Method of treating social deficits with class i HDAC inhibitors

Class I HDAC inhibitors address chlorpyrifos-induced social deficits by upregulating neuronal and circadian genes, offering a treatment for ASD symptoms through targeted administration.

WO2026072622A1PCT designated stage Publication Date: 2026-04-02UNIV OF WASHINGTON
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/047653
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2025-03-11
Filing Date
2025-09-24
Publication Date
2026-04-02

AI Technical Summary

Technical Problem

Chronic exposure to chlorpyrifos, an organophosphate pesticide, is associated with significant developmental and neurological challenges, particularly increased risk of autism spectrum disorder (ASD), due to its impact on the gut microbiome and epigenetic dysregulation, with unclear mechanisms underlying these effects.

Method used

Administering therapeutically effective amounts of Class I HDAC inhibitors such as valproic acid, butyric acid, BRD-6929, RGFP966, or their pharmaceutically acceptable salts to treat organophosphate-induced social deficits, including ASD, by targeting specific HDAC enzymes like HDAC1 and HDAC3.

Benefits of technology

The HDAC inhibitors effectively rescue social deficits in zebrafish models of chlorpyrifos exposure, upregulating key neuronal and circadian genes, and reversing the downregulation caused by chlorpyrifos, providing a potential treatment for ASD-like symptoms.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025047653_02042026_PF_FP_ABST
    Figure US2025047653_02042026_PF_FP_ABST
Patent Text Reader

Abstract

The present technology generally relates to methods of treating social deficits with HDAC inhibitors. Select embodiments of the present technology include a method for treating organophosphate induced social deficits in a subject, comprising administering to a subject in need thereof a therapeutically effective amount of an HDAC inhibitor selected from the group consisting of valproic acid, butyric acid, BRD-6929, RGFP966, pharmaceutically acceptable salts thereof, and combinations thereof. The subject may have been diagnosed with a disease or disorder characterized by social deficits, such as autism spectrum disorder. The subject may be monitored for a change in the severity of social deficits.
Need to check novelty before this filing date? Find Prior Art

Description

METHOD OF TREATING SOCIAL DEFICITS WITH CLASS I HDAC INHIBITORS CROSS-REFERENCE TO RELATED APPLICATION

[0001] This application claims the benefit of U.S. Application No. 63 / 698856, filed on September 25, 2024, and U.S. Application No. 63 / 770221, filed on March 11, 2025, the disclosures of which are hereby incorporated by reference in their entireties. STATEMENT OF GOVERNMENT LICENSE RIGHTS

[0002] This invention was made with government support under Grant No. 5R25ES025503 and R00ES031050, awarded by the National Institutes of Environmental Health Sciences (NIEHS). The government has certain rights in the invention. STATEMENT REGARDING SEQUENCE LISTING

[0003] The Sequence Listing XML associated with this application is provided in XML format and is hereby incorporated by reference into the specification. The name of the XML file containing the Sequence Listing is 3915- P1371WO.UW_Sequence_Listing.xml. The XML file is 33,483 bytes; was created on September 23, 2025; and is being submitted electronically via Patent Center with the filing of the Specification. BACKGROUND

[0004] Chlorpyrifos (CPF) is an organophosphate pesticide critical for agricultural pest management, being used in ~100 countries on 8.5 million acres of crop annually. Its primary mechanism of action involves the inhibition of acetylcholinesterase, which results in acetylcholine accumulation and continuous nerve stimulation, leading to its acute toxicity. Beyond its immediate physiological effects, CPF poses significant environmental risks due to its persistence in soil and water ecosystems, potentially harming non-target species including beneficial insects, birds, aquatic life, and mammals. Recognizing these substantial health and environmental concerns, the Environmental Protection Agency (EPA) has initiated steps to phase out CPF in food production, underscoring the growing scientific consensus about its potential hazards. However, CPF has been continually applied to non-food agriculture, industry, and household uses. In addition to CPF, approximately 40 other organophosphate pesticides remain widely used but are not regulated.3915-P1371WO.UW -1-

[0005] While the acute toxicity of CPF as an acetylcholinesterase (AChE) inhibitor has been well-characterized, the long-term health implications of chronic CPF exposure are not well understood. Chronic CPF exposure has been associated with significant developmental and neurological challenges, particularly in children. Epidemiological studies have documented potential links between CPF exposure and decreased cognitive function, including lower IQ scores and developmental delays. Of particular concern is the growing body of evidence suggesting a correlation between CPF exposure and increased risk of autism spectrum disorder (ASD). This potentially contributes to the estimated 40% of autism risk believed to be caused by environmental factors.

[0006] The potential mechanism underlying this relationship may be linked to CPF's impact on the gut microbiome. Exposure to CPF has been shown to induce dysbiosis, or microbial imbalance, in the gastrointestinal tract. Pesticide-induced gut dysbiosis is increasingly recognized as a potential contributing factor to neurodevelopmental disorders, including ASD. Disruptions in the microbiome can alter metabolite production, which may subsequently influence neurodevelopment through various mechanisms. The gut microbiome metabolite butyrate, for example, is a histone deacetylase (HDAC) inhibitor. HDAC inhibitors such as valproic acid can modulate gene expression by preventing the removal of acetyl groups from histones and thereby influencing neurodevelopmental processes. This mechanism is particularly intriguing in the context of ASD, where epigenetic dysregulation is increasingly recognized as a relevant factor. For example, histone acetylation, a key epigenetic process, has been implicated in ASD pathogenesis.

[0007] Despite these emerging insights, significant knowledge gaps persist. The precise mechanisms by which CPF contributes to ASD remain unclear, and the role of gut microbiome metabolites and epigenetics in CPF-induced neurodevelopmental toxicity remains poorly understood. Accordingly, a need exists for new treatments for organophosphate induced social deficits such as those associated with ASD. The present disclosure seeks to fulfill this need and provides further related advantages. SUMMARY

[0008] In one aspect, the present disclosure provides a method for treating organophosphate induced social deficits in a subject, comprising administering to a subject in need thereof a therapeutically effective amount of an HDAC inhibitor selected from the3915-P1371WO.UW -2-group consisting of valproic acid, butyric acid, BRD-6929, RGFP966, pharmaceutically acceptable salts thereof, and combinations thereof.

[0009] In some embodiments, the HDAC inhibitor is valproic acid, or a pharmaceutically acceptable salt thereof. In some embodiments, the HDAC inhibitor is butyric acid, or a pharmaceutically acceptable salt thereof. In some embodiments, the HDAC inhibitor is sodium butyrate. In some embodiments, the HDAC inhibitor is BRD- 6929, or a pharmaceutically acceptable salt thereof. In some embodiments, the HDAC inhibitor is RGFP966, or a pharmaceutically acceptable salt thereof.

[0010] In some embodiments, the subject has been diagnosed with a disease or disorder characterized by social deficits. In some embodiments, the disease or disorder characterized by social deficits is autism spectrum disorder. In some embodiments, the subject does not have a second condition that requires treatment with the HDAC inhibitor. In some embodiments, the method further includes monitoring the subject for a change in the severity of social deficits.

[0011] In some embodiments, administering to a subject in need thereof comprises oral administration. In some embodiments, administering to a subject in need thereof comprises cranial or spinal administration. In some embodiments, administering to a subject in need thereof comprises administering with an administration frequency selected from the group consisting of daily administration, weekly administration, biweekly administration, and monthly administration.

[0012] In some embodiments, the subject is a human. DESCRIPTION OF THE DRAWINGS

[0013] The foregoing aspects and many of the attendant advantages of this invention will become more readily appreciated as the same become better understood by reference to the following detailed description, when taken in conjunction with the accompanying drawings.

[0014] FIGURE 1A shows that chlorpyrifos (CPF) induced social deficits through embryonic exposure in a dose-dependent manner. CPF's effects were significant from 10-17.5 μM and peaked at 15 μM. Significance was calculated by one-way ANOVA and Dunnett's multiple comparison test. *p< 0.05, ***p< 0.001, ****p<0.0001.

[0015] FIGURE 1B shows that gut microbial metabolites were tested at 10 μM for their abilities to rescue social deficits. Dots represent the social scores of individual fish. Sodium butyrate effectively rescued social deficits induced by 15 μM CPF. UDCA:3915-P1371WO.UW -3-ursodeoxycholic acid; IPA: indole-3-propionic acid; CDCA: chenodeoxycholic acid. Significance was calculated by one-way ANOVA and Dunnett's multiple comparison test. **p< 0.01, ***p< 0.001.

[0016] FIGURE 1C shows that sodium butyrate rescued social deficits induced by CPF in a dose-dependent manner. Significant rescue was observed at 10 μM. Significance was calculated by one-way ANOVA and Dunnett's multiple comparison test. *p< 0.05.

[0017] FIGURE 2A shows Class I HDAC inhibition phenocopies butyrate's rescue effect. Valproic acid (VPA) but not trichostatin A (TSA) or nicotinamide (NAM) rescued social deficits induced by CPF. VPA is an inhibitor of classes I and IIa HDACs, TSA inhibits classes I, II, and IV HDACs, and NAM is an inhibitor of class III (sirtuins) HDACs. Significance was calculated by one-way ANOVA and Dunnett's multiple comparison test. *p< 0.05, ****p<0.0001.

[0018] FIGURE 2B shows CRISPR-Cas9 induced F0 knockout (KO) of zebrafish class I HDACs (HDAC-I) rescued social deficits induced by CPF. This experiment shares the same DMSO and CPF controls with the HDAC1 KO experiment in Figure 3A. Significance was calculated by two-way ANOVA with Fisher's LSD test for post hoc analysis. ****p<0.0001.

[0019] FIGURE 2C shows CRISPR-Cas9 induced F0 KO of zebrafish class IIa HDACs (HDAC-IIa) failed to rescue social deficits induced by CPF. Significance was calculated by two-way ANOVA with Fisher's LSD test for post hoc analysis. ns: not significant, *p< 0.05.

[0020] FIGURE 3A shows selective inhibition of HDAC1 effectively rescues CPF-induced social deficit. CRISPR-Cas9 induced F0 knockout (KO) of the zebrafish hdac1 gene robustly rescued social deficits induced by CPF (CPF+hdac1 KO). Social behavior in DMSO control was also significantly boosted by hdac1 KO (DMSO+hdac1 KO). This experiment shares the same DMSO and CPF controls with the HDAC-I KO experiment shown in FIGURE 2B. Significance was calculated by two-way ANOVA with Fisher's LSD test for post hoc analysis. **p<0.01, ****p<0.0001.

