCAGAAAAACTCCTGT GACCTGTTCAGGAGTTTTTTCTGCATTTGAATACATAACATAAAAGGTTTTTACCGGTGAACATATTTGT TCTTGAGTAGTTTGCTCTTTATAAATAAATTCATTCACAAAAAGTAGGCTCTGTGAATGAATTTATTTAC ATAGAGATCTTTTTATCTCTTATAGTCATAGTCCATATAGTCAAAAATCGTACGATTAGCAAAGTGAGCTTAACTAATCGTACGATTTTTATTATCTATATTTGATGAACAGATTAGTTTTCTTTTTACAAAGTACATTATAAAAAAGAAAAATGAAAATATGATGAAAATATAATGAGTTATATAGCTTTAAAAAATAAAAAAACAAAC ATGTTGTCAACTGGAAACAGTGGTTTCATAGGGGATTTGTTAATTTGATTATTTGATGTGTTCATAAAAA ATCCATTACGGTAACTAGAAATGAATAGGCTGTGTAGTATAAGAAAGAAAAAAACTCCCCATGTGGGAGG GAGTTTTTCTTCTAAGTATCAAGATATTGCGTCAAAAATGATACTTTGGGTATCTTTAACAGTTTGTGCGAAATTTGTAGAAGGTATACAAGCTTTAAATAAATAGTCAATTTGCATTTATTAAAGTGTATGAAATGCTTTAATAAATGCTGTGAGGGCTAATATAAAAAATGTTCAAGGTCTAAACTATTAGTCAAATTAGAATATCTT ATAGATACAAAAAAGGGTATAAGAACAATTGTATTTTTCTTATCTGCAGCACAACATTTAAGAGAACAAA ACTTACTTGTAGCTCGTATTGGTTTATATTCTTTTCTACAAATTTTACATTTTTTAATTGAATGTTTGAT ATATGCTTTTCCTTTACACTTCTGAGAACAATATTTTGCATTTTTGTTATAACTTTTAAATTCAGAATCGCAAATCTGACAAAAAAACTGAGCCAAGTTGCTAATCACTCCTGCTAAATACTAATGGTTGCAATCGTACTATATGAAATGAATTCTAAAGCTTGTTGCTAATAAAGTCCATTATGATAACTAGGTTTGTAGGTGATATGC AGTCGAAAAATAGAAAAAACTCCTGGTTCCTGTTCAGGAGTTTTTTCATGGATTATGGCGAGATGATGAT ATGAATCATCTTGGATAGTGTTCTCGAGAAATGAAGTTTTATTCGTATAGGCAAGTTACCTATATGATTA TTAGTGAATATAATAATATAGGCTTATACTTCGCTCTTAGTATTAAGTTTATGGCCCTAGAATCCTTATATTTTGTTTTTTTTTAAAGTACCCTTTGGATTTTAGCTTCTAATGGGTACTTTTTATTATCAGAAAGTATGTCTTTAACGACAGGATAGATCATTATGGATAATCAGTTAAAAGAAATCTTTGGTGCTTGGTTAGCAGCTA TTGGAACCGTCACAGCTGCTGTAGGCAGTACTCCTTTCCGTTCATTAGGAAACAGTTTCAGAAAAGATTT AAATTTGATTGGAAATGAACTACAGGCTGTAGGAAATGCCCTAGAGGCTGATGGACAAGGAGAAGAGAAT CTTGAAAGACTTGGGAATGAACTTCAATCTGTGGGCAATGTGACTGTGATTTCTGGACTTGTCATAGATT TTAAAGATACAACACAACAGAAACTGATTATTAGTGGAAATTGGATTCAAGCTTTAGGTGGAGCTACTGC TTTAGGAGATGAATTTCAAGATACTTCAAATATAAATGAAATCTATAATATTATTGGAAACCTACTTCAA GTCATTGGAAACTCACTTCAAGCTTTGAGTGGTGTAAATGAATTGAAAGCCAGTTATATAGATAACAAAG ATTCATCTGAAAAAGAAGAAGATAATAATAGTATATGGTCGTTAGATGTTGTTGGGAGTTGGATTCAGGC GGTTGGATCTGTTATTTCATTAATCGGACAGATTCAAGAAGAAAGTGAAGAACAAAGTAATGAAAACGAAGAAAATGATTCTACAGATAGTGATGAAAAACACGATAATACCTCACAAGACGATAGGAGGAAATACGAGAATGGCATACCAAATAAACATTTTTAATATGGACATTAACTATTGCAGTAAAGATGGAAATATTAACGTAAATCGTACAATAAATAAAGACGATTACTTAAAGGATAAAGATAATAATATAAATTCTTCGGCAGCAAATAA TCAAAAACAGTAAATTTTTATTTTCTAACAGTTACTTTTTCTTATAAAATCGAAGATTACAAATAAGTAG TTTGTTTAAACTAATGAGTTTTATGCCTTAAGTAGTTCATAAAAAAGAAAGCTGTCGGGGAGGACAGCTT TCTTTTTTATAAGGTTGCAGTGGAAGACAACCTTTAGGCATCAAGAATAGTTTGCTCAAAGTATTTTTTGATATTCAGGTTGTTTATTTTTATGTTTCTTTATAGTTTTGAATCTTTTTACTTCTTTATTCCTCTATACGTGCGGGGTTATAGCCGTAAACATTAGCAAGATCAGTGTAAATAGAAAATATTAAAACGCTAAGCCAAATT GCTCCGCCAATTAAAAAGAACAGATATTTAAATAGATTTTTCATGTTTTTTATTCCTTTCAAAAAAGAAA AAATCACTTATTTCTCAAAGTGATTTTTTCTTTTATAAATGTGCATTCATCTATGCTAAGGGTTACATCT TTTCTAGTTTGCGCTTAATATACTTTTTAATTCATATAAATCAGAAATAACACATGAACACATGAACTCCTGAGTTCATGTGTTATTTGCTATCTTAGTTTATAAAGGTTTTGAGTCCTTTTTTAAATTAGAATATAAGTGGGACAATAAGCAAAGTGTTCTGGAAAAATCCATTATGGTAACTACGGTTATATATTATATTTATTTAAT TCTTGAAGATCTTCTTCAACTAACAATATAAGGTACCAAACAATAATGGTCTTTTCTAATCCCACCAATG AAATGTAACCACTTGACATTTTTATAGATTGTTTTTAATACAATTCTTGGTAGAGGTGATAAAAAGTGAC GAGAGTAAAATATAGGAGTAATGACATTGATTTAATTGCAAGGATGATGCGGGCAGAGGCTGTGGGTGAAGGGCAACAAGGGATGCTTATGGTTGGGAATGTCATTGTAAATAGAACAGCAGTTGACTGTTTAGATTTTAAGGATTTGAGAACCATACGGGATGTAATTTTTCATGTTCAAGGGGGAAATTACTCTTTTGAAGCAGTACA AAAAGGTAGTTTATTTTATAGGCCAGCAAGGGATGTGGAAAGAAGATTGGCACGACAAGTAGTAAACTAT TGGAGACAACATCCTTCTAAATATGCTCTTTGGTATTTTAATCCTCCTGCTGCGTGTCCACCTACATGGT ACGGTCAACCAATTTCAGGACAATTTAAACAACACTGTTATTATGAACCAGAGGCTGGTACATGCGAAAGTGTTTATAGATAGTAAAGAAAGCTTGGATCAGTTATTAACTGTTCTTCATATCAATGTGCTGTTATATGTAGTGTGATTTTTAAACATATCCATGATTTTTTTAGAGACTGCATATCTTCTTGTAATTTTTCAATAAGAG TAAAGAACTTGTCCTTCTTTTCCCCACTTAACTTCAACTGCTTTTTCATTTTCTCACAATCTGATGTGTC CCTATGCGCCAATGTTTATAGAATATGAGTGTTTCATATAAAAATATCCCTTTATCTGCGAGAAAATTAC TTTAAGGAAATACCTTAACAAGCAGAAAAGAGAGCAGACTGTAAATTAACAGTCTGCTCTCTTTTTTATGTTTCTTTTGCTACCTTACTAAAATTGTAATTGCGTTAACTAAACATGTATACCATATACAGCGTAAAAACAGAAAAAACTATCCCTAGACCAGTCAGATAGGTGGCGAGGTAGTTTTTCGGAGAAACCCCCTTCTTCAGA