Chimeric antigen receptors targeting bcma

Circular RNA constructs with IRES encoding BCMA binding molecules, delivered via lipid nanoparticles, address the limitations of CAR-T therapies by enhancing efficacy and reducing toxicity in cancer treatment.

WO2026072709A1PCT designated stage Publication Date: 2026-04-02ORNA THERAPEUTICS INC +1
View PDF 45 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/047769
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2025-06-17
Filing Date
2025-09-24
Publication Date
2026-04-02

AI Technical Summary

Technical Problem

CAR-T therapies for cancer treatment face significant challenges including toxic side effects such as cytokine release syndrome, neurotoxicity, and complex procedures, and BCMA-targeted CAR-T cells have limited long-term efficacy in multiple myeloma.

Method used

Development of circular RNA constructs with an internal ribosome entry site (IRES) encoding a BCMA binding molecule, delivered via lipid nanoparticles, to target BCMA and treat cancer, bypassing lymphodepletion and enhancing therapeutic efficacy.

Benefits of technology

The circular RNA constructs provide stable and tissue-specific delivery of BCMA-targeting CARs, reducing toxic side effects and improving the duration and efficacy of cancer treatment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025047769_02042026_PF_FP_ABST
    Figure US2025047769_02042026_PF_FP_ABST
Patent Text Reader

Abstract

Provided herein are RNA sequences encoding a chimeric antigen receptor (CAR) comprising a B-cell maturation antigen (BCMA) binding molecule, along with related compositions and methods. In some embodiments, circular RNAs encoding the BCMA binding molecule or BCMA CAR, along with related compositions, methods, and precursors, are described herein. In some embodiments, these compositions comprise a transfer vehicle, e.g., comprising an ionizable lipid described herein.
Need to check novelty before this filing date? Find Prior Art

Description

CHIMERIC ANTIGEN RECEPTORS TARGETING BCMA CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of priority of U.S. Provisional Application No. 63 / 699,026, filed September 25, 2024, U.S. Provisional Application No.63 / 743,962, filed January 10, 2025, and U.S. Provisional Application No.63 / 825,337, filed June 17, 2025, the contents of which are hereby incorporated by reference in their entirety for all purposes. SEQUENCE LISTING XML

[0002] This application contains a Sequence Listing which has been submitted electronically in XML format. The Sequence Listing XML is incorporated herein by reference. Said XML file, created on September 23, 2025, is named OBS-046WO_SL.xml and is 5,926,347 bytes in size. BACKGROUND

[0003] Adoptive T-cell immunotherapy is a rapidly growing field, in particular, in cancer treatments. However, while CAR-T therapies have become an important tool in cancer treatments, they have toxic side effects and involve complex procedures. Treatment with CAR- T can lead to a large and rapid release of cytokines into the blood and can cause cytokine release syndrome (CRS) or CAR-T cell-related encephalopathy syndrome (CRES), also referred to as neurotoxicity associated with CAR-T. CRS is the most common and well-described toxicity associated with CAR-T therapy, occurring in over 90% of patients at any grade and is characterized by high fever, hypotension, hypoxia and / or multiple organ toxicity and can lead to death. Neurotoxicity is characterized by damage to nervous tissue that can cause tremors, encephalopathy, dizziness or seizures. Additionally, prior to infusion, the patients generally undergo lymphodepletion. Lymphodepletion is known to increase CAR-T cell expansion and enhance efficacy of infused CAR-T cells by, for example, altering the tumor phenotype and microenvironment. However, lymphodepletion agents often cause side effects to the patients. For example, lymphodepletion can cause neutropenia, anemia, thrombocytopenia, and immunosuppression, leading to a greater risk of infection, along with other toxicities. In addition to the toxicities associated with targeted CAR-T therapies, there are procedures, specialized equipment, and costs involved in producing the modified lymphocytes. CAR-T therapies require an assortment of protocols to isolate, genetically modify, and selectively expand the redirected cells before infusing them back into the patient.

[0004] “CAR T cells are now an established treatment for patients with relapsed and / or refractory B cell lymphomas, B cell acute lymphoblastic leukaemia and multiple myeloma.” Cappell & Kochenderfer, Long-term outcomes following CAR T cell therapy: what we know so far, Nature Reviews Clinical Oncology (2023). However, while “over a decade of follow- up data are available from the initial patients who received CD19-targeted CAR T cells for B cell malignancies,” the follow-up data “on the outcomes of patients who received B cell maturation antigen (BCMA)-targeted CAR T cells for multiple myeloma are more limited owing to the more recent development of these constructs.” Id. “Overall, the data demonstrate that CD19-targeted CAR T cells can induce prolonged remissions in patients with B cell malignancies” and “[b]y contrast, remissions induced by BCMA-targeted CAR T cells are typically more short-lived.” Id.

[0005] Circular RNA (circRNA or oRNA®) is a stable form of RNA that provides an advantage compared to linear RNA in structure and function, especially in the case of molecules that are prone to folding in an inactive conformation (Wang and Ruffner, 1998). Circular RNA polynucleotides lack the free ends necessary for exonuclease-mediated degradation, causing them to be resistant to several mechanisms of RNA degradation and granting extended half-lives when compared to an equivalent linear RNA. Circularization may allow for the stabilization of RNA polynucleotides that generally suffer from short half-lives and may improve the overall efficacy of exogenous mRNA in a variety of applications. Circular RNA can also be particularly interesting and useful for in vivo applications, especially in the research area of RNA-based control of gene expression and therapeutics.

[0006] Because circRNAs are more stable and can be expressed in tissue-specific manner, and because using circRNAs can avoid the lymphodepletion step of traditional therapies, circRNAs provide an attractive alternative to traditional CAR therapies and other therapies. Accordingly, provided herein are circular RNA constructs that comprise an internal ribosome entry site (IRES) and at least one expression sequence encoding a BCMA binding molecule. In certain embodiments, the binding molecule encodes a CAR that targets BCMA, for use in treating cancer. The circular RNA can be formulated with a transfer vehicle to facilitate and / or enhance the delivery and release of circRNA to one or more target cells. Accordingly, lipid nanoparticles (LNPs) or other transfer vehicles containing ionizable lipids may be used to deliver the circular RNA described herein, for example, to a patient in need of treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0007] Figures 1A-1F shows a schematic of selected internal ribosome entry sites (IRES)selected for construct design of oRNA. FIG.1A depicts a general sequence construct of a linear RNA polynucleotide precursor (10). The sequence as provided is illustrated in a 5’ to 3’ order of a 5’ enhanced intron element (20), a 5’ enhanced exon element (30), a core functional element (40), a 3’ enhanced exon element (50) and a 3’ enhanced intron element (60). FIG. 1B shows an exemplary linear RNA polynucleotide precursor (10) comprising in the following 5’ to 3’ order, a leading untranslated sequence (21), a 5’ affinity tag (22), a 5’ external spacer (26), a 3’ intron fragment (28), a 3’ exon fragment (32), a 5’ internal duplex region (34), a 5’ internal spacer (36), a TIE (42), a coding element (46), a stop region (48), a 3’ internal spacer (52), a 3’ internal duplex region (54), a 5’ exon fragment (56), a 5’ intron fragment (62), a 3’ external spacer (64), a 3’ affinity tag (68), and a terminal untranslated sequence (69). FIG. 1C illustrates exemplary locations for an accessory element (70) (e.g., a miRNA binding site) included in a linear RNA polynucleotide located within the core functional element (40), for example where 42 is the TIE (translation initiation element), 46 is the coding region, 47 is the noncoding region, and 48 is the stop region (stop codon or stop cassette). IRES candidates (i.e., synthetic and non-synthetic IRES) were ranked according to: (1) absorbance profile of the polysome species contained in sucrose gradients collected from cells translating circular RNAs having the IRES (depicted in FIG.1D); and (2): half-life of circular RNAs having the IRES (illustrated in FIG. 1E). FIG. 1F depicts the combined relationship between the polysome absorbance profile and the half-life stability used to select the IRES candidates.

[0008] Figures 2A-2B depicts mean fluorescent intensity (gMFI) of human T cells post electroporation of circular RNAs encoding a CD19-CD28ζ (control), BCMA-41BBζ, or BCMA-CD28ζ chimeric antigen receptor (CAR). The circular RNAs were generated from an IVT reaction of DNA Templates 1-4, 7-12. The human T cells were treated with commercially available soluble BMCA detection reagent containing R-phycoerythrin (PE) fluorophore (indicated as “sBCMA-PE”). “Mock” as indicated in FIGs.2A-2B represents a “mock control” comprising T cells not electroporated with circular RNA.

[0009] Figures 3A-3B illustrates calculated tumor cell killing within MM1S cells via percent cytotoxicity (indicated as “% cytotoxicity”) at either 24 hours (FIG.3A) or 48 hours (FIG. 3B) post electroporation of circular RNAs encoding CD19-CD28ζ (control), BCMA- 41BBζ, or BCMA-CD28ζ chimeric antigen receptor (CAR). The circular RNAs were generated from an IVT reaction of DNA templates 1, 2, 7-12. % cytotoxicity has been normalized to the mock control (indicated as “Mock”) comprising T cells not electroporatedwith circular RNA. A varying effector-to-target (indicated as “E:T”) ratio was used (i.e., ranged up to 1:1 E:T).

[0010] Figures 4A-4D illustrates tumor burden measured by total flux in photons per second (p / s) within U266B1 inoculated mice post injection of circular RNA encoding an anti- BCMA CAR (FIGs.4A-4B), anti-CD19 CAR (FIG.4C) or anti-HER2 CAR (FIG.4D). The circular RNAs were generated from an IVT reaction of DNA templates 2-5. The circular RNAs were formulated with lipid nanoparticles (LNP) comprising Formulation A. “Tumor only” as indicated in FIGs. 4A-4D were negative control mice that received no additional treatment (e.g., no circular RNA or PBMC engraftment). “Tumor +PBMC” as indicated in FIGs.4A- 4D were negative control mice that received PBMC engraftment but were not injected with circular RNA. Formulation A was utilized for these experiments.

[0011] Figures 5A-5F illustrate tumor burden measured by total flux in photons per second (p / s) within U266B1 inoculated mice post injection of circular RNA encoding an anti-BCMA CAR (FIGs.5B-5F) or control anti-HER2 CAR (FIG.5A). The circular RNAs were generated from an IVT reaction of DNA templates 2,5, 7-10. The circular RNAs were formulated with lipid nanoparticles (LNP) comprising Formulation A. “Tumor only” as indicated in FIGs. 5A-5F were negative control mice that received no additional treatment (e.g., no circular RNA or PBMC engraftment). “Tumor +PBMC” as indicated in FIGs.5A-5F were negative control mice that received PBMC engraftment but were not injected with circular RNA. Formulation IA was utilized for these experiments.

[0012] Figures 6A-6E illustrate tumor burden measured by total flux in photons per second (p / s) within U266B1 inoculated mice post injection of circular RNA encoding an anti-BCMA CAR or control anti-HER2 CAR. The circular RNAs were developed from an IVT reaction of DNA templates 2, 10, or 5 (Her2 CAR Control). The circular RNAs were formulated with lipid nanoparticles (LNP) comprising Formulation A (FIGs. 6A, 6B, and 6D) or Formulation B (FIGs. 6A, 6C, and 6E). “Tumor only” as indicated in FIGs. 6A-6E were negative control mice that received no additional treatment (e.g., no circular RNA or PBMC engraftment). “Tumor +PBMC” as indicated in FIG. 6A was negative control mice that received PBMC engraftment but were not injected with circular RNA.

[0013] Figures 7A-7D depict a graphical representation of the flow cytometry results collected in human CD3+ T cells post transfection of LNPs formulated with circular RNA encoding an anti-BCMA chimeric antigen receptor (CAR). Anti-BCMA CARs comprised Binder 2, Binder 7 (FIGs.7A or 7D), Binder 8 (FIG. 7B) or a combination of Binder 7 andBinder 8 (FIG.7C) and a CD28ζ (FIGs.7A-7C) or 4-1BBζ costimulatory domain (FIG.7D). The circular RNAs were generated from an IVT reaction of DNA Templates 2, 7-46. Circular RNAs further comprise an internal ribosome entry site (IRES) comprising a sequence of from Table 9, Nos. 19, 20, 26-33. BMCA CAR expression was measured using a soluble BCMA detection reagent containing R-phycoerthrin (PE) fluorophore. “Mock” control are T cells that were not electroporated with circular RNAs.

[0014] Figures 8A-8D illustrates expression of BCMA CAR (depicted as % soluble BMCA detection reagent in FIGs. 8A and 8C) and intensity of expression (depicted as geometric mean fluorescence intensity (gMFI) in FIGs.8B and 8D) collected in human CD3+ T cells 24-72 hours post transfection of LNPs formulated with circular RNA encoding an anti- BCMA chimeric antigen receptor (CAR). Anti-BCMA CARs comprised Binder 2, Binder 7, Binder 8 or a combination of Binder 7 and Binder 8 and a CD28ζ or 4-1BBζ costimulatory domain). Circular RNAs further comprise an internal ribosome entry site (IRES) comprising a sequence of IRES A-IRES J (i.e., IRES Nos. 19, 20, 26-33 of Table 9). BMCA CAR expression was measured using a soluble BCMA detection reagent containing R-phycoerthrin (PE) fluorophore. “Mock” control are T cells that were not electroporated with circular RNAs.

[0015] Figures 9A-9D depict a graphical representation of the flow cytometry results collected in cynomolgus CD3+ T cells post transfection of LNPs formulated with circular RNA encoding an anti-BCMA chimeric antigen receptor (CAR) for two different donors (left and right). Anti-BCMA CARs comprised Binder 2, Binder 7 (FIGs. 9A or 9D), Binder 8 (FIG. 9B) or a combination of Binders 7 and Binder 8 (FIG.9C) and a CD28ζ (FIGs.9A-9C) or 4- 1BBζ costimulatory domain (FIG. 9D). The circular RNAs were generated from an IVT reaction of DNA Templates 2, 7-46. Circular RNAs further comprise an internal ribosome entry site (IRES) comprising a IRES from Table 9, Nos.19-20, 26-33. BMCA CAR expression was measured using a soluble BCMA detection reagent containing R-phycoerthrin (PE) fluorophore. “Mock” control are T cells that were not electroporated with circular RNAs.

[0016] Figures 10A-10D illustrate expression of BCMA CAR (depicted as % soluble BMCA detection reagent in FIGs. 10A and 10C) and intensity of expression (depicted as geometric mean fluorescence intensity (gMFI) in FIGs.10B and 10D) collected in cynomolgus CD3+ T cells 24-72 hours post transfection of LNPs formulated with circular RNA encoding an anti-BCMA chimeric antigen receptor (CAR). Anti-BCMA CARs comprised Binder 2, Binder 7, Binder 8 or a combination of Binder 7 and Binder 8 and a CD28ζ or 4-1BBζ costimulatory domain). Circular RNAs further comprise an internal ribosome entry site (IRES)comprising a sequence of IRES A-IRES J (i.e., IRES Nos.19, 20, 26-33 of Table 9). BMCA CAR expression was measured using a soluble BCMA detection reagent containing R- phycoerthrin (PE) fluorophore. “Mock” control are T cells that were not electroporated with circular RNAs.

[0017] Figures 11A-11C show anti-BCMA CAR expression and intensity of expression 24 hours post transfection of circular RNAs encoding anti-BCMA CARs formulated with a lipid nanoparticle and dosed at 10 ng, 30 ng, or 100 ng per 0.1 x 106human T cells. BCMA CAR expression and intensity was measured using soluble BCMA detection reagent (indicated as “sBCMA-PE”). The circular RNAs were developed from an IVT reaction of DNA Templates 1, 2, 7-10. FIG.11A shows a graphical representation of the flow cytometry results. FIGs. 11B and 11C illustrate % sBCMA-PE detected and geometric mean fluorescence intensity (gMFI) respectively. “Mock” control are T cells that were not electroporated with circular RNAs.

[0018] Figures 12A-12B illustrate calculated tumor cell killing within MM1S cells via percent cytotoxicity (indicated as “% cytotoxicity”) at either 24 hours post electroporation of circular RNAs encoding a CD19-41BBζ (control), CD19-CD28ζ (control), BCMA-41BBζ, or BCMA-CD28ζ chimeric antigen receptor (CAR). The circular RNAs were developed from an IVT reaction of DNA Templates 1, 2, 7-10. Anti-BCMA CARs comprised Binder 2, 7, 8, or a combination of Binders 7 and 8. % cytotoxicity has been normalized to the mock control (indicated as “Mock”) comprising T cells not electroporated with circular RNA. A varying effector-to-target (indicated as “E:T”) ratio of 1:3 E:T ratio (FIG.12A) or 1:5 E:T ratio (FIG. 12B).

[0019] Figures 13A-13B show anti-BCMA CAR expression and intensity of expression 24 hours post transfection of circular RNAs encoding anti-BCMA CARs formulated with a lipid nanoparticle using Formulation A and dosed at 200 ng per 0.1 x 106cynomolgus T cells. Anti-BCMA CAR expression and intensity was measured using soluble BCMA detection reagent (indicated as “sBCMA-PE”). Anti-BCMA CARs comprised Binder 7, Binder 8, or a combination of Binders 7 and Binder 8. FIGs.13A and 13B illustrate % sBCMA-PE detected and geometric mean fluorescence intensity (gMFI) respectively. “Mock” control are T cells that were not electroporated with circular RNAs. Circular RNAs engineered from DNA Template 2 were used for comparison purposes. Circular RNAs further comprised IRES A-J (i.e., IRES Nos.19, 20, 26-33 from Table 9).

[0020] Figures 14A-14C illustrate calculated tumor cell killing within MM1S (FIG.14A),human BCMA (“huBCMA”) (FIG.14B), or cynomolgus BCMA (“cyBCMA”) (FIG.14C) cells via percent cytotoxicity (indicated as “% cytotoxicity”) at either 24 hours post electroporation of circular RNAs encoding a CD19-41BBζ (control), CD19-CD28ζ (control), BCMA-41BBζ, or BCMA-CD28ζ chimeric antigen receptor (CAR). The anti-BCMA and anti-CD19 CARs comprise either Binder 2, Binder 7, Binder 8, or a combination of Binder 7 and Binder 8. Circular RNAs were generated from an IVT reaction of DNA templates comprising IRES A-J (i.e., IRES Nos. 19, 20, 26-33 of Table 9). % cytotoxicity has been normalized to the mock control (indicated as “Mock”) comprising T cells not electroporated with circular RNA.

[0021] Figures 15A-15B illustrates anti-BCMA CAR expression (FIGs. 15A and 15B) and % cytologic killing (FIG. 15C) 24 or 48 hours post transfection of “Mock” (i.e., 0ng), 200 ng, or 500 ng of circular RNA encoding anti-BCMA CAR or HER2 CAR to cynomolgus T cells. FIG.15A depicts % soluble BCMA-PE detection reagent of the cynomolgus T cells. FIG. 15B depicts geometric mean fluorescence intensity (gMFI) of the cynomolgus T cells. Circular RNAs were generated in FIGs.15A-15B from an IVT reaction on DNA Template 2. Circular RNAs were generated in FIG.15C from an IVT reaction on DNA Template 1, 2, or 5.

[0022] Figures 16A-16B show anti-BCMA CAR expression depicted as geometric mean fluorescence intensity gMFI in human T cells (FIG. 16A) and in cynomolgus T cells (FIG. 16B) 24 hours post transfection of circular RNA comprising an internal ribosome entry site (IRES) (comprising IRES A-J (i.e., IRES NOs. 19, 20, 26-33 from Table 9)) and encoding a BCMA-CD28ζ CAR (comprising Binder 7 or Binder 8). “Mock” control are T cells that were not electroporated with circular RNAs. LNP Formulation B was utilized in these experiments.

