Method for regulating mRNA and protein expression of SCN1a gene, and compound
By using agRNA-mediated RNA editing technology, the problem of NaV1.1 protein expression deficiency in Dravet syndrome was solved, and NaV1.1 protein expression was enhanced, providing a direct treatment to improve patients' symptoms and prognosis.
Patent Information
- Application Number
- PCT/CN2024/122759
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2024-09-30
- Publication Date
- 2026-04-02
AI Technical Summary
Current treatments for Dravet syndrome cannot directly address the NaV1.1 protein expression defect in the SCN1A gene, which makes seizures difficult to control. Antiepileptic drugs can only reduce seizures but cannot control them, and whether the ketogenic diet can improve prognosis remains to be discussed.
Using antisense oligonucleotide guide RNA (agRNA)-mediated RNA editing technology, the ADAR protein is recruited by binding to the precursor mRNA of the SCN1A gene, and the splicing site is edited to enhance the expression level of Nav1.1 protein, thereby repairing or inhibiting abnormal splicing of the SCN1A gene.
By altering the splicing pattern of the SCN1A gene and increasing the expression of Nav1.1 protein, there is a potential therapeutic effect on Dravet syndrome, which could improve patients' symptoms and prognosis.
Smart Images

Figure CN2024122759_02042026_PF_FP_ABST
Abstract
Description
Methods and compounds for modulating SCN1A gene mRNA and protein expression TECHNICAL FIELD
[0001] The present disclosure belongs to the field of biological medicine, and relates to a method and compounds for modulating SCN1A gene mRNA and protein expression. BACKGROUND
[0002] Dravet syndrome, also known as severe myoclonic epilepsy of infancy, is a progressive disease with few effective treatments. It usually first appears in infants and young children, and patients have frequent, long seizures; behavioral problems; developmental delays; movement and balance problems; and other issues. People with the disease often require constant care and face a higher risk of sudden death. It is believed that approximately one in 15,700 people are affected. It is currently widely believed that the SCN1A gene (voltage-gated sodium channel alpha 1-subunit, SCN1A) encoding the Nav1.1 ion channel protein is one of the genes most clinically relevant to epilepsy.
[0003] The pathogenic mechanism of SCN1A gene mutation in Dravet syndrome and other epilepsies is currently manifested as a copy loss of the gene or a haploinsufficiency effect due to the inability to perform its normal function due to mutation, and usually one of the pair of SCN1A alleles in Dravet syndrome patients is normal and the other is mutated. The normal SCN1A allele undergoes alternative splicing at exon 20, one of which is a normal splicing pattern that generates mRNA that can translate the coding protein Nav1.1, which can be referred to as productive splicing to generate productive SCN1A mRNA. Another splicing pattern retains 64 bases in intron 20, which generates mRNA that cannot translate the coding protein Nav1.1, and these 64 bases are referred to as pseudo-exon (Exon20N), which can be referred to as non-productive splicing to generate non-productive SCN1A mRNA.
[0004] Existing treatments for Dravet syndrome include anti-epileptic drugs, vagus nerve stimulation, and the use of a very low carbohydrate ketogenic diet. However, none of these treatments directly addresses the root cause of the disease, which is to change the expression defect of NaV1.1 protein in intermediate nerve cells. Seizures in Dravet syndrome are usually difficult to control, and anti-epileptic drugs can reduce seizures but cannot control seizures, and whether anti-epileptic drugs and ketogenic diets can improve prognosis is still under discussion.
[0005] SUMMARY
[0006] In some embodiments, the present disclosure aims to overcome the deficiencies of the prior art and provide a method and compound for repairing or inhibiting abnormal splicing of the SCN1A gene.
[0007] In some embodiments, the present disclosure provides an antisense oligonucleotide guide RNA (agRNA) and employs agRNA-mediated RNA editing technology to regulate SCN1A gene alternative splicing, and the expression level of the SCN1A gene in cells is improved by the agRNA, which can be used as a potential therapeutic means.
[0008] In some embodiments, the present disclosure provides a use of an antisense oligonucleotide guide RNA in the preparation of a medicament for changing the expression of a target protein in a cell of a subject, wherein the cell has a pre-mRNA encoding the target protein, wherein the pre-mRNA comprises an intron, an exon flanking a 5' splice site of the intron, and an exon flanking a 3' splice site or a pseudo 3' splice site of the intron; the antisense oligonucleotide guide RNA is capable of binding to the pre-mRNA to form a structure capable of recruiting ADAR in the cell, thereby forming a complex containing an ADAR protein; and the target protein is a Nav1.1 protein. In some embodiments, the present disclosure provides a method for changing the expression of a target protein in a cell of a subject, wherein the method comprises contacting the cell with the antisense oligonucleotide guide RNA; the cell has a pre-mRNA encoding the target protein, wherein the pre-mRNA comprises an intron, an exon flanking a 5' splice site of the intron, and an exon flanking a 3' splice site or a pseudo 3' splice site of the intron; the antisense oligonucleotide guide RNA is capable of binding to the pre-mRNA to form a structure capable of recruiting ADAR in the cell, thereby forming a complex containing an ADAR protein; and the target protein is a Nav1.1 protein.
[0009] In some embodiments, the antisense oligonucleotide guide RNA is used to change the expression of a target protein Nav1.1 protein in a cell of a subject, thereby for treating Dravet syndrome.
[0010] In some embodiments, the antisense oligonucleotide guide RNA is capable of recruiting ADAR to the 3’ splice site or pseudo 3’ splice site to edit the A base of the 3’ splice site or pseudo 3’ splice site, thereby splicing out the entire exon flanked by the 3’ splice site or pseudo 3’ splice site of the intron from the pre-mRNA, causing the exon to be skipped, altering the expression level or sequence composition of the mature mRNA encoding the target protein, and altering the expression level or function of the target protein in the cell.
[0011] In some embodiments, the antisense oligonucleotide guide RNA is unmodified or has modifications.
[0012] In some embodiments, the modifications comprise backbone modifications, sugar modifications, or base modifications.
[0013] In some embodiments, the modified base comprises a 2’-MOE modified base, a phosphorothioate bond modified base, a locked nucleic acid modified base, a 2’-F modified base, a 2’-MOE modified 5 methyl base, a 2’-OMe modified 5 methyl base, a 2’-OMe modified base, a 5 methyl modified base, a LNA modified 5 methyl base, a 2’-F modified 5 methyl base, a S-GNA modified base, a 2’F-ANA modified base, an INV modified base, a L-DNA modified base, a cET modified modified base, or a UNA modified base.
[0014] In some embodiments, the 5’ splice site has the consensus NNN / GUNNNN or NNN / GCNNNN motif.
[0015] In some embodiments, the 3’ splice site or pseudo 3’ splice site has the consensus NAG / N motif.
[0016] In some embodiments, the “N” is one of an A, U, G, C, or I base, and “ / ” is the exon-intron boundary.
[0017] In some embodiments, the adenine in the NAG / N sequence of the 3’ splice site or pseudo 3’ splice site is edited by ADAR.
[0018] In some embodiments, the ADAR editing is ADAR-mediated A-to-I editing.
[0019] In some embodiments, the ADAR is selected from ADAR1 or ADAR2.
[0020] In some embodiments, the antisense oligonucleotide guide RNA, after binding to the pre-mRNA, forms a complex capable of recruiting ADAR, which is capable of mutating the A in the NAG / N of the 3' splice site or pseudo 3' splice site of the pre-mRNA to a G.
[0021] In some embodiments, the antisense oligonucleotide guide RNA is fully complementary or incompletely complementary to the pre-mRNA.
[0022] In some embodiments, the incomplete base complementation is complementation with one or more mismatches, wobbles, deletions, and / or bulges to the targeted region.
[0023] In some embodiments, the antisense oligonucleotide guide RNA has at least one mismatch to the pre-mRNA.
[0024] In some embodiments, the base of the antisense oligonucleotide guide RNA that binds to the A base of the 3' splice site or pseudo 3' splice site is one of C, A, G, or I, or a base derivative thereof.