GTGCTTATCTAAATACAAAATTTAGAAACATGTAAACGAAACAATGCGTCTCGTATCTATACCAAAAATA CTCCAGAATCGTCCATTCCATCTAAAACCAGCGACAGATCTTGGTCCCACAAAAATAGGGAAAAACCAAA AACTTGAACCATTTCTAAGCCATATAAATGTATTACGGAATAAACACATTGAAATGGCTCCTGGATCGACTGCAAATGGTGTTGCTAATTGTTGTTGGGGGATAAAGGCTGGTGGAGGGGTAGTTGGAGGTTGCTGTCCACCGAAGGAGGGGAAACCCCCTGGTGGTCTAGGAGGACTAGGGAATGGGAACTGTGGGCCTAAAAATCTTG GATAAGAATAAGAATCTATATAATTCACGTCCATATTTTTTCACCTCAATATATTATTAATACCTAATAC AATATGAGAAATAGGCCCAAAATGTTCGGACCCTTAGGAATATAGCAAACTTATGGAGGTGGCTCAAAAA TGGGAGGAATGTATGATTTAGCAAGAAAAGTGAAGTAAAGAAGCTTACAGTTTATATACTGTAAGCTTCT TAAAATAGACCTTAGTAGCAAGATAAAACAACTTAAAGTTGTTTCTAATTGCCTTAAGGCAATTTTTTGT TTAACTATTTAACGGCTAAAGTCTGGTCCCTGATTTCTCGATCTATTTATATTTGTACTTCTCATTCTTT TTAATTGATGTCTTTGTTGAGCTTGCTCTTGGCTACGAGTAGCTTGTTGAATAGCATTAAAGACAGTATC TAAAGCGTTTATATTGCTTTCATGTGTTTTTATTTCTTTTTCTAACCATGGGACGACTGTTTTCTCCATT GTGTTCATACGACTTTGTTGTTGTTGTAAATCTTGTTGTCCTTTATAGCCCAGTTCTTTTAGGTTTTCACGTCCATATTTAGCTTCACTTTGCAATTCTTCATAATCTTGACGAGCTTTTTTCGAGACAAGTCGTTTGGCTTTTTCTCCTGGGTTCTTGTCTAATTCATCAAGCTTTTTCTCCACTCTGCCAAGTTTCTCTACTTCTTTACTCATAGTTGAGACATGTTCTTTCTCTATACACACCATTTTCTGATGTTTTTTGAACTCGTCTAGCTTCT TTTGGTTAGCATCTAGACTTTGTTCGATGTTGGATAGTCTAAACTGATTTTGTTGAGCAGTATCGTGATA CTGTTCCAGCTTTAATGCATTGCTGTACGTAAGATACTTTCCAGCTGTTTTGAGATCTGGATAATAAGAG CTTATCTCACGAATTTTGGCCATTTTGATGGCATCCTCAGCCTGTAACAATACCCTAGTTTCGACTTGAATTTGTTTTTTCTCATATTTAATCTGATTGAGTCGATTCTCTTTCTTTTGAGAGAATTGTTGGTAACGCTGATAGAACTCTTCTTTGTTTGAAAAACGAAGAGATTCTTTATGTTTTTCAATGCTGTTCTCATAGCTTTCT TTGTTACTTTCTAAATCAGAAATTTTATCAAGATGACGTCGTTTCATCATGTTATTCTCTTTGAGTTTAA ATGGATTAAGGGACTTCTTAAGTTCCTCTACTTTTTCTTCGTTCTGTTGAATTTCACGCTCTAAATCGCT CACACGATCATAATAATTGCTGACATTCAGGAATTGTTGTTGTTGTACGTGAAAGTGTCGTTCAATAGGGTCGTGACGGTCATTCATTTTGCGTAGTTCTTCGTGGCGTACTGTGATATCTTCTAAGGTAATAACTTTTTGACCTACAAGAGAAGCAGCTTTTTGAATATAGGTTTTCTCTATATCCGTAGAAAAGCTGAATTGTTTCTC TTTTTCCTTCATTTTCTTTAAGTGGTCTTCTTTTTGACGACGATAAGCTTGTAAATCAACCACGGCCTTA TTGTAGTCTTGGCGGTCTCTATTGATCTGGCCACGATCTGTTTTCTTCCCTTTCTTCTCCATGTCATGTG CGACATGGCCTAAGTGAACCATTGGTAAGATTTCTAGTCCACGCTTTTCATGAGAAAGATGAGTAATACGTTCATTGCTTTGAGCTTGTTCCAGGGCTTTGTTGGCATAGTTCGCCCACTGTTCACGAATGGATAGGCAGCCTTCGCTGTTTTTGACGTACCCATGGTTGTTTTCTTTCGCATTCGCAAAATCTGCATTCCAGTCACGGT TCTTTTTGCCGAATCCATCTTCACTTAGATTTCTCATAGTTAACATGATGTGAGCATGAGGATTATTTTT ATCATCACGATGGATAGCAATATCAGCAACCATCCCTTTTTGAACAAACTCATTTTGTGTAAAGGCTTGA ATGAGTTCTTTTTGTTGATCATGATTCAGTTCAATTGGCAAAGCAATATTCAATTCGCGTGCCAATTGTGAGTCTTTACGCTTCTCCACTTTTTCAACTTCATTCCATAAACGGTTTCGGTCTTTCATCCATTCTGGAGCAATAGAAGGAGTCAGAATCATGGTTTCTGGTTTCACATTACGAGCATAAAACTTTTGCTCGTCTGTACGT TCATCATGTAGTTTTTCGCCACTTCGATAAGCAGCTGCAGCGACTGCTGATTGTCCTTTTGAACGACTGA TAATTTGCATCGACAGATGGTAAATAGCCATGATTCGTTCCTCCTTTCTTGAGAATGGGTTTTGGTTTTA GGAATAAGTTGATGAGAGCACATTGTGCACTCATCAACGATTTTGATGAAACCACTATTATGAACACCAAAGGTGTCAAATGGTGGTTTCATCTTTGCCGATAGGCAAACAGGTTTTATGAAATTCGCCATCTAGGCGAATGGGTCTTTGGTTTTGTCTTTTCGTTCCGAAGGAACCGCACACATCGGAACGATGTATAAGTGCGCCCTT ATCTCTTTGATCTAAGGGAATTATACCATATCCTGGTGAGAGAATCTATGCTAAGGATACCAATTTATCT CAATTTTTGCTATAATCAATTTAAACATTAGAGAACAGAAAAAAGGAGATGAGGATGGGTGCCGAAGAAG CGAACAGATGAGGAGATTCTTCAGGAATTAGAAGAGAAAATTGAGAAGATGAAAGCGAAGAAACAACAAGTTGAAGCGCGTAAAAAAGAAAAAGAGAGAAAAGAAAGAACAAGACGACTTATTCAAGTCGGCGCGATCTTTGAGAAATACTTTGAGATTCAAAGTGAAGAAGAGGCAGAAAAGATTGCGAAGGCATTGCAATCGTATGTA GGAAAAAACAAAGATAAGATTTTGCATCATGATGTTGTGGTAACTCAGAAGAAGAAAACAATGCAAGAAG CGGCATCTACAAAAGAATAATATCTTTTACTATACTTAATTCAAAAGTTACACTATCAGATTAAGCAAAA AAACATCTTAAAATCGTCGAGGAACTTGTTGGATGAATTAAGATATAGCTATCCCCTCTTTCAACCATAA GCTTTAGCTAGTCTGCCAAAGTCTATAAAAATACCATAAAAGCCAAGTAAGTTTAGACTTATTAGAATCT TAACTGAAAACTCCATGTATATGTATGCATAACTCTTCTCCTTAGCTTGAAGTGTTATATATAGCGAAAT TAATTTCTACAGTCATATAACAATATTCATAGCTAAATATACTTGTTTTGATATATTTTGCTAATTTTTA TTGAATTATGAGACTACTTAACGCTATAATAAAACTAACAAAAACGTGCGGATAGAAAAAAGACTTCAAC TGTTTAAGTAGTGTAACCCCACTCTTAAACCGTTCCCCCTACAGCAACTAGGGAAAACACTTGTCGAAGTCTCTTGTTAATAGTTTCATTATCGATAAGATAAAACTTATGTTTTTATTTTATATGA