[0023] Figure 17A-17B depicts cynomolgus BCMA CAR T cells tumor cell killing as compared to human BCMA CAR T cells in co-cultured MM1S cells. Cynomolgus and human BCMA CAR T cells comprising Binders 2, 7, or 8. Circular RNAs were engineered from DNA Templates comprising IRES A-C, G, or I.

[0024] Figures 18A-18B show anti-BCMA CAR expression and intensity of expression 24 hours post transfection of circular RNAs encoding anti-BCMA CARs formulated with a lipid nanoparticle and dosed at 200 ng per 0.1 x 106cynomolgus T cells. Anti-BCMA CAR expression and intensity was measured using soluble BCMA detection reagent (indicated as “sBCMA-PE”). FIGs.18A and 18B illustrate % sBCMA-PE detected and geometric mean fluorescence intensity (gMFI) respectively. “Mock” control are T cells that were notelectroporated with circular RNAs. LNP Formulation B was utilized in these experiments. Anti-BCMA CAR comprised Binder 1, Binder 7 or Binder 8 or a combination of Binder 7 and Binder 8; and a costimulatory domain of either CD28ζ or 4-1BBζ. Circular RNAs comprised IRES A, C, K-O (i.e., IRES NOs.19-25).

[0025] Figures 19A-19B illustrate calculated tumor cell killing within MM1S cells (FIG. 19A) or cynomolgus K562 cells (FIG. 19B) via percent cytotoxicity (indicated as “% cytotoxicity”) at either 24 hours (left) or 48 hours (right) post electroporation of circular RNAs encoding a CD19-41BBζ (control), CD19-CD28ζ (control), BCMA-41BBζ, or BCMA- CD28ζ chimeric antigen receptor (CAR). The anti-BCMA and anti-CD19 CARs comprise Binder 1, Binder 2, Binder 7, Binder 8 or a combination of Binder 7 and Binder 8. % cytotoxicity has been normalized to the mock control (indicated as “Mock”) comprising T cells not electroporated with circular RNA. The circular RNAs comprise IRES A, C, K-O.

[0026] Figures 20A-20H illustrate % expression (% soluble BCMA-PE) (FIG. 20A) intensity of expression of BCMA CAR (depicted as geometric mean fluorescence intensity (gMFI) in FIG. 20B) collected in cynomolgus CD3+ T cells post transfection of LNPs formulated with circular RNA encoding an anti-BCMA chimeric antigen receptor (CAR), and killing of tumor cells (% cytotoxicity) (in FIGs.20C-20H) within the T cells co-cultured with cynomolgus K562 cells at 48 hours (left) or after 24 hours (right). Anti-BCMA CARs comprise Binder 7 or 8, or Binder 2 (within control circular RNA engineered from DNA Template 2). Circular RNAs further comprise an internal ribosome entry site (IRES) comprising IRES A. C or O. BMCA CAR expression was measured using a soluble BCMA detection reagent containing R-phycoerthrin (PE) fluorophore. “Mock” control are T cells that were not electroporated with circular RNAs. LNP Formulation B was utilized in these experiments.

[0027] Figures 21A-21C illustrate tumor burden represented by IVIS imaging (FIG.21A) and total flux (FIG. 21B-FIG. 21C) in photons per seconds (p / s) post in vivo injection of 1 mpk of circular RNA encoding BCMA-CD28ζ or BCMA-41BBζ CAR into NGS mice. “No TA” as indicated in FIGs.21A-21C refers to NGS mice treated with

[0028] Figures 22A-22G illustrate tumor burden represented by IVIS imaging (FIG.22A) and total flux (FIGs.22B-22G) in photons per seconds (p / s) post in vivo injection of 0.1 mpk or 0.3 mpk of circular RNA encoding BCMA-CD28ζ, BCMA-41BBζ CAR, or HER2-CD28ζ CAR (Control). As shown in FIGs.22A-22G, “28z” indicates a CD28ζ costimulatory domain and “BBz” indicate a 4-1BBζ costimulatory domain.

[0029] Figures 23A-23H illustrates tumor burden represented by total flux in photons perseconds (p / s) post in vivo injection of 0.1 mpk (left) or 0.03 mpk (right) of circular RNA encoding BCMA-CD28ζ, BCMA-41BBζ CAR, or HER2-CD28ζ (control) CAR (FIG.23B). Anti-HER 2 CAR (control) comprise Binder 5. Anti-BCMA CAR comprise either Binder 7 or 8.

[0030] Figure 24A shows % plasma cells measured by flow cytometry following administration of anti-BCMA oCAR (BCMA panCAR) formulated in LNP formulation F-Z4 at 0.3 mg / kg, with dexamethasone pretreatment, to non-human primate as compared to PBS control. Figure 24B shows ddPCR of plasma cell-specific RNA transcripts following administration of anti-BCMA oCAR (BCMA panCAR) formulated in LNP formulation F-Z4 at 0.3 mg / kg, with dexamethasone pretreatment, to non-human primate as compared to PBS control.

[0031] Figure 25 shows tumor burden (total flux p / s) over time for BCMA circular RNA (oRNA) CAR (oCAR) and BCMA linear RNA (mRNA) CAR (mCAR) compared to controls.

[0032] Figure 26 shows exemplary tumor burden (IVIS imaging) over time for BCMA oCAR and BCMA mCAR.

[0033] Figure 27A shows % of anti-BCMA CAR for BCMA oCAR and BCMA mCAR.

[0034] Figure 27B shows gMFI of anti-BCMA CAR for BCMA oCAR and BCMA mCAR.

[0035] Figure 27C shows % cytotoxicity for BCMA oCAR and BCMA mCAR.

[0036] Figure 28 shows anti-BCMA CAR expression in the peripheral blood of non- human primates treated with 1 mg / kg anti-BCMA CAR oRNA, anti-BCMA CAR mRNA, or control.

[0037] Figure 29 shows J-chain3 plasma cell-specific transcripts in the peripheral blood of non-human primates treated with 1 mg / kg anti-BCMA CAR oRNA (“panCAR”), anti- BCMA CAR mRNA, or control. DETAILED DESCRIPTION

[0038] Reference will now be made in detail to certain embodiments, examples of which are illustrated in the accompanying drawings. While the disclosure is described in conjunction with the illustrated embodiments, it will be understood that they are not intended to limit the disclosure to those embodiments. On the contrary, the disclosure is intended to cover allalternatives, modifications, and equivalents, which may be included within the disclosure as defined by the appended claims and included embodiments.

[0039] Before describing the present teachings in detail, it is to be understood that the disclosure is not limited to specific compositions or process steps, as such may vary. It should be noted that, as used in this specification and the appended claims, the singular form “a”, “an” and “the” include plural references unless the context clearly dictates otherwise.

[0040] Numeric ranges are inclusive of the numbers defining the range. Measured and measurable values are understood to be approximate, taking into account significant digits and the error associated with the measurement. Also, the use of “comprise”, “comprises”, “comprising”, “contain”, “contains”, “containing”, “include”, “includes”, and “including” are not intended to be limiting. It is to be understood that both the foregoing general description and detailed description are exemplary and explanatory only and are not restrictive of the teachings.

[0041] Unless specifically noted in the specification, embodiments in the specification that recite “comprising” various components are also contemplated as “consisting of” or “consisting essentially of” the recited components; embodiments in the specification that recite “consisting of” various components are also contemplated as “comprising” or “consisting essentially of” the recited components; and embodiments in the specification that recite “consisting essentially of” various components are also contemplated as “consisting of” or “comprising” the recited components (this interchangeability does not apply to the use of these terms in the claims). The term “or” is used in an inclusive sense, i.e., equivalent to “and / or,” unless the context clearly indicates otherwise.

[0042] The section headings used herein are for organizational purposes only and are not to be construed as limiting the desired subject matter in any way. In the event that any material incorporated by reference contradicts any term defined in this specification or any other express content of this specification, this specification controls. While the present teachings are described in conjunction with various embodiments, it is not intended that the present teachings be limited to such embodiments. On the contrary, the present teachings encompass various alternatives, modifications, and equivalents, as will be appreciated by those of skill in the art. 1. DEFINITIONS

[0043] Unless stated otherwise, the following terms and phrases as used herein are intended to have the following meanings:

[0044] As used herein, linear nucleic acid molecules are said to have a “5’-terminus” (or“5’ end”) and a “3’-terminus” (or “3’ end”) because nucleic acid phosphodiester linkages occur at the 5’ carbon and 3’ carbon of the sugar moieties of the substituent mononucleotides. The end nucleotide of a polynucleotide at which a new linkage would be to a 5’ carbon is its 5’ terminal nucleotide. The end nucleotide of a polynucleotide at which a new linkage would be to a 3’ carbon is its 3’ terminal nucleotide. A “terminal nucleotide,” as used herein, is the nucleotide at the end position of the 3’- or 5’-terminus.

[0045] As used herein, the term “3’ intron segment” (or “3’ intron fragment”) refers to a sequence with at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% similarity to the 3’-proximal end of a natural intron (e.g., a group I or group II intron). In certain embodiments, the 3’ intron segment includes the 5’ nucleotide of the splice site dinucleotide. “3’ exon segment” (or “3’ exon fragment”) refers to a sequence with at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% similarity to the 5’-proximal end of an exon adjacent to a “3’ intron segment” as described herein. In certain embodiments, the 3’ exon segment includes the 3’ nucleotide of the splice site dinucleotide.

[0046] The term “5’ intron segment” (or “5’ intron fragment”) refers to a sequence with at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher 100% similarity to the 5’-proximal end of a natural intron (e.g., a group I or group II intron). In certain embodiments, the 5’ intron segment includes the 3’ nucleotide of the splice site dinucleotide. “5’ exon segment” (or “5’ exon fragment”) refers to a sequence with at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher 100% similarity to the 3’-proximal end of an exon adjacent to a “5’ intron segment” as described herein. In certain embodiments, the 5’ exon segment includes the 5’ nucleotide of the splice site dinucleotide.

[0047] In some embodiments, the 3’ intron segment and the 3’ exon segment together form a first portion of an autocatalytic or self-splicing intron-exon sequence. In some embodiments, the 5’ intron segment and the 5’ exon segment together form the remainder (i.e., second portion) of the autocatalytic or self-splicing intron-exon sequence. In these embodiments, a linear nucleic acid molecule, e.g., RNA, comprising the 3’ intron segment and the 3’ exon segment at the 5’ end of the linear nucleic acid molecule and further the 5’ intron segment and the 5’ exon segment at the 3’ end the linear nucleic acid molecule, is capable ofautocatalytically self-splicing and thereby capable of forming a circular nucleic acid molecule, e.g., circular RNA. In these embodiments, the 3’ intron segment and the 5’ intron segments are excised from the circular nucleic acid molecule, e.g., circular RNA, and the 3’ exon segment and the 5’ exon segment are retained in the circular nucleic acid molecule, e.g., circular RNA. Each retained post-splicing exon segment may be referred to as a self-splicing or self-spliced exon segment, e.g., a 3’ self-splicing or self-spliced exon segment and a 5’ self-splicing or self- spliced exon segment.

[0048] In some embodiments, the intron segment is a “Group I intron” and the corresponding exon segment may be referred to as a “Group I exon” or “Group 1 self-splicing exon” or “Group I self-spliced exon segment” or the like. In some embodiments, the intron segment is a “Group II intron” and the corresponding exon segment may be referred to as a “Group II exon” or “Group II self-splicing exon” or “Group II self-spliced exon segment” or the like.

[0049] In some embodiments, the retained, post-splicing, self-splicing 3’ or 5’ exon segment is a non-coding sequence in the circular nucleic acid molecule, e.g., circular RNA. In some embodiments, the circular nucleic acid molecule, e.g., circular RNA, further comprises a desired coding sequence, and the retained, post-splicing, self-splicing 3’ or 5’ exon segment is (e.g., designed) to be a portion of the desired expression sequence, contiguous with the desired coding sequence, and / or in frame with the desired coding sequence.

[0050] Within a circular nucleic acid molecule, e.g., derived from a linear nucleic acid precursor, and comprising a coding sequence, the 5’ to 3’ orientation of the coding sequence may be used to inform whether other sequences within the circular nucleic acid are 5’ and / or 3’, e.g., for example, 5’ is nearer to the 5’ of the coding sequence, and the 3’ end is downstream of the coding sequence. As used herein, within a circular nucleic acid molecule, e.g., derived from a linear nucleic acid precursor, reference to a “5’” or “3’” portion of the molecule may correspond to the orientation of the sequence within the linear nucleic acid precursor.

[0051] As used herein, “splice site” refers to the junction consisting of a dinucleotide between an exon and an intron in an unspliced RNA. As used herein, the term “splice site” refers to a dinucleotide that is partially or fully included in a group I or group II intron and / or exon and between which a phosphodiester bond is cleaved during RNA circularization. A “splice site dinucleotide” refers two nucleotides: a 5’ splice site nucleotide and the 3’ splice site nucleotide. A “5’ splice site” refers to the natural 5’ dinucleotide of the intron and / or exon e.g., group I or group II intron and / or exon, while a “3’ splice site” refers to the natural 3’ dinucleotide of the intron and / or exon. Exemplary splice site dinucleotides are shown in Table1 below. Table 1: Exemplary Splice Site Dinucleotides

[0052] As used herein, the term “permutation site” refers to a site in an intron and / or exon (e.g., a group I or II intron and / or exon) where a cut is made prior to permutation of the intron / or exon. For example, such a cut generates an intron sequence comprising a 3’ intron segment and a sequence comprising a 5’ intron segment (e.g., group I or group II intron fragments) that are permuted to be on either side of a stretch of precursor RNA to be circularized. The permuted intron segments are thereby called “3’ permuted intron segments” or “3’ permuted elements” and “5’ permuted intron segments” or “5’ permuted elements” in the context of said precursor RNA. As used herein, “permuted intron segment” and “permuted intron element” are used interchangeably. In some embodiments, the permutation site consists of a dinucleotide.

[0053] As used herein, the singular forms “a,” “an,” and “the” include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to “a cell” includes combinations of two or more cells, or entire cultures of cells; reference to “a polynucleotide” includes, as a practical matter, many copies of that polynucleotide.

[0054] A used herein, the terms “about,” or “approximately” are understood as within a range of normal tolerance in the art, for example within 2 standard deviations of the mean. “About” can be understood as within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, 0.1%, 0.09%, 0.08%, 0.07%, 0.06%, 0.05%, 0.04%, 0.03%, 0.02%, or 0.01% of the stated value. Unless otherwise clear from the context, all numerical values provided herein are modified by the term “about.”

[0055] As used herein, “accessory element” or “accessory sequences” refer to internal spacer(s), external spacer(s), and / or homology arm(s). As used herein, a “combined accessory element” or “combined accessory sequences” comprises the accessory element and further comprises an intron and / or exon segment. In some embodiments, the accessory element increases circularization efficiency and / or translation efficiency in a circular RNA as compared to a control circular RNA without the accessory sequences.

[0056] As used herein, an “affinity sequence” or “affinity tag” is a region of a polynucleotide sequence ranging from one (1) nucleotide to hundreds or thousands of nucleotides containing a repeated set of nucleotides for the purposes of aiding purification of a polynucleotide sequence. For example, an affinity sequence may comprise, but is not limited to, a polyA or polyAC sequence. In some embodiments, affinity tags are used in purification methods, referred to herein as “affinity-purification,” in which selective binding of a binding agent to molecules comprising an affinity tag facilitates separation from molecules that do not comprise an affinity tag. In some embodiments, an affinity-purification method is a “negative selection” purification method, in which unwanted species, such as linear RNA, are selectively bound and removed and wanted species, such as circular RNA, are eluted and separated from unwanted species.

[0057] An “antigen” refers to any molecule that provokes an immune response or is capable of being bound by an antibody or an antigen binding molecule. The immune response may involve either antibody production, or the activation of specific immunologically- competent cells, or both. A person of skill in the art would readily understand that any macromolecule, including virtually all proteins or peptides, may serve as an antigen. An antigen may be endogenously expressed, i.e. expressed by genomic DNA, or may be recombinantly expressed. An antigen may be specific to a certain tissue, such as a cancer cell, or it may be broadly expressed. In addition, fragments of larger molecules may act as antigens. In some embodiments, antigens are tumor antigens.

[0058] An “antigen binding molecule,” “antigen binding portion,” or “antibody fragment” refers to any molecule that specifically binds to a desired antigen. In someembodiments, an antigen binding molecule comprises the antigen binding parts (e.g., CDRs) of an antibody or antibody-like molecule. An antigen binding molecule may include the antigenic complementarity determining regions (CDRs). Examples of antibody fragments include, but are not limited to, Fab, Fab', F(ab')2, Fv fragments, dAb, linear antibodies, scFv antibodies, and multispecific antibodies formed from antigen binding molecules. Peptibodies (i.e., Fc fusion molecules comprising peptide binding domains) are another example of suitable antigen binding molecules. In some embodiments, the antigen binding molecule binds to an antigen on a tumor cell. In some embodiments, the antigen binding molecule binds to an antigen on a cell involved in a hyperproliferative disease or to a viral or bacterial antigen. In further embodiments, the antigen binding molecule is an antibody fragment, including one or more of the complementarity determining regions (CDRs) thereof, that specifically binds to the antigen. In further embodiments, the antigen binding molecule is a single chain variable fragment (scFv). In some embodiments, the antigen binding molecule comprises or consists of avimers.

[0059] The term “antibody” (Ab) includes, without limitation, a glycoprotein immunoglobulin which binds specifically to an antigen. In general, an antibody may comprise at least two heavy (H) chains and two light (L) chains interconnected by disulfide bonds, or an antigen-binding molecule thereof. Each H chain may comprise a heavy chain variable region (abbreviated herein as VH) and a heavy chain constant region. The heavy chain constant region can comprise three constant domains, CH1, CH2 and CH3. Each light chain can comprise a light chain variable region (abbreviated herein as VL) and a light chain constant region. The light chain constant region can comprise one constant domain, CL. The VH and VL regions may be further subdivided into regions of hypervariability, termed complementarity determining regions (CDRs), interspersed with regions that are more conserved, termed framework regions (FR). CDRs may be described by numbering known in the art, for example, Kabat numbering, Chothia numbering, AbM numbering, or contact numbering. Each VH and VL may comprise three CDRs and four FRs, arranged from amino-terminus to carboxy- terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4. The variable regions of the heavy and light chains contain a binding domain that interacts with an antigen. The constant regions of the Abs may mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component of the classical complement system. Antibodies may include, for example, monoclonal antibodies, recombinantly produced antibodies, monospecific antibodies, multispecific antibodies (including bispecific antibodies), human antibodies, engineered antibodies, humanized antibodies, chimeric antibodies, immunoglobulins, synthetic antibodies,tetrameric antibodies comprising two heavy chain and two light chain molecules, an antibody light chain monomer, an antibody heavy chain monomer, an antibody light chain dimer, an antibody heavy chain dimer, an antibody light chain- antibody heavy chain pair, intrabodies, antibody fusions (sometimes referred to herein as “antibody conjugates”), heteroconjugate antibodies, single domain antibodies (sdAb) (including, e.g., heavy chain-only antibodies (HcAbs), variable domain of new antigen receptor (VNAR), variable heavy domain of heavy chain (VHH)) or nanobodies), monovalent antibodies, single chain antibodies or single-chain variable fragments (scFv), camelid antibodies, affibodies, Fab fragments, F(ab’)2 fragments, disulfide-linked variable fragments (sdFv), anti-idiotypic (anti-id) antibodies (including, e.g., anti-anti-Id antibodies), minibodies, domain antibodies, synthetic antibodies (sometimes referred to herein as “antibody mimetics”), divalent single chain antibodies or diabodies and antigen-binding fragments of any of the above. In some embodiments, antibodies described herein refer to polyclonal antibody populations.