[0025] In some embodiments, the base of the antisense oligonucleotide guide RNA that binds to the A base of the 3' splice site or pseudo 3' splice site is C or a base derivative thereof.
[0026] In some embodiments, the antisense oligonucleotide guide RNA forms a double-stranded RNA with the pre-mRNA that is incompletely base complemented.
[0027] In some embodiments, the complementary strands are base complemented at non-mismatch or non-deletion or non-bulge or non-internal loop or non-wobble base pairing sites.
[0028] In some embodiments, the proportion of complemented base pairs in the double-stranded RNA formed by the antisense oligonucleotide guide RNA and the pre-mRNA is greater than 60%.
[0029] In some embodiments, the proportion of complemented base pairs in the double-stranded RNA formed by the antisense oligonucleotide guide RNA and the pre-mRNA is greater than 75%.
[0030] In some embodiments, the antisense oligonucleotide guide RNA is capable of binding to the pre-mRNA to form a complex with an ADAR protein, and after editing the pre-mRNA, the editing efficiency is greater than 1%.
[0031] In some embodiments, the antisense oligonucleotide guide RNA targets a position of the pre-mRNA within a region from 1000 bp upstream to 1000 bp downstream relative to the 3' splice site or pseudo 3' splice site.
[0032] In some embodiments, the antisense oligonucleotide guide RNA targets a position of the pre-mRNA within a region from 500 bp upstream to 500 bp downstream relative to the 3' splice site or pseudo 3' splice site.
[0033] In some embodiments, the antisense oligonucleotide guide RNA targets a position of the pre-mRNA within a region from 100 bp upstream to 100 bp downstream relative to the 3' splice site or pseudo 3' splice site.
[0034] In some embodiments, the antisense oligonucleotide guide RNA has a sequence length of 10-300 bp. In some embodiments, the antisense oligonucleotide guide RNA has a sequence length of 20-150 bp. In some embodiments, the antisense oligonucleotide guide RNA has a sequence length of 20-100 bp. In some embodiments, the antisense oligonucleotide guide RNA has a sequence length of 20-70 bp.
[0035] In some embodiments, the sequence of the antisense oligonucleotide guide RNA is selected from a sequence having at least 80% or at least 81% or at least 82% or at least 83% or at least 84% or at least 85% or at least 86% or at least 87% or at least 88% or at least 89% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99% or at least 99.5% or at least 99.8% or at least 99.9% or 100% sequence identity to any one of the antisense oligonucleotide guide RNA sequences contained in the sequences set forth as SEQ ID NOs: 10-200, SEQ ID NOs: 217-222, or expressed by a vector comprising any one of the sequences of SEQ ID NOs: 201-203.
[0036] In some embodiments, the medicament is a medicament for treating Dravet syndrome.
[0037] In some embodiments, the disclosure provides an antisense oligonucleotide guide RNA, wherein the antisense oligonucleotide guide RNA comprises a sequence having at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99% or at least 99.5% or at least 99.8% or at least 99.9% or 100% sequence identity to any of the antisense oligonucleotide guide RNA sequences contained in the sequences set forth in SEQ ID NOs: 10-200, the sequences set forth in SEQ ID NOs: 217-222, or the sequences expressed from a vector comprising any of the sequences set forth in SEQ ID NOs: 201-203.
[0038] In some embodiments, the antisense oligonucleotide guide RNA is unmodified or has modifications.
[0039] In some embodiments, the antisense oligonucleotide guide RNA comprises backbone modifications, sugar modifications, or base modifications.
[0040] In some embodiments, the modified base comprises a 2’-MOE modified base, a phosphorothioate linkage modified base, a locked nucleic acid modified base, a 2’-F modified base, a 2’-MOE modified 5 methyl base, a 2’-OMe modified 5 methyl base, a 2’-OMe modified base, a 5 methyl modified base, a LNA modified 5 methyl base, a 2’-F modified 5 methyl base, a S-GNA modified base, a 2’F-ANA modified base, an INV modified base, a L-DNA modified base, a cET modified modified base, or a UNA modified base.
[0041] In some embodiments, the disclosure provides a vector comprising a polynucleotide encoding the antisense oligonucleotide guide RNA of claim 5.
[0042] In some embodiments, the vector is a recombinant expression vector.
[0043] In some embodiments, the vector comprises a plasmid or a viral vector. In some embodiments, the vector is a delivery vector. In some embodiments, the vector is a plasmid or a viral vector for expression in a higher eukaryotic cell or a prokaryotic cell.
[0044] In some embodiments, the present disclosure provides a composition comprising a viral vector comprising a polynucleotide encoding or comprising an antisense oligonucleotide guide RNA that binds to a targeted portion of a pre-mRNA encoding a Nav1.1 protein; the antisense oligonucleotide guide RNA comprises a sequence having at least 80% or at least 81% or at least 82% or at least 83% or at least 84% or at least 85% or at least 86% or at least 87% or at least 88% or at least 89% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99% or at least 99.5% or at least 99.8% or at least 99.9% or 100% sequence identity to any of the sequences set forth in SEQ ID NOs: 10-200, the sequences set forth in SEQ ID NOs: 217-222, or the antisense oligonucleotide guide RNA sequences contained in the sequences expressed from the vectors comprising any of the sequences set forth in SEQ ID NOs: 201-203.
[0045] In some embodiments, when the antisense oligonucleotide guide RNA is introduced into a cell having a pre-mRNA encoding the Nav1.1 protein, the antisense oligonucleotide guide RNA increases the expression level of the treated Nav1.1 protein-encoding in the cell.
[0046] In some embodiments, the present disclosure provides a host cell comprising the antisense oligonucleotide guide RNA, the vector, or the composition.
[0047] In some embodiments, the present disclosure provides a pharmaceutical composition comprising the antisense oligonucleotide guide RNA or its complementary sequence and a pharmaceutically acceptable excipient.
[0048] In some embodiments, the present disclosure provides a method of treating a disease in a subject in need by altering the expression of a target protein or functional RNA in a cell of the subject, comprising contacting the cell of the subject with the antisense oligonucleotide guide RNA, the vector, or the composition, or the host cell or the pharmaceutical composition.
[0049] In some embodiments, the present disclosure provides use of the antisense oligonucleotide guide RNA, the vector, or the composition, or the host cell or the pharmaceutical composition in the manufacture of a medicament for treating a disease in a subject in need by altering the expression of a target protein or functional RNA in a cell of the subject.
[0050] In some embodiments, the disease in the subject in need thereof comprises a disease or disorder associated with a loss-of-function mutation in the SCN1A gene.
[0051] In some embodiments, the disease comprises Dravet syndrome, but is not limited to Dravet syndrome.
[0052] In some embodiments, the disclosure provides a method of treating Dravet syndrome, comprising administering to a patient or individual the antisense oligonucleotide guide RNA, the vector, or the composition, or the host cell, or the pharmaceutical composition.
[0053] In some embodiments, the cell has a precursor mRNA encoding a target protein Nav1.1, wherein the precursor mRNA comprises an intron, an exon flanked by a 5’ splice site of the intron, and an exon flanked by a 3’ splice site or a pseudo 3’ splice site of the intron.
[0054] In some embodiments, the antisense oligonucleotide guide RNA is capable of binding to the precursor mRNA to form a structure capable of recruiting ADAR in the cell, thereby forming a complex containing ADAR protein.
[0055] In some embodiments, the antisense oligonucleotide guide RNA is capable of recruiting ADAR to the 3’ splice site or the pseudo 3’ splice site to edit the A base of the 3’ splice site or the pseudo 3’ splice site, thereby splicing out the entire exon flanked by the 3’ splice site or the pseudo 3’ splice site of the intron from the precursor mRNA, causing the exon skipping, altering the level or sequence of the mature mRNA encoding the target protein, and altering the expression level or function of the target protein in the cell.
[0056] In some embodiments, the 5’ splice site has a consensus NNN / GUNNNN or NNN / GCNNNN motif.
[0057] In some embodiments, the 3’ splice site or the pseudo 3’ splice site has a consensus N / AGN motif.
[0058] In some embodiments, the “N” is any base, and “ / ” is an exon-intron boundary.