[0182] The following are examples of replication plasmids that can be used in the present technology.

[0183] pBM400 - Bacillus megaterium QM B1551 plasmid pBM400: NC_004604.2.

[0184] pBM500 - Priestia megaterium QM B1551 plasmid pBM500, complete sequence: NC_014025.1.

[0185] pBM600 - Priestia megaterium QM B1551 plasmid pBM600, complete sequence: NC_014031.1.

[0186] pBM700 - Priestia megaterium QM B1551 plasmid pBM700, complete sequence: NC_014023.1.

[0187] The following nucleic acids are used in the experiments described herein:

[0188] pWhiskey_MjTyrRS (SEQ ID NO: 4) TGCAGTCCGGCAAAAAAGGGCAAGGTGTCAATTCTCATGTTTGACAGCTTATC ATCGGCAATAGTTACCCTTATTATCAAGATAAGAAAGAAAAGGATTTTTCGCT ACGCTCAAATCCTTTAAAAAAACACAAAAGACCACATTTTTTAATGTGGTCT TTTATTCTTCAACTAAAGCACCCATTAGTTCgCTAGcCCCAGCGAACCATTTGA GGTGATAGGTAAGATTATACCGAGGTATGAAAACGAGAATTGGACCTTTACA GAATTACTCTATGAAGCGCCATATTTAAAAAGCTACCAAGACGAAGAGGATG AAGAGGATGAGGAGGCAGATTGCCTTGAATATATTGACAATACTGATAAGAT AATATATCTTTTATATAGAAGATATCGCCGTATGTAAGGATTTCAGGGGGCAA GGCATAGGCAGCGCGCTTATCAATATATCTATAGAATGGGCAAAGCATAAAA ACTTGCATGGACTAATGCTTGAAACCCAGGACAATAACCTTATAGCTTGTAAA TTCTATCATAATTGTGGTTTCAAAATCGGCTCCGTCGATACTATGTTATACGCC AACTTTCAAAACAACTTTGAAAAAGCTGTTTTCTGGTATTTAAGGTTTTAGA ATGCAAGGAACAGTGAATTGGAGTTCGTCTTGTTATAATTAGCTTCTTGGGGT ATCTTTAAATACTGTAGAAAAGAGGAAGGAAATAATAAATGGCTAAAATGAG AATATCACCGGAATTGAAAAAACTGATCGAAAAATACCGCTGCGTAAAAGAT ACGGAAGGAATGTCTCCTGCTAAGGTATATAAGCTGGTGGGAGAAAATGAAA ACCTATATTTAAAAATGACGGACAGCCGGTATAAAGGGACCACCTATGATGT GGAACGGGAAAAGGACATGATGCTATGGCTGGAAGGAAAGCTGCCTGTTCCA AAGGTCCTGCACTTTGAACGGCATGATGGCTGGAGCAATCTGCTCATGAGTGAGGCCGATGGCGTCCTTTGCTCGGAAGAGTATGAAGATGAACAAAGCCCTGA AAAGATTATCGAGCTGTATGCGGAGTGCATCAGGCTCTTTCACTCCATCGACA TATCGGATTGTCCCTATACGAATAGCTTAGACAGCCGCTTAGCCGAATTGGAT TACTTACTGAATAACGATCTGGCCGATGTGGATTGCGAAAACTGGGAAGAAG ACACTCCATTTAAAGATCCGCGCGAGCTGTATGATTTTTTAAAGACGGAAAA GCCCGAAGAGGAACTTGTCTTTTCCCACGGCGACCTGGGAGACAGCAACATC TTTGTGAAAGATGGCAAAGTAAGTGGCTTTATTGATCTTGGGAGAAGCGGCA GGGCGGACAAGTGGTATGACATTGCCTTCTGCGTCCGGTCGATCAGGGAGGA TATCGGGGAAGAACAGTATGTCGAGCTATTTTTTGACTTACTGGGGATCAAGC CTGATTGGGAGAAAATAAAATATTATATTTTACTGGATGAATTGTTTTAGTAC CTAGATTTAGATGTCTAAAAAGCTTTAACTACAAGCTTTTTAGACATCTAATC TTTTCTGAAGTACATCCGCAACTGTCCATACTCTGATGTTTTATATCTTTTCTA AAAGTTCGCTAGATAGGGGTCCCGAGCGCCTACGAGGAATTTGTATCGgggccc CAACGGCCTCAACCTACTACTGGGCTGCTTCCTAATGCAGGAGTCGCATAAG GGAGAGCGTCGACATGGGATCCGGATGCCATCCGCCTGTGTATGTTAAGTCA TGCTCATTCACAACCCCGCTGATATACGTCATGACTAAGGTGCCGCCGTCAGC CGTAAACGCTTTTAAACGGGAAACGGTGTCCTCGCTGATTAAATACAGCATC GGGACGATCAGCAGTTTATATGGTGAAAAGTCTTGTTCTTTCGTGATGACGTC GACAGGGATATCGTGTTCCCAGAATGTGCGGTAATGCTGCTGAAGCGTTTGC GGATAACGTTTTGTCGCCTTCGCAAACCCCTGAGCATCCTCGAGCGCCCAATG ATTTTCCCAGTCATATAAAATCGCGGTTTGAGCCGGCCTCTTCGTTCCGACAA CTTCGGACAGCCGTTCCAATGTCTCGCCTACCTTGGCCACTTCTTGAAAGACG CGGTTCTTCGGGCTATTGTCATGATCCACAACCGCTCCGTGTAATTTTTCTGAT GACCCCCGTGATTTGCGGTATTGGAAATAGAGAACGCTGTCCGACGGCGTTT AAGGATGGAGATAAGGATGGAGATCAATTCGGAGATCCATTTGGCAAAACAT ACACCATCATGTTAAAAGGAACGAACAGTGATGGTGTAACGAGGACCGAGA AATACAGTTTTGTTAAAAGAGATCCAGCGTCGGCCAAAACCATCGGCTATCA AAATCCGAATCATTGGAGCCAGGTAAATGCTTATATCTATAAACATGATGGG AGCCGAGTAATTGAATTGACCGGATCTTGGCCTGGAAAACCAATGACTAAAA ATGCAGACGGAATTTACACGCTGACGCTGCCTGCGGACACGGATACAACCAA CGCAAAAGTGATTTTTAATAATGGCAGCGCCCAAGTGCCCGGTCAGAATCAG CCTGGCTTTGATTACGTGCTAAATGGTTTATATAATGACTCGGGCTTAAGCGG TTCTCTTCCCCATTGAGGGCAAGGCTAGACGGGACTTACCGAAAGAAACCATCAATGATGGTTTCTTTTTTGTTCATAAATCAGACAAAACTTTTCTCTTGCAAAA GTTTGTGAAGTGTTGCACAATATAAATGTGAAATACTTCACAAACAAAAAGA CATCAAAGAGAAACATACCCTGCAAGGATGCTGATATTGTCTGCATTTGCGCC GGAGCAAACCAAAAACCTGGTGAGACACGCCTTGAATTAGTAGAAAAGAACT TGAAGATTTTCAAAGGCATCGTTAGTGAAGTCATGGCGAGCGGATTTGACGG CATTTTCTTAGTCGCGACGCGAGGCTGGATGGCCTTCCCCATTATGATTCTTCT CGCTTCCGGCGGCATCGGGATGCCCGCGTTGCAGGCCATGCTGTCCAGGCAG GTAGATGACGACCATCAGGGACAGCTTCAAGGATCGCTCGCGGCTCTTACCA GCCTAACTTCGATCATTGGACCGCTGATCGTCACGGCGATTTATGCCGCCTCG GCGAGCACATGGAACGGGTTGGCATGGATTGTAGGCGCCGCCCTATACCTTG TCTGCCTCCCCGCGTTGCGTCGCGGTGCATGGAGCCGGGCCACCTACTGAAGT GGATTTCTTTAAGAGCTCCTTTAACTTCCTCACCAGTAGTTGTATCGGTACCAT AAGTAGAAGCAGCAACCCAAGTAGCTTTACCAGCATCCGGTTCAACCAGCAT AGTAAGAATCTTACTGGACATCGGCAGTTCTTCGAACAGTGCGCCAACTACC AGCTCTTTCTCCAGAATGGGCTATACCTCTTTTACCTAAAGAGCATGTAACTT