[0060] An immunoglobulin may derive from any of the commonly known isotypes, including but not limited to IgA, secretory IgA, IgG and IgM. IgG subclasses are also well known to those in the art and include but are not limited to human IgG1, IgG2, IgG3 and IgG4. “Isotype” refers to the Ab class or subclass (e.g., IgM or IgG1) that is encoded by the heavy chain constant region genes. The term “antibody” includes, by way of example, both naturally occurring and non-naturally occurring Abs; monoclonal and polyclonal Abs; chimeric and humanized Abs; human or nonhuman Abs; wholly synthetic Abs; and single chain Abs. A nonhuman Ab may be humanized by recombinant methods to reduce its immunogenicity in humans. Where not expressly stated, and unless the context indicates otherwise, the term “antibody” also includes an antigen-binding fragment or an antigen-binding portion of any of the aforementioned immunoglobulins, and includes a monovalent and a divalent fragment or portion, and a single chain Ab.

[0061] As used herein, the terms “variable region” or “variable domain” are used interchangeably and are common in the art. The variable region typically refers to a portion of an antibody, generally, a portion of a light or heavy chain, typically about the amino-terminal 110 to 120 amino acids in the mature heavy chain and about 90 to 115 amino acids in the mature light chain, which differ extensively in sequence among antibodies and are used in the binding and specificity of a particular antibody for its particular antigen. The variability in sequence is concentrated in those regions called complementarity determining regions (CDRs) while the more highly conserved regions in the variable domain are called framework regions (FR). Without wishing to be bound by any particular mechanism or theory, it is believed thatthe CDRs of the light and heavy chains are primarily responsible for the interaction and specificity of the antibody with antigen. In some embodiments, the variable region is a human variable region. In some embodiments, the variable region comprises rodent or murine CDRs and human framework regions (FRs). In particular embodiments, the variable region is a primate (e.g., non-human primate) variable region. In some embodiments, the variable region comprises rodent or murine CDRs and primate (e.g., non-human primate) framework regions (FRs). The terms “VL” and “VL domain” are used interchangeably to refer to the light chain variable region of an antibody or an antigen-binding molecule thereof. The terms “VH” and “VH domain” are used interchangeably to refer to the heavy chain variable region of an antibody or an antigen-binding molecule thereof.

[0062] As used herein, the terms “constant region” and “constant domain” are interchangeable and have a meaning common in the art. The constant region is an antibody portion, e.g., a carboxyl terminal portion of a light and / or heavy chain which is not directly involved in binding of an antibody to antigen but which may exhibit various effector functions, such as interaction with the Fc receptor. The constant region of an immunoglobulin molecule generally has a more conserved amino acid sequence relative to an immunoglobulin variable domain.

[0063] As used herein, “aptamer” refers in general to either an oligonucleotide of a single defined sequence or a mixture of said nucleotides, wherein the mixture retains the properties of binding specifically to the target molecule (e.g., eukaryotic initiation factor, 40S ribosome, polyC binding protein, polyA binding protein, polypyrimidine tract-binding protein, argonaute protein family, Heterogeneous nuclear ribonucleoprotein K and La and related RNA-binding protein). Thus, as used herein “aptamer” denotes both singular and plural sequences of nucleotides, as defined hereinabove. The term “aptamer” is meant to refer to a single- or double-stranded nucleic acid which is capable of binding to a protein or other molecule. In general, aptamers preferably comprise about 10 to about 100 nucleotides, preferably about 15 to about 40 nucleotides, more preferably about 20 to about 40 nucleotides, in that oligonucleotides of a length that falls within these ranges are readily prepared by conventional techniques. Optionally, aptamers can further comprise a minimum of approximately 6 nucleotides, preferably 10, and more preferably 14 or 15 nucleotides, that are necessary to effect specific binding. In some embodiments, the circRNA described herein comprises and / or functions as an aptamer.

[0064] As used herein, “autoimmunity” is defined as persistent and progressive immune reactions to non-infectious self-antigens, as distinct from infectious non self-antigens frombacterial, viral, fungal, or parasitic organisms which invade and persist within mammals and humans. Autoimmune conditions include scleroderma, Grave's disease, Crohn's disease, Sjorgen's disease, multiple sclerosis, Hashimoto's disease, psoriasis, myasthenia gravis, autoimmune polyendocrinopathy syndromes, Type I diabetes mellitus (TIDM), autoimmune gastritis, autoimmune uveoretinitis, polymyositis, colitis, and thyroiditis, as well as in the generalized autoimmune diseases typified by human Lupus.

[0065] “Autoantigen” or “self-antigen” as used herein refers to an antigen or epitope which is native to the mammal and which is immunogenic in said mammal.

[0066] The term “autologous” refers to any material derived from the same individual to which it is later to be re-introduced. For example, the engineered autologous cell therapy (eACT™) method described herein involves collection of lymphocytes from a patient, which are then engineered to express, e.g., a CAR construct, and then administered back to the same patient.

[0067] “Binding affinity” generally refers to the strength of the sum total of non-covalent interactions between a single binding site of a molecule (e.g., an antibody) and its binding partner (e.g., an antigen). Unless indicated otherwise, as used herein, “binding affinity” refers to intrinsic binding affinity which reflects a 1 : 1 interaction between members of a binding pair (e.g., antibody and antigen). The affinity of a molecule X for its partner Y may generally be represented by the dissociation constant (KDor Kd). Affinity may be measured and / or expressed in a number of ways known in the art, including, but not limited to, equilibrium dissociation constant (KD), and equilibrium association constant (KAor Ka). The KDis calculated from the quotient of koff / kon, whereas KA is calculated from the quotient of kon / koff. konrefers to the association rate constant of, e.g., an antibody to an antigen, and koffrefers to the dissociation of, e.g., an antibody to an antigen. The kon and koff may be determined by techniques known to one of ordinary skill in the art, such as BIACORE® or KinExA.

[0068] As used herein, the term “specifically binds,” refers to molecules that bind to an antigen (e.g., epitope or immune complex) as such binding is understood by one skilled in the art. For example, a molecule that specifically binds to an antigen may bind to other peptides or polypeptides, generally with lower affinity as determined by, e.g., immunoassays, BIACORE®, KinExA 3000 instrument (Sapidyne Instruments, Boise, ID), or other assays known in the art. In a specific embodiment, molecules that specifically bind to an antigen bind to the antigen with a KAthat is at least 2 logs, 2.5 logs, 3 logs, 4 logs or greater than the KAwhen the molecules bind to another antigen.

[0069] As used herein, “bicistronic RNA” refers to a polynucleotide that includes twoexpression sequences coding for two distinct proteins. These expression sequences can be separated by a nucleotide sequence encoding a cleavable peptide such as a protease cleavage site. They can also be separated by a ribosomal skipping element.

[0070] A “cancer” refers to a broad group of various diseases characterized by the uncontrolled growth of abnormal cells in the body. Unregulated cell division and growth results in the formation of malignant tumors that invade neighboring tissues and may also metastasize to distant parts of the body through the lymphatic system or bloodstream. A “cancer” or “cancer tissue” may include a tumor. Examples of cancers that may be treated by the methods disclosed herein include, but are not limited to, cancers of the immune system including lymphoma, leukemia, myeloma, and other leukocyte malignancies. In some embodiments, the methods disclosed herein may be used to reduce the tumor size of a tumor derived from, for example, bone cancer, pancreatic cancer, skin cancer, cancer of the head or neck, cutaneous or intraocular malignant melanoma, uterine cancer, ovarian cancer, rectal cancer, cancer of the anal region, stomach cancer, testicular cancer, uterine cancer, multiple myeloma (MM), Hodgkin's Disease, non-Hodgkin's lymphoma (NHL), primary mediastinal large B cell lymphoma (PMBC), diffuse large B cell lymphoma (DLBCL), follicular lymphoma (FL), transformed follicular lymphoma, splenic marginal zone lymphoma (SMZL), cancer of the esophagus, cancer of the small intestine, cancer of the endocrine system, cancer of the thyroid gland, cancer of the parathyroid gland, cancer of the adrenal gland, cancer of the urethra, cancer of the penis, chronic or acute leukemia, acute myeloid leukemia, chronic myeloid leukemia, acute lymphoblastic leukemia (ALL) (including non T cell ALL), chronic lymphocytic leukemia (CLL), solid tumors of childhood, lymphocytic lymphoma, cancer of the bladder, cancer of the kidney or ureter, neoplasm of the central nervous system (CNS), primary CNS lymphoma, tumor angiogenesis, spinal axis tumor, brain stem glioma, pituitary adenoma, epidermoid cancer, squamous cell cancer, T cell lymphoma, environmentally induced cancers including those induced by asbestos, other B cell malignancies, and combinations of said cancers. In some embodiments, the methods disclosed herein may be used to reduce the tumor size of a tumor derived from, for example, sarcomas and carcinomas, fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, Kaposi's sarcoma, sarcoma of soft tissue, and other sarcomas, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, hepatocellular carcinomna, lung cancer, colorectal cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma (for example adenocarcinoma of the pancreas, colon, ovary, lung, breast, stomach, prostate, cervix, or esophagus), sweat glandcarcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, Wilms' tumor, cervical cancer, testicular tumor, bladder carcinoma, carcinoma of the fallopian tubes, carcinoma of the endometrium, carcinoma of the cervix, carcinoma of the vagina, carcinoma of the vulva, carcinoma of the renal pelvis, CNS tumors (such as a glioma, astrocytoma, medulloblastoma, craniopharyogioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, menangioma, melanoma, neuroblastoma and retinoblastoma). The particular cancer may be responsive to chemo- or radiation therapy or the cancer may be refractory. A refractory cancer refers to a cancer that is not amenable to surgical intervention and the cancer is either initially unresponsive to chemo- or radiation therapy or the cancer becomes unresponsive over time.

[0071] As used herein, the terms “circRNA,” “circular polyribonucleotide,” “circular RNA,” “circularized RNA,” “circular RNA polynucleotide” and “oRNA” are used interchangeably and refer to a single-stranded polyribonucleotide wherein the 3’ and 5’ ends that are normally present in a linear RNA polynucleotide have been joined together, e.g., by covalent bonds. As used herein, such terms also include preparations comprising circRNAs.

[0072] As used herein, the term “circularization efficiency” refers to a measurement of the rate of formation of amount of resultant circular polyribonucleotide as compared to its linear starting material.

[0073] The expression sequences in the polynucleotide construct may be separated by a “cleavage site” sequence which enables polypeptides encoded by the expression sequences, once translated, to be expressed separately by the cell, e.g., eukaryotic cell. A “self-cleaving peptide” refers to a peptide which is translated without a peptide bond between two adjacent amino acids, or functions such that when the polypeptide comprising the proteins and the self- cleaving peptide is produced, it is immediately cleaved or separated into distinct and discrete first and second polypeptides without the need for any external cleavage activity.

[0074] As used herein, “co-administering” refers to administering a therapeutic agent provided herein in conjunction with one or more additional therapeutic agents sufficiently close in time such that the therapeutic agent provided herein can enhance the effect of the one or more additional therapeutic agents, or vice versa.

[0075] As used herein, “coding element,” “coding sequence,” “coding nucleic acid,” or “coding region” is region located within the expression sequence and encodings for one or more proteins or polypeptides (e.g., therapeutic protein).

[0076] As used herein, a “noncoding element,” “noncoding sequence,” “non-codingnucleic acid,” or “noncoding nucleic acid” is a region located within the expression sequence. This sequence by itself does not encode for a protein or polypeptide, but may have other regulatory functions, including but not limited, allow the overall polynucleotide to act as a biomarker or adjuvant to a specific cell.

[0077] A “costimulatory ligand,” as used herein, includes a molecule on an antigen presenting cell that specifically binds a cognate co-stimulatory molecule on a T cell. Binding of the costimulatory ligand provides a signal that mediates a T cell response, including, but not limited to, proliferation, activation, differentiation, and the like. A costimulatory ligand induces a signal that is in addition to the primary signal provided by a stimulatory molecule, for instance, by binding of a T cell receptor (TCR) / CD3 complex with a major histocompatibility complex (MHC) molecule loaded with peptide. A co-stimulatory ligand may include, but is not limited to, 3 / TR6, 4-IBB ligand, agonist or antibody that binds Toll-like receptor, B7-1 (CD80), B7-2 (CD86), CD30 ligand, CD40, CD7, CD70, CD83, herpes virus entry mediator (HVEM), human leukocyte antigen G (HLA-G), ILT4, immunoglobulin-like transcript (ILT) 3, inducible costimulatory ligand (ICOS-L), intercellular adhesion molecule (ICAM), ligand that specifically binds with B7-H3, lymphotoxin beta receptor, MHC class I chain-related protein A (MICA), MHC class I chain-related protein B (MICB), OX40 ligand, PD-L2, or programmed death (PD) LI. A co-stimulatory ligand includes, without limitation, an antibody that specifically binds with a co-stimulatory molecule present on a T cell, such as, but not limited to, 4-1BB / CD137, B7-H3, CD2, CD27, CD28, CD30, CD40, CD7, CD86, CD152, ICOS, ligand that specifically binds with CD83, lymphocyte function- associated antigen-1 (LFA-1), natural killer cell receptor C (NKG2C), OX40, PD-1, or tumor necrosis factor superfamily member 14 (TNFSF14 or LIGHT).

[0078] A “costimulatory molecule” is a cognate binding partner on a T cell that specifically binds with a costimulatory ligand, thereby mediating a costimulatory response by the T cell, such as, but not limited to, proliferation. Costimulatory molecules include, but are not limited to, 4-1BB / CD137, B7-H3, BAFFR, BLAME (SLAMF8), BTLA, CD 33, CD 45, CD100 (SEMA4D), CD103, CD134, CD137, CD152, CD154, CD16, CD160 (BY55), CD 18, CD19, CD19a, CD2, CD22, CD247, CD27, CD276 (B7-H3), CD28, CD29, CD3 (alpha; beta; delta; epsilon; gamma; zeta), CD30, CD37, CD4, CD4, CD40, CD49a, CD49D, CD49f, CD5, CD64, CD69, CD7, CD80, CD83 ligand, CD84, CD86, CD8alpha, CD8beta, CD9, CD96 (Tactile), CD1- la, CDl-lb, CDl-lc, CDl-ld, CDS, CEACAM1, CRT AM, DAP-10, DNAM1 (CD226), Fc gamma receptor, GADS, GITR, HVEM (LIGHTR), IA4, ICAM-1, ICAM-1, ICOS, Ig alpha (CD79a), IL2R beta, IL2R gamma, IL7R alpha, integrin, ITGA4, ITGA4,ITGA6, IT GAD, ITGAE, ITGAL, ITGAM, ITGAX, ITGB2, ITGB7, ITGB1, KIRDS2, LAT, LFA-1, LFA-1, LIGHT, LIGHT (tumor necrosis factor superfamily member 14; TNFSF14), LTBR, Ly9 (CD229), lymphocyte function-associated antigen-1 (LFA-1 (CD1 la / CD18), MHC class I molecule, NKG2C, NKG2D, NKp30, NKp44, NKp46, NKp80 (KLRF1), OX40, PAG / Cbp, PD-1, PSGL1, SELPLG (CD162), signaling lymphocytic activation molecule, SLAM (SLAMF1; CD150; IPO-3), SLAMF4 (CD244; 2B4), SLAMF6 (NTB-A; Lyl08), SLAMF7, SLP-76, TNF, TNFr, TNFR2, Toll ligand receptor, TRANCE / RANKL, VLA1, or VLA-6, or fragments, truncations, or combinations thereof.

[0079] As used herein, an antigen binding molecule, an antibody, or an antigen binding molecule thereof “cross-competes” with a reference antibody or an antigen binding molecule thereof if the interaction between an antigen and the first binding molecule, an antibody, or an antigen binding molecule thereof blocks, limits, inhibits, or otherwise reduces the ability of the reference binding molecule, reference antibody, or an antigen binding molecule thereof to interact with the antigen. Cross competition may be complete, e.g., binding of the binding molecule to the antigen completely blocks the ability of the reference binding molecule to bind the antigen, or it may be partial, e.g., binding of the binding molecule to the antigen reduces the ability of the reference binding molecule to bind the antigen. In some embodiments, an antigen binding molecule that cross-competes with a reference antigen binding molecule binds the same or an overlapping epitope as the reference antigen binding molecule. In other embodiments, the antigen binding molecule that cross-competes with a reference antigen binding molecule binds a different epitope as the reference antigen binding molecule. Numerous types of competitive binding assays may be used to determine if one antigen binding molecule competes with another, for example: solid phase direct or indirect radioimmunoassay (RIA); solid phase direct or indirect enzyme immunoassay (EIA); sandwich competition assay (Stahli et al., 1983, Methods in Enzymology 9:242-253); solid phase direct biotin-avidin EIA (Kirkland et al., 1986, J. Immunol. 137:3614-3619); solid phase direct labeled assay, solid phase direct labeled sandwich assay (Harlow and Lane, 1988, Antibodies, A Laboratory Manual, Cold Spring Harbor Press); solid phase direct label RIA using 1-125 label (Morel et al., 1988, Molec. Immunol.25:7-15); solid phase direct biotin-avidin EIA (Cheung, et al., 1990, Virology 176:546-552); and direct labeled RIA (Moldenhauer et al., 1990, Scand. J. Immunol. 32:77-82).

[0080] A “cytokine,” as used herein, refers to a non-antibody protein that is released by one cell in response to contact with a specific antigen, wherein the cytokine interacts with a second cell to mediate a response in the second cell. A cytokine may be endogenouslyexpressed by a cell or administered to a subject. Cytokines may be released by immune cells, including macrophages, B cells, T cells, neutrophils, dendritic cells, eosinophils and mast cells to propagate an immune response. Cytokines may induce various responses in the recipient cell. Cytokines may include homeostatic cytokines, chemokines, pro- inflammatory cytokines, effectors, and acute-phase proteins. For example, homeostatic cytokines, including interleukin (IL) 7 and IL-15, promote immune cell survival and proliferation, and pro- inflammatory cytokines may promote an inflammatory response. Examples of homeostatic cytokines include, but are not limited to, IL-2, IL-4, IL-5, IL-7, IL-10, IL-12p40, IL-12p70, IL-15, and interferon (IFN) gamma. Examples of pro-inflammatory cytokines include, but are not limited to, IL-la, IL-lb, IL- 6, IL-13, IL-17a, IL-23, IL-27, tumor necrosis factor (TNF)-alpha, TNF-beta, fibroblast growth factor (FGF) 2, granulocyte macrophage colony-stimulating factor (GM- CSF), soluble intercellular adhesion molecule 1 (sICAM-1), soluble vascular adhesion molecule 1 (sVCAM-1), vascular endothelial growth factor (VEGF), VEGF-C, VEGF-D, and placental growth factor (PLGF). Examples of effectors include, but are not limited to, granzyme A, granzyme B, soluble Fas ligand (sFasL), TGF-beta, IL-35, and perforin. Examples of acute phase-proteins include, but are not limited to, C-reactive protein (CRP) and serum amyloid A (SAA).

[0081] The terms “deoxyribonucleic acid” and “DNA” as used herein mean a polymer composed of deoxyribonucleotides. The terms “ribonucleic acid” and “RNA” as used herein mean a polymer composed of ribonucleotides.

[0082] As used herein, the term “DNA template” refers to a DNA sequence capable of transcribing a linear RNA polynucleotide. For example, but not intending to be limiting, a DNA template may include a DNA vector, PCR product or plasmid.