[0059] In some embodiments, the adenine in the 3’ splice site or the pseudo 3’ splice site N / AGN sequence is edited by ADAR.
[0060] In some embodiments, the ADAR editing is ADAR-mediated A-to-I editing.
[0061] In some embodiments, the ADAR is selected from ADAR1 or ADAR2.
[0062] In some embodiments, the antisense oligonucleotide guide RNA, after binding to the pre-mRNA, forms a complex capable of recruiting ADAR, which is capable of mutating the A in the NAG / N of the 3' splice site or pseudo 3' splice site of the pre-mRNA to I. BRIEF DESCRIPTION OF DRAWINGS
[0063] Figure 1 shows the map of the human SCN1A gene reporter plasmid.
[0064] Figure 2 shows the map of the murine SCN1A gene reporter plasmid.
[0065] Figure 3 shows the map of the SCN1A expression vector. (A) pCAG-mSCNA-WPRE plasmid map. (B) pCMV(CAT)T7-SB100 plasmid map.
[0066] Figure 4 shows the verification results of SCN1A gene transcription expression of mSCN1A-Hela stable cell strain.
[0067] Figure 5 shows the verification results of SCN1A gene transcription expression of human SCN1A gene reporter plasmid.
[0068] Figure 6 shows the verification results of SCN1A gene transcription expression of murine SCN1A gene reporter plasmid.
[0069] Figure 7 shows the expression of SCN1A gene in the brain tissue of wild-type C57BL / 6 mice on the second day after birth.
[0070] Figure 8 shows the expression results of SCN1A gene in the brain tissue of adult wild-type C57BL / 6 mice.
[0071] Figure 9 shows the editing efficiency of agRNA in Hela cells.
[0072] Figure 10 shows the plasmid map of pC0043-U6-SCN1A-51nt-circle (A), pC0043-U6-SCN1A-101nt-circle (B), and pC0043-U6-SCN1A-151nt-circle (C).
[0073] Figure 11 shows functional verification of the plasmid expressing agRNA targeting the 3' splice site of pseudo-exon of SCN1A gene. (A) is the transcription expression result of SCN1A gene. (B) is the expression of productive transcription product of SCN1A gene detected by fluorescent quantitative PCR. (C) is the expression of non-productive transcription product of SCN1A gene detected by fluorescent quantitative PCR. (D) is the editing efficiency result. (E) is the original map of Sanger sequencing.
[0074] Figure 12 shows the splicing jump effect of pseudo-exon after mutating the 3' splice site from AG to GG. (A) is the transcription expression result of SCN1A gene. (B) is the expression of productive transcription product of SCN1A gene detected by fluorescent quantitative PCR. (C) is the expression of non-productive transcription product of SCN1A gene detected by fluorescent quantitative PCR. DETAILED DESCRIPTION
[0075] The technical solutions of the present disclosure are further illustrated by specific examples below, which do not represent a limitation on the scope of protection of the present disclosure. Some non-essential modifications and adjustments made by others according to the concept of the present disclosure still fall within the scope of protection of the present disclosure.
[0076] Certain definitions
[0077] In the present disclosure, the term "antisense oligonucleotide guide RNA", also known as "Antisense Oligonucleotide guide RNA", is abbreviated as "agRNA", which generally refers to an artificially synthesized single-stranded or double-stranded oligonucleotide. The agRNA can be modified to change its structure, binding site, etc. In the present disclosure, the agRNA can be in single-stranded form, and its function can be to complementarily pair with a specific sequence of the target RNA and edit it.
[0078] In the present disclosure, the term "modification" generally refers to the modification of natural or artificially synthesized components. The modification can include modification of bases, modification of nucleosides, modification of sugars, modification of internucleotide linkages; it can include chemical modification and non-chemical modification.
[0079] In the present disclosure, the terms "complementary pairing" and "complementary" can be used interchangeably, and generally refer to Watson-Crick or Hoogsteen base pairing between nucleotide units of nucleic acid molecules. In the present disclosure, base pairing can refer to A-T, C-G, T*A / T, C*G / C. In the present disclosure, complementary pairing can be complete complementary pairing, or there can be one or more bulges, wobbles, deletions, and / or mismatches between nucleic acid molecules. In the present disclosure, the agRNA can form a double-stranded complex with the target RNA through complementary pairing.
[0080] In the present disclosure, the term "bulge" generally refers to a region in which one or more bases upstream and downstream of the bulge region are complementary to the target RNA strand and the corresponding two bases of the target RNA strand are consecutive.
[0081] In the present disclosure, the term "wobble" generally refers to a G-U pairing.
[0082] In the present disclosure, the term "deletion" generally refers to a region in which the bases upstream and downstream of the deletion region are consecutive and there are corresponding number of bases of the target RNA strand in the deletion region.
[0083] In the present disclosure, the term "mismatch" generally refers to a pair of opposite nucleotides in a double-stranded RNA complex that is not a perfect base pair according to Watson-Crick base pairing rules. The type of mismatch can be one of A-A, A-G, A-C, U-U, U-C, G-G, G-A, C-A, C-C, C-U.
[0084] In the present disclosure, the term "perfect complementarity" generally refers to a state in which there is only strict Watson-Crick or Hoogsteen base pairing between the nucleotide units of the nucleic acid molecules. There is no bulge, wobble, deletion, and / or mismatch in perfect complementarity.
[0085] In the present disclosure, the term "treatment" generally refers to: (1) preventing a disease, disorder, and / or condition from occurring in a patient that can be predisposed to the disease, disorder, and / or condition, but has not yet been diagnosed as having it; (2) inhibiting the disease, disorder, or condition, i.e., arresting its development; and (3) relieving the disease, disorder, or condition, i.e., causing the disease, disorder, and / or condition and / or symptoms associated with the disease, disorder, and / or condition to regress.
[0086] In the present disclosure, the term "delivery vector" generally refers to a vector that delivers one or more nucleotides to a cell. The vector can include a viral vector, a non-viral vector. The viral vector can include a lentivirus (LV) vector, an adenovirus (AdV) vector, and an adeno-associated virus (AAV) vector, etc. The non-viral vector can include a liposome, a molecular conjugate, a polymer, a complex vector, and a nanoparticle vector, etc. In the present disclosure, the delivery vector can deliver the agRNA or the isolated nucleic acid molecule of the present disclosure into a cell.
[0087] In the present disclosure, the term "subject" generally refers to a human or non-human animal, including but not limited to a cat, a dog, a horse, a pig, a cow, a sheep, a rabbit, a mouse, a rat, or a monkey.
[0088] In the present disclosure, the term “RNA editing” generally refers to a cotranscriptional or posttranscriptional modification process that introduces changes in a genomically encoded RNA sequence, resulting in a mutated RNA. Adenosine editing in double-stranded RNA (dsRNA) from adenosine to inosine (A-to-I) is a common type of RNA editing in mammals, catalyzed by adenosine deaminases of the RNA-acting (ADAR) enzyme family. In vertebrates, three ADAR proteins, ADAR1, ADAR2, and ADAR3, have been previously characterized in the family. ADAR1 and ADAR2 (ADARs) catalyze all currently known A-to-I editing sites. ADAR3 has no known deaminase activity. Inosine (I) mimics guanosine (G), so ADAR proteins introduce a virtual A-to-G substitution in the transcript. This change can lead to specific amino acid substitutions, alternative splicing, miRNA-mediated gene silencing, or changes in transcript localization and stability.
[0089] In the present disclosure, the term “nucleotide” refers to the individual nucleobase- ribosyl-phosphate or nucleobase-deoxyribosyl-phosphate. In the present disclosure, the terms “adenosine” and “adenine” (abbreviated “A”), “guanosine” and “guanine” (abbreviated “G”), “cytidine” and “cytosine” (abbreviated “C”), “uridine” and “uracil” (abbreviated “U”), “thymidine” and “thymine” (abbreviated “T”), “inosine” and “inosine” (abbreviated “I”), are used interchangeably.