[0021] FIGURE 3B shows that knocking out the zebrafish hdac3 gene modestly rescued social deficits induced by CPF (CPF+hdac3 KO). Significance was calculated by two-way ANOVA with Fisher's LSD test for post hoc analysis. *p<0.05.3915-P1371WO.UW -4-

[0022] FIGURE 3C shows that knocking out the zebrafish hdac8 gene rescued social deficits induced by CPF (CPF+hdac8 KO). Significance was calculated by two-way ANOVA with Fisher's LSD test for post hoc analysis. **p<0.01, ***p<0.001.

[0023] FIGURE 3D shows dose dependent rescue of CPF-induced social deficits following overnight exposures of BRD-6929, a selective inhibitor of HDAC1 (HDAC1i). The open dot marks the DMSO control. The HDAC1 inhibitor BRD-6929 robustly rescued CPF-induced social deficit in a dose-responsive manner. Significance was calculated by one-way ANOVA and Dunnett's multiple comparison test. *p<0.05.

[0024] FIGURE 3E shows dose dependent rescue of CPF-induced social deficits following overnight exposure to RGFP966, a selective inhibitor of HDAC3 (HDAC3i). The open dot marks the DMSO control. The HDAC3 inhibitor RGFP966 modestly rescued social deficit in a dose-responsive manner. Significance was calculated by one-way ANOVA and Dunnett's multiple comparison test. *p<0.05.

[0025] FIGURE 3F shows does dependent rescue of CPF-induced social deficits following overnight exposure to PCI-34051, a selective inhibitor of HDAC8 (HDAC8i). The open dot marks the DMSO control. The HDAC8 inhibitor PCI-34051 failed to rescue CPF-induced social deficit. Significance was calculated by one-way ANOVA and Dunnett's multiple comparison test.

[0026] FIGURE 4A shows that Gene Set Enrichment Analysis (GSEA) of RNA- seq data using Gene Ontology's (GO) Biological Process (BP) terms identified 13 pathways (arrows) related to neuronal projection, synaptogenesis, and learning among the top 20 downregulated pathways in CPF-treated samples as compared to the DMSO control samples. Significantly downregulated pathways (p < 0.05) are ranked by Normalized Enrichment Score (NES).

[0027] FIGURE 4B shows butyrate partially rescues a sustained downregulation of neuronal genes induced by early exposure to CPF through a comparison of the average normalized expressions of 30 neuronal hub genes. Neuronal hub genes are significantly downregulated in CPF:No-SB samples compared to the DMSO:No-SB controls. Butyrate (SB) significantly upregulated the expression of neuronal hub genes in CPF-treated fish (CPF:SB), although not enough to match the level of expression in DMSO:No-SB control samples. Gene expression levels are not significantly different in CPF:SB samples as compared to DMSO:SB samples. Lines between treatment groups connect expression levels of the same gene. Significance was calculated by two-way ANOVA with Tukey's3915-P1371WO.UW -5-multiple comparison test. ns: not significant, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

[0028] FIGURE 5A shows early CPF exposure upregulates circadian pathways. Gene Set Enrichment Analysis (GSEA) of RNA-seq data using Gene Ontology's (GO) Biological Process (BP) terms is provided. Showing the top 20 upregulated pathways in CPF-treated samples as compared to the DMSO control samples, among which 5 are related to circadian regulation (arrows). Significantly upregulated pathways (p < 0.05) are ranked by Normalized Enrichment Score (NES).

[0029] FIGURE 5B shows early CPF exposure induces sustained overexpression of important circadian genes through a volcano plot showing the RNA-seq result comparing gene expression in CPF-treated samples and DMSO control samples.11 of the top 21 significantly upregulated genes (ranked by adjusted p value) are circadian genes.

[0030] FIGURE 5C shows a quantitative PCR analyses conducted using samples from an independent experimental replicate validated RNA-seq results by confirming upregulation of key circadian genes following embryonic exposure to CPF. CPF-treated fish and DMSO control fish were dissected at the exact same time during the day by two experimenters working side-by-side. Significance was calculated by two-tailed Student's t test. *p< 0.05, **p<0.01, ***p<0.001, ****p<0.0001.

[0031] FIGURE 6A shows nitrogen metabolism-related pathways in the juvenile zebrafish gut are selectively impacted by early CPF exposure. Enrichment analyses detected changes in gut metabolomic pathways in CPF-treated fish compared to DMSO control fish, based on untargeted metabolomics analysis of gastrointestinal tissues and gut contents. Surveying the RaMP-DB databases consistently identified urea cycle, arginine metabolism, and aspartate metabolism among the top enriched pathways (arrows). Both arginine and aspartate are intermediate metabolites of the urea cycle. Changes in nitric oxide (NO) metabolism and nitric oxide synthase (NOS) activity were detected. Shade coding represents levels of significance (p value). The size of each dot represents enrichment ratio.

[0032] FIGURE 6B shows nitrogen metabolism-related pathways in the juvenile zebrafish gut are selectively impacted by early CPF exposure. Enrichment analyses detected changes in gut metabolomic pathways in CPF-treated fish compared to DMSO control fish, based on untargeted metabolomics analysis of gastrointestinal tissues and gut contents. Surveying the SMPDB databases consistently identified urea cycle, arginine3915-P1371WO.UW -6-metabolism, and aspartate metabolism among the top enriched pathways (arrows). Both arginine and aspartate are intermediate metabolites of the urea cycle. Shade coding represents levels of significance (p value). The size of each dot represents enrichment ratio.

[0033] FIGURE 6C shows nitrogen metabolism-related pathways in the juvenile zebrafish gut are selectively impacted by early CPF exposure. Enrichment analyses detected changes in gut metabolomic pathways in CPF-treated fish compared to DMSO control fish, based on untargeted metabolomics analysis of gastrointestinal tissues and gut contents. Surveying the KEGG databases consistently identified urea cycle, arginine metabolism, and aspartate metabolism among the top enriched pathways (arrows). Both arginine and aspartate are intermediate metabolites of the urea cycle. Shade coding represents levels of significance (p value). The size of each dot represents enrichment ratio.

[0034] FIGURE 6D shows an enrichment analysis comparing metabolomic changes between CPF+SB and CPF samples based on untargeted metabolomics analysis of gastrointestinal tissues and gut contents. Pathways related to the urea cycle, arginine metabolism, and aspartate metabolism (arrows) were identified by surveying SMPDB.

[0035] FIGURE 7A shows ȕ coefficient estimates and significance for the 10 species with the largest beta values (log fold change) and the 10 species with the smallest beta values. ȕ coefficients are calculated for the test between CPF and DMSO samples. Error bars represent the confidence interval of each coefficient. Shading denotes false discovery rate (FDR). There are a total of 139 significant species, only the 20 with the most extreme beta values are shown in this plot.

[0036] FIGURE 7B shows nitrite concentration was significantly elevated in 6 dpf zebrafish larvae following embryonic (0-3 dpf) treatment of CPF. n=85 larvae per condition. Significance was calculated by two-tailed Student's t test. **p<0.01.

[0037] FIGURE 8A shows a schematic demonstration of the NO-HDAC hypothesis. Chlorpyrifos (CPF) exposure increases the abundance of the denitrifying bacteria Pseudomonas in the gut microbiome, enhancing the production of nitric oxide (NO) in the gut through the denitrification pathway. CPF is also known to stimulate NO production by activating eNOS through acetylcholine (Ach) accumulation and promoting iNOS expression. Elevated NO levels result in the selective inhibition of HDAC8 through S-nitrosylation. HDAC1 and HDAC3 are resistant to S-nitrosylation and thus escape inhibition by NO. This selective inhibition skews the balance of class I HDAC activity in the developing zebrafish brain, altering histone acetylation patterns in a way that suppresses3915-P1371WO.UW -7-the expression of neuronal genes critical for social behavior, thereby leading to social behavioral deficits. Other biological effects of NO production include the downregulation of NO-sensitive bacteria of the genus Aeromonas and the upregulation of circadian genes, particularly the Per and Cry family genes. Butyrate inhibits all members of class I HDACs, including the zebrafish HDAC1, HDAC3, and HDAC8, thereby resetting the genome-wide balance of histone acetylation at gene loci targeted by class I HDACs. SNO: S- nitrosothiols.

[0038] FIGURE 8B shows embryonic exposure to the NO donor SNAP (10 μM) induced social deficits. Significance was calculated by two-tailed Student's t test. *p< 0.05.

[0039] FIGURE 8C shows exposure to the non-selective PDE inhibitor IBMX (100 μM) did not induce measurable social deficits. Significance was calculated by two- tailed Student's t test. ns: not significant.

[0040] FIGURE 9A shows a boxplot showing individual fish's social scores for the CPF dose curve. Each fish's social score is represented by a shaded dot. Significance was calculated by one-way ANOVA and Dunnett's multiple comparison test. ns: not significant, **p<0.01, ***p<0.001, ****p<0.0001.

[0041] FIGURE 9B shows a boxplot showing individual fish's social scores for the BRD-6929 rescue experiments. All fish were pre-exposed to 15 μM CPF at 0-3 dpf. Significance was calculated by one-way ANOVA and Dunnett's multiple comparison test. ns: not significant, *p<0.05.

[0042] FIGURE 9C shows a boxplot showing individual fish's social scores for the RGFP966 rescue experiments. All fish were pre-exposed to 15 μM CPF at 0-3 dpf. Significance was calculated by one-way ANOVA and Dunnett's multiple comparison test. ns: not significant, *p<0.05.

[0043] FIGURE 9D shows a boxplot showing individual fish's social scores for the PCI-34051 rescue experiments. All fish were pre-exposed to 15 μM CPF at 0-3 dpf. Significance was calculated by one-way ANOVA and Dunnett's multiple comparison test. ns: not significant.

[0044] FIGURE 10A shows a comparison of the average normalized expressions of circadian hub genes. Circadian hub gene expressions are significantly elevated in CPF samples compared to DMSO samples. Butyrate (SB) further upregulated the expression of circadian hub genes in CPF-treated fish. Lines between treatment groups connect3915-P1371WO.UW -8-expression levels of the same gene. Significance was calculated by two-way ANOVA with Tukey's multiple comparison test. ***p< 0.001, ****p<0.0001.