[0083] As used herein, the terms “duplexed,” “double-stranded,” and “hybridized” are used interchangeably and refer to double-stranded nucleic acids formed by hybridization of two single strands of nucleic acids containing complementary sequences. Sequences of the two single-stranded nucleic acids can be fully complementary or partially complementary. In some embodiments, a nucleic acid provided herein may be fully double-stranded or partially double- stranded. In most cases, genomic DNA is double-stranded.

[0084] As used herein, two “duplex sequences,” “duplex forming sequences,” “duplex region,” “duplex forming regions,” “homology arms,” or “homology regions,” complement, or are complementary, fully or partially, to one another when the two regions share a sufficient level of sequence identity to one another’s reverse complement to act as substrates for a hybridization reaction. In some embodiments, two duplex forming sequences arethermodynamically favored to cross-pair in a sequence specific interaction. As used herein, polynucleotide sequences have “homology” when they are either identical or share sequence identity to a reverse complement or “complementary” sequence. The percent sequence identity between a homology region and a counterpart homology region’s reverse complement can be any percent of sequence identity that allows for hybridization to occur. In some embodiments, an internal duplex forming region of a polynucleotide disclosed herein is capable of forming a duplex with another internal duplex forming region and does not form a duplex with an external duplex forming region.

[0085] As used herein, the term “encode” refers broadly to any process whereby the information in a polymeric macromolecule is used to direct the production of a second molecule that is different from the first. The second molecule may have a chemical structure that is different from the chemical nature of the first molecule. For example, a DNA template (e.g., a DNA vector) may encode a RNA polynucleotide; a precursor RNA polynucleotide (e.g., a linear precursor RNA polynucleotide) may encode a mature RNA polynucleotide (e.g., a circular RNA polynucleotide).

[0086] As used herein, “endogenous” means a substance that is native to, i.e., naturally originated from, a biological system (e.g., an organism, a tissue, or a cell). For example, in some embodiments, a “endogenous polynucleotide” is normally expressed in a cell or tissue. In some embodiments, a polynucleotide is still considered endogenous if the control sequences, such as a promoter or enhancer sequences which activate transcription or translation, have been altered through recombinant techniques.

[0087] As used herein, the term “heterologous” means from any source other than naturally occurring sequences.

[0088] As used herein, an “endonuclease site” refers to a stretch of nucleotides within a polynucleotide that is capable of being recognized and cleaved by an endonuclease protein.

[0089] An “eukaryotic initiation factor” or “eIF” refers to a protein or protein complex used in assembling an initiator tRNA, 40S and 60S ribosomal subunits required for initiating eukaryotic translation.

[0090] As used herein, an “epitope” is a term in the art and refers to a localized region of an antigen to which an antibody may specifically bind. An epitope may be, for example, contiguous amino acids of a polypeptide (linear or contiguous epitope) or an epitope can, for example, come together from two or more non-contiguous regions of a polypeptide or polypeptides (conformational, non-linear, discontinuous, or non-contiguous epitope). In some embodiments, the epitope to which an antibody binds may be determined by, e.g., NMRspectroscopy, X-ray diffraction crystallography studies, ELISA assays, hydrogen / deuterium exchange coupled with mass spectrometry (e.g., liquid chromatography electrospray mass spectrometry), array -based oligo-peptide scanning assays, and / or mutagenesis mapping (e.g., site- directed mutagenesis mapping). For X-ray crystallography, crystallization may be accomplished using any of the known methods in the art (e.g., Giege R et al., (1994) Acta Crystallogr D Biol Crystallogr 50(Pt 4): 339-350; McPherson A (1990) Eur J Biochem 189: 1- 23; Chayen NE (1997) Structure 5: 1269- 1274; McPherson A (1976) J Biol Chem 251: 6300- 6303). Antibody: antigen crystals may be studied using well known X-ray diffraction techniques and may be refined using computer software such as X- PLOR (Yale University, 1992, distributed by Molecular Simulations, Inc.; see e.g. Meth Enzymol (1985) volumes 114 & 115, eds Wyckoff HW et al.; U.S. Patent Publication No. 2004 / 0014194), and BUSTER (Bricogne G (1993) Acta Crystallogr D Biol Crystallogr 49(Pt 1): 37-60; Bricogne G (1997) Meth Enzymol 276A: 361-423, ed Carter CW; Roversi P et al., (2000) Acta Crystallogr D Biol Crystallogr 56(Pt 10): 1316-1323).

[0091] As used herein, the term “expression sequence” refers to a nucleic acid sequence that encodes a product, e.g., a peptide or polypeptide, regulatory nucleic acid, or non-coding nucleic acid. An exemplary expression sequence that codes for a peptide or polypeptide can comprise a plurality of nucleotide triads, each of which can code for an amino acid and is termed as a “codon.”

[0092] As used herein, a “fusion protein” is a protein with at least two domains that are encoded by separate genes that have been joined to transcribe for a single peptide.

[0093] As used herein, the term “genetically engineered” or “engineered” refers to a method of modifying the genome of a cell, including, but not limited to, deleting a coding or non-coding region or a portion thereof or inserting a coding region or a portion thereof. In some embodiments, the cell that is modified is a lymphocyte, e.g., a T cell, which may either be obtained from a patient or a donor. The cell may be modified to express an exogenous construct, such as, e.g., a chimeric antigen receptor (CAR) or a T cell receptor (TCR), which is incorporated into the cell's genome.

[0094] As used herein, an “immune response” refers to the action of a cell of the immune system (for example, T lymphocytes, B lymphocytes, natural killer (NK) cells, macrophages, eosinophils, mast cells, dendritic cells and neutrophils) and soluble macromolecules produced by any of these cells or the liver (including Abs, cytokines, and complement) that results in selective targeting, binding to, damage to, destruction of, and / or elimination from a vertebrate's body of invading pathogens, cells or tissues infected with pathogens, cancerous or otherabnormal cells, or, in cases of autoimmunity or pathological inflammation, normal human cells or tissues.

[0095] As used herein, the term “immunogenic” or “immunostimulatory” refers to a potential to induce an immune response to a substance. An immune response may be induced when an immune system of an organism or a certain type of immune cells is exposed to an immunogenic substance. The term “non-immunogenic” refers to a lack of or absence of an immune response above a detectable threshold to a substance. No immune response is detected when an immune system of an organism or a certain type of immune cells is exposed to a non- immunogenic substance. In some embodiments, a non-immunogenic polyribonucleotide (e.g., a circular polyribonucleotide) as provided herein, does not induce an immune response above a pre-determined threshold when measured by an immunogenicity assay. In some embodiments, no innate immune response is detected when an immune system of an organism or a certain type of immune cells is exposed to a non-immunogenic polyribonucleotide (e.g., circular polyribonucleotide) as provided herein. In some embodiments, no adaptive immune response is detected when an immune system of an organism or a certain type of immune cell is exposed to a non-immunogenic polyribonucleotide as provided herein.

[0096] As used herein, an “internal ribosome entry site” or “IRES” refers to an RNA sequence or structural element capable of initiating translation of a polypeptide in the absence of a typical RNA cap structure. An IRES sequence may be naturally occurring or synthetic, e.g., derived from a naturally occurring virus IRES. In some embodiments, the IRES sequence ranges in size from 10 to 1000 nucleotides. In some embodiments, the IRES sequence if greater than 1000 nucleotides in size. In some embodiments, the IRES sequence ranges in size from 100 to 200 nucleotides, 201 to 300 nucleotides, 301 to 400 nucleotides, 401 to 500 nucleotides, 501 to 600 nucleotides, 601 to 700 nucleotides, 701 to 800 nucleotides, 801 to 900 nucleotides, 901 to 1000 nucleotides.

[0097] As used herein, an “intervening region” refers to the portion of an RNA sequence that comprises one or more noncoding or one or more coding elements, or combinations thereof (e.g., translation initiation element, coding element, and / or stop codon) between splice sites. In some embodiments, the intervening regions are between the 5’ combined accessory element and the 3’ combined accessory element or between the 3’ intron fragment and the 5’ intron fragment in a precursor RNA polynucleotide. In some embodiments, the intervening region is between the monotron element and terminal element in other precursor RNA polynucleotides.

[0098] As used herein, “isolated” or “purified” generally refers to isolation of a substance (for example, in some embodiments, a compound, a polynucleotide, a protein, a polypeptide, apolynucleotide composition, or a polypeptide composition) such that the substance comprises a significant percent (e.g., greater than 1%, greater than 2%, greater than 5%, greater than 10%, greater than 20%, greater than 50%, or more, usually up to about 90%-100%) of the sample in which it resides. In certain embodiments, a substantially purified component comprises at least 50, 60, 70, 75, 80, 85, 90, 95, 96, 97, 98, or 99% of the sample. In additional embodiments, a substantially purified component comprises about, 80%-85%, or 90%-95%, 95-99%, 96-99%, 97-99%, or 95-100% of the sample. Techniques for purifying polynucleotides and polypeptides of interest are well-known in the art and include, for example, ion-exchange chromatography, affinity chromatography and sedimentation according to density. Generally, a substance is purified when it exists in a sample in an amount, relative to other components of the sample, that is more than as it is found naturally.

[0099] As used herein, a “leading untranslated sequence” is a region of polynucleotide sequences ranging from 1 nucleotide to hundreds of nucleotides located at the upmost 5' end of a polynucleotide sequence. The sequences can be defined or can be random. A leading untranslated sequence is non-coding.

[0100] As used herein, a “terminal untranslated sequence” is a region of polynucleotide sequences ranging from 1 nucleotide to hundreds of nucleotides located at the downmost 3' end of a polynucleotide sequence. The sequences can be defined or can be random. A terminal untranslated sequence is non-coding.

[0101] As used herein, the terms “terminal sequence” or “terminal element” are used interchangeably to refer to an RNA sequence capable of complexing with a monotron sequence or monotron element. The terminal sequence comprises a splice site nucleotide from the natural group I or group II intron present in the monotron. In some embodiments, the terminal sequence further comprises a natural exon or a fragment thereof and / or a synthetic sequence.

[0102] The term “lymphocyte” as used herein includes natural killer (NK) cells, T cells, or B cells. NK cells are a type of cytotoxic (cell toxic) lymphocyte that represent a major component of the innate immune system. NK cells reject tumors and cells infected by viruses. It works through the process of apoptosis or programmed cell death. They were termed “natural killers” because they do not require activation in order to kill cells. T cells play a major role in cell-mediated-immunity (no antibody involvement). T cell receptors (TCR) differentiate T cells from other lymphocyte types. The thymus, a specialized organ of the immune system, is the primary site for T cell maturation. There are numerous types of T cells, including: helper T cells (e.g., CD4+ cells), cytotoxic T cells (also known as TC, cytotoxic T lymphocytes, CTL, T-killer cells, cytolytic T cells, CD8+ T cells or killer T cells), memory T cells ((i) stemmemory cells (TSCM), like naive cells, are CD45RO-, CCR7+, CD45RA+, CD62L+ (L- selectin), CD27+, CD28+ and IL-7Ra+, but also express large amounts of CD95, IL-2R, CXCR3, and LFA-1, and show numerous functional attributes distinctive of memory cells); (ii) central memory cells (TCM) express L-selectin and CCR7, they secrete IL-2, but not IFNγ or IL-4, and (iii) effector memory cells (TEM), however, do not express L-selectin or CCR7 but produce effector cytokines like IFNγ and IL-4), regulatory T cells (Tregs, suppressor T cells, or CD4+CD25+ or CD4+ FoxP3+ regulatory T cells), natural killer T cells (NKT) and gamma delta T cells. B-cells, on the other hand, play a principal role in humoral immunity (with antibody involvement). B-cells make antibodies, are capable of acting as antigen- presenting cells (APCs) and turn into memory B-cells and plasma cells, both short-lived and long-lived, after activation by antigen interaction. In mammals, immature B-cells are formed in the bone marrow.

[0103] As used herein, a “miRNA site” or “miRNA binding site” refers to a stretch of nucleotides within a polynucleotide that is capable of forming a duplex with at least 8 nucleotides of a natural miRNA sequence.

[0104] As used herein, the terms “monotron,” “monotron sequence,” or “monotron element” are used interchangeably to refer a segment of a precursor RNA polynucleotide that is located at either the 5’ or 3’ end of the polynucleotide, i.e., either 5’ or 3’ from the intervening region. A monotron element refers to a sequence with 70% or higher similarity to a natural group I or group II intron including the splice site dinucleotide. In some embodiments, the monotron is capable of contributing to ribozymatic activity that allows it to enzymatically self- cleave. In some embodiments, the monotron is capable of forming a phosphodiester bond with a terminal sequence, i.e., a sequence containing a splice site dinucleotide and optionally a natural exon sequence or fragment thereof. In some embodiments, the terminal sequence is upstream of the monotron in a linear precursor. In some embodiments, the monotron sequence is upstream of the terminal sequence in a linear precursor. When the terminal sequence is upstream to the monotron in a linear precursor, the monotron can perform two transesterification reactions, e.g., sequentially, self-cleavage and formation of a phosphodiester bond with the terminal sequence. In embodiments in which the terminal sequence is upstream to the monotron in the linear precursor, (a) the monotron is capable of interacting with a nucleophile that is capable of cleaving at the splice site dinucleotide at or near the 5’ end of the monotron, and (b) the cleavage product of (a), i.e., the 5’ splice site nucleotide, e.g., having a 3’ hydroxyl group, engages in a transesterification reaction (cleaves) at the splice site nucleotide of the terminal sequence, yielding a circular RNA or oRNA. In these embodiments,the monotron interacts with the nucleophile (e.g., a guanosine, e.g., a free guanosine that is introduced to the precursor) by forming a binding pocket with the nucleophile, and the linear precursor is capable of adopting a conformation in which the nucleophile is in proximity to and is capable of cleaving at the splice site dinucleotide at or near the 5’ end of the monotron. When the monotron is upstream of the terminal sequence in a linear precursor, the monotron can also perform two transesterification reactions. In embodiments in which the monotron is upstream of the terminal sequence in the linear precursor, (a) the monotron is capable of interacting with a nucleophile that is capable of cleaving at the splice site nucleotide of the terminal element, and (b) the cleavage product of (a), i.e., the 5’ splice site nucleotide, e.g., having a 3’ hydroxyl group, engages in a transesterification reaction (cleaves) at the splice site dinucleotide at or near the 3’ end of the monotron, yielding a circular RNA or oRNA. In these embodiments, the monotron interacts with the nucleophile (e.g., a guanosine, e.g., a free guanosine that is introduced to the precursor) by forming a binding pocket with the nucleophile, and the linear precursor is capable of adopting a conformation in which the nucleophile is in proximity to and is capable of cleaving the splice site nucleotide of the terminal element.

[0105] In some embodiments, the monotron comprises a 5’ proximal end of a natural group I or group II intron including the splice site dinucleotide and optionally a natural exon sequence or fragment thereof. In some embodiments, the 5’ end of the monotron refers to nucleotides within the 5’ half of the monotron. In some embodiments, the 3’ end of the monotron refers to nucleotides within the 3’ half of the monotron. In some embodiments, at or near the 5’ end of the monotron refers to within the 5’ half of the monotron. In some embodiments, at or near the 5’ end of the monotron refers to within the first ten 5’ positions in the monotron. In some embodiments, at the 5’ end of the monotron refers to the first 5’ position(s) in the monotron. In some embodiments, at or near the 3’ end of the monotron refers to within the 3’ half of the monotron. In some embodiments, at or near the 3’ end of the monotron refers to within the last ten 3’ positions in the monotron. In some embodiments, at the 3’ end of the monotron refers to last 3’ position(s) in the monotron.

[0106] The term “nucleophile” refers to a nucleophilic nucleotide or nucleoside capable of initiating a nucleophilic attack at a splice site and / or transesterification reaction (cleavage) at a splice site.

[0107] The term “nucleotide” and “nucleoside” refer to a ribonucleotide, a deoxyribonucleotide, or an analog thereof. Nucleotides include species that comprise purines, e.g., adenine, hypoxanthine, guanine, and their derivatives and analogs, as well as pyrimidines, e.g., cytosine, uracil, thymine, and their derivatives and analogs. Nucleosides are similar tonucleotides, e.g., comprising purines and pyrimidines, but without the additional phosphate group.

[0108] “Modified” nucleotide or nucleosides, or nucleoside or nucleotide “analogs” include nucleotides or nucleoside having modifications in the chemical structure of the base, sugar and / or phosphate, including, but not limited to, 5’-position pyrimidine modifications, 8’- position purine modifications, modifications at cytosine exocyclic amines, and substitution of 5-bromo-uracil; and 2’-position sugar modifications, including but not limited to, sugar- modified ribonucleotides in which the 2’-OH is replaced by a group such as an H, OR, R, halo, SH, SR, NH2, NHR, NR2, or CN, wherein R is an alkyl moiety as defined herein. Nucleotide or nucleoside modifications are also meant to include nucleotides or nucleoside with bases such as inosine, queuosine, xanthine; sugars such as 2’-methyl ribose; non-natural phosphodiester linkages such as methylphosphonate, phosphorothioate and peptide linkages. The “modified” nucleotide or nucleoside may be naturally occurring (e.g., pseudouridine) or synthetic. Nucleotide or nucleoside modifications include 5-methoxyuridine, 1- methylpseudouridine, and 6-methyladenosine. Exemplary nucleotide or nucleotide modifications are described herein. As exhibited by the exemplary nucleotide or nucleotide modification, such modifications differ from mutations selected from insertions, deletions, addition, or subtraction of nucleotides, for example, the mutations in a permuted Group I and Group II intron segment. As used herein, a nucleotide or nucleoside “comprising no nucleotide or nucleoside modifications” (i.e., comprising 0% modifications) can be interchangeable with “an unmodified nucleotide or nucleoside” in context. A modified polynucleotide sequence contains at least one nucleotide or nucleoside having a modification, e.g., between 1% and 100%, 1% and 2%, 1% and 3%, 1% and 4%, 1% and 5%, 5% and 6%, 5% and 7%, 5% and 8%, 5% and 9%, 5% and 10%, 10% and 20%, 20% and 30%, 30% and 40%, 40% and 50%, 50% and 60%, 60% and 70%, 70% and 80%, 80% and 90% or 90% and 100% of the nucleotides or nucleosides are modified. In some embodiments, “% modification” refers to the level of incorporation within a polynucleotide, i.e., the number of modified nucleotides or nucleosides in a polynucleotide sequence divided by the total number of nucleotides or nucleosides (modified or unmodified) in the polynucleotide sequence. In some embodiments, “% modification” refers to the relative quantity of modified nucleotide or nucleoside used to generate the polynucleotide (e.g., 5% modified adenosine refers to feeding 5 mM modified adenosine and 95 mM unmodified adenosine to generate a polynucleotide sequence).

[0109] All nucleotide sequences disclosed herein can represent an RNA sequence or a corresponding DNA sequence. It is understood that deoxythymidine (dT or T) in a DNA istranscribed into a uridine (U) in an RNA. As such, “T” and “U” may be used interchangeably herein in nucleotide sequences.