TACTGGATATAGCTAGAAAAGGCTATCGGGGAGAGTGTGATGATAAGTGGGA AGGACTATATTCAAAGGTGAAAGCACTCGTTAAGTATATGAAAAATTCTATA GAAACTTCTCTCAATTAGGCTAATTTTATTGCAATAACAGGTGCTTACTTTTCT GGAGTTCTTTAGCAAATTTTTTTATTAGCTGAACTTAGTATTAGTGGCCATACT CCTCCAATCCAAAGCTATTTAGAAAGATTACTATATCCTCAAACAGGCGGTAA CCGGCCTCTTCATCGGGAATGCGCGCGACCTTCAGCATCACCGGCATGTCCCC CTGGCGACCTTCAGCATCACCGGCATGTCCCCCTGGCGCGACCTTCAGCATCA CCGGCATGTCCCCCTGGCGGACGGGAAGTATCCAGCTCGAGGTCGGGCCGCG TTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCG ACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGC GTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTAC CGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCT CACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGT GTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCG TCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACT GGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGA AGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCT CTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACG CGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTG ACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATC AAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAA TCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGT GAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTC CCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTG CTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAAT AAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCC GCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCC AGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTGCtGGCATCGTGGTGTCACG CTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAG TTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCG ATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGC ACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGG TGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCT CTTGCCCGGCGTCAACACGGGATAATACCGCGCCACATAGCAGAACTTTAAA AGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTAC CGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCA GCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAA ATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACT CTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGG ATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACA TTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATT AACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTTCAAGAATTAACA AAATTCTCCAGTCTTCACATCGGTTTGAAAGGAGGAAGCGGAAGAATGAAGT AAGAGGGATTTTTGACTCCGAAGTAAGTCTTCAAAAAATCAAATAAGGAGTG TCAAGACTAATGTGTGTTTACGACAATTCTCACTTCATACTTTTCCATCGTCAG GTCGCCTGACAATATGTCTCCTGTCATTATGTCCTTCACACTCTGATCAAACGT GACCAGCTGTTTTTCTTCCGTGAAATTCATGACAAAAATATAATCATTGTCCT GATCCTGCCTCGCTTGTACGGAGACGCCTTTTCCGTGCCGAACCGGAAAAACT GGAGAGAGAGACAGGTCTGTGATCAGACCCTCATAGAAATCACGCTGAAATT GATCCTCCAAACGCGCGCCGATAAAATACGCCTTGCCCTGCTGATACTCATGGCTTGTGACCGCTGGCGTGCGCGCATAAAAATCTTCTTGATACACCGCTTCCAC TGAAGCTGTCTTTACATCAATCACGGTTGCATAATCCTTCATTTCATATATTTG GCTGCGGTAGCTGACAGCGTTTCGATCCTTCGGATACAGGGTGTCCGTTTCAA GAGGCTCAACTCCAAATATAGCTTGAAGATCCTAGAAGCTTATCGAATTCGC GGCCGCTTCTAGAgatcctagaagcttatcCATTCCAAATTAAATTACCTATGCGTATCA TAACATATTGTGGCTTTCTGTAAAAAGATTTTAAATAAAGGGCATTCGTCTAG TCAAACTTTTGCTGATGACATACTTATATATTGATCAAGAAAAGGAGGTATGT AACATGGATGAATTTGAAATGATCAAACGCAATACTTCAGAAATTATC TCTGAAGAAGAATTAAGAGAAGTTTTGAAGAAGGATGAAAAATCAGCATATA TCGGCTTCGAACCATCAGGAAAGATCCACTTGGGACATTACCTGCAAATTAA AAAAATGATCGATTTGCAAAATGCCGGATTTGACATTATTATTCTTTTAGCGG ACCTTCATGCGTATTTAAATCAGAAAGGAGAGCTTGACGAAATCAGGAAAAT TGGTGATTACAATAAAAAAGTTTTCGAAGCAATGGGCCTTAAAGCGAAGTAC GTGTATGGGAGCGAATTCCAGCTCGACAAAGATTACACCCTGAACGTCTATC GCTTAGCGTTGAAGACAACGTTAAAGCGCGCCAGACGCTCCATGGAATTAAT CGCAAGGGAAGATGAAAACCCGAAAGTTGCCGAAGTCATATATCCAATAATG CAAGTTAACGATATTCACTACCTGGGCGTTGATGTCGCCGTTGGTGGTATGGA ACAGCGTAAGATTCATATGTTGGCACGCGAGTTATTACCAAAAAAAGTTGTTT GCATTCACAATCCCGTGCTGACGGGTCTGGACGGCGAAGGCAAAATGTCTTC ATCTAAAGGAAACTTCATTGCGGTGGACGATTCACCTGAAGAGATTCGCGCT AAAATTAAGAAAGCCTACTGTCCGGCAGGAGTGGTGGAGGGCAACCCTATAA TGGAGATTGCAAAGTATTTTTTAGAATATCCTCTTACGATTAAACGTCCGGAA AAATTTGGGGGCGATCTTACTGTTAATTCATATGAAGAACTGGAATCACTTTT TAAGAACAAAGAGTTGCATCCAATGGATCTTAAAAATGCTGTTGCTGAGGAA CTTATTAAAATCCTTGAGCCGATCAGGAAACGTCTTTAAATACTAGTAGCGGC CGC