[0090] In the present disclosure, the term “cell” generally includes prokaryotic and eukaryotic cells. Nucleic acids can be transfected in cells, plasmids can be propagated in prokaryotic cells, and nucleic acids, encoding polypeptides, can be expressed in eukaryotic cells. For example, a cell can include an agRNA and / or a delivery vector. A cell can be a cell from any organ, for example, skin, lung, heart, kidney, liver, pancreas, intestine, muscle, gland, eye, brain, blood, etc. For example, a cell can be a human cell or a mouse cell. For example, a cell can be an immune cell. For example, an immune cell can be a T cell, a B cell, a natural killer cell (NK cell), a macrophage, a NKT cell, a monocyte, a dendritic cell, a granulocyte, a lymphocyte, a leukocyte, a peripheral blood mononuclear cell, an embryonic stem cell, a lymphoid progenitor cell, and / or a pluripotent stem cell. For example, an immune cell can be a T cell.
[0091] As used herein and in the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a method” includes multiple such methods, and reference to “the fragment” includes reference to one or more fragments and equivalents thereof known to those skilled in the art, and so forth.
[0092] The term "and / or", as used in this document, refers to and encompasses any and all possible combinations of one or more of the associated listed items. The term "and / or" as used in a list of two or more items, means that any one of the listed items can be employed by itself, or any combination of two or more of the listed items can be employed. For example, if a composition, combination, formulation, or the like is described as containing (or including) components A, B, C, and / or D, the composition can contain A alone; B alone; C alone; D alone; a combination of A and B; a combination of A and C; a combination of A and D; a combination of B and C; a combination of B and D; a combination of C and D; a combination of A, B, and C; a combination of A, B, and D; a combination of A, C, and D; a combination of B, C, and D; or a combination of A, B, C, and D.
[0093] It is further understood that where the term "comprising" is used in the description of the various embodiments, it is to be understood that the embodiments can be alternatively or additionally described using the language "consisting essentially of or "consisting of.
[0094] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as those commonly understood by one of ordinary skill in the art to which this disclosure pertains. Although many methods and reagents are similar or identical to those described herein, exemplary methods and materials are disclosed.
[0095] It is to be understood that this disclosure is not limited to the particular methodology, protocols, and reagents, etc., described herein and as such can vary. The terminology used herein is for the purpose of describing particular embodiments or aspects only and is not intended to limit the scope of the present disclosure.
[0096] Herein, pre-mRNA (pre-messenger RNA) refers to the primary transcription product produced during the process of gene transcription, which contains a mixed sequence of exon and intron sequences.
[0097] Herein, mature mRNA (mature messenger RNA) is a pre-mRNA molecule that has been processed during the process of splicing. The intron sequence in the pre-mRNA is removed, while the exon sequence is linked together, resulting in a mature mRNA molecule that contains only the information required to encode a protein. This mature mRNA molecule can be translated into a protein, which participates in the biological activities of the cell.
[0098] The term "pharmaceutically acceptable" as used herein refers to those compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of patients without causing additional toxicity, irritation, allergic response, or other problem or complication (i.e., commensurate with a reasonable benefit / risk ratio).
[0099] A "pharmaceutical composition" as used herein refers to a therapeutically effective amount of a drug in combination with a pharmaceutically acceptable diluent, preservative, solubilizer, emulsifier, adjuvant, and / or carrier. A "therapeutically effective amount" as used herein refers to an amount that provides a therapeutic effect for a given indication and dosing regimen. In some embodiments, these compositions are liquid or lyophilized formulations, or otherwise dry formulations, containing various buffered contents (e.g., Tris-HCl, acetate, phosphate), diluents of various pH and ionic strength, additives such as albumin or gelatin to prevent adsorption to surfaces, denaturants (e.g., Tween 20, Tween 80, Pluronic F68, bile salt). Solubilizers (e.g., glycerol, polyethylene glycol), antioxidants (e.g., ascorbic acid, sodium metabisulfite), preservatives (e.g., Thimerosal, benzyl alcohol, parabens), bulking agents or tonicity modifiers (e.g., lactose, mannitol), covalent attachment of polymers such as polyethylene glycol to proteins, complexation with metal ions, or incorporation of the material into or onto particular preparations of polymeric compounds (e.g., polylactic acid, polyglycolic acid, hydrogels, etc.), or onto liposomes, microemulsions, micelles, unilamellar or multilamellar vesicles, erythrocyte ghosts, or spheroplasts. Such compositions would influence the physical state, solubility, stability, rate of in vivo release, and rate of in vivo clearance. Controlled release or sustained release compositions include formulations in lipophilic depots (e.g., fatty acids, waxes, oils).
[0100] The terms "oligonucleotide", "nucleotide sequence" and "nucleic acid" are used interchangeably. They refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or their analogs.
[0101] In some embodiments, the ADAR is naturally present in a host cell, such as a eukaryotic cell, preferably a mammalian cell, more preferably a human cell. In some embodiments, the ADAR is introduced into the host cell.
[0102] The experimental methods used in the examples are conventional methods unless otherwise specified; the materials, reagents, etc. used are commercially available unless otherwise specified.
[0103] Herein, the sequence of human SCN1A gene (5'-3') is referenced to NCBI Reference Sequence: NC_000002.12. Herein, the sequence of murine SCN1A gene (5'-3') is referenced to NCBI Reference Sequence: NC_000068.7.
[0104] Herein, for the sequence with base modification, the modification of the base is as described in the specification herein. Herein, "base derivative" refers to modification on the base, for example, C base can be replaced by 5mC (5-methylcytosine) and the like.
[0105] In the following examples herein, dN in the sequences of SEQ ID NO: 9-SEQ ID NO: 200 and SEQ ID NO: 217-SEQ ID NO: 222 (containing modified sequences) represents DNA base, and N represents RNA base; I base represents inosine; "eN" represents 2'-MOE modified base; wherein "el" represents 2'-MOE modified I base; "*" represents phosphorothioate bond; "L" is LNA, and "LN" represents locked nucleic acid (LNA) modified base; "fN" represents 2'-F modified base; wherein "fl" represents 2'-F modified I base; "e5mN": 2'-MOE modified 5-methyl base; "m5mN": 2'-OMe modified 5-methyl base; "mN" represents 2'-OMe modified base; "5mN" represents 5-methyl modified base; "L5mN" represents LNA modified 5-methyl base; "f5mN" represents 2'-F modified 5-methyl base; the sequence of SEQ ID NO: 173 contains cET modification, and the original sequence is represented by "cETN".
[0106] In addition, part of the sequences of SEQ ID NO: 124-SEQ ID NO: 195 also contain rare modifications, which are shown as follows:
[0107] The sequence of SEQ ID NO: 124 contains S-GNA modification (DOI: 10.1261 / rna.079526.122), and the original sequence is represented by "sgN";
[0108] The sequences of SEQ ID NO: 133, 142, 144, 146, 162, and 195 contain 2'F-ANA modification (DOI: 10.1002 / 0471142700.nc0415s1), and the original sequence is represented by capital "FN";
[0109] The sequences of SEQ ID NO: 149, 168, 170, 175 contain INV modification (DOI: 10.1089 / ard.1992.2.129), and the modified base is the C base of DNA, which is represented as "idC" in the original sequence;
[0110] The sequences of SEQ ID NO: 153, 163 contain L-DNA modification (DOI: 10.1021 / bi00191a015), and the modified base is the C base of DNA, which is represented as "LdC" in the original sequence.
[0111] Example 1 Construction of SCN1A gene reporter plasmid
[0112] 1. Human SCN1A gene reporter plasmid:
[0113] Using human genomic DNA as a template, three fragments of the SCN1A gene were amplified by PCR, and homologous arms were added. The first fragment was located at the genomic site Human GRCh37 / hg19: chr2: 166866129-166866451; the second fragment was located at the genomic site Human GRCh37 / hg19: chr2: 166863640-166863903; and the third fragment was located at the genomic site Human GRCh37 / hg19: chr2: 166858882-166859363. The pcDNA3.1 vector was linearized by double digestion with Nhe I and Hind III, and the three insertion fragments were connected together into the pcDNA3.1 vector by homologous recombination. The map of the human SCN1A gene reporter plasmid is shown in Figure 1.