[0110] The terms “nucleic acid”, “polynucleotide”, and “nucleic acid molecule,” are used interchangeably herein to describe a polymer of any length, e.g., greater than about 2 bases, greater than about 10 bases, greater than about 100 bases, greater than about 500 bases, greater than 1000 bases, or up to about 10,000 or more bases, composed of nucleotides, e.g., deoxyribonucleotides or ribonucleotides, and may be produced enzymatically or synthetically (e.g., as described in U.S. Pat. No. 5,948,902 and the references cited therein), which can hybridize with naturally occurring nucleic acids in a sequence specific manner analogous to that of two naturally occurring nucleic acids, e.g., can participate in Watson-Crick base pairing interactions. A nucleic acid “backbone” can be made up of a variety of linkages, including one or more of sugar-phosphodiester linkages, peptide-nucleic acid bonds (“peptide nucleic acids” or PNA; PCT No. WO 95 / 32305), phosphorothioate linkages, methylphosphonate linkages, or combinations thereof. Sugar moieties of a nucleic acid can be ribose, deoxyribose, or similar compounds with substitutions, e.g., 2’ methoxy or 2’ halide substitutions. Nitrogenous bases can be conventional bases (A, G, C, T, U), analogs thereof (e.g., modified uridines such as 5- methoxyuridine, pseudouridine, or N1-methylpseudouridine, or others); inosine; derivatives of purines or pyrimidines (e.g., N4-methyl deoxyguanosine, deaza- or aza-purines, deaza- or aza- pyrimidines, pyrimidine bases with substituent groups at the 5 or 6 position (e.g., 5- methylcytosine), purine bases with a substituent at the 2, 6, or 8 positions, 2-amino-6- methylaminopurine, O6-methylguanine, 4-thio-pyrimidines, 4-amino-pyrimidines, 4- dimethylhydrazine-pyrimidines, and O4-alkyl-pyrimidines; US Pat. No. 5,378,825 and PCT No. WO 93 / 13121). For general discussion see The Biochemistry of the Nucleic Acids 5-36, Adams et al., ed., 11th ed., 1992). Nucleic acids can include one or more “abasic” residues where the backbone includes no nitrogenous base for position(s) of the polymer (US Pat. No. 5,585,481). A nucleic acid can comprise only conventional RNA or DNA sugars, bases and linkages, or can include both conventional components and substitutions (e.g., conventional bases with 2’ methoxy linkages, or polymers containing both conventional bases and one or more base analogs). Naturally occurring nucleic acids are comprised of nucleotides, including guanine, cytosine, adenine, thymine, and uracil containing nucleotides (G, C, A, T, and U respectively).

[0111] As used herein, an “oligonucleotide” is a polynucleotide comprising fewer than 1000 nucleotides, such as a polynucleotide comprising fewer than 500 nucleotides or fewer than 100 nucleotides.

[0112] As used herein, “polyA” means a polynucleotide or a portion of a polynucleotide consisting of nucleotides comprising adenine. As used herein, “polyT” means a polynucleotide or a portion of a polynucleotide consisting of nucleotides comprising thymine. As used herein, “polyAC” means a polynucleotide or a portion of a polynucleotide consisting of nucleotides comprising adenine or cytosine.

[0113] As used herein, the term “ribosomal skipping element” refers to a nucleotide sequence encoding a short peptide sequence capable of causing generation of two peptide chains from translation of one RNA molecule. While not wishing to be bound by theory, it is hypothesized that ribosomal skipping elements function by (1) terminating translation of the first peptide chain and re-initiating translation of the second peptide chain; or (2) cleavage of a peptide bond in the peptide sequence encoded by the ribosomal skipping element by an intrinsic protease activity of the encoded peptide, or by another protease in the environment (e.g., cytosol).

[0114] The terms “sequence identity,” or “sequence similarity” as used herein, refers to the extent that sequences are identical on a nucleotide-by-nucleotide basis or an amino acid- by-amino acid basis over a window of comparison. Thus, a “percentage of sequence identity” may be calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g., A, T, C, G, I) or the identical amino acid residue (e.g., Ala, Pro, Ser, Thr, Gly, Val, Leu, Ile, Phe, Tyr, Trp, Lys, Arg, His, Asp, Glu, Asn, Gln, Cys and Met) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity. Included are nucleotides and polypeptides having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any of the reference sequences described herein, typically where the polypeptide variant maintains at least one biological activity of the reference polypeptide.

[0115] As used herein, a “spacer” refers to a region of a polynucleotide sequence ranging from 1 nucleotide to hundreds or thousands of nucleotides separating two other elements along a polynucleotide sequence. The sequences can be defined or can be random. A spacer is typically non-coding. In some embodiments, spacers include duplex regions.

[0116] As used here, the term “splicing efficiency” refers to a measurement of the rate of splicing activity (e.g., none, low, or high) in a splicing or self-splicing reaction, for example, in portions of a precursor RNA polynucleotide capable of self-circularization. In someembodiments, the splicing activity of, e.g., a monotron element or intron segment, is affected by the structure and / or sequence of the linear RNA polynucleotide.

[0117] As used herein, “structured” with regard to RNA refers to an RNA sequence that is predicted by the RNAFold software or similar predictive tools to form a structure (e.g., a hairpin loop) with itself or other sequences in the same RNA molecule. As used herein, “unstructured” with regard to RNA refers to an RNA sequence that is not predicted by RNA structure predictive tools to form a structure (e.g., a hairpin loop) with itself or other sequences in the same RNA molecule. In some embodiments, unstructured RNA can be functionally characterized using nuclease protection assays.

[0118] As used herein, the term “therapeutic protein” refers to any protein that, when administered to a subject directly or indirectly in the form of a translated nucleic acid, has a therapeutic, diagnostic, and / or prophylactic effect and / or elicits a desired biological and / or pharmacological effect.

[0119] As used herein, “translation initiation element” or “TIE” refers to a portion of the intervening region comprising a sequence to allow translation efficiency of an encoded protein. In some embodiments, core functional elements comprising one or more coding elements will further comprise one or more TIEs. In some embodiments, where the intervening region comprises one or more noncoding elements, the TIE can be part of the noncoding element. In some embodiments, the TIE comprises an internal ribosome entry site (IRES).

[0120] As used herein, “transcription” refers to the formation or synthesis of an RNA molecule by an RNA polymerase using a DNA molecule as a template. The disclosure is not limited with respect to the RNA polymerase that is used for transcription. For example, in some embodiments, a T7-type RNA polymerase can be used.

[0121] As used herein, “translation” refers to the formation of a polypeptide molecule by a ribosome based upon an RNA template.

[0122] As used herein, the term “translation efficiency” refers to a rate or amount of protein or peptide production from a ribonucleotide transcript. In some embodiments, translation efficiency can be expressed as amount of protein or peptide produced per given amount of transcript that codes for the protein or peptide.

[0123] As used herein, the term “transfect” or “transfection” refers to the intracellular introduction of one or more encapsulated materials (e.g., nucleic acids and / or polynucleotides) into a cell, or preferably into a target cell. The term “transfection efficiency” refers to the relative amount of such encapsulated material (e.g., polynucleotides) up-taken by, introduced into and / or expressed by the target cell which is subject to transfection. In some embodiments,transfection efficiency may be estimated by the amount of a reporter polynucleotide product produced by the target cells following transfection. In some embodiments, a transfer vehicle has high transfection efficiency. In some embodiments, a transfer vehicle has at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% transfection efficiency.

[0124] As used herein, “transfer vehicle” includes any of the standard pharmaceutical carriers, diluents, excipients, and the like, which are generally intended for use in connection with the administration of biologically active agents, including nucleic acids. In certain embodiments of the present disclosure, the transfer vehicles (e.g., lipid nanoparticles) are prepared to encapsulate one or more materials or therapeutic agents (e.g., circRNA). The process of incorporating a desired therapeutic agent (e.g., circRNA) into a transfer vehicle is referred to herein as or “loading” or “encapsulating” (Lasic, et al., FEBS Lett., 312: 255-258, 1992). The transfer vehicle-loaded or -encapsulated materials (e.g., circRNA) may be completely or partially located in the interior space of the transfer vehicle, within a bilayer membrane of the transfer vehicle, or associated with the exterior surface of the transfer vehicle.

[0125] The terms “treat,” and “prevent” as well as words stemming therefrom, as used herein, do not necessarily imply 100% or complete treatment or prevention. Rather, there are varying degrees of treatment or prevention of which one of ordinary skill in the art recognizes as having a potential benefit or therapeutic effect. The treatment or prevention provided by the method disclosed herein can include treatment or prevention of one or more conditions or symptoms of the disease. Also, for purposes herein, “prevention” can encompass delaying the onset of the disease, or a symptom or condition thereof, e.g., prophylaxis of disease.

[0126] As used herein, the terms “upstream” and “downstream” refer to relative positions of genetic code, e.g., nucleotides, sequence elements, in polynucleotide sequences. In some embodiments, in an RNA polynucleotide, upstream is toward the 5’ end of the polynucleotide and downstream is toward the 3’ end. In some embodiments, in a DNA polynucleotide, upstream is toward the 5’ end of the coding strand for the gene in question and downstream is toward the 3’ end.

[0127] As used herein, a “vaccine” refers to a composition for generating immunity for the prophylaxis and / or treatment of diseases. Accordingly, vaccines are medicaments which comprise antigens and are intended to be used in humans or animals for generating specific defense and protective substances upon administration to the human or animal. A. LIPID DEFINITIONS

[0128] As used herein, the phrase “biodegradable lipid” or “degradable lipid” refers toany of a number of lipid species that are broken down in a host environment on the order of minutes, hours, or days ideally making them less toxic and unlikely to accumulate in a host over time. Common modifications to lipids include ester bonds, and disulfide bonds among others to increase the biodegradability of a lipid.

[0129] As used herein, the phrase “biodegradable PEG lipid” or “degradable PEG lipid” refers to any of a number of lipid species where the PEG molecules are cleaved from the lipid in a host environment on the order of minutes, hours, or days ideally making them less immunogenic. Common modifications to PEG lipids include ester bonds, and disulfide bonds among others to increase the biodegradability of a lipid.

[0130] As used herein, the term “cationic lipid” or “ionizable lipid” refers to any of a number of lipid species that carry a net positive charge at a selected pH, such as physiological pH 4 and a neutral charge at other pHs such as physiological pH 7.

[0131] As used herein, the term “PEG” means any polyethylene glycol or other polyalkylene ether polymer.

[0132] As generally defined herein, a “PEG-OH lipid” (also referred to herein as “hydroxy-PEGylated lipid”) is a PEGylated lipid having one or more hydroxyl (–OH) groups on the lipid.

[0133] As used herein, a “phospholipid” is a lipid that includes a phosphate moiety and one or more carbon chains, such as unsaturated fatty acid chains.

[0134] As used herein, the term “structural lipid” refers to sterols and also to lipids containing sterol moieties. As defined herein, “sterols” are a subgroup of steroids consisting of steroid alcohols.

[0135] The terms “head-group” and “tail-group,” when used herein to describe the compounds (e.g., lipids) of the present disclosure, and in particular functional groups that are comprised in such compounds, are used for ease of reference to describe the orientation of such compounds or of one or more functional groups relative to other functional groups. For example, in certain embodiments, a hydrophilic head-group (e.g., guanidinium) is bound (e.g., by one or more of hydrogen-bonds, van der Waals' forces, ionic interactions and covalent bonds) to a cleavable functional group (e.g., a disulfide group), which in turn is bound to a hydrophobic tail-group (e.g., cholesterol). In certain embodiments, the compounds disclosed herein comprise, for example, at least one hydrophilic head-group and at least one hydrophobic tail-group, each bound to at least one cleavable group, thereby rendering such compounds amphiphilic.

[0136] As used herein, the term “amphiphilic” means the ability to dissolve in both polar(e.g., water) and non-polar (e.g., lipid) environments. For example, in certain embodiments, the compounds (e.g., lipids) disclosed herein comprise at least one lipophilic tail-group (e.g., cholesterol or a C6-20 alkyl) and at least one hydrophilic head-group (e.g., imidazole), each bound to a cleavable group (e.g., disulfide).

[0137] As used herein, the term “hydrophilic” is used to indicate in qualitative terms that a functional group is water-preferring, and typically such groups are water-soluble. For example, disclosed herein are compounds (e.g., ionizable lipids) that comprise a cleavable group (e.g., a disulfide (S—S) group) bound to one or more hydrophilic groups (e.g., a hydrophilic head-group), wherein such hydrophilic groups comprise or are selected from the group consisting of imidazole, guanidinium, amino, imine, enamine, an optionally-substituted alkyl amino (e.g., an alkyl amino such as dimethylamino) and pyridyl.

[0138] As used herein, the term “hydrophobic” is used to indicate in qualitative terms that a functional group is water-avoiding, and typically such groups are not water soluble. In certain embodiments, at least one of the functional groups of moieties that comprise the compounds disclosed herein is hydrophobic in nature (e.g., a hydrophobic tail-group comprising a naturally occurring lipid such as cholesterol). For example, disclosed herein are compounds (e.g., ionizable lipids) that comprise a cleavable functional group (e.g., a disulfide (S—S) group) bound to one or more hydrophobic groups, wherein such hydrophobic groups may comprise, or may be selected from, one or more naturally occurring lipids such as cholesterol, an optionally substituted, variably saturated or unsaturated C6-C20 alkyl, and / or an optionally substituted, variably saturated or unsaturated C6-C20acyl.

[0139] As used herein, the term “liposome” generally refers to a vesicle composed of lipids (e.g., amphiphilic lipids) arranged in one or more spherical bilayer or bilayers. Such liposomes may be unilamellar or multilamellar vesicles which have a membrane formed from a lipophilic material and an aqueous interior that contains the encapsulated circRNA to be delivered to one or more target cells, tissues and organs.

[0140] As used herein, the phrase “lipid nanoparticle” or “LNP” refers to a transfer vehicle comprising one or more cationic or ionizable lipids, stabilizing lipids, structural lipids, and helper lipids.

[0141] In certain embodiments, the compositions described herein comprise one or more liposomes or lipid nanoparticles. Examples of suitable lipids (e.g., ionizable lipids) that may be used to form the liposomes and lipid nanoparticles contemplated include one or more of the compounds disclosed herein (e.g., HGT4001, HGT4002, HGT4003, HGT4004 and / or HGT4005). Such liposomes and lipid nanoparticles may also comprise additional ionizablelipids such as C12-200, dLin-KC2-DMA, and / or HGT5001, helper lipids, structural lipids, PEG-modified lipids, MC3, DLinDMA, DLinkC2DMA, cKK-E12, ICE, HGT5000, DODAC, DDAB, DMRIE, DOSPA, DOGS, DODAP, DODMA, DMDMA, DODAC, DLenDMA, DMRIE, CLinDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLincarbDAP, DLinCDAP, kLin-K-DMA, dLin-K-XTC2-DMA, HGT4003, and combinations thereof.

[0142] In some embodiments, a lipid, e.g., an ionizable lipid, disclosed herein comprises one or more cleavable groups. The terms “cleave” and “cleavable” are used in this regard to mean that one or more chemical bonds (e.g., one or more of covalent bonds, hydrogen-bonds, van der Waals' forces and / or ionic interactions) between atoms in or adjacent to the subject functional group are broken (e.g., hydrolyzed) or are capable of being broken upon exposure to selected conditions (e.g., upon exposure to enzymatic conditions). In certain embodiments, the cleavable group is a disulfide functional group, and in particular embodiments is a disulfide group that is capable of being cleaved upon exposure to selected biological conditions (e.g., intracellular conditions). In certain embodiments, the cleavable group is an ester functional group that is capable of being cleaved upon exposure to selected biological conditions. For example, the disulfide groups may be cleaved enzymatically or by a hydrolysis, oxidation or reduction reaction. Upon cleavage of such disulfide functional group, the one or more functional moieties or groups (e.g., one or more of a head-group and / or a tail-group) that are bound thereto may be liberated. Exemplary cleavable groups may include, but are not limited to, disulfide groups, ester groups, ether groups, and any derivatives thereof (e.g., alkyl and aryl esters). In certain embodiments, the cleavable group is not an ester group or an ether group. In some embodiments, a cleavable group is bound (e.g., bound by one or more of hydrogen-bonds, van der Waals’ forces, ionic interactions and covalent bonds) to one or more functional moieties or groups (e.g., at least one head-group and at least one tail-group). In certain embodiments, at least one of the functional moieties or groups is hydrophilic (e.g., a hydrophilic head-group comprising one or more of imidazole, guanidinium, amino, imine, enamine, optionally-substituted alkyl amino and pyridyl). B. CHEMICAL DEFINITIONS

[0143] The disclosure may include compounds and pharmaceutically acceptable salts thereof, pharmaceutical compositions containing such compounds and methods of using such compounds and compositions, and the following terms, if present, have the following meanings unless otherwise indicated. It should also be understood that when described herein any of the moieties defined forth below may be substituted with a variety of substituents, and that therespective definitions are intended to include such substituted moieties within their scope as set out below. Unless otherwise stated, the term “substituted” is to be defined as set out below. It should be further understood that the terms “groups” and “radicals” can be considered interchangeable when used herein.

[0144] Compounds described herein may also comprise one or more isotopic substitutions. For example, H may be in any isotopic form, including1H,2H (D or deuterium), and3H (T or tritium); C may be in any isotopic form, including12C,13C, and14C; O may be in any isotopic form, including16O and18O; F may be in any isotopic form, including18F and19F; and the like.

[0145] When a range of values is listed, it is intended to encompass each value and sub– range within the range. For example, “C1–6alkyl” is intended to encompass, C1, C2, C3, C4, C5, C6, C1–6, C1–5, C1–4, C1–3, C1–2, C2–6, C2–5, C2–4, C2–3, C3–6, C3–5, C3–4, C4–6, C4–5, and C5–6 alkyl.

[0146] As used herein, the term “aliphatic” or “aliphatic group,” means a straight-chain (i.e., unbranched) or branched, substituted or unsubstituted hydrocarbon chain that is completely saturated or that contains one or more units of unsaturation, or a monocyclic hydrocarbon or bicyclic hydrocarbon that is completely saturated or that contains one or more units of unsaturation, but which is not aromatic (also referred to herein as “carbocycle,” “cycloaliphatic” or “cycloalkyl”), that has a single point of attachment to the rest of the molecule or multiple points of attachment to the rest of the molecule, as would be readily apparent to a person of ordinary skill in the art based on the context of the described molecule. In some embodiments, aliphatic groups contain 1-6 aliphatic carbon atoms. In some embodiments, aliphatic groups contain 1-5 aliphatic carbon atoms. In other embodiments, aliphatic groups contain 1-4 aliphatic carbon atoms. In still other embodiments, aliphatic groups contain 1-3 aliphatic carbon atoms, and in yet other embodiments, aliphatic groups contain 1-2 aliphatic carbon atoms. In some embodiments, “cycloaliphatic” (or “carbocycle” or “cycloalkyl”) refers to a monocyclic, bicyclic, or polycyclic C3-C14hydrocarbon that is completely saturated or that contains one or more units of unsaturation, but which is not aromatic, that has a single point of attachment to the rest of the molecule. Exemplary aliphatic groups include, but are not limited to, linear or branched, substituted or unsubstituted alkyl, alkenyl, alkynyl groups and hybrids thereof such as (cycloalkyl)alkyl, (cycloalkenyl)alkyl or (cycloalkyl)alkenyl. Examples of bicyclic and polycyclic cycloalkyls include bridged, fused, and spirocyclic carbocyclyls.