[0189] pTREX2_CotY_SC003 (SEQ ID NO: 5) actagtagcggccgctgcagtccggcaaaaaagggcaaggtgtcaattctcatgtttgacagcttatcatcggcaatag ttacccttattatcaagataagaaagaaaaggatttttcgctacgctcaaatcctttaaaaaaacacaaaagaccacat tttttaatgtggtctttattcttcaactaaagcacccattagttcaacaaacgaaaattggataaagtgggatattttt aaaatatatatttatgttacagtaatattgacttttaaaaaaggattgattctaatgaagaaagcagacaagtaagcct cctaaattcactttagataaaaatttaggaggcatatcaaatgaactttaataaaattgatttagacaattggaagagaaaagagatatttaatcattatttgaaccaacaaacgacttttagtataaccacagaaattgatattagtgttttatacc gaaacataaaacaagaaggatataaattttaccctgcatttattttcttagtgacaagggtgataaactcaaatacagc ttttagaactggttacaatagcgacggagagttaggttattgggataagttagagccactttatacaatttttgatggt gtatctaaaacattctctggtatttggactcctgtaaagaatgacttcaaagagttttatgatttatacctttctgatg tagagaaatataatggttcggggaaattgtttcccaaaacacctatacctgaaaatgctttttctctttctattattcc atggacttcatttactgggtttaacttaaatatcaataataatagtaattaccttctacccattattacagcaggaaaa ttcattaataaaggtaattcaatatatttaccgctatctttacaggtacatcattctgtttgtgatggttatcatgcag gattgtttatgaactctattcaggaattgtcagataggcctaatgactggcttttataatatgagataatgccgactgt actttttacagtcggttttctaatgtcactaacctgccccgttagttgaagaaggtttttatattacagctccagatcc tctacgccggacgcatcgtggcaggcatcaccggcgccacaggtgcggttgctggcgcctatatcgccgacatcaccga tggggaagatcgggctcgccacttcgggctcatgagcgcttgtttcggcgtgggtatggtggcaggccccgtggccggg ggactgttgggcgccatctccttgcatgcaccattccttgcggcggcggtgctcaacggcctcaacctactactgggct gcttcctaatgcaggagtcgcataagggagagcgtcgacatggatgagcgatgatgatatccgtttaggctgggcggtg atagcttctcgttcaggcagtacgcctcttttcttttccagacctgagggaggcggaaatggtgtgaggttcccgggga aaagccaaataggcgatcgcgggagtgctttatttgaagatcaggctatcactgcggtcaatagatttcacaatgtgat ggctggacagcctgaggaactctcgaacccgaatggaaacaaccagatatttatgaatcagcgcggctcacatggcgtt gtgctggcaaatgcaggttcatcctctgtctctatcaatacggcaacaaaattgcctgatggcaggtatgacaataaag ctggagcgggttcatttcaagtgaacgatggtaaactgacaggcacgatcaatgccaggtctgtagctgtgctttatcc tgatgatattgcaaaagcgcctcatgttttccttgagaattacaaaacaggtgtaacacattctttcaatgatcaactg acgattaccttgcgtgcagatgcgaatacaacaaaagccgtttatcaaatcaataatggaccagacgacaggcgtttaa ggatggagatcaattcacaatcggaaaaggagatccaatttggcaaaacatacaccatcatgttaaaaggaacgaacag tgatggtgtaacgaggaccgagaaatacagttttgttaaaagagatccagcgtcggccaaaaccatcggctatcaaaat ccgaatcattggagccaggtaaatgcttatatctataaacatgatgggagccgagtaattgaattgaccggatcttggc ctggaaaaccaatgactaaaaatgcagacggaatttacacgctgacgctgcctgcggacacggatacaaccaacgcaaa agtgatttttaataatggcagcgcccaagtgcccggtcagaatcagcctggctttgattacgtgctaaatggtttatat aatgactcgggcttaagcggttctcttccccattgagggcaaggctagacgggacttaccgaaagaaaccatcaatgat ggtttcttttttgttcataaatcagacaaaacttttctcttgcaaaagtttgtgaagtgttgcacaatataaatgtgaa atacttcacaaacaaaaagacatcaaagagaaacataccctgcaaggatgctgatattgtctgcatttgcgccggagca aaccaaaaacctggtgagacacgccttgaattagtagaaaagaacttgaagattttcaaaggcatcgttagtgaagtca tggcgagcggatttgacggcattttcttagtcgcgacgcgaggctggatggccttccccattatgattcttctcgcttc cggcggcatcgggatgcccgcgttgcaggccatgctgtccaggcaggtagatgacgaccatcagggacagcttcaagga tcgctcgcggctcttaccagcctaacttcgatcactggaccgctgatcgtcacggcgatttatgccgcctcggcgagca catggaacgggttggcatggattgtaggcgccgccctataccttgtctgcctccccgcgttgcgtcgcggtgcatggagccgggccacctactgaagtggatttctttaagagctcctttaacttcctcaccagtagttgtatcggtaccataagtag aagcagcaacccaagtagctttaccagcatccggttcaaccagcatagtaagaatcttactggacatcggcagttcttc gaacagtgcgccaactaccagctctttctccagaatgggctatacctcttttacctaaagagcatgtaactttactgga tatagctagaaaaggctatcggggagagtgtgatgataagtgggaaggactatattcaaaggtgaaagcactcgttaag tatatgaaaaattctatagaaacttctctcaattaggctaattttattgcaataacaggtgcttacttttctggagttc tttagcaaatttttttattagctgaacttagtattagtggccatactcctccaatccaaagctatttagaaagattact atatcctcaaacaggcggtaaccggcctcttcatcgggaatgcgcgcgaccttcagcatcaccggcatgtccccctggc ggacgggaagtatccagctcgaggtcgggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcac aaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccc tcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttc tcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgtt cagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcag cagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacgg ctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttgatagctcttga tccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctc aagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgag attatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaa acttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttg cctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgaga cccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaact ttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacg ttgttgccattgctgctggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatc aaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaag ttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgctttt ctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaac acgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctca aggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttca ccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaat actcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgt atttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattatta tcatgacattaacctataaaaataggcgtatcacgaggccctttcgtcttcaagaattaacaaaattctccagtcttca catcggtttgaaaggaggaagcggaagaatgaagtaagagggatttttgactccgaagtaagtcttcaaaaaatcaaat aaggagtgtcaagaatgtttgcaaaacgattcaaaacctctttactgccgttattcgctggatttttattgctgtttcatttggttctggcaggaccggcggctgcgagtgctgaaacggcgaacaaatcgaatgagcttacagcaccgtcgatcaaa agcggaaccattcttcatgcatggaattggtcgttcaatacgttaaaacacaatatgaaggatattcatgatgcaggat atacagccattcagacatctccgattaaccaagtaaaggaagggaatcaaggagataaaagcatgtcgaactggtactg gctgtatcagccgacatcgtatcaaattggcaaccgttacttaggtactgaacaagaatttaaagaaatgtgtgcagcc gctgaagaatatggcataaaggtcattgttgacgcggtcatcaatcataccaccagtgattatgccgcgatttccaatg aggttaagagtattccaaactggacacatggaaacacacaaattaaaaactggtctgatcacagcaacaaatacactcg tagccatcctagttatcactcttgtcctctaggacctaaaagcagagctaaaaacgctctgctttttcttattttccaa gcatatgatgaatatatagacgttcacccacaccaagtggggcacgggtacatatgttgttaaggactaaagtcaaata ccctataatactagaggcaggaggtcgccggatgagctgcggaaaaacccatggccgacatgagaactgtgtatgcgat gcagtggaaaagattttagcagagcaggaggcagttgaagaacagtgtccgactggctgctataccaaccttttaaacc ctacgattgctggaaaagacacaattccgtttctcgtttttgataaaaaaggcggattgttctccacattcggaaacgt agggggatttgtggatgatatgcaatgctttgaatccattttcttccgcgtcgaaaaattatgcgattgctgtgcaaca ctgtctattttacgcccggtcgatgtcaaaggcgataccttaagtgtttgccacccttgcgacccggatttcttcgggc tagaaaaaacagatttctgcattgaagtggatctcggatgcttctgcgcgattcagtgcctgtcaccagagctagttga cagaacatcgcctcacaaagataaaaagcatcatcacaatggaGGAGGCGGTGGTGGATCCATGTCCT ATTACGATTATGATATTCCGACGACAGAAAATCTGTACTTTCAAGGGGCTATG GTGACGACGCTGAGTGGCCTTAGCGGAGAACAAGGCCCGAGTGGCGACATGA CCACCGAAGAAGACTCCGCAACGCATATCAAGTTTAGCAAGCGTGATGAAGA TGGCCGTGAATTAGCAGGAGCAACTATGGAATTGCGCGACAGTTCAGGTAAG ACCATTTCCACGTGGATAAGCGATGGGCATGTAAAAGATTTTTACTTATATCC GGGGAAGTATACGTTTGTTGAAACAGCGGCTCCTGACGGATATGAAGTTGCC ACACCTATTGAATTCACAGTAAATGAGGATGGTCAAGTCACTGTGGATGGAG AGGCAACAGAAGGTGATGCCCATACAGGTTCATCGGGTTCGCATCATCACCA TCATCATTAAACCGGTtaacgctgatagtgctagtgtagatcgctactagagccaggcatcaaataa aacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacac tggctcaccttcgggtgggcctttctgcgtttatatactagtagcggccgctgcagtccggcaaaaaagggcaaggtgtc