[0045] FIGURE 10B shows GSEA analysis comparing the gene expression profiles (RNA-seq results) of CPF+SB samples and CPF samples using Gene Ontology's (GO) Biological Process (BP), Molecular Function (MF), and Cellular Component (CC) terms. The top 20 pathways ranked by absolute values in Normalized Enrichment Score (NES) are shown, including 13 upregulated pathways and 7 downregulated pathways. 6 out of the 13 upregulated pathways are associated with circadian regulation (arrows).

[0046] FIGURE 11A shows an enrichment analysis comparing metabolomic changes in CPF samples as compared to DMSO controls, based on untargeted metabolomics analysis of gastrointestinal tissues and gut contents. Surveying the Feces dataset in HMDB detected similar patterns of metabolite profile changes in CPF-treated samples compared to fecal samples collected from individuals with inflammatory bowel disease (IBD) including Crohn's disease and colitis, irritable bowel syndrome (IBS), and autism (arrows).

[0047] FIGURE 11B shows an enrichment analysis comparing metabolomic changes between CPF and DMSO samples based on untargeted metabolomics analysis of gastrointestinal tissues and gut contents. Pathways related to the urea cycle, arginine metabolism, and aspartate metabolism were not identified by surveying KEGG.

[0048] FIGURE 11C shows an enrichment analysis comparing metabolomic changes between CPF and DMSO samples based on untargeted metabolomics analysis of gastrointestinal tissues and gut contents. Pathways related to the urea cycle, arginine metabolism, and aspartate metabolism were not identified by surveying RaMP-DB.

[0049] FIGURE 12 shows ȕ coefficient estimates and significance for the top 25 phyla. The plot presents the ȕ coefficient for the test of CPF vs DMSO (the beta value is the log fold change), as well as the confidence interval for the coefficient (error bars). Shading of the symbols represent the FDR.

[0050] FIGURE 13 shows ȕ coefficient estimates and significance for the top 25 classes. The plot presents the ȕ coefficient for the test of CPF vs DMSO, as well as the confidence interval for the coefficient (error bars). Shading represent the FDR.

[0051] FIGURE 14 shows ȕ coefficient estimates and significance for the top 25 orders. The plot presents the ȕ coefficient for the test of CPF vs DMSO, as well as the confidence interval for the coefficient (error bars). Shading represent the FDR.3915-P1371WO.UW -9-

[0052] FIGURE 15 shows ȕ coefficient estimates and significance for the top 25 families. The plot presents the ȕ coefficient for the test of CPF vs DMSO, as well as the confidence interval for the coefficient (error bars). Shading represent the FDR.

[0053] FIGURE 16 shows boxplots of the normalized abundance measures for all detected Microbacterium species. Data points were grouped by significance. The abundances of the non-significant species are similar between CPF and DMSO, but much lower compared to that of the significant species. DETAILED DESCRIPTION

[0054] The present disclosure employs a high-throughput social behavior assay in zebrafish to investigate the effects of embryonic CPF exposure. Through a systematic screening of major gut microbiome metabolites, butyrate was discovered to effectively rescue CPF-induced social deficits.

[0055] Further investigation revealed that the classes I and IIa HDAC inhibitor valproic acid phenocopied butyrate's rescue effects, while trichostatin A (a classes I, II & IV HDAC inhibitor) and nicotinamide (a class III HDAC inhibitor) did not. Molecular mechanisms underlying CPF's neurodevelopmental toxicity were assessed using multi- omics analyses, including metagenomics, metabolomics, and RNA sequencing. RNA sequencing results revealed notable dysregulation of neuronal genes, many of which have been previously associated with ASD. Butyrate partially reversed this downregulation. Metabolomics and metagenomics analysis results both revealed changes related to nitrogen metabolism and nitric oxide (NO) production.

[0056] Definitions:

[0057] As used herein, "social deficits" include symptoms such as difficulty with communication, making friends, and relating to others. Social communication difficulties include difficulty initiating or maintaining conversations, difficulty listening and following conversations, difficulty interpreting non-verbal cues like body language and facial expressions, difficulty taking another person's perspective, difficulty empathizing and building rapport with others, and difficulty understanding or responding appropriately to the emotions of others. Other social challenges characterizing "social deficits" include lack of social-emotional reciprocity, poor nonverbal communication, and challenges in developing and maintaining relationships.

[0058] A "therapeutically effective amount of an HDAC inhibitor" refers to refers to the amount of a therapeutic agent (i.e., drug, or therapeutic agent composition) that elicits3915-P1371WO.UW -10-the biological or medicinal response that is being sought in a tissue, system, animal, individual or human by a researcher, veterinarian, medical doctor or other clinician, which includes one or more of the following:

[0059] (1) preventing the condition; for example, preventing a disease, condition or disorder in an individual who may be predisposed to the disease, condition or disorder but does not yet experience or display the pathology or symptomatology of the disease;

[0060] (2) inhibiting the condition; for example, inhibiting a disease, condition or disorder in an individual who is experiencing or displaying the pathology or symptomatology of the disease, condition or disorder; and

[0061] (3) ameliorating the condition; for example, ameliorating a disease, condition or disorder in an individual who is experiencing or displaying the pathology or symptomatology of the disease, condition or disorder (i.e., reversing the pathology and / or symptomatology) such as decreasing the severity of condition.

[0062] As used herein, "pharmaceutically acceptable" means suitable for use in contact with the tissues of humans and animals without undue toxicity, irritation, allergic response, and the like, commensurate with a reasonable benefit / risk ratio, and effective for their intended use within the scope of sound medical judgment.

[0063] A thorough discussion of pharmaceutically acceptable excipients and salts is available in Remington's Pharmaceutical Sciences, 18th Edition (Easton, Pa.: Mack Publishing Company, 1990).

[0064] As used herein, the term "individual," "subject," or "patient," used interchangeably, refers to any animal, including mammals, preferably mice, rats, other rodents, rabbits, dogs, cats, swine, cattle, sheep, horses, or primates, and most preferably humans.

[0065] Butyrate rescues chlorpyrifos-induced social deficit in zebrafish

[0066] Social behavioral deficit is a defining characteristic of ASD. Due to CPF's association with ASD, whether CPF can induce social deficits in zebrafish using a high- throughput behavioral platform Fishbook was investigated. Embryonic exposure to CPF at 0-3 days post fertilization (dpf) induced social deficits at the juvenile stage (25 dpf) in a dose dependent manner (FIGURE 1A and FIGURE 9A).15 μM CPF consistently induced significant social deficit and was used for all subsequent rescue experiments. Exposure to CPF is known to cause gut microbiome dysbiosis and alter the production of beneficial gut microbiome metabolites. Thus, CPF-induced social deficit may be alleviated by beneficial3915-P1371WO.UW -11-gut microbiome metabolites. A small-scale screen of 7 metabolites was conducted, including acetic acid, butyrate (in the form of sodium butyrate), 3-indolepropionic acid (IPA), cholic acid, chenodeoxycholic acid (CDCA), ursodeoxycholic acid (UDCA), and succinic acid, all applied at a 10 μM concentration (FIGURE 1B). Of these, only butyrate rescued CPF-induced social deficits (FIGURE 1B). To confirm this finding, sodium butyrate was applied at concentrations ranging from 1.25 μM to 40 μM at 2-fold increments. A bell-shaped rescue curve was observed which peaked at 10 μM, validating that 10 μM butyrate can effectively rescue CPF-induced social deficit (FIGURE 1C).

[0067] Inhibition of class I histone deacetylases phenocopies butyrate

[0068] Histone deacetylases (HDACs) are a family of enzymes that may remove acetyl groups from lysine residues on histone proteins, thereby altering chromatin structure and gene expression. HDACs are classified into five major classes based on sequence homology and functional properties, including classes I, IIa, IIb, III (sirtuins), and IV. Butyrate is a pan-inhibitor of HDACs. To identify the HDACs involved in butyrate's rescue effect, several class-specific HDAC inhibitors were tested, including valproic acid (VPA; a class I & IIa Inhibitor), trichostatin A (TSA; a class I, II, & IV Inhibitor), and nicotinamide (a class III / sirtuins inhibitor). Compounds were applied to juvenile zebrafish overnight prior to Fishbook assay; test subjects were pre-exposed to CPF at 0-3 dpf. Of these, only the class I & IIa Inhibitor VPA rescued CPF-induced social deficit (FIGURE 2A).

[0069] To further zoom in on the biological pathway underlying butyrate and VPA's rescue effects, simultaneously knock down was attempted for all class I HDACs or all class IIa HDACs in zebrafish, respectively, and evaluate their impacts on sociality with or without pre-exposure to CPF. In humans, class I HDACs include HDAC1, HDAC2, HDAC3, and HDAC8. The zebrafish genome possesses orthologous genes for the human HDAC1 (hdac1), HDAC3 (hdac3), and HDAC8 (hadc8), but not HDAC2. HDAC3 and HDAC8 are all expressed in the brain. The human class IIa HDACs include HDAC4, HDAC5, HDAC7, and HDAC9. HDAC7 is not expressed in the brain and is therefore excluded from this experiment. The zebrafish genome also possesses orthologs for the human HDAC4 (hdac4), HDAC5 (hdac5), and HDAC9 (hdac9). To knockout all genes in each class using CRISPR-Cas9, 3 guide RNAs for each gene were pooled in the same class (HDAC1 / 3 / 8 for class I, and HDAC4 / 5 / 9 for class IIa), and separately co-injected each guide RNA mixture with Cas9 protein into 1-2 cell stage zebrafish embryos to induce3915-P1371WO.UW -12-knockout. F0 knockout of class I HDACs phenocopied butyrate and VPA robustly rescued CPF-induced social deficit (FIGURE 2B), whereas the class IIa knockout did not rescue CPF-induced social deficit and instead inhibited social behavior when compared to wild- type DMSO control (FIGURE 2C). Together, these results suggest that class I HDACs are involved in the regulation of CPF-induced social deficit in zebrafish.