[0147] As used herein, the term “alkyl” refers to both straight and branched chain C1-40hydrocarbons (e.g., C6-20 hydrocarbons), and include both saturated and unsaturated hydrocarbons. In certain embodiments, the alkyl may comprise one or more cyclic alkyls and / orone or more heteroatoms such as oxygen, nitrogen, or sulfur and may optionally be substituted with substituents (e.g., one or more of alkyl, halo, alkoxyl, hydroxy, amino, aryl, ether, ester or amide). In certain embodiments, a contemplated alkyl includes (9Z,12Z)-octadeca-9,12- dien. The use of designations such as, for example, “C6-20” is intended to refer to an alkyl (e.g., straight or branched chain and inclusive of alkenes and alkyls) having the recited range carbon atoms. In some embodiments, an alkyl group has 1 to 10 carbon atoms (“C1–10alkyl”). In some embodiments, an alkyl group has 1 to 9 carbon atoms (“C1–9 alkyl”). In some embodiments, an alkyl group has 1 to 8 carbon atoms (“C1–8alkyl”). In some embodiments, an alkyl group has 1 to 7 carbon atoms (“C1–7 alkyl”). In some embodiments, an alkyl group has 1 to 6 carbon atoms (“C1–6alkyl”). In some embodiments, an alkyl group has 1 to 5 carbon atoms (“C1–5alkyl”). In some embodiments, an alkyl group has 1 to 4 carbon atoms (“C1–4 alkyl”). In some embodiments, an alkyl group has 1 to 3 carbon atoms (“C1–3 alkyl”). In some embodiments, an alkyl group has 1 to 2 carbon atoms (“C1-2 alkyl”). In some embodiments, an alkyl group has 1 carbon atom (“C1 alkyl”). Examples of C1–6 alkyl groups include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, pentyl, hexyl, and the like.

[0148] As used herein, “alkenyl” refers to a radical of a straight–chain or branched hydrocarbon group having from 2 to 20 carbon atoms, one or more carbon–carbon double bonds (e.g., 1, 2, 3, or 4 carbon–carbon double bonds), and optionally one or more carbon– carbon triple bonds (e.g., 1, 2, 3, or 4 carbon–carbon triple bonds) (“C2–20alkenyl”). In certain embodiments, alkenyl does not contain any triple bonds. In some embodiments, an alkenyl group has 2 to 10 carbon atoms (“C2–10alkenyl”). In some embodiments, an alkenyl group has 2 to 9 carbon atoms (“C2–9 alkenyl”). In some embodiments, an alkenyl group has 2 to 8 carbon atoms (“C2–8alkenyl”). In some embodiments, an alkenyl group has 2 to 7 carbon atoms (“C2–7 alkenyl”). In some embodiments, an alkenyl group has 2 to 6 carbon atoms (“C2–6 alkenyl”). In some embodiments, an alkenyl group has 2 to 5 carbon atoms (“C2–5alkenyl”). In some embodiments, an alkenyl group has 2 to 4 carbon atoms (“C2–4 alkenyl”). In some embodiments, an alkenyl group has 2 to 3 carbon atoms (“C2–3 alkenyl”). In some embodiments, an alkenyl group has 2 carbon atoms (“C2alkenyl”). The one or more carbon– carbon double bonds can be internal (such as in 2–butenyl) or terminal (such as in 1–butenyl). Examples of C2–4alkenyl groups include ethenyl (C2), 1–propenyl (C3), 2–propenyl (C3), 1– butenyl (C4), 2–butenyl (C4), butadienyl (C4), and the like. Examples of C2–6 alkenyl groups include the aforementioned C2–4alkenyl groups as well as pentenyl (C5), pentadienyl (C5), hexenyl (C6), and the like. Additional examples of alkenyl include heptenyl (C7), octenyl (C8), octatrienyl (C8), and the like.

[0149] As used herein, “alkynyl” refers to a radical of a straight–chain or branched hydrocarbon group having from 2 to 20 carbon atoms, one or more carbon–carbon triple bonds (e.g., 1, 2, 3, or 4 carbon–carbon triple bonds), and optionally one or more carbon–carbon double bonds (e.g., 1, 2, 3, or 4 carbon–carbon double bonds) (“C2–20alkynyl”). In certain embodiments, alkynyl does not contain any double bonds. In some embodiments, an alkynyl group has 2 to 10 carbon atoms (“C2–10alkynyl”). In some embodiments, an alkynyl group has 2 to 9 carbon atoms (“C2–9 alkynyl”). In some embodiments, an alkynyl group has 2 to 8 carbon atoms (“C2–8alkynyl”). In some embodiments, an alkynyl group has 2 to 7 carbon atoms (“C2–7 alkynyl”). In some embodiments, an alkynyl group has 2 to 6 carbon atoms (“C2–6 alkynyl”). In some embodiments, an alkynyl group has 2 to 5 carbon atoms (“C2–5alkynyl”). In some embodiments, an alkynyl group has 2 to 4 carbon atoms (“C2–4 alkynyl”). In some embodiments, an alkynyl group has 2 to 3 carbon atoms (“C2–3 alkynyl”). In some embodiments, an alkynyl group has 2 carbon atoms (“C2 alkynyl”). The one or more carbon– carbon triple bonds can be internal (such as in 2–butynyl) or terminal (such as in 1–butynyl). Examples of C2–4 alkynyl groups include, without limitation, ethynyl (C2), 1–propynyl (C3), 2– propynyl (C3), 1–butynyl (C4), 2–butynyl (C4), and the like. Examples of C2–6 alkenyl groups include the aforementioned C2–4alkynyl groups as well as pentynyl (C5), hexynyl (C6), and the like. Additional examples of alkynyl include heptynyl (C7), octynyl (C8), and the like.

[0150] As used herein, “alkylene,” “alkenylene,” and “alkynylene,” refer to a divalent radical of an alkyl, alkenyl, and alkynyl group respectively. When a range or number of carbons is provided for a particular “alkylene,” “alkenylene,” or “alkynylene” group, it is understood that the range or number refers to the range or number of carbons in the linear carbon divalent chain. “Alkylene,” “alkenylene,” and “alkynylene” groups may be substituted or unsubstituted with one or more substituents as described herein.

[0151] The term “alkoxy,” as used herein, refers to an alkyl group which is attached to another moiety via an oxygen atom (–O(alkyl)). Non-limiting examples include e.g., methoxy, ethoxy, propoxy, and butoxy.

[0152] As used herein, the term “aryl” refers to aromatic groups (e.g., monocyclic, bicyclic and tricyclic structures) containing six to ten carbons in the ring portion. The aryl groups may be optionally substituted through available carbon atoms and in certain embodiments may include one or more heteroatoms such as oxygen, nitrogen or sulfur. In some embodiments, an aryl group has six ring carbon atoms (“C6aryl”; e.g., phenyl). In some embodiments, an aryl group has ten ring carbon atoms (“C10 aryl”; e.g., naphthyl such as 1–naphthyl and 2–naphthyl).

[0153] As used herein, the term “bicyclic ring” or “bicyclic ring system” refers to anybicyclic ring system, i.e. carbocyclic or heterocyclic, saturated or having one or more units of unsaturation, having one or more atoms in common between the two rings of the ring system. Thus, the term comprises any permissible ring fusion, such as ortho-fused or spirocyclic. As used herein, the term “heterobicyclic” is a subset of “bicyclic” that requires that one or more heteroatoms are present in one or both rings of the bicycle. Such heteroatoms may be present at ring junctions and are optionally substituted, and may be selected from nitrogen (including N-oxides), oxygen, sulfur (including oxidized forms such as sulfones and sulfonates), phosphorus (including oxidized forms such as phosphonates and phosphates), boron, etc. In some embodiments, a bicyclic group has 7-12 ring members and 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. As used herein, the term “bridged bicyclic” refers to any bicyclic ring system, i.e. carbocyclic or heterocyclic, saturated or partially unsaturated, having at least one bridge. As defined by IUPAC, a “bridge” is an unbranched chain of atoms or an atom or a valence bond connecting two bridgeheads, where a “bridgehead” is any skeletal atom of the ring system which is bonded to three or more skeletal atoms (excluding hydrogen). In some embodiments, a bridged bicyclic group has 7-12 ring members and 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. Such bridged bicyclic groups are well known in the art and include those groups set forth below where each group is attached to the rest of the molecule at any substitutable carbon or nitrogen atom. Unless otherwise specified, a bridged bicyclic group is optionally substituted with one or more substituents as set forth for aliphatic groups. Additionally or alternatively, any substitutable nitrogen of a bridged bicyclic group is optionally substituted. Exemplary bicyclic rings include:Exemplary bridged bicyclics include:

[0154] The term “cycloalkyl” refers to a monovalent saturated cyclic, bicyclic, or bridged cyclic (e.g., adamantyl) hydrocarbon group of 3-12, 3-8, 4-8, or 4-6 carbons, referred to herein, e.g., as "C4-8cycloalkyl," derived from a cycloalkane. Exemplary cycloalkyl groups include, but are not limited to, cyclohexanes, cyclopentanes, cyclobutanes and cyclopropanes.

[0155] As used herein, “cyano” refers to –CN.

[0156] As used herein, “heteroaryl” refers to a radical of a 5–10 membered monocyclic or bicyclic 4n+2 aromatic ring system (e.g., having 6 or 10 electrons shared in a cyclic array) having ring carbon atoms and 1–4 ring heteroatoms provided in the aromatic ring system, wherein each heteroatom is independently selected from nitrogen, oxygen and sulfur (“5–10 membered heteroaryl”). In heteroaryl groups that contain one or more nitrogen atoms, the point of attachment can be a carbon or nitrogen atom, as valency permits. Heteroaryl bicyclic ring systems can include one or more heteroatoms in one or both rings. “Heteroaryl” includes ring systems wherein the heteroaryl ring, as defined above, is fused with one or more carbocyclyl or heterocyclyl groups wherein the point of attachment is on the heteroaryl ring, and in such instances, the number of ring members continue to designate the number of ring members in the heteroaryl ring system. “Heteroaryl” also includes ring systems wherein the heteroaryl ring, as defined above, is fused with one or more aryl groups wherein the point of attachment iseither on the aryl or heteroaryl ring, and in such instances, the number of ring members designates the number of ring members in the fused (aryl / heteroaryl) ring system. Bicyclic heteroaryl groups wherein one ring does not contain a heteroatom (e.g., indolyl, quinolinyl, carbazolyl, and the like) the point of attachment can be on either ring, i.e., either the ring bearing a heteroatom (e.g., 2–indolyl) or the ring that does not contain a heteroatom (e.g., 5– indolyl).

[0157] As used herein, “heterocyclyl” or “heterocyclic” refers to a radical of a 3– to 10– membered non–aromatic ring system having ring carbon atoms and 1 to 4 ring heteroatoms, wherein each heteroatom is independently selected from nitrogen, oxygen, sulfur, boron, phosphorus, and silicon (“3–10 membered heterocyclyl”). In heterocyclyl groups that contain one or more nitrogen atoms, the point of attachment can be a carbon or nitrogen atom, as valency permits. A heterocyclyl group can either be monocyclic (“monocyclic heterocyclyl”) or a fused, bridged or spiro ring system such as a bicyclic system (“bicyclic heterocyclyl”), and can be saturated or can be partially unsaturated. Heterocyclyl bicyclic ring systems can include one or more heteroatoms in one or both rings. “Heterocyclyl” also includes ring systems wherein the heterocyclyl ring, as defined above, is fused with one or more carbocyclyl groups wherein the point of attachment is either on the carbocyclyl or heterocyclyl ring, or ring systems wherein the heterocyclyl ring, as defined above, is fused with one or more aryl or heteroaryl groups, wherein the point of attachment is on the heterocyclyl ring, and in such instances, the number of ring members continue to designate the number of ring members in the heterocyclyl ring system. The terms “heterocycle,” “heterocyclyl,” “heterocyclyl ring,” “heterocyclic group,” “heterocyclic moiety,” and “heterocyclic radical,” may be used interchangeably.

[0158] The terms “halo” and “halogen” as used herein refer to an atom selected from fluorine (fluoro, F), chlorine (chloro, Cl), bromine (bromo, Br), and iodine (iodo, I). In certain embodiments, the halo group is either fluoro or chloro.

[0159] As used herein, “oxo” refers to –C=O.

[0160] In general, the term “substituted”, whether preceded by the term “optionally” or not, means that at least one hydrogen present on a group (e.g., a carbon or nitrogen atom) is replaced with a permissible substituent, e.g., a substituent which upon substitution results in a stable compound, e.g., a compound which does not spontaneously undergo transformation such as by rearrangement, cyclization, elimination, or other reaction. Unless otherwise indicated, a “substituted” group has a substituent at one or more substitutable positions of the group, and when more than one position in any given structure is substituted, the substituent is either the same or different at each position. Illustrative substituents include, but are not limited to,halogens, hydroxyl groups, or any other organic groupings containing any number of carbon atoms, for example, 1-14 carbon atoms, and optionally include one or more heteroatoms such as oxygen, sulfur, or nitrogen grouping in linear, branched, or cyclic structural formats. Representative substituents include alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, phenyl, substituted phenyl, aryl, substituted aryl, heteroaryl, substituted heteroaryl, halo, hydroxyl, alkoxy, substituted alkoxy, phenoxy, substituted phenoxy, aroxy, substituted aroxy, alkylthio, substituted alkylthio, phenylthio, substituted phenylthio, arylthio, substituted arylthio, cyano, isocyano, substituted isocyano, carbonyl, substituted carbonyl, carboxyl, substituted carboxyl, amino, substituted amino, amido, substituted amido, sulfonyl, substituted sulfonyl, sulfonic acid, phosphoryl, substituted phosphoryl, phosphonyl, substituted phosphonyl, polyaryl, substituted polyaryl, C3-C20 cyclic, substituted C3-C20 cyclic, heterocyclic, substituted heterocyclic, aminoacid, peptide, and polypeptide groups. Combinations of substituents envisioned by this disclosure are preferably those that result in the formation of stable or chemically feasible compounds. The term "stable", as used herein, refers to compounds that are not substantially altered when subjected to conditions to allow for their production, detection, and, in certain embodiments, their recovery, purification, and use for one or more of the purposes disclosed herein.

[0161] Suitable monovalent substituents on a substitutable carbon atom of an "optionally substituted" group are independently halogen; —(CH2)0-4R∘; —(CH2)0-4OR∘; —O(CH2)0-4R∘, — O—(CH2)0-4C(O)OR∘; —(CH2)0-4CH(OR∘)2; —(CH2)0-4SR∘; —(CH2)0-4Ph, which may be substituted with R∘; —(CH2)0-4O(CH2)0-1Ph which may be substituted with R∘; —CH═CHPh, which may be substituted with R∘;—(CH2)0-4O(CH2)0-1-pyridyl which may be substituted with R∘; —NO2; —CN; —N3; —(CH2)0-4N(R∘)2; —(CH2)0-4N(R∘)C(O)R∘; —N(R∘)C(S)R∘; —(CH2)0-4N(R∘)C(O)NR∘2; —N(R∘)C(S)NR∘2; —(CH2)0-4N(R∘)C(O)OR∘; —N(R∘)N(R∘)C(O)R∘; — N(R∘)N(R∘)C(O)NR∘2; —N(R∘)N(R∘)C(O)OR∘; —(CH2)0-4C(O)R∘; —C(S)R∘; —(CH2)0- 4C(O)OR∘; —(CH2)0-4C(O)SR∘; —(CH2)0-4C(O)OSiR∘3; —(CH2)0-4OC(O)R∘; —OC(O)(CH2)0-4SR∘, SC(S)SR∘;—(CH2)0-4SC(O)R∘;—(CH2)0-4C(O)NR∘2;—C(S)NR∘2;—C(S)SR∘;—SC(S)SR∘, —(CH2)0-4OC(O)NR∘2; —C(O)N(OR∘)R∘; —C(O)C(O)R∘; —C(O)CH2C(O)R∘; —C(NOR∘)R∘; — (CH2)0-4SSR∘; —(CH2)0-4S(O)2R∘; —(CH2)0-4S(O)2OR∘; —(CH2)0-4OS(O)2R∘; —S(O)2NR∘2; — (CH2)0-4S(O)R∘; —N(R∘)S(O)2NR∘2; —N(R∘)S(O)2R∘; —N(OR∘)R∘; —C(NH)NR∘2; —P(O)2R∘; — P(O)R∘2; —OP(O)R∘2; —OP(O)(OR∘)2; SiR∘3; —(C1-4straight or branched alkylene)O—N(R∘)2; or—(C1-4 straight or branched alkylene)C(O)O—N(R∘)2, wherein each R∘may be substituted as defined below and is independently hydrogen, C1-6aliphatic, —CH2Ph, —O(CH2)0-1Ph, —CH2-(5-6 membered heteroaryl ring), or a 5-6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, or, notwithstanding the definition above, two independent occurrences of R∘, taken together with their intervening atom(s), form a 3-12-membered saturated, partially unsaturated, or aryl mono- or bicyclic ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, which may be substituted as defined below.

[0162] Suitable monovalent substituents on R∘(or the ring formed by taking two independent occurrences of R∘together with their intervening atoms), are independently halogen, —(CH2)0-2R●, -(haloR●), —(CH2)0-2OH, —(CH2)0-2OR●, —(CH2)0-2CH(OR●)2; — O(haloR●), —CN, —N3, —(CH2)0-2C(O)R●, —(CH2)0-2C(O)OH, —(CH2)0-2C(O)OR●, —(CH2)0-2SR●, —(CH2)0-2SH, —(CH2)0-2NH2, —(CH2)0-2NHR●, —(CH2)0-2NR●2, —NO2, —SiR●3, — OSiR●3,—C(O)SR●,—(C1-4straight or branched alkylene)C(O)OR●, or—SSR●wherein each R●is unsubstituted or where preceded by "halo" is substituted only with one or more halogens, and is independently selected from C1-4 aliphatic,—CH2Ph,—O(CH2)0-1Ph, or a 5-6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. Suitable divalent substituents on a saturated carbon atom of R∘include═O and ═S.

[0163] Suitable divalent substituents on a saturated carbon atom of an "optionally substituted" group include the following:═O, ═S,═NNR*2,═NNHC(O)R*,═NNHC(O)OR*, ═NNHS(O)2R*, ═NR*, ═NOR*, —O(C(R*2))2-3O—, or —S(C(R*2))2-3S—, wherein each independent occurrence of R* is selected from hydrogen, C1-6aliphatic which may be substituted as defined below, or an unsubstituted 5-6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. Suitable divalent substituents that are bound to vicinal substitutable carbons of an "optionally substituted" group include:—O(CR*2)2-3O—, wherein each independent occurrence of R* is selected from hydrogen, C1-6aliphatic which may be substituted as defined below, or an unsubstituted 5-6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

[0164] Suitable substituents on the aliphatic group of R* include halogen,—R●, -(haloR●), —OH, —OR●, —O(haloR●), —CN, —C(O)OH, —C(O)OR●, —NH2, —NHR●, —NR●2, or —NO2, wherein each R●is unsubstituted or where preceded by "halo" is substituted only with one or more halogens, and is independently C1-4 aliphatic, —CH2Ph, —O(CH2)0-1Ph, or a 5-6- membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independentlyselected from nitrogen, oxygen, or sulfur.

[0165] Suitable substituents on a substitutable nitrogen of an "optionally substituted" group include—R†,—NR†2,—C(O)R†,—C(O)OR†,—C(O)C(O)R†,—C(O)CH2C(O)R†,—S(O)2R†,— S(O)2NR†2, —C(S)NR†2, —C(NH)NR†2, or —N(R†)S(O)2R†; wherein each R†is independently hydrogen, C1-6 aliphatic which may be substituted as defined below, unsubstituted—OPh, or an unsubstituted 5-6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, or, notwithstanding the definition above, two independent occurrences of R†, taken together with their intervening atom(s) form an unsubstituted 3-12-membered saturated, partially unsaturated, or aryl mono- or bicyclic ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

[0166] Suitable substituents on the aliphatic group of R†are independently halogen,—R●, -(haloR●), —OH, —OR●, —O(haloR●), —CN, —C(O)OH, —C(O)OR●, —NH2, —NHR●, —NR●2, or —NO2, wherein each R●is unsubstituted or where preceded by "halo" is substituted only with one or more halogens, and is independently C1-4aliphatic, —CH2Ph, —O(CH2)0-1Ph, or a 5-6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

[0167] Heteroatoms such as nitrogen may have hydrogen substituents and / or any permissible substituents of organic compounds described herein which satisfy the valences of the heteroatoms. It is understood that "substitution" or "substituted" comprises the implicit proviso that such substitution is in accordance with permitted valence of the substituted atom and the substituent, and that the substitution results in a stable compound, i.e., a compound that does not spontaneously undergo transformation, for example, by rearrangement, cyclization, or elimination.