[0114] 2. Murine SCN1A gene reporter plasmid:
[0115] Using C57BL / 6 mouse genomic DNA as a template, three fragments of the SCN1A gene were amplified by PCR, and homologous arms were added. The first fragment was located at the genomic site Mouse GRCm39 / mm39: chr2: 66126997-66127319; the second fragment was located at the genomic site Mouse GRCm39 / mm39: chr2: 66123676-66124739; and the third fragment was located at the genomic site Mouse GRCm39 / mm39: chr2: 66119118-66119599. The pcDNA3.1 vector was linearized by double digestion with Nhe I and Hind III, and the three insertion fragments were connected together into the pcDNA3.1 vector by homologous recombination. The map of the murine SCN1A gene reporter plasmid is shown in Figure 2.
[0116] Example 2 Construction of mSCN1A-Hela stable cell line and detection of gene expression
[0117] Construction of pCAG-mSCN1A-WPRE plasmid: The sequence of SCN1A gene in the SCN1A gene reporter plasmid of mouse origin was amplified by PCR and a homologous arm was added to obtain an insertion fragment. The pCAG-WPRE was linearized by double digestion with NheI and SpeI and the insertion fragment was connected to the vector by homologous recombination to obtain the pCAG-mSCNA-WPRE plasmid.
[0118] According to the conventional cell passage and transfection procedures, the SCN1A expression vector pCAG-mSCNA-WPRE (Figure 3A) and pCMV(CAT)T7-SB100 (Figure 3B) plasmids were co-transfected into Hela cells. After 48 hours of transfection, the screening drug G418 was added and the liquid was changed every two days. When there were no living cells in the untransfected group, the screening of Hela cell strain stably transfected with mouse SCN1A gene was completed and the mSCN1A-Hela stable cell line was obtained.
[0119] The obtained mSCN1A-Hela stable cell line was inoculated in a 24-well cell culture plate and 12 hours later, 20 pmol of positive drug ASO was transfected into the cells by Lipofectamine TM RNAiMAX. After 48 hours of transfection of ASO, the total RNA of the cells was extracted by FastPure Cell / Tissue Total RNA Isolation Kit (manufacturer: Novozyme, product number: RC101-01) according to the instructions. Then the RNA was reverse transcribed to obtain cDNA by HiScript III 1st Strand cDNA Synthesis Kit (+gDNAwiper) (manufacturer: Novozyme, product number: R312-02) according to the instructions. Then 2x Taq PCR StarMix (manufacturer: GenStar, product number: A012) kit was used to perform PCR amplification with cDNA as template using primers Mouse-F: CCCTAAGAGCCTTATCACGATTT (SEQ ID NO: 204) and Mouse-R: TAACAGGGCATTCACAACCA (SEQ ID NO: 205) according to the instructions. The PCR product was subjected to 2% agarose gel electrophoresis and the gel was exposed for detection.
[0120] The results are shown in Figure 4. The mSCN1A-Hela stable cell strain can stably express the mouse SCN1A gene fragment, and there are two kinds of transcription products, respectively, the non-productive transcription product containing the pseudo-exon and the productive transcription product not containing the pseudo-exon. After treatment with the positive drug (SEQ ID NO: 11, the specific sequence is shown in Table 3), the non-productive transcription product is reduced, and the productive transcription product is significantly increased, indicating that the mSCN1A-Hela stable cell strain constructed by the present disclosure can be effectively used to verify the function of the agRNA targeting the pseudo-exon of the mouse SCN1A gene.
[0121] Example 3: Detection of gene expression of SCN1A gene reporter plasmid
[0122] Hela cells were inoculated in a 24-well cell culture plate, and after 12 hours, the reporter plasmid was transfected into the Hela cells using Lipofectamine 3000 reagent, 500 ng of human SCN1A gene reporter plasmid (as shown in Example 1) or mouse SCN1A gene reporter plasmid (as shown in Example 1) was transfected per well, and after 12 hours, the cells were treated with Lipofectamine TM RNAiMAX to transfect 20 pmol of the positive drug into the cells. After 48 hours of treatment with the positive drug (SEQ ID NO: 9, the specific sequence is shown in Table 3), the total RNA of the cells was extracted using the FastPure Cell / Tissue Total RNA Isolation Kit (manufacturer: Novozyme, product number: RC101-01) according to the instructions.
[0123] The RNA was reverse transcribed to obtain cDNA using HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) (manufacturer: Novoprotein, product number: R312-02) according to the instructions. Then, the human SCN1A gene was amplified using 2x Taq PCR StarMix (manufacturer: GenStar, product number: A012) kit according to the instructions, using Human-F: GAGACCTCTAAGAGCCTTATCTCG (SEQ ID NO: 206) and Human-R: TCATGATGGATGGAATTGCT (SEQ ID NO: 207) primer pairs, and the mouse SCN1A gene was amplified using Mouse-F: CCCTAAGAGCCTTATCACGATTT (SEQ ID NO: 204) and Mouse-R: TAACAGGGCATTCACAACCA (SEQ ID NO: 205) primer pairs. The PCR products were subjected to 2% agarose gel electrophoresis and the gel was exposed for detection.
[0124] The experimental results are shown in FIGS. 5 and 6. The human and mouse SCN1A gene reporter plasmids can correctly express the SCN1A gene fragment in cells, and there are two types of transcription products, i.e., a non-productive transcription product containing a pseudo-exon and a productive transcription product not containing a pseudo-exon. After positive drug treatment, the non-productive transcription product decreases and the productive transcription product significantly increases, indicating that the human and mouse SCN1A gene reporter plasmids constructed in the present disclosure can be effectively used to verify the function of agRNA targeting the pseudo-exon of human or mouse SCN1A gene.
[0125] Example 4: Verification of transcriptional expression of SCN1A gene in brain tissue of C57BL / 6 mice
[0126] The brain tissues of adult and day 2 postnatal wild-type C57BL / 6 mice were separated, and then the expression of SCN1A gene was detected according to the method in Example 2.
[0127] The experimental results are shown in FIGS. 7 and 8. The SCN1A gene in the brain tissues of adult and day 2 postnatal wild-type C57BL / 6 mice expresses a non-productive transcription product containing a pseudo-exon and a productive transcription product not containing a pseudo-exon. The expression of non-productive transcription product of SCN1A gene in the brain tissue of adult wild-type C57BL / 6 mice is lower than that of day 2 postnatal wild-type C57BL / 6 mice. The experimental results show that wild-type C57BL / 6 mice can be effectively used to verify the function of agRNA targeting the pseudo-exon of mouse SCN1A gene.
[0128] Example 5: Pseudo-exon sequence of SCN1A gene
[0129] As shown in Table 1, SEQ ID NO: 1 is the pre-mRNA sequence of human SCN1A gene exon 20; SEQ ID NO: 5 is the pre-mRNA sequence of murine SCN1A gene exon 21. SEQ ID NO: 4 is the pre-mRNA of human SCN1A gene pseudo-exon; SEQ ID NO: 8 is the pre-mRNA of murine SCN1A gene pseudo-exon.
[0130] Table 1 Human and murine SCN1A sequences
[0131] Example 6: Verification of the function of agRNA targeting the 3' splice site of human SCN1A gene pseudo-exon in HEK293T-ADAR-OE cells
[0132] 1. HEK293T-ADAR-OE cells overexpressing ADAR protein were seeded in a 48-well cell culture plate, and after 12 hours, human SCN1A gene reporter plasmid (as shown in Example 1) was transfected into the cells using Lipofectamine 3000 reagent, with 250 ng of plasmid transfected per well. After 8 hours of plasmid transfection, 10 pmol of agRNA was transfected into the cells using Lipofectamine TM RNAiMAX, and the control group was not transfected with agRNA. After 48 hours of agRNA transfection, total RNA was extracted from the cells using the FastPure Cell / Tissue Total RNA Isolation Kit according to the instructions. Subsequently, cDNA was reverse transcribed from the RNA according to the instructions of the HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper).