[0190] pBS0E_T7_ST_sfGFP (SEQ ID NO: 6) ttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccg gatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgt agccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggc tgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggc tgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcac gagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgattt ttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgct ggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctga taccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcctgatgcggtatttt ctccttacgcatctgtgcggtatttcataccgcatatggtgcactctcagtacaatctgctctgatgccgcatagttaa gccagtatacactccgctatcgctacgtgactgggtcatggctgcgccccgacacccgccaacacccgctgacgcgccc tgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggtttt caccgtcatcaccgaaacgcgcgaggcagctgcggtaaagctcatcagcgtggtcgtgaagcgattcacagatgtctgc ctgttcatccgcgtccagctcgttgagtttctccagaagcgttaatgtctggcttctgataaagcgggccatgttaagg gcggttttttcctgtttggtcactgatgcctccgtgtaagggggatttctgttcatgggggtaatgataccgatgaaac gagagaggatgctcacgatacgggttactgatgatgaacatgcccggttactggaacgttgtgagggtaaacaactggc ggtatggatgcggcgggaccagagaaaaatcactcagggtcaatgccagcgcttcgttaatacagatgtaggtgttcca cagggtagccagcagcatcctgcgatgcagatccggaacataatggtgcagggcgctgacttccgcgtttccagacttt acgaaacacggaaaccgaagaccattcatgttgttgctcaggtcgcagacgttttgcagcagcagtcgcttcacgttcg ctcgcgtatcggtggttcattctgctaaccagtaaggcaaccccgccagcctagccgggtcctcaacgacaggagcacg atcatgcgcacccgtggccaggacccaacgctgcccgagatgcgccgcgtgcggctgctggagatggcggacgcgatgg atatgttctgccaagggttggtttgcgcattcacagttctccgcaagaattgattggctccaattcttggagtggtgaa tccgttagcgaggtgccgccagcttccattcaggtcgaggtggcccggctccatgcaccgcgacgcaacgcggggaggc agacaaggtatagggcggcgcctacaatccatgccaacccgttccatgtgctcgccgaggcggcataaatcgccgtgac gatcagcggtccaatgatcgaagttaggctggtaagagccgcgagcgatccttgaagctgtccctgatggtcgtcatct acctgcctggacagcatggcctgcaacgcgggcatcccgatgccgccggaagcgagaagaatcataatggggaaggcca tccagcctcgcgtcgcgactaagaaaatgccgtcaaatccgctcgccatgacttcactaacgatgcctttgaaaatctt caagttctcttctactaattcaaggcgtgtctcaccaggtttttggtttgctccggcgcaaatgcagacaatatcagga tggggtgatgtcaaagcttgaaaaaacgcacgtaacaaaagcaaaatttatgctccatgggggagactacaaccccgat cagtggctggatcggcccgatattttagctgacgatatcaaactgatgaagctttctcatacgaatacgttttctgtcg gcatttttgcatggagcgcacttgagccggaggagggcgtatatcaatttgaatggctggatgatatttttgagcggat tcacagtataggcggccgggtcatattagcaacgccgagcggagcccgtccggcctggctgtcgcaaacctatccggaa gttttgcgcgtcaatgcctcccgcgtcaaacagctgcacggcggaaggcacaaccactgcctcacatctaaagtctacc gagaaaaaacacggcacatcaaccgcttattagcagaacgatacggacatcacccggcgctgttaatgtggcacatttc aaacgaatacgggggagattgccactgtgaatcgatgcggccgctctaggagttaacaagagtttgtagaaacgcaaaa aggccatccgtcaggatggccttctgcttagctagagcggcggatttgtcctactcaggagagcgttcaccgacaaaca acagataaaacgaaaggcccagtctttcgactgagcctttcgttttatttgatgcctcaagctagagagtcctagagtctagggacctctttagctccttggaagctgtcagtagtatacctaataatttatctacattccctttagtaacgtgtaac tttccaaatttacaaaagcgactcatagaattatttcctcccgttaaataatagataactattaaaaatagacaatact tgctcataagtaacggtacttaaattgtttactttggcgtgtttcattgcttgatgaaactgatttttagtaaacagtt gacgatattctcgattgacccattttgaaacaaagtacgtatatagcttccaatatttatctggaacatctgtggtatg gcgggtaagttttattaagacactgtttacttttggtttaggatgaaagcattccgctggcagcttaagcaattgctga atcgagacttgagtgtgcaagagcaaccctagtgttcggtgaatatccaaggtacgcttgtagaatccttcttcaacaa tcagatagatgtcagacgcatggctttcaaaaaccacttttttaataatttgtgtgcttaaatggtaaggaatactccc aacaattttatacctctgtttgttagggaattgaaactgtagaatatcttggtgaattaaagtgacacgagtattcagt tttaatttttctgacgataagttgaatagatgactgtctaattcaatagacgttacctgtttacttattttagccagtt tcgtcgttaaatgccctttacctgttccaatttcgtaaacggtatcggtttcttttaaattcaattgttttattatttg gttgagtactttttcactcgttaaaaagttttgagaatattttatatttttgttcatgtaatcactccttcttaattac aaatttttagcatctaatttaacttcaattcctattatacaaaattttaagatactgcactatcaacacactcttaagt ttgcttctaagtcttatttccataacttcttttacgtttccgccattctttgctgtttcgatttttatgatatggtgca agtcagcacgaacacgaaccgtcttatctcccattatatctttttttgcactgattggtgtatcatttcgtttttcttt ttgtgctagaggatcaattcttgaagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataa tggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattc aaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtgcggccgcccgc gggagctccccgggacgttcttgccattgctgcataaaaaacgcccggcggcaaccgagcgttctgaattaattaatca tcgcgactgcatctttcgctaaggatgatttctggaattggccgactttagatattttcgttataaagaaaaataattt gcacatgaaaaaggagatttctattttagaactcctttttcatatgagaaggtgccatgtcactattgcttcagaaata ctcctagaataaaaaaactcatctttaaagatgagctgtccattccataaaaaattacattgtaatcatgtccagaaaa tgatcaatcacaatggaggacattcctaatgccggtgcattctgtcctaaggaagatggcaataattcatagctattgc ctaattgggaataaacccttgatgatacttcacttctcattgaatttaaaaccataggatgcgattcaattatgctatt tcttaaaattacggcttgtgggttgaaagtatttagaatattggtaaggcctattcctaaatagaatccaaaattttgt aatgcatttaaggttccgatatcattcagatgggcgaggtttatgatatcttgataggacagttttttctctttggtct gaagagattttaataaagccttctctgaagcatacaattcccagcatcctcggtttccgcaactgcatttaggaccatt aaagtctattgtcatatgtcccatttctccagagaagccgcttactcctctatataaatgattgttgataataacaccg atccctattcctgtgctgatacttacgtaaataatgttatcgtgattttttgcagctccaaatactttttctccatatg cgccagcatttgcctcattttcaataaaaacaggcacattgtacttctcttgtatcgaagattttaagtcaatatctct ccagttggagttcggagtgaaaacaattttttgatctttatcaatgagtccaggcacgcaaatacctataccaataagc ccgtacggagattggggcatttgcgtaataaagtgatgaatcatatcaatcaaaatgtctttcgttatttctggagaat tggattccaaatggcggtattgatcaagaacgattgttccttcaaggtctgttaaaatgccattaatataatccacacc aacatctattccaacggagtatcctgcctttttattaaaaacaagcatgacaggtcttcttccgccacttgattgtccttgacctatttcaaataccatactttctttcattaacgtgtttacctgtgatgagacagttgatttatttaatccagtca tttcagataattttgctcttgaaataggtgaatttttaaggatttcttttaataataacttttgatttacttttttgac aaaggtttgatcagcgatatccacttcatccactccatttgtttaatctttaaattaagtatcaacatagtacatagcg aatcttccctttattatatctaatgtgttcataaaaaactaaaaaaaatattgaaaatactgacgaggttatataagat gaaaataagttagtttgtttaaacaacaaactaataggtgatgtacttactatatgaaataaaatgcatctgtagaatt caaaaaaaaatctagagcaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacagg tttcccgactCTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTC ATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTC CGCGCACATTTCCCCGAAAAGTGCTAGTGGTGCTAGCCCCGCGAAATTAATA CGACTCACTATAGGGTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATAT ACATatgggacgtggcgttcct catattgttatggtggacgcctacaaacgctataaatcgggaggtggttcaggccgtaaaggcgaagagctgttcactg gtgtcgtccctattctggtggaactggatggtgatgtcaacggtcataagttttccgtgcgtggcgagggtgaaggtga cgcaactaatggtaaactgacgctgaagttcatctgtactactggtaaactgccggtaccttggccgactctggtaacg acgctgacttatggtgttcagtgctttgctcgttatccggaccatatgaagcagcatgacttcttcaagtccgccatgc cggaaggctatgtgcaggaacgcacgatttcctttaaggatgacggcacgtacaaaacgcgtgcggaagtgaaatttga aggcgataccctggtaaaccgcattgagctgaaaggcattgactttaaagaagacggcaatatcctgggccataagctg gaatacaattttaacagccacaatgtttacatcaccgccgataaacaaaaaaatggcattaaagcgaattttaaaattc gccacaacgtggaggatggcagcgtgcagctggctgatcactaccagcaaaacactccaatcggtgatggtcctgttct gctgccagacaatcactatctgagcacgcaaagcgttctgtctaaagatccgaacgagaaacgcgatcatatggttctg ctggagttcgtaaccgcagcgggcatcacgcatggtatggatgaactgtacaaaggctccggctccggctcccaccatc accatcaccattgaTGAGGATCCCGGGAATTCTCGAGTAAGGTTAACCTGCAGGAGGC CTTTAATTAAGGTGGTGCGGC CGCGCTAGCGGTCCCGGGGGATCGATCCGGCTGCTAACAAAGCCCGAAAGGA AGCTGAGTTGGCTGCTGCCACCGCTGA GCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTT TGaacgctgatagtgctagtgtagat cgctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcg gtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagtagcggccgctg cagagatatcgatttcaagctatatttggagttgagcctcttgaaacggacaccctgtatccgaaggatcgaaacgctg tcagctaccgcagccaaatatatgaaatgaaggattatgcaaccgtgattgatgtaaagacagcttcagtggaagcggt gtatcaagaagatttttatgcgcgcacgccagcggtcacaagccatgagtatcagcagggcaaggcgtattttatcggc gcgcgtttggaggatcaatttcagcgtgatttctatgagggtctgatcacagacctgtctctctctccagtttttccggttcggcacggaaaaggcgtctccgtacaagcgaggcaggatcaggacaatgattatatttttgtcatgaatttcacgga agaaaaacagctggtcacgtttgatcagagtgtgaaggacataatgacaggagacatattgtcaggcgacctgacgatg gaaaagtatgaagtgagaattgtcgtaaacacacattagcccatcattcttgaagacgaaagggcctcgtgatacgcct atttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcggaacc cctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataat attgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgt ttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactg gatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgc tatgtggcgcggtattatcccgtgttgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgactt ggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataacc atgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaaca tgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccac gatgccagcagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaatta atagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgata aatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagt tatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaag cattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatct aggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgt agaaaagatcaaaggatcttc