[0070] HDAC1 inhibition alone effectively rescues chlorpyrifos-induced social deficit

[0071] To identify the HDAC enzyme specifically involved in social behavioral regulation following CPF pre-exposure, CRISPR-Cas9 was used to individually knock out the zebrafish orthologs of each class I HDAC gene. Knocking out hdac1 robustly upregulated social behavior in vehicle control fish as well as CPF-exposed fish (FIGURE 3A). Knocking out hdac3 and hdac8 both modestly rescued social behavior in CPF- exposed fish, but did not boost sociality in the control fish (FIGURES 3B & 3C). In fact, hdac8 knockout reduced social score when compared to wild-type DMSO control (FIGURE 3C). Rescue of CPF-induced social deficit was attempted via overnight exposure to selective HDAC inhibitors that specifically target HDAC1 (BRD-6929), HDAC3 (RGFP966), and HDAC8 (PCI-34051). The HDAC1 selective inhibitor, BRD-6929, strongly rescued CPF-induced social deficit in a dose-dependent manner, with 50 μM BRD-6929 most robustly boosted social behavior (FIGURE 3D and FIGURE 9B). The HDAC3 selective inhibitor RGFP966 modestly improved social behavior in CPF-exposed fish, especially when applied at 50 μM, but did not consistently boost the average social score to above 0 at higher dosages tested (FIGURE 3E and FIGURE 9C): a social score below 0 indicates social avoidance, a social score of 0 indicates no social preference, and a social score above 0 indicates social interest. The HDAC8 selective inhibitor PCI-34051 failed to rescue CPF-induced social deficit at the dosages tested (FIGURE 3F and FIGURE 9D). These results suggest that HDAC1 and to some extent HDAC3 likely mediates butyrate and VPA's rescue effects, and that targeted inhibition of HDAC1 alone is sufficient to robustly rescue social deficit induced by CPF exposure.

[0072] Accordingly, in an aspect, the present disclosure provides a method for treating organophosphate induced social deficits in a subject, comprising administering to a subject in need thereof a therapeutically effective amount of an HDAC inhibitor selected from the group consisting of valproic acid, butyric acid, BRD-6929, RGFP966, combinations thereof, or a pharmaceutically acceptable salt thereof.3915-P1371WO.UW -13-

[0073] In some embodiments, the HDAC inhibitor is valproic acid, or a pharmaceutically acceptable salt thereof. In some embodiments, the HDAC inhibitor is butyric acid, or a pharmaceutically acceptable salt thereof. In some embodiments, the HDAC inhibitor is sodium butyrate. In some embodiments, the HDAC inhibitor is BRD- 6929, or a pharmaceutically acceptable salt thereof. In some embodiments, the HDAC inhibitor is RGFP966, or a pharmaceutically acceptable salt thereof.

[0074] In some embodiments, the subject has been diagnosed with a disease or disorder characterized by social deficits. In some embodiments, the disease or disorder characterized by social deficits is autism spectrum disorder. In some embodiments, the subject does not have a second condition that requires treatment with the HDAC inhibitor. In some embodiments, the method further includes monitoring the subject for a change in the severity of social deficits. In this regard, as many of the symptoms corresponding with a disease or disorder characterized by social deficits may take a variety of forms in different subjects, the effectiveness of treatment with the HDAC inhibitors described herein may be monitored and dosages adjusted based on the individual presentation of symptoms by the subject.

[0075] In some embodiments, administering to a subject in need thereof comprises oral administration. In some embodiments, administering to a subject in need thereof comprises cranial or spinal administration. In some embodiments, administering to a subject in need thereof comprises administering with an administration frequency selected from the group consisting of daily administration, weekly administration, biweekly administration, and monthly administration. In this regard, what constitutes a pharmaceutically acceptable dose may be tailored based on the lifetime of the HDAC inhibitors within the subject and the nature of symptoms being presented by the subject.

[0076] In some embodiments, the subject is a human. In some embodiments, the subject is another type of animal, such a dog or other domesticated animal.

[0077] Butyrate partially rescues selective inhibition of neuronal genes by chlorpyrifos

[0078] To investigate the molecular mechanisms underlying CPF-induced social deficits and butyrate's rescue effect, whole-brain RNA-sequencing (RNA-seq) was conducted using 25 days post fertilization (dpf) zebrafish. Four experimental treatments were examined, including DMSO control treatment (DMSO), sodium butyrate treatment (SB), CPF treatment (CPF), and sodium butyrate rescue of CPF-exposed fish (CPF+SB).3915-P1371WO.UW -14-CPF and DMSO were exposed to embryonic and early-larval-stage zebrafish at 0-3 dpf. Butyrate was applied the day before sample collection and kept overnight. Zebrafish gene names were converted to human orthologs gene names for pathway analysis.

[0079] Gene Set Enrichment Analysis (GSEA) using Gene Ontology's (GO) Biological Process (BP) terms found that embryonic exposure to CPF significantly inhibits expression of neuronal genes related to neuronal projection (axonal and dendritic), synaptogenesis (presynaptic and postsynaptic), and learning, as compared to the DMSO control (FIGURE 4A). Out of the top 20 significantly downregulated GO pathways, 13 are related to the regulation of neuronal processes (FIGURE 4A). Genes associated with butanoate (butyrate) metabolism are negatively enriched in CPF-treated zebrafish compared to the control fish, although this pathway did not make the cut for the top 20 downregulated pathways ranked by normalized enrichment scores (NESs). Significantly downregulated neuronal genes belonging to the 13 pathways form a compact protein- protein interaction network.

[0080] Within this network, the top 30 hub genes were identified by network topology analysis and ranked by node degree values (the number of direct interactions within the network). These hub genes again form a compact PPI network. While the expressions of neuronal hub genes are suppressed in the CPF samples as compared to the DMSO control samples, butyrate rescues this suppression by upregulating the 30 neuronal hub genes in CPF-exposed fish (CPF+SB), as shown by statistical analysis of their average normalized gene expression levels (FIGURE 4B). Approximately half (14 out of 30) of the hub genes are high-confidence or suspected ASD risk genes as identified by the Simons Foundation Autism Research Initiative (SFARI) in their list of SFARI genes, including BRAF (SFARI gene score [SGS]: 1S), CAMK2B (SGS: S), CDH2 (SGS: 3S), DRD2 (SGS: 2), GRIA2 (SGS: 1), GRIA3 (SGS: S), GRIN1 (SGS: 1), GRIN2B (SGS: 1), GRM5 (SGS: 2), MAPK3 (SGS: 2), NLGN1 (SGS: 2), PAX6 (SGS: S), SNAP25 (SGS: 2), and SYP (SGS: 3). The genes GRIA2 (adjusted p value [padj] = 0.00098), GRIA3 (padj = 0.0011), and GRIN1 (padj = 0.013) were significantly upregulated by butyrate.

[0081] These results indicate that a network of neuronal genes associated with ASD risk may be selectively downregulated in CPF-exposed zebrafish, and this downregulation is at least partially rescued by butyrate treatment.

[0082] Embryonic exposure to chlorpyrifos induces sustained overexpression of key circadian genes3915-P1371WO.UW -15-

[0083] GSEA using GO-BP terms found that 5 out of the 20 positively enriched pathways are associated with circadian regulation (FIGURE 5A). RNA-seq data demonstrated a significant overexpression of circadian genes in the juvenile zebrafish brain: 11 out of the top 21 significantly upregulated genes are circadian genes, including per1a, per1b, per2, cry1a, cry1b, cry2, cry5, nr1d1, ciarta, bhlhe41, and si:ch211- 132b12.7 (FIGURE 5B). Because circadian gene expressions oscillate during the day, to prevent RNA-seq sample collection times affecting gene expression levels and bias the result, the same experimental treatments were repeated and collected brain samples from CPF-treated fish and control fish at the exact same time of the day through brain dissections performed in parallel by two experienced experimenters. Quantitative PCR analysis using these samples confirmed circadian gene upregulation in CPF-treated fish compared to the control fish (FIGURE 5C). It is worth noting that the human orthologs of several identified circadian genes are known ASD risk genes in the SFARI gene list, including PER1 (SGS: 2), PER2 (SGS: 2), and NR1D1 (SGS: 2).

[0084] Significantly upregulated circadian genes belonging to the five identified circadian pathways (FIGURE 5A) form a compact PPI network. Plotting an expression heatmap of these circadian hub genes using RNA-seq data showed that butyrate treatment following CPF-exposure (CPF+SB) further boosted the expression of these key circadian genes compared to the CPF-treated sample. Statistical analysis of the average normalized gene expression levels of circadian hub genes confirms this elevation in gene expression in the CPF+SB samples compared to the CPF samples (FIGURE 10A). This observation is also verified by analyzing the differential gene expression data between CPF+SB and CPF samples using GSEA, which found that 6 out of the 10 upregulated pathways are associated with circadian regulation (FIGURE 10B). These results demonstrate that butyrate did not reverse CPF-induced upregulation of circadian gene expression, but instead further boosted their expression. Without wishing to be bound by any particular theory, butyrate's social behavioral rescue effect is unlikely mediated by the circadian pathway.

[0085] Chlorpyrifos induces lasting changes in nitrogen metabolism pathways in the gut

[0086] To test the hypothesis that CPF-exposure may alter the production of beneficial metabolites by the gut microbiome, zebrafish were exposed to three treatment conditions: DMSO, CPF, and CPF+SB. CPF and DMSO were exposed to zebrafish at 0-3 dpf. Butyrate was applied the day before sample collection and kept overnight. The entire3915-P1371WO.UW -16-gastrointestinal tract, including the gut contents, were collected from juvenile stage zebrafish (25 dpf) through dissection.

[0087] Untargeted metabolomics were conducted to determine the metabolite profiles of each sample. Enrichment analysis using MetaboAnalyst 6.0 against the "Feces" dataset in the Human Metabolome Database (HMDB) detected similar patterns of metabolite profile changes in CPF-treated samples compared to fecal samples collected from individuals with inflammatory bowel disease (IBD), including Crohn's disease and colitis, irritable bowel syndrome (IBS), and autism (FIGURE 11A). Several enrichment analyses were run against the Relational Database of Metabolomics Pathways (RaMP-DB), the Small Molecule Pathway Database (SMPDB), and the Kyoto Encyclopedia of Genes and Genomes (KEGG) to detect metabolomic pathways altered in the CPF samples as compared to the DMSO controls.