[0133] 2. Real-time fluorescent quantitative PCR detection: using the ChamQ SYBR qPCR Master Mix kit according to the instructions, real-time fluorescent quantitative PCR detection was performed on the cDNA template using the HPrimer1-F and HPrimer1-R primer pairs to detect the expression changes of the SCN1A gene productive transcription product, and using the HPrimer2-F and HPrimer2-R primer pairs to detect the expression changes of the SCN1A gene non-productive transcription product.
[0134] 3. Sanger sequencing sample preparation: The 2x Taq PCR StarMix (manufacturer: GenStar, product number: A012) kit was used according to the instructions to amplify the pre-mRNA of the SCN1A gene using HPrimer3-F and HPrimer3-R primers, and the PCR product was subjected to Sanger sequencing.
[0135] 4. Sanger data RNA editing level measurement: The raw sequencing files obtained by Sanger sequencing need to measure the editing level of the editing site. The EditR software (https: / / moriaritylab.shinyapps.io / editr_v10 / ) is used for calculation and analysis. The software analyzes the peak value of each base of A, T, G, and C in the upstream and downstream regions of the editing site. The calculation method of editing efficiency is 100*(1-A peak / A+T+C+G peak sum).
[0136] Table 2 Primer sequences for detecting human SCN1A gene
[0137] This example designs a series of agRNAs targeting the pre-mRNA of the human SCN1A gene, and the sequences of the regions targeted by the agRNAs are located on the Human GRCh37 / hg19: chr2. The experimental results are shown in Table 3. The results show that the agRNAs designed by the present disclosure to target the 3' splice site of the pseudo-exon of the SCN1A gene can induce RNA editing of the 3' splice site of the pseudo-exon in the pre-mRNA of the SCN1A gene in cells, can induce splicing skipping of the pseudo-exon of the SCN1A gene, increase the expression of the productive SCN1A gene, and reduce the expression of the non-productive SCN1A gene. The agRNAs designed by the present disclosure have better effects than the ASO (SEQ ID NO: 9) of the prior art under the same experimental conditions.
[0138] Table 3 Function verification of agRNAs targeting the 3' splice site of the pseudo-exon of the human SCN1A gene
[0139] Note: The conventional fluorescent quantitative PCR method is used for detection. The "%" in the table means that the expression of the detected gene in the treatment group is the percentage of the control group. For example, 167% means that the expression of the detected gene in the treatment group is 167 times that of the control group.
[0140] Example 7: Verification of the function of agRNAs targeting the 3' splice site of the pseudo-exon of the mouse SCN1A gene in Hela cells
[0141] The mSCN1A-Hela stable cell strain stably expressing SCN1A gene (obtained by the method of Example 2) was inoculated in a 48-well cell culture plate, and 10 pmol of agRNA was transfected into the cells with Lipofectamine TM RNAiMAX 48 hours after transfection of agRNA, the expression of SCN1A gene and the editing of the target site of pre-mRNA of SCN1A gene in the cells were detected according to the method in Example 6.
[0142] The cDNA was used as a template to detect the expression changes of the productive transcription product of SCN1A gene in the cells transfected with the mouse SCN1A gene reporter plasmid by real-time fluorescent quantitative PCR using the ChamQ SYBR qPCR Master Mix kit according to the instructions, using the MPrimer1-F and MPrimer1-R primer pairs. The cDNA was used as a template to detect the expression changes of the non-productive transcription product of SCN1A gene by real-time fluorescent quantitative PCR using the ChamQ SYBR qPCR Master Mix kit according to the instructions, using the MPrimer2-F and MPrimer2-R primer pairs. The cDNA was used as a template to amplify the pre-mRNA of SCN1A gene in the cells transfected with the mouse SCN1A gene reporter plasmid and detect the editing efficiency of the target site using the 2x Taq PCR StarMix kit according to the instructions, using the MPrimer3-F and MPrimer3-R primer pairs.
[0143] Table 4 Sequences of primers for detecting mouse SCN1A gene
[0144] The experimental results are shown in Table 5, and the results show that the agRNAs designed by the disclosure to target the 3' splice site of the pseudo-exon of SCN1A gene can all induce RNA editing of the 3' splice site of the pseudo-exon in the pre-mRNA of the endogenously expressed SCN1A gene in cells, and can all induce splicing skipping of the pseudo-exon of SCN1A gene in cells, increase the expression of the productive SCN1A gene, and reduce the expression of the non-productive SCN1A gene.
[0145] Table 5 Functional verification of agRNAs targeting the 3' splice site of the pseudo-exon of the mouse SCN1A gene
[0146] The calculation method of the values in this table is the same as that in Table 3.
[0147] Example 8: Verification of the function of agRNAs targeting the 3' splice site of the pseudo-exon of SCN1A gene in C57BL / 6 mice
[0148] A single intracerebroventricular (ICV) injection was administered to C57BL / 6 mice on the second day after birth by a stereotaxic apparatus injection system, wherein 20 μg of agRNA was injected into each mouse in the administration group, and 3 mice were injected in each group; the control group was injected with the same volume of vehicle (PBS) per mouse, and 3 mice were injected in each group. The mice were anesthetized and sacrificed on the 13th day after administration, and the mouse brain tissue was isolated, and the expression of the SCN1A gene in the brain tissue was detected according to the method in Example 7.
[0149] The experimental results are shown in Table 6, and the results show that the agRNA designed by the present disclosure to target the 3' splice site of the pseudo-exon of the SCN1A gene can induce the splicing jump of the pseudo-exon of the SCN1A gene in the brain tissue of the mouse in vivo, increase the expression of the productive SCN1A gene, and reduce the expression of the non-productive SCN1A gene.
[0150] Table 6 Verification of the function of agRNA targeting the 3' splice site of the pseudo-exon of the SCN1A gene in C57BL / 6 mice
[0151] The numerical values in this table are calculated in the same way as in Table 3.
[0152] Example 9 Verification of the editing efficiency of agRNA targeting the 3' splice site of the pseudo-exon of the SCN1A gene in Hela cells
[0153] The mSCN1A-Hela stable cell strain stably expressing the SCN1A gene (constructed according to the method of Example 1) was inoculated in a 48-well cell culture plate, and 10 pmol of agRNA was transfected into the cells with Lipofectamine TM RNAiMAX 12 hours later, wherein the control group was not transfected with agRNA. After 48 hours of transfection of agRNA, the editing of the target site of the pre-mRNA of the SCN1A gene in the cells was detected according to the method in Example 7. The 2x Taq PCR StarMix kit was used according to the instruction steps to amplify the pre-mRNA of the SCN1A gene in the transfected mouse SCN1A gene reporter plasmid cells using the MPrimer3-F and MPrimer3-R primers, and the editing efficiency of the target site was detected.
[0154] The experimental results are shown in Figure 9, and the results show that the agRNAs designed by the present disclosure to target the 3' splice site of the SCN1A gene pseudo-exon can all induce RNA editing of the 3' splice site of the pseudo-exon in the endogenous SCN1A gene pre-mRNA in cells.
[0155] Example 10 Functional verification of plasmid-expressed agRNA
[0156] The foregoing examples are all synthesized by chemical synthesis. Whether the agRNAs targeting the 3' splice site of the SCN1A gene pseudo-exon synthesized in vivo have the same function on the SCN1A gene pseudo-exon remains to be further verified. In this embodiment, three sequences of SEQ ID NO: 201, SEQ ID NO: 202 and SEQ ID NO: 203 are synthesized by gene synthesis, as shown in Table 7 below.
[0157] Table 7
[0158] The pC0043-U6-circle vector is linearized by double digestion with Kpnl and Xhol, and the above synthesized DNA fragments are respectively connected to the pC0043-U6-circle vector by homologous recombination. Three plasmids of pC0043-U6-SCN1A-51nt-circle, pC0043-U6-SCN1A-101nt-circle and pC0043-U6-SCN1A-151nt-circle are obtained, and the plasmid maps are shown in Figure 10.