[0191] The present disclosure is not to be limited in terms of the particular embodiments described in this application, which are intended as illustrations of various aspects. Many modifications and variations can be made without departing from its spirit and scope, as will be apparent to those skilled in the art. Functionally equivalent methods and apparatuses within the scope of the disclosure, in addition to those enumerated herein, will be apparent to those skilled in the art from the foregoing descriptions. Such modifications and variations are intended to fall within the scope of the appended claims. The present disclosure is to be limited only by the terms of the appended claims, along with the full scope of equivalents to which such claims are entitled. It is to be understood that this disclosure is not limited to particular methods, reagents, compounds compositions or biological systems, which can, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.

[0192] With respect to the use of substantially any plural and / or singular terms herein, those having skill in the art can translate from the plural to the singular and / or from the singular to the plural as is appropriate to the context and / or application. The various singular / plural permutations may be expressly set forth herein for sake of clarity.

[0193] It will be understood by those within the art that, in general, terms used herein, and especially in the appended claims (e.g., bodies of the appended claims) are generally intended as “open” terms (e.g., the term “including” should be interpreted as “including but not limited to,” the term “having” should be interpreted as “having at least,” the term “includes” should be interpreted as “includes but is not limited to,” etc.). It will be further understood by those within the art that if a specific number of an introduced claim recitation is intended, such an intent will be explicitly recited in the claim, and in the absence of such recitation no such intent is present. For example, as an aid to understanding, the following appended claims may contain usage of the introductory phrases "at least one" and "one or more" to introduce claim recitations. However, the use of such phrases should not be construed to imply that the introduction of a claim recitation by the indefinite articles "a" or "an" limits any particular claim containing such introduced claim recitation to embodiments containing only one such recitation, even when the same claim includes the introductory phrases "one or more" or "at least one" and indefinite articles such as "a" or "an" (e.g., “a” and / or “an” should be interpreted to mean “at least one” or “one or more”); the same holds true for the use of definite articles used to introduce claim recitations. In addition, even if a specific number of an introduced claim recitation is explicitly recited, those skilled in the art will recognize that such recitation should be interpreted to mean at least the recited number (e.g., the bare recitation of "two recitations," without other modifiers, means at least two recitations, or two or more recitations). Furthermore, in those instances where a convention analogous to “at least one of A, B, and C, etc.” is used, in general such a construction is intended in the sense one having skill in the art would understand the convention (e.g., “ a system having at least one of A, B, and C” would include but not be limited to systems that have A alone, B alone, C alone, A and B together, A and C together, B and C together, and / or A, B, and C together, etc.). In those instances where a convention analogous to “at least one of A, B, or C, etc.” is used, in general such a construction is intended in the sense one having skill in the art would understand the convention (e.g., “ a system having at least one of A, B, or C” would include but not be limited to systems that have A alone, B alone, C alone, A and B together, A and C together,B and C together, and / or A, B, and C together, etc.). It will be further understood by those within the art that virtually any disjunctive word and / or phrase presenting two or more alternative terms, whether in the description, claims, or drawings, should be understood to contemplate the possibilities of including one of the terms, either of the terms, or both terms. For example, the phrase “A or B” will be understood to include the possibilities of “A” or “B” or “A and B.”

[0194] In addition, where features or aspects of the disclosure are described in terms of Markush groups, those skilled in the art will recognize that the disclosure is also thereby described in terms of any individual member or subgroup of members of the Markush group.

[0195] As will be understood by one skilled in the art, for any and all purposes, such as in terms of providing a written description, all ranges disclosed herein also encompass any and all possible subranges and combinations of subranges thereof. Any listed range can be easily recognized as sufficiently describing and enabling the same range being broken down into at least equal halves, thirds, quarters, fifths, tenths, etc. As a non- limiting example, each range discussed herein can be readily broken down into a lower third, middle third and upper third, etc. As will also be understood by one skilled in the art all language such as “up to,” “at least,” and the like include the number recited and refer to ranges which can be subsequently broken down into subranges as discussed above. Finally, as will be understood by one skilled in the art, a range includes each individual member. Thus, for example, a group having 1-3 cells refers to groups having 1, 2, or 3 cells. Similarly, a group having 1-5 cells refers to groups having 1, 2, 3, 4, or 5 cells, and so forth.

[0196] From the foregoing, it will be appreciated that various embodiments of the present disclosure have been described herein for purposes of illustration, and that various modifications may be made without departing from the scope and spirit of the present disclosure. Accordingly, the various embodiments disclosed herein are not intended to be limiting, with the true scope and spirit being indicated by the following claims.

[0197] All references recited herein are incorporated herein by specific reference in their entirety. Abil, Zhanar, Ana Maria Restrepo Sierra, and Christophe Danelon. "Clonal amplification-enhanced gene expression for cell-free directed evolution." bioRxiv (2022): 2022-11.Gantz, Maximilian, et al. "On synergy between ultrahigh throughput screening and machine learning in biocatalyst engineering." Faraday Discussions (2024). Roychowdhury, Hridindu, and Philip A. Romero. "Microfluidic deep mutational scanning of the human executioner caspases reveals differences in structure and regulation." Cell Death Discovery 8.1 (2022): 7. Hunt, Andrew C., et al. "A rapid cell-free expression and screening platform for antibody discovery." Nature communications 14.1 (2023): 3897. Kwon, Yong-Chan, and Michael C. Jewett. "High-throughput preparation methods of crude extract for robust cell-free protein synthesis." Scientific reports 5.1 (2015): 8663. WO2023245018. US 6,806,048. US 20040171065.