[0088] Urea cycle, arginine metabolism, and aspartate metabolism were consistently identified among the top enriched pathways (FIGURES 6A-6C). Both arginine and aspartate are intermediate metabolites of the urea cycle. Interestingly, changes in the nitric oxide (NO) pathway and nitric oxide synthase (NOS) activity were detected by surveying RaMP-DB (FIGURE 6A). L-arginine is a precursor for the endogenous production of NO through NOS, thus connecting urea cycle, arginine metabolism, and aspartate metabolism with the NO / NOS pathway. Enrichment analysis using SMPDB detected significant changes in urea cycle, arginine metabolism, and aspartate metabolism between the CPF+SB and CPF samples (FIGURE 6D), indicating that these pathways were also altered by butyrate treatment.

[0089] However, none of the three pathways passed significance threshold when surveying the KEGG and RaMP-DB databases for metabolic changes between the CPF+SB and CPF samples (FIGURES 11B and 11C), suggesting that the butyrate-induced changes in these pathways may be mild.

[0090] Chlorpyrifos increases the abundance of denitrifying bacteria in the zebrafish gut microbiome

[0091] Metagenomics analysis was conducted to examine if changes in the zebrafish gut microbiome contributes to its metabolomic alterations following CPF exposure. CPF and DMSO were exposed to zebrafish at 0-3 dpf. Following ~ 3 weeks of growth in nursery, fecal matters were collected from juvenile stage zebrafish (25 dpf) for DNA extraction and shotgun metagenomic sequencing. Sankey diagrams were generated3915-P1371WO.UW -17-to show combined taxonomy of species found in the DMSO control and CPF samples, respectively. Differential abundance and prevalence analyses were conducted between the two treatment groups at every taxonomic level, from species to kingdom. Only differentially abundant taxa were identified, and no evidence was found for differentially prevalent taxa.

[0092] The count of significant taxa at each level is shown in Table 7. There are two differentially abundant phyla, Actinomycetota and Cyanobacteriota (FIGURE 12), each increased in abundance by 2- to 2.5-fold following CPF exposure, as shown by their ȕ coefficient values (Table 1). At the class level, Actinomycetes and Cyanophyceae were found to have similar 2- to 2.5-fold increases in abundance in the CPF samples (FIGURE 13 and Table 2). The order Micrococcales and the family Microbacteriaceae both increased by ~2.5-fold in abundance following CPF exposure (FIGURES 14 and 15, and Tables 3 and 4).

[0093] Table 1: Statistics for the two significant phyla from FIGURE 12. (S10B) Ph l C ffi i t StdE FDR 0 9 rom FIGURE 13.Class Coefficient Std.Err FDR 2 8om FIGURE 14. Order Coefficient Std.Err FDR 9rom FIGURE 15. Family Coefficient Std.Err FDR 4cies by genus.Count3915-P1371WO.UW -18-Pseudomonas 6 33915-P1371WO.UW -19-

[0098] Although no significant changes in abundance were detected at the genus level, 139 species were found to be differentially abundant (Table 6 and Table 7), among which 86 species belong to the genus Microbacterium (Table 6 and Table 5).

[0099] All differentially abundant Microbacterium species showed an increase in abundance in the CPF-treated samples as compared to the DMSO control. A boxplot comparing normalized abundance measures for the significant and non-significant Microbacterium species found that the non-significant species have similar yet much lower abundance in CPF and DMSO samples, which may explain why even though so many Microbacterium species are differentially abundant, when combined at the genus level the difference is no longer significant (FIGURE 16). The Microbacterium genus is classified under the family Microbacteriaceae, the order Micrococcales, the class Actinomycetes, and the phylum Actinomycetota.

[0100] Table 6: coefficient estimates for 139 significant species detected by comparing microbiome compositions of fecal matters collected from CPF-treated fish and DMSO control fish. The microbiome profile of each sample was identified by shotgun metagenomics analysis. Species Coefficient Std.Err FDR 6 6 6 6 9 6 1 1 3 8 2 1 5 4 63915-P1371WO.UW -20-Rathayibacter sp. VKM Ac-2803 1.5002846 0.162164 0.050064 Mi i 1 R 14 24 17 27 269 1 6 1 2 7 5 9 9 3 1 6 8 1 5 6 6 7 6 1 6 9 6 1 4 6 1 9 1 6 33915-P1371WO.UW -21-Microbacterium sp. M28 1.2290338 0.120868 0.039726 Mi i 11 121212 12 4 4 32 1 5 4 3 3 1 7 6 1 7 6 3 3 1 7 5 1 6 1 1 6 6 4 5 3 7 5 5 1 93915-P1371WO.UW -22-Microbacterium oryzae 0.9760702 0.082274 0.034236 Mi i h i l 7 12 7472 451 8 9 1 5 1 7 5 5 9 7 7 5 9 3 6 1 6 6 1 6 8 6 6 5 6 1 6 3 3 63915-P1371WO.UW -23-Microbacterium protaetiae 0.7136138 0.09675 0.069521 Mi i 1M 7 124 1772 766 1 3 4 5 8 3 9 8 8 6 1 6 8 8 2 4 1 6 5 1 5 6 9 9 1 6ly abundant at each taxonomic level.3915-P1371WO.UW -24-Phylum 2 counts of differentially abundant species by genus.Genus Count e 86 Microbacterium species, 11 Aeromonas species, 6Pseudomonas species, 2 Pseudoalteromonas species, and 2 Vibrio species were found to be differentially abundant in CPF and DMSO samples (Table 8). When plotting species with the 10 highest and 10 lowest ȕ coefficient values, no Microbacterium species were found (FIGURE 7A). Instead, the 2 Pseudoalteromonas species, 2 Vibrio species, and 4 out of the 6 Pseudomonas species were among the top 10 species with the highest increase in abundance (FIGURE 7A). In a Sankey diagram for CPF samples, the genus Pseudomonas shows the highest read count (2.35M) compared to Pseudoalteromonas (165k) and Vibrio (851k), indicating that Pseudomonas is a dominant genus among the top species with increased abundance following CPF exposure.

[0104] Many Pseudomonas species are facultative anaerobes that carry out complete denitrification – the stepwise reduction of nitrate (NO^^) to nitrite (NO^^), nitric oxide (NO), nitrous oxide (N^O), and finally nitrogen gas (N^). Studies of activated sludge and biofilm reactors show that among denitrifying bacteria, Pseudomonas is frequently the dominant genus. This unique metabolic capability connects changes in the abundance of Pseudomonas with the observed changes in nitrogen metabolism in the CPF samples (FIGURES 6A-6C). Some members of the genera Pseudoalteromonas and Vibrio have also been reported to be capable of at least partial denitrification. Microbacterium is generally not known to possess denitrifying activity.3915-P1371WO.UW -25-

[0105] In contrast to the abovementioned genera, all 11 Aeromonas species decreased in abundance following CPF exposure (Table 6). Of the top 10 species showing the greatest reduction in abundance in the CPF samples compared to controls, 9 are Aeromonas (FIGURE 7A). This may be due to Aeromonas' susceptibility to the antimicrobial effect of nitric oxide (NO), a metabolite presumably produced at a higher amount by the increased denitrifying gut bacteria in CPF-treated fish. Indeed, using Griess assay, significantly elevated nitrite levels in 6 dpf zebrafish larvae pre-exposed to CPF from 0-3 dpf was detected (FIGURE 7B).

[0106] As a stable oxidation product of NO, nitrite levels are commonly used as an indirect measurement of NO. Elevated nitrite levels therefore indicate elevated NO levels in zebrafish following CPF exposure. This result is consistent with the identification of disrupted NO / NOS-related pathways through metabolomics analysis (FIGURE 6A). The delay between CPF exposure (0-3 dpf) and the detection of elevated NO (6 dpf) suggest a lasting effect of CPF on NO production, which is likely at least in part mediated by changes in gut microbiome composition.

[0107] A NO-HDAC hypothesis on CPF-induced social deficits

[0108] Without wishing to be bound by any particular theory, these findings suggest a working hypothesis that CPF induces ASD-relevant neurodevelopmental defects through excessive NO production and the resulting imbalanced activities of class I HDACs (the "NO-HDAC hypothesis of CPF's neurodevelopmental toxicity") (FIGURE 8A). Briefly, CPF exposure may first increase NO production through a combination of three (likely independent) mechanisms: (1) these results show that via an unknown mechanism, CPF exposure increases the abundance of denitrifying bacteria in the gut microbiome, most notably Pseudomonas (FIGURE 7A), which could enhance NO production (FIGURE 7B) through the denitrification pathway; (2) CPF exposure has been found to trigger the expression of inducible nitric oxide synthase (iNOS) in various experimental systems, resulting in increased NO production; and (3) CPF prevents the breakdown of the neurotransmitter acetylcholine (ACh) via its activity as an irreversible inhibitor of the enzyme acetylcholinesterase (AChE), which can in turn activate endothelial nitric oxide synthase (eNOS) and thereby promoting NO production.

[0109] NO is known to inhibit HDAC2 (not present in zebrafish) and HDAC8 through S-nitrosylation of two cysteine residues which are conserved in all class I HDACs, yet through an unknown mechanism, HDAC1 and HDAC3 are largely immune to S-3915-P1371WO.UW -26-nitrosylation despite possessing the same conserved cysteine residues. An abnormally high level of NO induced by CPF exposure may lead to excessive (compared to physiological level) inhibition of HDAC8 through S-nitrosylation, while HDAC1 and HDAC3 activities will remain relatively intact due to their resistance to S-nitrosylation. This selective inhibition of HDAC2 / 8 over HDAC1 / 3 may skew the normal physiological balance of class I HDAC activities in the brain, altering histone acetylation patterns in a way that suppresses the expression of neuronal genes critical for social behavioral development and thus leading to the social deficit phenotype.

[0110] Without wishing to be bound by any particular theory, this model may help to explain butyrate's rescue effect: based on the NO-HDAC hypothesis, butyrate rescues CPF-induced social deficit by simultaneously inhibiting all members of class I HDACs, including the zebrafish hdac1, hdac3, and hdac8, thus correcting the genome-wide imbalance of histone acetylation by "resetting" and rebalancing the global histone acetylation states, especially at gene loci targeted by class I HDACs. This rebalancing theory also may explain why knocking out or pharmaceutically inhibiting the zebrafish hdac1 and hdac3 resulted in successful rescue of the CPF-induced social deficit phenotype (FIGURES 3A, 3B, 3D, & 3E), whereas chemical inhibition of hdac8 failed to rescue the deficit (FIGURE 3F).