[0159] The mRNA expressed in cells by the plasmid pC0043-U6-SCN1A-51 nt-circle is circularized by the ribozyme to form a circular mRNA, wherein the gRNA with a length of 51 nt can target the region of the SCN1A gene at the genomic site Mouse GRCm39 / mm39: chr2: 66124216-66124266; the mRNA expressed in cells by the plasmid pC0043-U6-SCN1A-101 nt-circle is circularized by the ribozyme to form a circular mRNA, wherein the gRNA with a length of 101 nt can target the region of the SCN1A gene at the genomic site Mouse GRCm39 / mm39: chr2: 66124191-66124291; the mRNA expressed in cells by the plasmid pC0043-U6-SCN1A-51 nt-circle is circularized by the ribozyme to form a circular mRNA, wherein the gRNA with a length of 151 nt can target the region of the SCN1A gene at the genomic site Mouse GRCm39 / mm39: chr2: 66124166-66124316.
[0160] The mSCN1A-Hela stable cell strain stably expressing the SCN1A gene was inoculated in a 24-well cell culture plate, and after 12 hours, the above three plasmids were transfected into the cells using Lipofectamine 3000 reagent, 500 ng per well, three biological replicates per group, and the control group was transfected with pC0043-U6 empty plasmid. After 48 hours of transfection, the expression of the SCN1A gene in the cells and the editing of the pre-mRNA target site of the SCN1A gene were detected according to the method in Example 6.
[0161] The experimental results are shown in Figure 11, and the results show that by using plasmid vectors to biosynthesize agRNAs of different lengths targeting the 3' splice site of the pseudo-exon of the SCN1A gene in cells, RNA editing of the 3' splice site of the pseudo-exon in the pre-mRNA of the SCN1A gene can be induced in cells (Figure 11D and Figure 11E), pseudo-exon splicing skipping of the SCN1A gene can be induced in cells (Figure 11A), expression of the productive SCN1A gene can be increased (Figure 11B), and expression of the non-productive SCN1A gene can be reduced (Figure 11C). And from the results, the longer the expressed agRNA, the higher the RNA editing efficiency of the 3' splice site of the pseudo-exon in the pre-mRNA of the SCN1A gene induced by the agRNA, and the better the pseudo-exon splicing skipping effect mediated by the agRNA.
[0162] Example 11 Disruption of the 3' splice site promotes splicing skipping of the exon in the pre-mRNA
[0163] The 3' splice site AG / GATA sequence of the pseudo-exon (Exon20N) in the wild-type SCN1A gene reporter plasmid was mutated to GG / GATA by PCR site-directed mutation method to obtain a mutant SCN1A gene reporter plasmid. Through gene expression detection of the mutant reporter plasmid, the influence of RNA editing mediated by ADAR proteinase on the splicing of the pseudo-exon or exon after editing A base to I base to destroy the 3' splice site in vivo was simulated.
[0164] HEK293T cells were seeded in a 24-well cell culture plate, and 12 hours later, wild-type and mutant human SCN1A gene reporter plasmids were transfected into HEK293T cells using Lipofectamine 3000 reagent, 500 ng of plasmid per well. After 24 hours of plasmid transfection, total RNA was extracted from the cells using the FastPure Cell / Tissue Total RNA Isolation Kit (manufacturer: Novozyme, catalog number: RC101-01) according to the instructions. Then the RNA was reverse transcribed to obtain cDNA using the HiScript III 1st Strand cDNA Synthesis Kit (+gDNAwiper) (manufacturer: Novozyme, catalog number: R312-02) according to the instructions.
[0165] The 2x Taq PCR StarMix (manufacturer: GenStar, catalog number: A012) kit was used according to the instructions, and the cDNA was used as the template, and the SCN1A gene was amplified using Primer4-F and Primer4-R primers. The PCR product was subjected to 2% agarose gel electrophoresis and the gel was exposed for detection, and the experimental results are shown in Figure 12A.
[0166] The ChamQ SYBR qPCR Master Mix kit was used according to the instructions, and the cDNA was used as the template, and the SCN1A gene production transcription product expression change was detected by real-time fluorescent quantitative PCR using Primer5-F and Primer5-R primer pairs, and the experimental results are shown in Figure 12B; the SCN1A gene non-productive transcription product expression change was detected by real-time fluorescent quantitative PCR using Primer6-F and Primer6-R primer pairs, and the experimental results are shown in Figure 12C.
[0167] Table 8 SCN1A gene detection primer sequences
[0168] Experimental results: as shown in Figure 12, when the 3' splice site AG / GATA sequence of the SCN1A pseudo-exon is mutated to GG / GATA, the pseudo-exon is skipped in the splicing process of pre-mRNA, the expression of the productive transcription product in the mutant reporter plasmid is greatly up-regulated compared with the wild type, and the expression of the non-productive transcription product is greatly down-regulated compared with the wild type. The experimental results show that the destruction of the 3' splice site of the exon or pseudo-exon can effectively promote the splicing skipping of the exon or pseudo-exon.
Claims
1. Use of an antisense oligonucleotide guide RNA in the manufacture of a medicament for altering the expression of a target protein by a cell of a subject, characterized in that, The cell has a precursor mRNA encoding the target protein, wherein the precursor mRNA comprises an intron, an exon flanking the 5' splice site of the intron, and an exon flanking the 3' splice site or pseudo 3' splice site of the intron; The antisense oligonucleotide guide RNA is capable of binding to the precursor mRNA to form a structure capable of recruiting ADAR in the cell, thereby forming a complex containing ADAR protein; and the target protein is a Nav1.1 protein.
2. A method of altering the expression of a target protein by a cell of a subject, wherein, The method comprises contacting the cell with an antisense oligonucleotide guide RNA; The cell has a precursor mRNA encoding the target protein, wherein the precursor mRNA comprises an intron, an exon flanking the 5' splice site of the intron, and an exon flanking the 3' splice site or pseudo 3' splice site of the intron; the antisense oligonucleotide guide RNA is capable of binding to the precursor mRNA to form a structure capable of recruiting ADAR in the cell, thereby forming a complex containing ADAR protein; and the target protein is a Nav1.1 protein.
3. The use as claimed in claim 1, or the method as claimed in claim 2, wherein, The antisense oligonucleotide guide RNA is capable of recruiting ADAR to the 3' splice site or pseudo 3' splice site to edit the A base of the 3' splice site or pseudo 3' splice site, thereby splicing the entire exon flanking the 3' splice site or pseudo 3' splice site of the intron from the precursor mRNA to cause the exon to skip, thereby changing the expression level or sequence composition of the mature mRNA encoding the target protein, and changing the expression level or function of the target protein in the cell; Preferably, the antisense oligonucleotide guide RNA is unmodified or has modifications; Preferably, the modifications comprise backbone modifications, sugar modifications, or base modifications; Preferably, the modified bases include 2'-MOE modified bases, phosphorothioate bond modified bases, locked nucleic acid modified bases, 2'-F modified bases, 2'-MOE modified 5 methyl bases, 2'-OMe modified 5 methyl bases, 2'-OMe modified bases, 5 methyl modified bases, LNA modified 5 methyl bases, 2'-F modified 5 methyl bases, S-GNA modified bases, 2'F-ANA modified bases, INV modified bases, L-DNA modified bases, cET modified modified bases, or UNA modified bases; Preferably, the 5' splice site has a common NNN / GUNNNN or NNN / GCNNNN motif; Preferably, the 3' splice site or pseudo 3' splice site has a common NAG / N motif; Preferably, the "N" is one of A, U, G, C, or I base, and " / " is an exon-intron boundary; Preferably, the adenine in the NAG / N sequence of the 3' splice site or pseudo 3' splice site is edited by ADAR; Preferably, the ADAR editing is ADAR-mediated A-to-I editing; Preferably, the ADAR is selected from ADAR1 or ADAR2; Preferably, the antisense oligonucleotide guide RNA can mutate the A in the NAG / N of the 3' splice site or pseudo 3' splice site of the pre-mRNA to I after forming a complex capable of recruiting ADAR after binding to the pre-mRNA; Preferably, the antisense oligonucleotide guide RNA is fully complementary or incompletely complementary to the pre-mRNA; Preferably, the incomplete base complementary pairing is a complementary pairing with one or more mismatches, wobbles, deletions, and / or bulges in the target region; Preferably, the antisense oligonucleotide guide RNA has at least one mismatch with the pre-mRNA; Preferably, the base in the antisense oligonucleotide guide RNA that binds to the A base of the 3' splice site or pseudo 3' splice site is one of C, A, G, U or a base derivative thereof; Preferably, the base in the antisense oligonucleotide guide RNA that binds to the A base of the 3' splice site or pseudo 3' splice site is C or a base derivative thereof; Preferably, the double-stranded RNA formed by the antisense oligonucleotide guide RNA and the pre-mRNA is an incomplete base complementary pairing.