Claims

CLAIMS 1. A modified sporulating bacteria comprising: a nucleic acid cassette having: a silent promotor that inhibits transcription by the modified sporulating bacteria; a nucleic acid sequence including a gene of interest that encodes a protein of interest; and a nucleic acid sequence encoding a loading peptide that incorporates into a coat of a spore; and a pre-spore having the nucleic acid sequence having the gene of interest that encodes the protein of interest.

2. The modified sporulating bacteria of claim 1, wherein the silent promoter is a T7 promotor that is activated by a T7 polymerase, or a polymerase that is not natural in the sporulating bacteria.

3. The modified sporulating bacteria of claim 1, wherein the pre-spore includes at least one copy of the nucleic acid cassette.

4. A plurality of modified sporulating bacteria of claim 1.

5. A kit for forming a modified spore having a protein of interest, comprising: the modified sporulating bacteria of claim 1; a lysis reagent that lyses the modified sporulating bacteria; a polymerase that activates the silent promotor; and cell free biosynthesis components.

6. The kit of claim 5, further comprising a T7 polymerase.

7. The kit of claim 5, further comprising at least one of: non-canonical amino acids configured for being incorporated into a protein; unnatural amino acids configured for being incorporated into a protein.

8. A system for forming a modified spore, comprising: a first input channel in a microfluidic system for receiving the sporulating bacteria of claim 1 in an aqueous medium; a second input channel in the microfluidic system for receiving cell free biosynthesis components in an aqueous medium;at least one oil channel having an oil, such that the first input channel and second input channel are fluidly coupled with the at least one oil channel having the oil; and a fluid flow system for flowing at least one of the sporulating bacteria, cell free biosynthesis components, or oil.

9. The system of claim 8, further comprising a reaction channel configured to receive the sporulating bacteria and cell free biosynthesis components in the aqueous medium into the oil, so as to form a droplet of the aqueous medium having the sporulating bacteria and cell free biosynthesis components.

10. A droplet comprising: the modified sporulating bacteria of claim 1, wherein the sporulating bacteria includes a pre-spore that is progressing to be a spore; and an aqueous medium forming the droplet containing the modified sporulating bacteria.

11. The droplet of claim 10, further comprising a lysis reagent.

12. The droplet of claim 10, further comprising a polymerase that activates the silent promotor.

13. The droplet of claim 10, further comprising cell free biosynthesis components for forming a protein.

14. The droplet of claim 10, wherein the droplet is within an oil.

15. A droplet comprising: a lysed modified sporulating bacteria of claim 1, wherein the nucleic acid cassette and pre-spore or spore therefrom outside the lysed modified sporulating bacteria; and an aqueous medium forming the droplet and containing the nucleic acid cassette and pre-spore or spore therefrom.

16. The droplet of claim 15, wherein the droplet is within an oil.

17. A modified spore comprising: a spore body containing at least one copy of a nucleic acid cassette having: a silent promotor that inhibits transcription by the modified sporulating bacteria; a nucleic acid sequence including a gene of interest that encodes a protein of interest; and a nucleic acid sequence encoding a loading peptide that incorporates into a coat of a spore;a spore coat; and a protein of interest derived from the gene of interest, wherein the protein of interest is inserted into the spore coat.

18. The modified spore of claim 17, wherein the modified spore is rendered germination-deficient or germination-delayed by mutations or deletions to native genes associated with germination.

19. The modified spore of claim 17, comprising a plurality of the protein of interest inserted into the spore coat.

20. The modified spore of claim 17, comprising the nucleic acid cassette having the nucleic acid sequence including a gene of interest that encodes the protein of interest, wherein the protein of interest includes the loading peptide or omits the loading peptide.

21. A method of forming the modified sporulating bacteria of claim 1, comprising: providing a nucleic acid cassette having: a silent promotor that inhibits transcription by the sporulating bacteria; a nucleic acid sequence including a gene of interest that encodes a protein of interest; and a nucleic acid sequence encoding a loading peptide that incorporates into a coat of a spore; providing a sporulating bacteria; introducing the nucleic acid cassette into cytoplasm of the sporulating bacteria; and introducing the gene of interest into a pre-spore within the sporulating bacteria.

22. The method of claim 21, wherein the pre-spore includes the nucleic acid cassette.

23. A method of forming a modified spore, comprising: providing the modified sporulating bacteria of claim 1; lysing the modified sporulating bacteria with a lysis reagent; activating the silent promotor with a polymerase for the silent promotor; generating the protein of interest from the gene of interest; generating a modified spore having a spore coat with the protein of interest inserted therein and having the gene of interest within the spore.

24. The method of claim 23, comprising: introducing the modified sporulating bacteria into an aqueous medium having the lysis reagent, polymerase, and protein-forming amino acids; and generating the modified spore in the aqueous medium.

25. The method of claim 23, comprising: introducing the modified sporulating bacteria into a first input of a microfluidic system; introducing the lysis reagent, polymerase, and protein-forming amino acids into a second input of the microfluidic system; combining the modified sporulating bacteria with the lysis reagent, polymerase, and protein-forming cell free biosynthesis components in a channel of the microfluidic system; and generating the modified spore in the channel of the microfluidic system.

26. The method of claim 25, comprising: forming a droplet in oil in the channel of the microfluidic system, the droplet comprising the modified sporulating bacteria and lysis reagent, polymerase, and protein- forming cell free biosynthesis components; and lysing the modified sporulating bacteria in the droplet; generating the modified spore in the droplet.

27. The method of claim 26, comprising flowing the droplet though the microfluidic system during the lysing of the modified sporulating bacteria and generating the modified spore.

28. The method of claim 26, comprising: flowing the droplet though the microfluidic system during the lysing of the modified sporulating bacteria and generating the modified spore; breaking the droplet to release the modified spore; and harvesting the modified spore by centrifugation or filtration.

29. The method of claim 23, comprising: providing a reaction composition comprising the modified sporulating bacteria, lysing reagent, polymerase, aqueous medium, and oil into a sonicator; and sonicating the reaction composition so as to cause the lysing, activating, generating the protein of interest, and generating the modified spore.

30. A method of detecting a modified spore, comprising: providing the modified spore of claim 1; providing a binding agent that binds with the protein of interest; binding the binding agent with the protein of interest; and detecting the binding of the binding agent with the protein of interest.

31. A method of assaying the modified spore, comprising: providing the modified spore of claim 1; providing a stimulus or stress condition to the modified spore; and detecting an outcome of the modified spore in response to the stimulus or stress condition.

32. A method of forming a modified sporulating bacteria, comprising: providing the modified spore of claim 1; and providing a stimulus to the modified spore so as to cause production of a modified sporulating bacteria having the gene of interest.

33. A modified sporulating bacteria comprising: a first nucleic acid cassette within cytoplasm of the sporulating bacteria, the nucleic acid cassette having: a silent promotor that inhibits transcription by the sporulating bacteria; and a nucleic acid sequence including a gene of interest that encodes a protein of interest; a second or multiple additional nucleic acid cassettes within cytoplasm of the sporulating bacteria, the nucleic acid cassette having: a promotor, silent or not; and a nucleic acid sequence encoding a gene of interest with a protein of interest that includes a loading peptide that incorporates into a coat of a spore before or after droplet encapsulation, or does not contain a loading peptide; and a pre-spore having the nucleic acid sequence having the gene of interest that encodes the protein of interest.

34. A combination of modified sporulating bacteria comprising: a first modified sporulating bacteria having a first nucleic acid cassette within cytoplasm of the sporulating bacteria, the nucleic acid cassette having: a silent promotor that inhibits transcription by the sporulating bacteria; anda nucleic acid sequence including a gene of interest that encodes a protein of interest; and a pre-spore having the nucleic acid sequence having the gene of interest that encodes the protein of interest; and a second modified sporulating bacteria having a second nucleic acid cassette within cytoplasm of the sporulating bacteria, the nucleic acid cassette having: the silent promotor; and a nucleic acid sequence encoding a loading peptide that incorporates into a coat of a spore; and a pre-spore having the nucleic acid sequence having the gene of interest that encodes the protein of interest.

35. A system for forming a modified spore, comprising: a sonicator; the sporulating bacteria of claim 1 in a first aqueous medium; cell free biosynthesis components in a second aqueous medium; and an oil.

Images