[0111] Knocking out hdac8 did rescue social deficit induced by CPF (FIGURE 3C), but this may be due to the loss of S-nitrosylation target for NO. Knocking out hdac8 significantly inhibited social behavior compared to wild-type control (FIGURE 3C), while in contrast, hdac1 knockout robustly boosted social behavior (FIGURE 3A). In comparison, hdac3 knockout did not significantly affect social behavior when compared to wild-type control (FIGURE 3B), indicating that hdac1 and hdac8 may be the two members of class I HDACs that are key to maintaining the hypothesized state of histone acetylation balance.

[0112] Finally, the elevated NO in this NO-HDAC model also explains the reduction of the NO-sensitive bacteria genus Aeromonas (FIGURE 7A) and the upregulation of circadian genes (FIGURE 5), particularly the Per and Cry family genes, following CPF exposure. A more in-depth analysis of the NO-HDAC hypothesis can be found in the Discussion of Mechanistic Studies section.

[0113] As a preliminary test of this hypothesis, zebrafish embryos were exposed to the NO donor S-nitroso-N-acetylpenicillamine (SNAP). Fishbook assay detected a3915-P1371WO.UW -27-lasting deficit in social behavior at the juvenile stage following embryonic exposure to SNAP (FIGURE 8B), suggesting a role of NO in social behavioral development, which is in line with this model's prediction. A major biological effect of NO is to promote the production of cyclic guanosine monophosphate (cGMP), an effect that can be pharmacologically mimicked by inhibiting cGMP-degrading phosphodiesterases (PDEs). Embryonic exposure to 3-isobutyl-1-methylxanthine (IBMX), a broad-spectrum PDE inhibitor, did not induce social deficits in zebrafish (FIGURE 8C), indicating that NO likely modulates social behavior through a cGMP-independent mechanism, which again aligns with this model (FIGURE 8A).

[0114] Discussion of Mechanistic Studies

[0115] The present disclosure reveals a multi-layered mechanism through which embryonic exposure to CPF, a commonly used organophosphate pesticide, may induce lasting social behavioral deficits in zebrafish, a core phenotype relevant to ASD. Using high-throughput behavioral screening, transcriptomics, metabolomics, and metagenomics, CPF may disrupt social behavior by altering the gut microbiome and gut-derived metabolites, leading to suppression of neuronal gene expression in the brain. Notably, butyrate, a gut microbiome metabolite and HDAC inhibitor, may rescue CPF-induced social deficits and inhibition of neuronal genes.

[0116] Mechanistic dissection identified HDAC1 as an important mediator of this rescue effect. Additionally, sustained overexpression of circadian genes and significant alterations in nitrogen-related metabolic pathways were observed, including upregulation of denitrifying bacteria such as Pseudomonas and depletion of nitric oxide (NO)-sensitive Aeromonas species.

[0117] The NO-HDAC hypothesis (FIGURE 8A) developed based on these findings is strongly supported by this data and may help to explain observations in this study.

[0118] First, CPF-treated zebrafish show significant increase in Pseudomonas abundance, an established genus of denitrifying bacteria capable of producing NO under anaerobic and microaerobic conditions.

[0119] Second, concurrent with the increase in Pseudomonas species, significant enrichment in nitrogen metabolism-related pathways was observed, including arginine, aspartate, and urea cycle metabolism, which are tightly linked to NO synthesis and may3915-P1371WO.UW -28-represent secondary effects of increasing denitrification and NO production mediated by Pseudomonas.

[0120] Third, CPF exposure caused a reduction in Aeromonas species which are facultative anaerobes known to be sensitive to NO, suggesting elevated NO levels in the gut environment.

[0121] Fourth, brain transcriptome analysis revealed a pronounced downregulation of neuronal genes, many of which are high-confidence ASD risk genes. Butyrate rescued both the CPF-induced downregulation of neuronal genes and social deficits. More selectively, HDAC1 inhibition was sufficient to robustly rescue behavioral phenotypes, indicating that HDAC1 is an important component of this pathway.

[0122] Finally, elevated expression of circadian genes observed in this study, in particular Per and Cry family genes, is consistent with the known ability of NO to induce these genes via CREB phosphorylation and S-nitrosylation of Bmal1. Butyrate failed to reverse the CPF-induced circadian gene upregulation, suggesting that circadian gene expression changes are likely not causal for behavioral deficits but are rather a secondary effect of NO signaling.

[0123] CPF has been shown to elevate NO levels in the brain in vivo, across multiple animal models. Rodent and fish studies consistently demonstrate increased NO metabolites and iNOS activity following CPF exposure. Furthermore, other organophosphates such as malathion, parathion, diazinon, and dichlorvos exhibit similar effects, pointing to a conserved mechanism of NO elevation induced by this class of chemicals. NO inhibits HDAC2 and HDAC8 through the S-nitrosylation of two cysteine residues that are highly conserved among all members of class I HDAC.

[0124] However, HDAC1 and HDAC3 are not subjected to NO-mediated S- nitrosylation despite possessing the same conserved cysteine residues. HDAC2 is not present in the zebrafish genome, leaving HDAC8 to be the sole target of NO among members of class I HDACs. Class I HDACs play essential regulatory roles in the development of the central nerves system. In particular, HDAC8 is a SFARI gene (SGS: S) found to be associated with Cornelia de Lange syndrome, autism, Rett-related disorder, and intellectual disability.

[0125] Without wishing to be bound by any particular theory, NO-mediated S- nitrosylation of HDAC8 may lead to increased histone acetylation and gene activation at specific gene loci, disrupting the balanced levels of histone acetylation and gene expression3915-P1371WO.UW -29-among key neuronal genes, which is typically maintained by all class I HDACs in a coordinated manner. Butyrate and VPA presumably rescued this imbalanced state by simultaneously inhibiting all class I HDACs, thereby resetting histone acetylation for all class I HDAC targeted regions of the genome.

[0126] This theoretical framework also may explain the rescue effects of inhibiting HDAC1 and HDAC3 (FIGURES 3A-3B and 3D-3E). The rescue effect of knocking out hdac8 (FIGURE 3C) may be a result of NO losing its target molecule and therefore no longer able to modulate gene expression through HDAC8 S-nitrosylation. This approach to rescue neurodevelopmental deficits through epigenetic reprogramming echoes previous success in correcting social deficits induced by imbalanced histone methylation. The hypothesis of differential inhibition of class I HDACs by NO also resonates well with the concept of a post-translational code for class I HDACs.

[0127] Importantly, elevated nitric oxide levels and nitrosative stress have been associated with the pathogenesis of ASD. Studies found increased concentrations of nitric oxide, its stable metabolites (e.g., nitrite and nitrate), and biomarkers of nitrosative stress in the plasma and saliva of children diagnosed with ASD. The same phenomenon was observed in animal models of ASD including Shank3-deficient mice and Cntnap2 mutant mice. Shank3-deficient mice exhibited widespread changes in the S-nitroso-proteome, in particular the S-nitrosylation of key synaptic proteins, proteins involved in glutamate transmission, and protein products of high-risk SFARI genes.

[0128] Inhibition of NO production by a neuronal nitric oxide synthase (nNOS) inhibitor restored the reduced synaptic protein expression and decreased dendritic spine density in Shank3 mutant mice. In Cntnap2 mutant mice, nNOS inhibition similarly reversed the increase in NO metabolites and nitrosative stress markers, and rescued deficits in synaptic protein expression and dendritic spine density. These findings suggest that dysregulated nitric oxide signaling may be a common feature in autism, providing additional support for the model that links CPF-induced NO elevation to neurodevelopmental and behavioral alterations.

[0129] In conclusion, these findings bridge CPF-induced microbiome dysbiosis, NO production, epigenetic modification, and ASD-relevant behavior through a novel mechanistic axis involving denitrifying bacteria and selective HDAC regulation.

[0130] MATERIALS AND METHODS

[0131] Zebrafish husbandry3915-P1371WO.UW -30-

[0132] Zebrafish were housed at 26°C–27°C on a 14-hour light, 10-hour dark light cycle. Wild-type AB strain was used for all experiments. All zebrafish experiments were approved by the Institutional Animal Care and Use Committee at the University of Washington.

[0133] Chemical exposure

[0134] Fertilized embryos were sorted and transferred into 100 mm diameter and 15 mm deep petri dishes at 100 embryos per dish. Each dish was filled with 25 mL of HEPES-buffered E3 medium. Compound stocks were prepared DMSO to maintain stability and stored at -20°C. Each compound was added at various concentrations, with negative controls receiving an equal volume of the corresponding solvent. To prevent media contamination, dead embryos were removed at 1- and 2-days post-fertilization (dpf). At 3 dpf, all viable larvae were rinsed with E3 medium and transferred into clean petri dishes containing fresh E3 medium. At 5 dpf, larvae from each petri dish were transferred to separate nursery tanks and raised to 25 dpf for Fishbook assays. For overnight metabolite exposure, 24 dpf fish were transferred into 100 mm diameter and 15 mm deep petri dishes at 15 fish per dish. Fish were exposed to metabolites overnight (~15 hours) then rinsed and tested in the Fishbook assay.

[0135] The following compounds were also obtained from Cayman Chemical (Ann Arbor, MI, USA): chloropyrifos (CAS # 2921-88-2, Item No. 21412), butyric acid (CAS #73607-83-7, Item No.29408), sodium butyrate (CAS #156-54-7, Item No.13121), 3-indolepropionic acid (IPA, CAS #830-96-6, Item No.28821), cholic acid (CAS #81-25- 4, Item No. 20250), chenodeoxycholic acid (CDCA, CAS #2646-38-0, Item No. 35346), ursodeoxycholic acid (UDCA, CAS #31687-65-7, Item No. 15121), valproic acid (VPA, CAS #1069-66-5, Item No. 13033), nicotinamide (CAS #98-92-0, Item No. 11127), and trichostatin A (TSA, CAS #58880-19-6, Item No. 89730). Acetic acid (CAS #64-19-7, Product No.45754) and succinic acid (CAS #110-15-6, Product No. S9512) were obtained from Sigma-Aldrich. The following HDAC inhibitors were obtained from MedChemExpress (Monmouth Junction, NJ, USA): BRD-6929 (CAS #849234-64-6, Cat. No.: HY-100719), RGFP966 (CAS #1357389-11-7, Cat. No.: HY-13909), and PCI-34051 (CAS #950762-95-5, Cat. No.: HY-15224).