4. The use or the method of claim 3, wherein, The complementary strand is base complementary pairing at non-mismatch or non-deletion or non-bulge or non-inner loop or non-wobble base pairing sites; Preferably, the proportion of complementary paired bases in the double-stranded RNA formed by the antisense oligonucleotide guide RNA and the pre-mRNA is greater than 60%; Preferably, the proportion of complementary paired bases in the double-stranded RNA formed by the antisense oligonucleotide guide RNA and the pre-mRNA is greater than 75%; Preferably, the antisense oligonucleotide guide RNA can bind to the pre-mRNA to form a complex connected with ADAR protein, and then edit the pre-mRNA, with an editing efficiency of greater than 1%.
5. The use as claimed in claim 1, or the method as claimed in claim 2, wherein, The position of the antisense oligonucleotide guide RNA targeting the pre-mRNA is within the region of 1000bp upstream to 1000bp downstream relative to the 3' splice site or pseudo 3' splice site; Preferably, the position of the antisense oligonucleotide guide RNA targeting the pre-mRNA is within the region of 500bp upstream to 500bp downstream relative to the 3' splice site or pseudo 3' splice site; Preferably, the position of the antisense oligonucleotide guide RNA targeting the pre-mRNA is within the region of 100bp upstream to 100bp downstream relative to the 3' splice site or pseudo 3' splice site; Preferably, the sequence length of the antisense oligonucleotide guide RNA is 10-300bp; Preferably, the sequence length of the antisense oligonucleotide guide RNA is 20-150bp; Preferably, the sequence length of the antisense oligonucleotide guide RNA is 20-100bp; Preferably, the sequence length of the antisense oligonucleotide guide RNA is 20-70bp; Preferably, the sequence of the antisense oligonucleotide guide RNA is selected from the sequences shown in SEQ ID NO: 10-200, SEQ ID NO: 217-222, or, Preferably, the sequence of the antisense oligonucleotide guide RNA is selected from the sequences shown in SEQ ID NO: 10-200, SEQ ID NO: 217-222, or, a sequence having at least 80% or at least 81% or at least 82% or at least 83% or at least 84% or at least 85% or at least 86% or at least 87% or at least 88% or at least 89% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99% or at least 99.5% or at least 99.8% or at least 99.9%, or 100% sequence identity with any one of the antisense oligonucleotide guide RNA sequences contained in the sequences expressed by the vectors containing any one of the sequences of SEQ ID NOs: 201-203; Preferably, the drug is a drug for treating Dravet syndrome.
6. An antisense oligonucleotide guide RNA, wherein, a sequence having at least 80% or at least 81% or at least 82% or at least 83% or at least 84% or at least 85% or at least 86% or at least 87% or at least 88% or at least 89% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99% or at least 99.5% or at least 99.8% or at least 99.9%, or 100% sequence identity with any one of the antisense oligonucleotide guide RNA sequences contained in the sequences expressed by the vectors containing any one of the sequences of SEQ ID NOs: 201-203, Preferably, the antisense oligonucleotide guide RNA is unmodified or has modifications; Preferably, the antisense oligonucleotide guide RNA comprises backbone modifications, sugar modifications, or base modifications; Preferably, the modified base comprises a 2’-MOE modified base, a phosphorothioate bond modified base, a locked nucleic acid modified base, a 2’-F modified base, a 2’-MOE modified 5 methyl base, a 2’-OMe modified 5 methyl base, a 2’-OMe modified base, a 5 methyl modified base, a LNA modified 5 methyl base, a 2’-F modified 5 methyl base, a S-GNA modified base, a 2’F-ANA modified base, an INV modified base, a L-DNA modified base, a cET modified modified base, or a UNA modified base.
7. A vector, wherein, the vector comprises a polynucleotide encoding or comprising the antisense oligonucleotide guide RNA of claim 6; Preferably, the vector is a recombinant expression vector; Preferably, the vector comprises a plasmid or a viral vector; Preferably, the vector is a delivery vector; Preferably, the vector is a plasmid or a viral vector for expression in a higher eukaryotic cell or a prokaryotic cell.
8. A composition comprising a plasmid or viral vector comprising a polynucleotide encoding or comprising an antisense oligonucleotide guide RNA, wherein, the antisense oligonucleotide guide RNA binds to a targeted portion of a pre-mRNA encoding a Nav1.1 protein; the antisense oligonucleotide guide RNA comprises a sequence as set forth in SEQ ID NOs: 10-200, SEQ ID NOs: 217-222, or, the antisense oligonucleotide guide RNA sequence contained in a sequence expressed from a vector comprising any one of SEQ ID NOs: 201-203 has at least 80% or at least 81% or at least 82% or at least 83% or at least 84% or at least 85% or at least 86% or at least 87% or at least 88% or at least 89% or at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99% or at least 99.5% or at least 99.8% or at least 99.9% or 100% sequence identity to any one of the sequences, Preferably, when the antisense oligonucleotide guide RNA is introduced into a cell having a pre-mRNA encoding the Nav1.1 protein, the antisense oligonucleotide guide RNA increases the level of expression of the treated Nav1.1 protein-encoding in the cell.
9. The host cell of claim 8, wherein, comprising the antisense oligonucleotide guide RNA of claim 6, the vector of claim 7, or the composition of claim 8.
10. A pharmaceutical composition, wherein, which comprises the antisense oligonucleotide guide RNA of claim 6 and a pharmaceutically acceptable excipient.
11. A method of treating a disease in a subject in need thereof by altering the expression of a target protein or functional RNA by a cell of the subject, wherein, comprising contacting a cell of a subject with the antisense oligonucleotide guide RNA of claim 6, the vector of claim 7, or the composition of claim 8, or the host cell of claim 9 or the pharmaceutical composition of claim 10; Preferably, the disease of the subject in need comprises a disease or disorder associated with abnormal expression of the SCN1A gene; Preferably, the disease comprises Dravet syndrome; Preferably, the cell has a pre-mRNA encoding a target protein Nav1.1, wherein the pre-mRNA comprises an intron, an exon flanked by a 5' splice site of the intron, and an exon flanked by a 3' splice site or a pseudo 3' splice site of the intron; Preferably, the antisense oligonucleotide guide RNA is capable of binding to the pre-mRNA to form a structure capable of recruiting ADAR in the cell, thereby forming a complex containing ADAR protein; Preferably, the antisense oligonucleotide guide RNA is capable of recruiting ADAR to the 3' splice site or the pseudo 3' splice site to edit the A base of the 3' splice site or the pseudo 3' splice site, thereby splicing the entire exon flanked by the 3' splice site or the pseudo 3' splice site of the intron from the pre-mRNA to cause the exon skipping, thereby altering the level or sequence of the mature mRNA encoding the target protein, and altering the expression level or function of the target protein in the cell; Preferably, the 5' splice site has a consensus NNN / GUNNNN or NNN / GCNNNN motif; Preferably, the 3' splice site or the pseudo 3' splice site has a consensus N / AGN motif; Preferably, the "N" is any base, and " / " is the exon-intron boundary. Preferably, the adenine in the 3' splice site or pseudo 3' splice site N / AGN sequence is edited by ADAR; Preferably, the ADAR editing is ADAR-mediated A-to-I editing; Preferably, the ADAR is selected from ADAR1 or ADAR2; Preferably, the antisense oligonucleotide guide RNA, after binding to the pre-mRNA, forms a complex capable of recruiting ADAR, which is capable of mutating the A in the NAG / N of the 3' splice site or pseudo 3' splice site of the pre-mRNA to I.