[0168] In a broad aspect, the permissible substituents include acyclic and cyclic, branched and unbranched, carbocyclic and heterocyclic, aromatic and nonaromatic substituents of organic compounds. Illustrative substituents include, for example, those described herein. The permissible substituents can be one or more and the same or different for appropriate organic compounds. The heteroatoms such as nitrogen may have hydrogen substituents and / or any permissible substituents of organic compounds described herein which satisfy the valencies of the heteroatoms.

[0169] In various embodiments, the substituent is selected from alkoxy, aryloxy, alkyl, alkenyl, alkynyl, amide, amino, aryl, arylalkyl, carbamate, carboxy, cyano, cycloalkyl, ester,ether, formyl, halogen, haloalkyl, heteroaryl, heterocyclyl, hydroxyl, ketone, nitro, phosphate, sulfide, sulfinyl, sulfonyl, sulfonic acid, sulfonamide, and thioketone, each of which optionally is substituted with one or more suitable substituents. In some embodiments, the substituent is selected from alkoxy, aryloxy, alkyl, alkenyl, alkynyl, amide, amino, aryl, arylalkyl, carbamate, carboxy, cycloalkyl, ester, ether, formyl, haloalkyl, heteroaryl, heterocyclyl, ketone, phosphate, sulfide, sulfinyl, sulfonyl, sulfonic acid, sulfonamide, and thioketone, wherein each of the alkoxy, aryloxy, alkyl, alkenyl, alkynyl, amide, amino, aryl, arylalkyl, carbamate, carboxy, cycloalkyl, ester, ether, formyl, haloalkyl, heteroaryl, heterocyclyl, ketone, phosphate, sulfide, sulfinyl, sulfonyl, sulfonic acid, sulfonamide, and thioketone can be further substituted with one or more suitable substituents.

[0170] Examples of substituents include, but are not limited to, halogen, azide, alkyl, aralkyl, alkenyl, alkynyl, cycloalkyl, hydroxyl, alkoxyl, amino, nitro, sulfhydryl, imino, amido, phosphonate, phosphinate, carbonyl, carboxyl, silyl, ether, alkylthio, sulfonyl, sulfonamido, ketone, aldehyde, thioketone, ester, heterocyclyl,–CN, aryl, aryloxy, perhaloalkoxy, aralkoxy, heteroaryl, heteroaryloxy, heteroarylalkyl, heteroaralkoxy, azido, alkylthio, oxo, acylalkyl, carboxy esters, carboxamido, acyloxy, aminoalkyl, alkylaminoaryl, alkylaryl, alkylaminoalkyl, alkoxyaryl, arylamino, aralkylamino, alkylsulfonyl, carboxamidoalkylaryl, carboxamidoaryl, hydroxyalkyl, haloalkyl, alkylaminoalkylcarboxy, aminocarboxamidoalkyl, cyano, alkoxyalkyl, perhaloalkyl, arylalkyloxyalkyl, and the like. In some embodiments, the substituent is selected from cyano, halogen, hydroxyl, and nitro.

[0171] As used herein, “pharmaceutically acceptable salt” refers to those salts which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response and the like, and are commensurate with a reasonable benefit / risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, Berge et al., describes pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences (1977) 66:1–19. Pharmaceutically acceptable salts include those derived from suitable inorganic and organic acids and bases. Examples of pharmaceutically acceptable, nontoxic acid addition salts are salts of an amino group formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid or with organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid or malonic acid or by using other methods used in the art such as ion exchange. Other pharmaceutically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate,ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2–hydroxy–ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2–naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3– phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p–toluenesulfonate, undecanoate, valerate salts, and the like. Pharmaceutically acceptable salts derived from appropriate bases include alkali metal, alkaline earth metal, ammonium and N+(C1–4alkyl)4salts. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like. Further pharmaceutically acceptable salts include, when appropriate, nontoxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halide, hydroxide, carboxylate, sulfate, phosphate, nitrate, lower alkyl sulfonate, and aryl sulfonate.

[0172] In typical embodiments, the present disclosure is intended to encompass the compounds disclosed herein, and the pharmaceutically acceptable salts, pharmaceutically acceptable esters, tautomeric forms, polymorphs, and prodrugs of such compounds. In some embodiments, the present disclosure includes a pharmaceutically acceptable addition salt, a pharmaceutically acceptable ester, a solvate (e.g., hydrate) of an addition salt, a tautomeric form, a polymorph, an enantiomer, a mixture of enantiomers, a stereoisomer or mixture of stereoisomers (pure or as a racemic or non-racemic mixture) of a compound described herein.

[0173] Compounds described herein can comprise one or more asymmetric centers, and thus can exist in various isomeric forms, e.g., enantiomers and / or diastereomers. For example, the compounds described herein can be in the form of an individual enantiomer, diastereomer or geometric isomer, or can be in the form of a mixture of stereoisomers, including racemic mixtures and mixtures enriched in one or more stereoisomer. Isomers can be isolated from mixtures by methods known to those skilled in the art, including chiral high pressure liquid chromatography (HPLC) and the formation and crystallization of chiral salts; or preferred isomers can be prepared by asymmetric syntheses. See, for example, Jacques et al., Enantiomers, Racemates and Resolutions (Wiley Interscience, New York, 1981); Wilen et al., Tetrahedron 33:2725 (1977); Eliel, Stereochemistry of Carbon Compounds (McGraw–Hill, NY, 1962); and Wilen, Tables of Resolving Agents and Optical Resolutions p.268 (E.L. Eliel, Ed., Univ. of Notre Dame Press, Notre Dame, IN 1972). The disclosure additionally encompasses compounds described herein as individual isomers substantially free of other isomers, and alternatively, as mixtures of various isomers.

[0174] In certain embodiments, the compounds (e.g., ionizable lipids) and the transfervehicles (e.g., lipid nanoparticles) of which such compounds are a component exhibit an enhanced (e.g., increased) ability to transfect one or more target cells. Accordingly, also provided herein are methods of transfecting one or more target cells. Such methods generally comprise the step of contacting the one or more target cells with the compounds and / or pharmaceutical compositions disclosed herein such that the one or more target cells are transfected with the RNA (e.g., circular RNA) encapsulated therein.

[0175] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting. Unless specifically stated or obvious from context, as used herein, the term “or” is understood to be inclusive. Unless defined herein and below in the reminder of the specification, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. 2. CIRCULAR RNA

[0176] Provided herein are circular RNA constructs encoding a BCMA binding molecule, e.g., CAR, and related pharmaceutical compositions comprising transfer vehicles, wherein the circular RNA constructs are capable of in vivo delivery to immune cells for therapy. According to the present disclosure, the circular RNA provided herein can be injected into an animal (e.g., a human), such that a polypeptide encoded by the circular RNA molecule is expressed inside the animal, for example by one or more immune cells, e.g., T cells, NK cells, macrophages, etc.

[0177] In some embodiments, the BCMA binding molecule may be encoded by a linear mRNA constructs, and pharmaceutical compositions comprising transfer vehicles and said linear mRNA constructs are capable of in vivo delivery to immune cells for therapy.

[0178] In some embodiments, provided herein are circular RNA comprising, optionally in the following order, a 3ʹ self-spliced exon segment, optionally a first spacer, a translation initiation element (TIE) (e.g., comprising an Internal Ribosome Entry Site (IRES)), an expression sequence encoding a BCMA binding molecule (e.g., encoding a chimeric antigen receptor (CAR)), optionally a second spacer, and a 5ʹ self-spliced exon segment.

[0179] In some embodiments, the circular RNA comprises expression sequences encoding two or more BCMA binding molecules. In some embodiments, the two or more BCMA molecules are two or more copies of the same BCMA binding molecule. In some embodiments, the two or more BCMA molecules are different BCMA binding molecules. In some embodiments, a first BCMA binding molecule comprises a first set of complementarydetermining region sequences (CDRs), and a second BCMA binding molecule comprises a second set of CDRs that differs from the first set of CDRs; in these embodiments, the first set of CDRs and the second set of CDRs may bind to the same or to different epitopes of BCMA. In some embodiments, a first BCMA binding molecule binds a first epitope of BCMA, and a second BCMA binding molecule binds a second epitope of BCMA that differs from the first epitope.

[0180] In certain embodiments, a circular RNA is formulated into a pharmaceutical composition. In certain embodiments, the pharmaceutical composition comprises a transfer vehicle. In certain embodiments, a circular RNA construct comprising a TIE and at least one expression sequence encoding a BCMA binding molecule is formulated into a pharmaceutical composition comprising a transfer vehicle.

[0181] In certain embodiments, pharmaceutical compositions comprising a circular RNA construct comprising a TIE and at least one expression sequence encoding a BCMA binding molecule, and a transfer vehicle are disclosed. In certain embodiments, the transfer vehicle facilitates and / or enhances the delivery and release of circular RNA to one or more target cells.

[0182] In certain embodiments, the circular RNA constructs and related pharmaceutical compositions comprise a TIE and at least one expression sequence encoding a BCMA binding molecule, wherein the TIE is capable of facilitating expression of the protein when delivered in vivo.

[0183] In some embodiments, a polynucleotide encodes a protein that is made up of subunits that are encoded by more than one gene. For example, the protein may be a heterodimer, wherein each chain or subunit of the protein is encoded by a separate. It is possible that more than one circular RNA molecule is delivered in the transfer vehicle and each circular RNA encodes a separate subunit of the protein. Alternatively, a single circular RNA may be engineered to encode more than one subunit. In certain embodiments, separate circular RNA molecules encoding the individual subunits may be administered in separate transfer vehicles.

[0184] In certain embodiments, the circular RNA comprises a TIE and at least one expression sequence encoding an anti-BCMA CAR construct. In some embodiments, the CAR may be programmed to both recognize BCMA and, when bound to that BCMA, activate the immune cell to attack and destroy the cell. In certain embodiments, the payload encoded by the circular RNA polynucleotide may be optimized through use of a specific internal ribosome entry sites (IRES) within the TIE. The TIE can comprise an untranslated region (UTR), aptamer complex, or a combination thereof. The UTR can be in whole or in part from a viral or eukaryotic mRNA. In some embodiments, TIE, e.g., IRES, specificity within a circularRNA can significantly enhance expression of the BCMA binding molecule encoded within the coding element.

[0185] The circular RNA is produced by transcription of a DNA template that results in formation of a precursor linear RNA polynucleotide capable of circularizing. Linear precursor RNA polynucleotides are provided for producing circular RNA constructs and related pharmaceutical compositions. The DNA template shares the same sequence as the precursor linear RNA polynucleotide prior to splicing of the precursor linear RNA polynucleotide. The DNA template shares the same sequence as the precursor linear RNA polynucleotide prior to splicing of the precursor linear RNA polynucleotide. In some embodiments, said linear precursor RNA polynucleotide undergoes splicing to remove a 3’ intron element and 5’ intron element during the process of circularization. In some embodiments, the resulting circular RNA polynucleotide lacks a 3’ intron element and a 5’ intron element, but maintains a 3’ exon element, an intervening region comprising an anti-BCMA CAR coding sequence, and a 5’ exon element. Circularization strategies are known in the art and described elsewhere herein. In certain embodiments, the resulting circular RNA can include a PIE (permuted intron-exon) region, a translation region (IRES and coding / noncoding elements), and a PIE region. The resulting permuted intron-exon (PIE) regions allow for 5’ and 3’ ends of the RNA to covalently link and form the circular RNA.

[0186] In certain embodiments circular RNA provided herein is produced inside a cell. In some embodiments, precursor RNA is transcribed using a DNA template (e.g., in some embodiments, using a vector provided herein) in the cytoplasm by a bacteriophage RNA polymerase, or in the nucleus by host RNA polymerase II and then circularized.

[0187] In certain embodiments, the circular RNA provided herein is injected into an animal (e.g., a human, non-human primate, or rodent), such that the BCMA binding molecule, e.g., CAR, encoded by the circular RNA molecule is expressed inside the animal. In certain embodiments, the BCMA binding molecule, e.g., CAR, encoded by the circular RNA is embedded at least in part on the surface or inside of a cell within the animal.

[0188] In some embodiments, the DNA (e.g., vector), linear RNA (e.g., precursor RNA), and / or circular RNA polynucleotide provided herein is between 300 and 10000, 400 and 9000, 500 and 8000, 600 and 7000, 700 and 6000, 800 and 5000, 900 and 5000, 1000 and 5000, 1100 and 5000, 1200 and 5000, 1300 and 5000, 1400 and 5000, and / or 1500 and 5000 nucleotides in length. In some embodiments, the polynucleotide is at least 300 nucleotides, 400 nucleotides, 500 nucleotides, 600 nucleotides, 700 nucleotides, 800 nucleotides, 900 nucleotides, 1000 nucleotides, 1100 nucleotides, 1200 nucleotides, 1300 nucleotides, 1400 nucleotides, 1500nucleotides, 2000 nucleotides, 2500 nucleotides, 3000 nucleotides, 3500 nucleotides, 4000 nucleotides, 4500 nucleotides, or 5000 nucleotides in length. In some embodiments, the polynucleotide is no more than 3000 nucleotides, 3500 nucleotides, 4000 nucleotides, 4500 nucleotides, 5000 nucleotides, 6000 nucleotides, 7000 nucleotides, 8000 nucleotides, 9000 nucleotides, or 10000 nucleotides in length. In some embodiments, the length of a DNA, linear RNA, and / or circular RNA polynucleotide provided herein is about 300 nucleotides, 400 nucleotides, 500 nucleotides, 600 nucleotides, 700 nucleotides, 800 nucleotides, 900 nucleotides, 1000 nucleotides, 1100 nucleotides, 1200 nucleotides, 1300 nucleotides, 1400 nucleotides, 1500 nucleotides, 2000 nucleotides, 2500 nucleotides, 3000 nucleotides, 3500 nucleotides, 4000 nucleotides, 4500 nucleotides, 5000 nucleotides, 6000 nucleotides, 7000 nucleotides, 8000 nucleotides, 9000 nucleotides, or 10000 nucleotides .

[0189] In some embodiments, the circular RNA provided herein has higher functional stability than mRNA comprising the same expression sequence. In some embodiments, the circular RNA provided herein has higher functional stability than mRNA comprising the same expression sequence, modified nucleotides (e.g., 5moU modifications), an optimized UTR, a cap, and / or a polyA tail.

[0190] In some embodiments, the circular RNA provided herein has a functional half-life of at least 5 hours, 10 hours, 15 hours, 20 hours, 30 hours, 40 hours, 50 hours, 60 hours, 70 hours or 80 hours. In some embodiments, the circular RNA polynucleotide provided herein has a functional half-life of 5-80, 10-70, 15-60, and / or 20-50 hours. In some embodiments, the circular RNA polynucleotide provided herein has a functional half-life greater than (e.g., at least 1.5-fold greater than, at least 2-fold greater than) that of an equivalent linear RNA polynucleotide encoding the same protein. In some embodiments, functional half-life can be assessed through the detection of functional protein synthesis.

[0191] In some embodiments, the circular RNA polynucleotide provided herein has a half- life of at least 5 hours, 10 hours, 15 hours, 20 hours, 30 hours, 40 hours, 50 hours, 60 hours, 70 hours, or 80 hours. In some embodiments, the circular RNA polynucleotide provided herein has a half-life of 5-80, 10-70, 15-60, and / or 20-50 hours. In some embodiments, the circular RNA polynucleotide provided herein has a half-life greater than (e.g., at least 1.5-fold greater than, at least 2-fold greater than) that of an equivalent linear RNA polynucleotide encoding the same protein. In some embodiments, the circular RNA polynucleotide, or pharmaceutical composition thereof, has a functional half-life in a human cell greater than or equal to that of a pre-determined threshold value. In some embodiments the functional half-life is determined by a functional protein assay. For example, in some embodiments, the functional half-life isdetermined by an in vitro luciferase assay, wherein the activity of Gaussia luciferase (GLuc) is measured in the media of human cells (e.g. HepG2) expressing the circular RNA polynucleotide every 1, 2, 6, 12, or 24 hours over 1, 2, 3, 4, 5, 6, 7, or 14 days. In other embodiments, the functional half-life is determined by an in vivo assay, wherein levels of a protein encoded by the expression sequence of the circular RNA polynucleotide are measured in patient serum or tissue samples every 1, 2, 6, 12, or 24 hours over 1, 2, 3, 4, 5, 6, 7, or 14 days. In some embodiments, the pre-determined threshold value is the functional half-life of a reference linear RNA polynucleotide comprising the same expression sequence as the circular RNA polynucleotide.

[0192] In some embodiments, the circular RNA provided herein may have a higher magnitude of expression than equivalent linear mRNA, e.g., a higher magnitude of expression 24 hours after administration of RNA to cells. In some embodiments, the circular RNA provided herein has a higher magnitude of expression than mRNA comprising the same expression sequence, 5moU modifications, an optimized UTR, a cap, and / or a polyA tail.

[0193] In some embodiments, the circular RNA provided herein may be less immunogenic than an equivalent mRNA when exposed to an immune system of an organism or a certain type of immune cell. In some embodiments, the circular RNA provided herein is associated with modulated production of cytokines when exposed to an immune system of an organism or a certain type of immune cell. For example, in some embodiments, the circular RNA provided herein is associated with reduced production of IFN-β1, RIG-I, IL-2, IL-6, IFNγ, and / or TNFα when exposed to an immune system of an organism or a certain type of immune cell as compared to mRNA comprising the same expression sequence. In some embodiments, the circular RNA provided herein is associated with less IFN-β1, RIG-I, IL-2, IL-6, IFNγ, and / or TNFα transcript induction when exposed to an immune system of an organism or a certain type of immune cell as compared to mRNA comprising the same expression sequence. In some embodiments, the circular RNA provided herein is less immunogenic than mRNA comprising the same expression sequence. In some embodiments, the circular RNA provided herein is less immunogenic than mRNA comprising the same expression sequence, modified nucleotides (e.g., 5moU modifications), an optimized UTR, a cap, and / or a polyA tail.

[0194] In some embodiments, the circular RNA provided herein can be encapsulated by a transfer vehicle (e.g., LNPs), which can deliver the circular RNA constructs. Encapsulating the circular RNA in the transfer vehicle, for example can efficiently introduce the BCMA binding molecule, e.g., CAR, genes to immune cells, e.g., T cells. The transfer vehicles cancomprise, e.g., ionizable lipids, PEG-modified lipids, helper lipids, and / or structural lipids, that are capable of encapsulating the circular RNAs. Pharmaceutical compositions are provided for circular RNA constructs comprising an IRES, an expression sequence encoding a BCMA binding molecule (e.g., BCMA CAR), and a transfer vehicle.

[0195] In certain embodiments, the circular RNA constructs provided herein can be transfected into a cell as is or can be transfected in DNA vector form and transcribed in the cell. Transcription of circular RNA from a transfected DNA vector can be via added polymerases or polymerases encoded by nucleic acids transfected into the cell, or preferably via endogenous polymerases. Accordingly, also provided herein is a eukaryotic cell comprising a circular RNA polynucleotide provided herein. In some embodiments, the eukaryotic cell is a human cell. In some embodiments, the eukaryotic cell is an immune cell. In some embodiments, the eukaryotic cell is a T cell, natural killer cell (NK cell), dendritic cell, macrophage, B cell, neutrophil, or basophil. Also provided herein is a prokaryotic cell comprising a circular RNA polynucleotide provided herein.