[0136] Fishbook assay

[0137] The test arena consists of a total of 443D printed, 10-mm-deep, 8.5-mm- wide, and 80-mm-long rectangular chambers grouped together in parallel with each other.3915-P1371WO.UW -31-Each chamber is divided into three compartments by two transparent acrylic windows (1.5 mm thick): a 60-mm-long middle testing chamber to place the test subject and two 8.5- mm-long end chambers to place the social stimulus fish or remain empty, respectively. Test subjects were each placed inside an individual test chamber using a plastic transfer pipette with its tip cut off to widen the opening. A 3D printed white comb-like structure was placed in front of the social stimulus compartment to block the test subject's visual access to social stimulus fish before testing begins. After test subjects were placed inside the chambers, the arena was placed inside the imaging station, and the combs were removed to visually expose the social stimulus fish to the test subjects. Following a brief acclimation period, a 10-min test session was video recorded.

[0138] Videos were streamed through the software Bonsai. Videos were analyzed in real time during recording, and the frame-by-frame x and y coordinates of each fish relative to its own test compartment were exported as a CSV file. Data was analyzed using custom Python scripts to calculate social scores and generate tracking plots. Social score was defined as a fish's average y-axis position for all frames. The middle of each test chamber was designated as the origin of the y axis, with an assigned value of zero. A value of 1 was assigned to the end of the chamber next to the social stimulus fish and a value of í1 to the other end of the chamber next to the empty control compartment. In this coordinate system, all social scores have values between í1 and 1. A higher social score demonstrates a shorter average distance between a test subject and a social stimulus fish during a test, which suggests a stronger social preference.

[0139] Fishbook results were analyzed and plotted using GraphPad Prism. For analysis of multiple groups, normal distribution of datasets was examined using Shapiro- Wilk test to confirm that more than half the data was normally distributed and standard deviations fell within the variance ratio. To compare multiple groups with one independent variable, one-way analysis of variance (ANOVA) assuming gaussian distribution and equal standard deviation was performed, using Dunnett's test to correct for multiple comparisons. To compare groups with two independent variables, two-way ANOVA was performed followed by Fisher's Least Significant Difference (LSD) test for post hoc analysis. P values less than 0.05 were considered significant.

[0140] CRISPR-Cas9 gene knockout

[0141] Three sets of sgRNAs were designed for targeting each HDAC ortholog to maximize the efficiency of F0 knockout. CHOPCHOP was used for the sgRNA design.3915-P1371WO.UW -32-

[0142] sgRNAs targeting early coding exons were selected to introduce nonsense mutations as early as possible and increase the likelihood of loss-of-function mutations. All gRNA sequences are shown in Table 9 (see SEQ ID Nos.1-18).

[0143] Table 9: Design of gRNA sequences for knocking out the zebrafish hdac1, hdac3, hdac4, hdac5, hdac8, and hdac9 genes. gRNA G G G G G G G G G G G3915-P1371WO.UW -33-gRNA ATTTAGGTGACACTATAGCCTCATGTGGCTTCAATAGGTTTTAGAGCTAG hd 8 1 AAATAGCAAG SE ID NO 13 G G G G ce,followed by an overlap adapter, which is complementary to the 5' end of an 80 bp constant oligo according to a published protocol described in Gagnon, J. A. et al. Efficient mutagenesis by Cas9 protein-mediated oligonucleotide insertion and large-scale assessment of single-guide RNAs. PLoS One 9, e98186 (2014), which is incorporated by reference herein. Oligonucleotides were synthesized by Eurofins Scientific. Double- stranded DNAs were generated by Phusion Hot-Start Flex DNA Polymerase (New England Biolabs) using the gene specific oligos and the constant oligo. The double-stranded DNA was cleaned up using the Zymo Clean and Concentrator-5 kit (Zymo Research). In vitro sgRNA transcription was conducted using the MEGAscript SP6 transcription kit (Thermo Fisher Scientific) and cleaned up using the Zymo RNA Clean and Concentrator-5 kit (Zymo Research).

[0145] To perform zebrafish embryonic microinjections, pairs of male and female adult zebrafish were kept in a mating cage overnight while separated by a divider. 1-cell-stage embryos were collected the next day early in the morning immediately before injection by pulling out the divider to allow breeding. Injection solution was prepared by combining sgRNA with 2 μM Spy Cas9 NLS and 1X NEBuffer (New England Biolabs).

[0146] Zebrafish brain and intestine dissection

[0147] At 25 days post-fertilization, zebrafish were euthanized by immersion in icy water for 15 minutes in petri dishes. For brain dissection, the fish were positioned3915-P1371WO.UW -34-vertically, dorsal side up, in a pre-carved slot within dissection wax on a petri dish. The lower half of the body was immobilized using Gorilla Glue to ensure stability. The petri dish was filled with ice-cold phosphate-buffered saline (PBS) to prevent desiccation during the procedure. Brains were carefully extracted from the skull using the tip of a sharp syringe needle. Five brains were collected per replica, with four replicas prepared per condition. For intestine dissection, the fish were positioned horizontally on a clean petri dish, with the head and tail secured using glue. Ice-cold PBS was added to maintain hydration, and intestines were gently isolated using a dissection scalpel. Twenty-four intestines were collected per replica, with four replicas prepared per condition. Immediately after harvest, both brains and intestines were flash-frozen in liquid nitrogen and stored at -80°C.

[0148] RNA-sequencing

[0149] Total RNA was isolated from frozen 25 dpf zebrafish brains using Quick- RNA Miniprep Kit (Zymo Research, Irvine, California) by following the manufacturer's protocol. RNA concentrations were quantified using a NanoDrop 1000 Spectrophotometer (Thermo Scientific, Waltham, Massachusetts) at 260ௗnm. Sample QC was performed with Agilent 4150 bioanalyzer to identify samples with RIN>7.200ng qualified RNA from each sample was processed for library preparation. In brief, mRNA enrichment was performed on total RNA using oligo(dT)-attached magnetic beads. The enriched mRNA with poly(A) tails was fragmented using a fragmentation buffer, followed by reverse transcription using random N6 primers to synthesize cDNA double strands. The synthesized double stranded DNA was then end-repaired and 5'-phosphorylated, with a protruding 'A' at the 3' end forming a blunt end, followed by ligation of a bubble-shaped adapter with a protruding 'T' at the 3' end. The ligation products were PCR amplified using specific primers. The PCR products were denatured to single strands, and then single-stranded circular DNA libraries were generated using a bridged primer. The constructed libraries were quality-checked and sequenced after passing the quality control. The library was amplified with phi29 to make DNA nanoball (DNB) which had more than 300 copies of one molecular. The DNBs were load into the patterned nanoarray and pair end 150 bases reads were generated in the way of sequenced by synthesis. The sequencing was conducted on the MGI T7 platform.

[0150] Raw sequencing reads in FASTQ format were first processed to quality control using FastQC (v0.11.9), followed by Clumpify (BBMap, v38.90), Trimmomatic (v0.39) and fastp (v0.23.2) on Ubuntu 20.04 LTS to obtain clean reads. Analysis of the clean reads were performed using R Studio (v4.4.1). Clean reads were first aligned to the3915-P1371WO.UW -35-reference genome (Danio rerio, GCF_000002035.6_GRCz11_genomic). A gene expression matrix was created using featureCounts from the Rsubread (v2.18.0) package in R Studio. Differential expression analysis was performed using the Limma R package (v3.60.6). Genes with p-value < 0.05 and _log2FoldChange_ ^ 1 were considered significantly differentially expressed (DEGs). Volcano plot and heatmap were generated using EnhancedVolcano (v1.22.0), pheatmap (v1.0.12) and ggplot2 (v3.5.1) packages.

[0151] Gene set enrichment analysis (GSEA)

[0152] DEGs were subjected to functional enrichment analysis using the clusterProfiler R package (v4.12.6). GSEA was performed using the gseGO() and gseKEGG() functions for GO and KEGG enrichment respectively. Gene IDs were converted using biomaRt (v2.60.1) to ensure compatibility across databases. Pathways with adjusted p-value < 0.05 and normalized enrichment score (NES) > 1 were considered significant.

[0153] Protein–Protein Interaction (PPI) Analysis

[0154] To explore protein interaction relationships among DEGs, PPI networks were constructed using the STRING database (v12.0, https: / / string-db.org). Then PPI interaction data were imported into R studio for further network analysis. Network topology analysis was performed using igraph (v2.3.0) package to identify hub genes. Node degree (the number of direct interactions) was calculated for each gene, and genes with the highest degree values were considered hub genes.

[0155] Quantitative PCR

[0156] Total RNA samples extracted from zebrafish brains were reverse- transcribed into cDNA using SuperScript™ IV First-Strand Synthesis System per the manufacturer's protocol. (ThermoFisher Scientific, Waltham, Massachusetts). The resulting cDNA products were amplified by qPCR, using SYBR Green qPCR Master Mix (GlpBio Technology Inc, Montclair, California) in a Bio-Rad CFX Connect Real-Time System (Bio-Rad, Hercules, California). Data were normalized to the housekeeping gene Beta-actin. Primers were designed using the National Center for Biotechnology Information (NCBI) Primer-BLAST and synthesized by Eurofins Genomics (Louisville, Kentucky). Primer sequences are shown in Table 10 (see SEQ ID Nos.19-36).

[0157] Table 10: Design of quantitative PCR (qPCR) primer sequences for key zebrafish circadian rhythm genes. Gn PCR rim r d i n (5' 3')3915-P1371WO.UW -36-ATGTCCCTGGCACTGTGAAG (SEQ ID 1 F d NO 19 D D G3915-P1371WO.UW -37-GACACGAACAACACAGGTGG (SEQ 1d1 F d ID NO 35 D[ ] ce on r e ( ), me ano ( e ), ammonium acetate, and acetic acid, all LC-MS grade, were purchased from Fisher Scientific (Pittsburgh, PA). Ammonium hydroxide was bought from Sigma-Aldrich (Saint Louis, MO). DI water was provided in-house by a Water Purification System from EMD Millipore (Billerica, MA). PBS was bought from GE Healthcare Life Sciences (Logan, UT). The standard compounds corresponding to the measured metabolites were purchased from Sigma-Aldrich (Saint Louis, MO) and Fisher Scientific (Pittsburgh, PA).

[0160] Zebrafish intestine tissue samples (~10-12 mg) were homogenized in 200 μL MeOH:PBS (4:1, v:v, containing 1,810.5 ^M13C3-lactate and 142 ^M13C5-glutamic Acid) in an Eppendorf tube using a Bullet Blender homogenizer (Next Advance, Averill Park, NY). Then 800 μL MeOH:PBS (4:1, v:v, containing 1,810.5 ^M13C3-lactate and 142 ^M13C5-glutamic Acid) was added, and after vortexing for 10 s, the samples were stored at -20 °C for 30 min. The samples were then sonicated in an ice bath for 30 min. The samples were centrifuged at 14,000 RPM for 10 min (4 °C), and 800 μL supernatant was transferred to a new Eppendorf tube. The samples were then dried under vacuum using a CentriVap Concentrator (Labconco, Fort Scott, KS). Prior to MS analysis, the obtained residue was reconstituted in 150 ^L 40% PBS / 60% ACN. A quality control (QC) sample was pooled from all the study samples.

[0161] The untargeted LC-MS metabolomics method used here was modeled after protocols known to one of ordinary skill in the art. Briefly, all LC-MS experiments were performed on a Thermo Vanquish UPLC-Exploris 240 Orbitrap MS instrument (Waltham, MA). Each sample was injected twice, 10 μL for analysis using negative ionization mode and 4 μL for analysis using positive ionization mode. Both chromatographic separations were performed in hydrophilic interaction chromatography (HILIC) mode on a Waters XBridge BEH Amide column (150 x 2.1 mm, 2.5 μm particle size, Waters Corporation, Milford, MA). The flow rate was 0.3 mL / min, auto-sampler temperature was kept at 4 °C, and the column compartment was set at 40 °C. The mobile3915-P1371WO.UW -38-phase was composed of Solvents A (10 mM ammonium acetate, 10 mM ammonium hydroxide in 95% H2O / 5% ACN) and B (10 mM ammonium acetate, 10 mM ammonium hydroxide in 95% ACN / 5% H2O). After the initial 1 min isocratic elution of 90% B, the percentage of Solvent B decreased to 40% at t=11 min. The composition of Solvent B maintained at 40% for 4 min (t=15 min), and then the percentage of B gradually went back to 90%, to prepare for the next injection. Using mass spectrometer equipped with an electrospray ionization (ESI) source, untargeted data from 70 to 1050 m / z may be collected.

[0162] To identify peaks from the MS spectra, in-house chemical standards (~600 aqueous metabolites) were used, and in addition, the resulting MS spectra were searched against the HMDB library, Lipidmap database, METLIN database, as well as commercial databases including mzCloud, Metabolika, and ChemSpider. The absolute intensity threshold for the MS data extraction was 1,000, and the mass accuracy limit was set to 5 ppm. Identifications and annotations used available data for retention time (RT), exact mass (MS), MS / MS fragmentation pattern, and isotopic pattern. The Thermo Compound Discoverer 3.3 software was used for aqueous metabolomics data processing. The untargeted data were processed by the software for peak picking, alignment, and normalization. To improve rigor, only the signals / peaks with CV < 20% across quality control (QC) pools, and the signals showing up in >80% of all the samples were included for further analysis.

[0163] Metabolomics Data Analysis

[0164] Metabolomics data preprocessing and analysis were performed using the online platform MetaboAnalyst 6.0 (https: / / www.metaboanalyst.ca). Pathway enrichment analysis was conducted within MetaboAnalyst using the Enrichment Analysis module to identify significantly metabolic pathways. For visualization, heatmaps of selected metabolites were generated in R studio using the ComplexHeatmap (v2.20.0) packages.

[0165] Fecal Matter Collection

[0166] At 25 days post-fertilization, following feeding, zebrafish were transferred from nursery tanks into petri dishes, with 50 fish per dish, containing fish husbandry facility-conditioned water. After three hours, the fish were moved to fresh petri dishes, and the water containing fecal matter was collected and centrifuged. The supernatant was discarded, and the fecal matter pellet was immediately flash-frozen in liquid nitrogen and stored at -80°C.

[0167] Metagenomics3915-P1371WO.UW -39-

[0168] Microbial DNA was isolated from frozen zebrafish fecal matter using Quick-DNA Fecal / Soil Microbe Microprep Kit (Zymo Research, Irvine, California) by following the manufacturer's protocol. DNA concentrations were quantified using a NanoDrop 1000 Spectrophotometer (Thermo Scientific, Waltham, Massachusetts) at 260ௗnm. Sample QC was performed with Microplate Reader for concentration and Agarose Gel Electrophoresis for integrity. DNA samples was fragmented by ultrasound using the Covaris instrument. Short DNA fragments meeting the target length requirements (300- 400 base pairs) were obtained by adjusting the breaking parameters. The fragmented samples were selected using the Agencourt AMPure XP-Medium kit, and the sample bands were concentrated at ~ 300-400 bp. Purified DNA samples were quantified using the Qubit dsDNA HS Assay Kit 500 assays kit. The double-stranded DNA ends were repaired, and the "A" base was added at the 3' end. An adapter was connected to DNA. Ligation products were amplified by PCR. The amplified products were subjected to fragment screening using Agencourt AMPure XPMedium. The PCR products were detected with an Agilent 2100 Bioanalyzer. After the PCR products are denatured into single stranded DNA, a cyclization reaction was performed to obtain a single-chain circular product. A final library is obtained after the uncyclized linear DNA molecules were removed by enzyme digestion. Fragment size and concentration of the library were detected using an Agilent 2100 bioanalyzer (Agilent DNA 1000 Reagents). Single-stranded circular DNA molecules were replicated by rolling circle amplification to obtain DNBs that each contained more than 300 copies of the molecule. The DNBs were loaded into a patterned nanoarray to acquire 150 bp paired-end reads. The sequencing was conducted on the MGI T7 platform.

[0169] Metagenomics Data Analysis

[0170] 150 bp paired-end sequencing data for each sample was obtained. Initial quality control was performed using FastQC to assess read quality, and all samples were deemed to be of high quality. To remove host-derived sequences, raw FASTQ files were aligned to the Danio rerio reference genome (GRCz11) using Bowtie 2125 with default parameters. Only unmapped reads—those that did not align to the zebrafish genome—were retained for downstream microbial taxonomic analysis. On average, approximately 20 million non-zebrafish reads per sample were retained. The microbial origin of the remaining reads were inferred using Kraken 2126,127 (v2.1.3) with the Standard Kraken database. Kraken was run with default settings except for a modified classification threshold requiring a minimum of three overlapping k-mers to assign a read to a taxon,3915-P1371WO.UW -40-which is slightly more conservative than the default setting (two k-mers). This modification was made to increase classification specificity while maintaining sensitivity. Across samples, at least 40% of the non-host reads were classified as bacterial. To estimate read counts at different taxonomic levels, Bracken128 (Bayesian Reestimation of Abundance after Classification with Kraken) was used to re-estimate species, genus, and higher-level abundances from Kraken output files.

[0171] For differential abundance and prevalence analyses between treatment groups (CPF vs. DMSO), the MaAsLin 3 (Microbiome Multivariable Associations with Linear Models) R package129 was used, designed to model both abundance (based on read counts) and prevalence (based on presence / absence) while accounting for the compositional nature of microbiome data. Prior to modeling, abundance data were normalized using total sum scaling (TSS), dividing each feature count by the total count per sample to account for differences in library size. The normalized dataset was split into two matrices: a binary prevalence matrix (presence / absence) and a non-zero abundance matrix for quantitative analysis. All metagenomics data analyses were conducted using R version 4.4.0 (2024-04-24) on a CentOS Linux 7 (Core) platform (x86_64-pc-linux-gnu).

[0172] Griess Assay

[0173] To measure nitrite levels following CPF exposure, 85 embryos were exposed to 15 μM CPF or DMSO control from 0 to 3 dpf and collected at 6 dpf. After being weighed, larvae were washed, homogenized in 100 μL water, and centrifuged to collect the supernatants. The Griess assay was performed using the Griess Reagent Nitrite Measurement Kit (Cell Signaling Technology, #13547) according to the manufacturer's instructions. Each group was analyzed in triplicate.

[0174] While illustrative embodiments have been illustrated and described, it will be appreciated that various changes can be made therein without departing from the spirit and scope of the invention.3915-P1371WO.UW -41-

Claims

CLAIMS The embodiments of the invention in which an exclusive property or privilege is claimed are defined as follows:

1. A method for treating organophosphate induced social deficits in a subject, comprising administering to a subject in need thereof a therapeutically effective amount of an HDAC inhibitor selected from the group consisting of valproic acid, butyric acid, BRD- 6929, RGFP966, pharmaceutically acceptable salts thereof, and combinations thereof.

2. The method of claim 1, wherein the HDAC inhibitor is valproic acid, or a pharmaceutically acceptable salt thereof.

3. The method of claim 2, wherein the HDAC inhibitor is butyric acid, or a pharmaceutically acceptable salt thereof.

4. The method of claim 3, wherein the HDAC inhibitor is sodium butyrate.

5. The method of claim 2, wherein the HDAC inhibitor is BRD-6929, or a pharmaceutically acceptable salt thereof.

6. The method of claim 1, wherein the HDAC inhibitor is RGFP966, or a pharmaceutically acceptable salt thereof.

7. The method of any one of claims 1 to 6, wherein the subject has been diagnosed with a disease or disorder characterized by social deficits.

8. The method of claim 7, wherein the disease or disorder characterized by social deficits is autism spectrum disorder.

9. The method of any one of claims 1 to 8, wherein the subject does not have a second condition that requires treatment with the HDAC inhibitor.

10. The method of any one of claims 1 to 6, further comprising monitoring the subject for a change in the severity of social deficits.

11. The method of any one of claims 1 to 6, wherein administering to a subject in need thereof comprises oral administration.3915-P1371WO.UW -42-12. The method of any one of claims 1 to 6, wherein administering to a subject in need thereof comprises cranial or spinal administration.

13. The method of any one of claims 1 to 6, wherein administering to a subject in need thereof comprises administering with an administration frequency selected from the group consisting of daily administration, weekly administration, biweekly administration, and monthly administration.

14. The method of any one of claims 1 to 13, wherein the subject is a human.3915-P1371WO.UW -43-