[0196] In some embodiments, provided herein is a T cell, e.g., human T cell, comprising the circular RNA constructs provided herein. In some embodiments, provided herein is a helper T cell, e.g., human helper T cell, comprising the circular RNA constructs provided herein. In some embodiments, provided herein is a cytotoxic T cell, e.g., human cytotoxic T cell, comprising the circular RNA constructs provided herein. In some embodiments, provided herein is a NK cell, e.g., human NK cell, comprising the circular RNA constructs provided herein. In some embodiments, provided herein is a macrophage, e.g., human macrophage, comprising the circular RNA constructs provided herein. In some embodiments, provided herein is a monocyte, e.g., human monocyte, comprising the circular RNA constructs provided herein. In some embodiments, provided herein is a myeloid cell, human monocyte, comprising the circular RNA constructs provided herein. In some embodiments, these cells are present in the bone marrow. In some embodiments, these cells are present in the spleen. In some embodiments, these cells are present in the blood, e.g., peripheral blood.

[0197] In some embodiments, provided herein is a CD3+ cell, e.g., human CD3+ cell, comprising the circular RNA constructs provided herein. In some embodiments, provided herein is a CD4+ cell, e.g., human CD4+ cell, comprising the circular RNA constructs provided herein. In some embodiments, provided herein is a CD8+ cell, e.g., human CD8+ cell, comprising the circular RNA constructs provided herein. In some embodiments, provided herein is a CD14+ cell, e.g., human CD14+ cell, comprising the circular RNA constructs provided herein. In some embodiments, provided herein is a CD16+ cell, e.g., human CD16+cell, comprising the circular RNA constructs provided herein. In some embodiments, provided herein is a CD56+ cell, e.g., human CD56+ cell, comprising the circular RNA constructs provided herein. In some embodiments, provided herein is a CD11B+ cell, e.g., human CD11B+ cell, comprising the circular RNA constructs provided herein. In some embodiments, provided herein is a CD33+ cell, e.g., human CD33+ cell, comprising the circular RNA constructs provided herein. In some embodiments, provided herein is a CD33+ CD14+ cell, e.g., human CD33+ CD14+ cell, comprising the circular RNA constructs provided herein. In some embodiments, provided herein is a CD33+ CD14+ cell, e.g., human CD33+ CD64+ cell, comprising the circular RNA constructs provided herein. In some embodiments, these cells are present in the bone marrow. In some embodiments, these cells are present in the spleen. In some embodiments, these cells are present in the blood, e.g., peripheral blood.

[0198] The circular RNA can be unmodified, partially modified or completely modified. In one embodiment, the circular RNA contains at least one nucleoside modification. In one embodiment, up to 100% of the nucleosides of the circular RNA are modified. In one embodiment, at least one nucleoside modification is a uridine modification or an adenosine modification. In one embodiment, at least one nucleoside modification is selected from N6- methyladenosine (m6A), pseudouridine (ψ), N1-methylpseudouridine (m1ψ), and 5- methoxyuridine (5moU). In one embodiment, the precursor RNA is modified with methylpseudouridine (m1ψ). In certain embodiments, a coding sequence (e.g., encoding a BCMA binding molecule) of the circular RNA contains at least one nucleoside modification. In certain embodiments, a coding sequence (e.g., encoding a BCMA binding molecule) of a circular RNA does not contain any nucleotide modifications.

[0199] In certain embodiments, a provided polynucleotide (e.g., a DNA template, a linear RNA polynucleotide, or a circular RNA polynucleotide) comprises modified nucleotides and / or modified nucleosides. In some embodiments, the modified nucleoside is m5C (5- methylcytidine). In another embodiment, the modified nucleoside is m5U (5-methyluridine). In another embodiment, the modified nucleoside is m6A (N6-methyladenosine). In another embodiment, the modified nucleoside is s2U (2-thiouridine). In another embodiment, the modified nucleoside is Ψ (pseudouridine). In another embodiment, the modified nucleoside is Um (2′-O-methyluridine). In other embodiments, the modified nucleoside is m1A (1- methyladenosine); m2A (2-methyladenosine); Am (2’-O-methyladenosine); ms2m6A (2- methylthio-N6-methyladenosine); i6A (N6-isopentenyladenosine); ms2i6A (2-methylthio- N6isopentenyladenosine); io6A (N6-(cis-hydroxyisopentenyl)adenosine); ms2io6A (2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine); g6A (N6-glycinylcarbamoyladenosine); t6A (N6-threonylcarbamoyladenosine); ms2t6A (2-methylthio-N6-threonyl carbamoyladenosine); m6t6A (N6-methyl-N6-threonylcarbamoyladenosine); hn6A(N6- hydroxynorvalylcarbamoyladenosine); ms2hn6A (2-methylthio-N6-hydroxynorvalyl carbamoyladenosine); Ar(p) (2’-O-ribosyladenosine (phosphate)); I (inosine); m1I (1- methylinosine); m1Im (1,2’-O-dimethylinosine); m3C (3-methylcytidine); Cm (2’-O- methylcytidine); s2C (2-thiocytidine); ac4C (N4-acetylcytidine); f5C (5-formylcytidine); m5Cm (5,2′-O-dimethylcytidine); ac4Cm (N4-acetyl-2’-O-methylcytidine); k2C (lysidine); m1G (1- methylguanosine); m2G (N2-methylguanosine); m7G (7-methylguanosine); Gm (2′-O- methylguanosine); m22G (N2,N2-dimethylguanosine); m2Gm (N2,2’-O-dimethylguanosine); m22Gm (N2,N2,2’-O-trimethylguanosine); Gr(p) (2’-O-ribosylguanosine(phosphate)); yW (wybutosine); o2yW (peroxywybutosine); OHyW (hydroxywybutosine); OHyW* (undermodified hydroxywybutosine); imG (wyosine); mimG (methylwyosine); Q (queuosine); oQ (epoxyqueuosine); galQ (galactosyl-queuosine); manQ (mannosyl-queuosine); preQ0 (7- cyano-7-deazaguanosine); preQ1(7-aminomethyl-7-deazaguanosine); G+(archaeosine); D (dihydrouridine); m5Um (5,2’-O-dimethyluridine); s4U (4-thiouridine); m5s2U (5-methyl-2- thiouridine); s2Um (2-thio-2’-O-methyluridine); acp3U (3-(3-amino-3- carboxypropyl)uridine); ho5U (5-hydroxyuridine); mo5U (5-methoxyuridine); cmo5U (uridine 5-oxyacetic acid); mcmo5U (uridine 5-oxyacetic acid methyl ester); chm5U (5- (carboxyhydroxymethyl)uridine)); mchm5U (5-(carboxyhydroxymethyl)uridine methyl ester); mcm5U (5-methoxycarbonylmethyluridine); mcm5Um (5-methoxycarbonylmethyl-2’-O- methyluridine); mcm5s2U (5-methoxycarbonylmethyl-2-thiouridine); nm5S2U (5- aminomethyl-2-thiouridine); mnm5U (5-methylaminomethyluridine); mnm5s2U (5- methylaminomethyl-2-thiouridine); mnm5se2U (5-methylaminomethyl-2-selenouridine); ncm5U (5-carbamoylmethyluridine); ncm5Um (5-carbamoylmethyl-2′-O-methyluridine); cmnm5U (5-carboxymethylaminomethyluridine); cmnm5Um (5-carboxymethylaminomethyl- 2′-O-methyluridine); cmnm5s2U (5-carboxymethylaminomethyl-2-thiouridine); m62A (N6,N6-dimethyladenosine); Im (2’-O-methylinosine); m4C (N4-methylcytidine); m4Cm (N4,2’-O-dimethylcytidine); hm5C (5-hydroxymethylcytidine); m3U (3-methyluridine); cm5U (5-carboxymethyluridine); m6Am (N6,2’-O-dimethyladenosine); m62Am (N6,N6,O-2’- trimethyladenosine); m2,7G (N2,7-dimethylguanosine); m2,2,7G (N2,N2,7-trimethylguanosine); m3Um (3,2’-O-dimethyluridine); m5D (5-methyldihydrouridine); f5Cm (5-formyl-2’-O- methylcytidine); m1Gm (1,2’-O-dimethylguanosine); m1Am (1,2’-O-dimethyladenosine);τm5U (5-taurinomethyluridine); τm5s2U (5-taurinomethyl-2-thiouridine)); imG-14 (4- demethylwyosine); imG2 (isowyosine); or ac6A (N6-acetyladenosine).

[0200] In some embodiments, the modified nucleoside may include a compound selected from the group of: pyridin-4-one ribonucleoside, 5-aza-uridine, 2-thio-5-aza-uridine, 2- thiouridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxyuridine, 3-methyluridine, 5-carboxymethyl-uridine, 1-carboxymethyl-pseudouridine, 5-propynyl-uridine, 1-propynyl- pseudouridine, 5-taurinomethyluridine, 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2- thio-uridine, 1-taurinomethyl-4-thio-uridine, 5-methyl-uridine, 1-methyl-pseudouridine, 4- thio-1-methyl-pseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza- pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2- methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-m ethoxy-2-thio- pseudouridine, 5-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetylcytidine, 5- formylcytidine, N4-methylcytidine, 5-hydroxymethylcytidine, 1-methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio- pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-1-deaza- pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5- methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2- methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4-methoxy-1-methyl- pseudoisocytidine, 2-aminopurine, 2, 6-diaminopurine, 7-deaza-adenine, 7-deaza-8-aza- adenine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2-aminopurine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyladenosine, N6-methyladenosine, N6- isopentenyladenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis- hydroxyisopentenyl) adenosine, N6-glycinylcarbamoyladenosine, N6- threonylcarbamoyladenosine, 2-methylthio-N6-threonyl carbamoyladenosine, N6,N6- dimethyladenosine, 7-methyladenine, 2-methylthio-adenine, 2-methoxy-adenine, inosine, 1- methyl-inosine, wyosine, wybutosine, 7-deaza-guanosine, 7-deaza-8-aza-guanosine, 6-thio- guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6- thio-7-methyl-guanosine, 7-methylinosine, 6-methoxy-guanosine, 1-methylguanosine, N2- methylguanosine, N2,N2-dimethylguanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1- methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, and N2,N2-dimethyl-6-thio- guanosine. In another embodiment, the modifications are independently selected from the group consisting of 5-methylcytosine, pseudouridine and 1-methylpseudouridine.

[0201] In some embodiments, the modified ribonucleosides include 5-methylcytidine, 5-methoxyuridine, 1-methyl-pseudouridine, N6-methyladenosine, and / or pseudouridine. In some embodiments, such modified nucleosides provide additional stability and resistance to immune activation.

[0202] In some embodiments, provided herein is a circular RNA polynucleotide comprising, in the following order, a 3’ self-spliced exon segment, a translation initiation element (TIE), an expression sequence encoding a BCMA binding molecule with which the TIE is not naturally associated, and a 5’ self-spliced exon segment.

[0203] In some embodiments, provided herein is a circular RNA polynucleotide comprising: i) a 5’ combined accessory element; ii) an intervening region; and iii) a 3’ combined accessory element, where the intervening region is between the 5’ combined accessory element and the 3’ combined accessory element.

[0204] In some embodiments, the 5’ combined accessory element comprises a 3’ self- spliced exon segment. In some embodiments, the 3’ self-spliced exon segment comprises an exon segment or fragment thereof. In some embodiments, the 3’ self-spliced exon segment comprises a 3ʹ nucleotide of a 3ʹ splice site dinucleotide. In some embodiments, the 3’ self- spliced exon segment comprises an exon segment and a 3’ nucleotide of a 3’ splice site dinucleotide. In some embodiments, the exon segment comprises a natural exon sequence or non-naturally occurring sequence. In some embodiments, the 3' splice site dinucleotides are distinct from the natural splice site dinucleotide(s) associated with a natural Group I or Group II intron sequence.

[0205] In some embodiments, the 3’self-spliced exon segment comprises a sequence having a percent sequence identity of about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more to a sequence selected from Table 2 herein, Table 3 herein, or PCT / US2024 / 027627, the contents of which are hereby incorporated by reference. In some embodiments, the 3’ self-spliced exon segment is selected from an exon segment disclosed in Table 2 herein, Table 3 herein, or PCT / US2024 / 027627, the contents of which are hereby incorporated by reference. In some embodiments, the self-spliced exon segment is, e.g., 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, or 15 nucleotides. In some embodiments, the circular RNA comprises a self-spliced exon segment that is 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, or 15 nucleotides from the exonic sequences of Table 2 or is e.g., 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, or10 nucleotides from the exonic sequences of Table 3. See also PCT / US2024 / 027627, the contents of which are hereby incorporated by reference.

[0206] In some embodiments, the 3’ combined accessory element comprises a 5’ self- spliced exon segment. In some embodiments, the 5’ self-spliced exon segment comprises an exon segment or fragment thereof. In some embodiments, the 5’ self-spliced exon segment comprises a 5ʹ nucleotide of a 5ʹ splice site dinucleotide. In some embodiments, the 5’ self- spliced exon segment comprises an exon segment and a 5’ nucleotide of a 5’ splice site dinucleotide. In some embodiments, the exon segment comprises a natural exon sequence or non-naturally occurring sequence. In some embodiments, the 5’splice site dinucleotides are distinct from the natural splice site dinucleotide(s) associated with a natural Group I or Group II intron sequence.

[0207] In some embodiments, the 5’self-spliced exon segment comprises a sequence having a percent sequence identity of about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more to a sequence selected from Table 2 herein, Table 3 herein, or PCT / US2024 / 027627, the contents of which are hereby incorporated by reference. In some embodiments, the 5’ self-spliced exon segment is selected from an exon segment in Table 2 herein, Table 3 herein, or PCT / US2024 / 027627, the contents of which are hereby incorporated by reference. In some embodiments, the self-spliced exon segment is e.g., 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, or 15 nucleotides. In some embodiments, the circular RNA comprises a self-spliced exon segment that is 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, or 15 nucleotides from the exonic sequences of Table 2 or is e.g., 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, or 10 nucleotides from the exonic sequences of Table 3. See also PCT / US2024 / 027627, the contents of which are hereby incorporated by reference.

[0208] In some embodiments, as set forth herein, the intervening region comprises an expression sequence (coding region or element) encoding a BMCA binding molecule. In some embodiments, the intervening region comprises at least one translation initiation element (TIE). In some embodiments, the TIE comprises a viral or eukaryotic internal ribosome entry site (IRES). In some embodiments, the IRES comprises a sequence selected from the sequences in Table 4 or a fragment thereof or a sequence from PCT / US2022 / 033091 or PCT / US2023 / 084046, the contents of which are hereby incorporated by reference. In someembodiments the TIE is operably linked to an expression sequence encoding BCMA with which the TIE is not naturally associated.

[0209] In some embodiments, the intervening region comprises an untranslated region (UTR). In some embodiments, the UTR comprises one or more noncoding elements. In some embodiments, the one or more noncoding elements are selected from, e.g., a natural 3ʹ Untranslated Region (UTR), a natural 5ʹ Untranslated Region (UTR), a synthetic spacer sequence, an aptamer, and lncRNA, miRNA, and a miRNA sponge. In some embodiments, the noncoding element is or comprises the TIE.

[0210] In some embodiments, the intervening region comprises an expression sequence encoding a BCMA binding molecule, e.g., CAR. In some embodiments, the expression sequence encodes two or more polypeptides. In some embodiments, the expression sequence comprises one or more expression sequences or portions thereof, e.g., Table 2.

[0211] In some embodiments, provided herein are circular RNA polynucleotides comprising, in the following order, i) a 5’ combined accessory element comprising a 3’ self- spliced exon segment; ii) an intervening region comprising an expression sequence encoding a BCMA binding molecule; and iii) a 3’ combined accessory element comprising a 5’ self- spliced exon segment. In some embodiments, the 3’ self-spliced exon segment and / or the 5’ self-spliced exon segment is selected from an exon segment disclosed herein, e.g., in Table 2 or Table 3, or PCT / US2024 / 027627.

[0212] In some embodiments, provided herein are circular RNA polynucleotides comprising, in the following order, i) a 5’ combined accessory element comprising a 3’ self- spliced exon segment, wherein the 3’ self-spliced exon segment comprises an exon segment; ii) an intervening region encoding a BCMA binding molecule; and iii) a 3’ combined accessory element comprising a 5’ self-spliced exon segment, wherein the 5’ self-spliced exon segment comprises an exon segment. In some embodiments, the 3’ self-spliced exon segment and / or the 5’ self-spliced exon segment is selected from an exon segment disclosed herein, e.g., in Table 2 or Table 3, or PCT / US2024 / 027627.

[0213] In some embodiments, provided herein are circular RNA polynucleotides comprising, in the following order, i) a 5’ combined accessory element comprising a 3’ self- spliced exon segment, wherein the 3’ self-spliced exon segment comprises an exon segment and a 3’ nucleotide of a 3’ splice site dinucleotide; ii) an intervening region encoding a BCMA binding molecule; and iii) a 3’ combined accessory element comprising a 5’ self-spliced exon segment, wherein the 5’ self-spliced exon segment comprises an exon segment and a 5’nucleotide of a 5’ splice site dinucleotide. In some embodiments, the 3’ self-spliced exon segment and / or the 5’ self-spliced exon segment is selected from an exon segment disclosed herein, e.g., in Table 2 or Table 3, or PCT / US2024 / 027627.

[0214] A circular RNA polynucleotide comprising, in the following order, a 3’ self-spliced exon segment, an intervening region comprising an expression sequence encoding a BCMA binding molecule, and a 5’ self-spliced exon segment, wherein at least one of the 3’ or 5’ self- spliced exon segments is selected from an exon segment comprising a sequence selected from Table 2, Table 3, or PCT / US2024 / 027627.

[0215] As a non-limiting example, a circular RNA polynucleotide comprises the following elements operably connected and arranged in the following sequence: (a) a 3ʹ exon segment comprising a Group I or Group II exon 3ʹ nucleotide of a 3ʹ splice site dinucleotide; (b) an intervening region comprising an expression sequence encoding a BCMA binding molecule; and (c) a 5ʹ exon segment comprising a Group I or Group II exon 5ʹ nucleotide of a 5ʹ splice site dinucleotide.

[0216] As set forth in detail herein, in some embodiments, a circular RNA polynucleotide comprises a retained portion of a monotron element. See, e.g., supra. In some embodiments, a circular RNA polynucleotide comprises: a 5’ internal spacer, a 5’ internal duplex, at least a portion of a terminal element (or sequence or segment), at least a portion of a monotron element (or sequence or segment), a 3’ internal duplex, a 3’ internal spacer, an intervening region comprising an expression sequence encoding a BCMA binding molecule. In some embodiments, the intervening region further comprises TIE, e.g., operably linked to the expression sequence. In some embodiments, the monotron element present in the precursor RNA polynucleotide, of which a portion is retained in the circular RNA polynucleotide, comprises a polynucleotide sequence that has a percent sequence identity of about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more to a sequence selected from PCT / US2024 / 027627.

[0217] In some embodiments, the circular RNA polynucleotide comprises the following elements operably connected and arranged in the following sequence: (a) a 5’ internal spacer, (b) a 5’ internal duplex, (c) at least a portion of a terminal element, (d) at least a portion of a monotron element,(e) a 3’ internal duplex, (f) a 3’ internal spacer, and (g) an intervening region, optionally comprising a coding region, and IRES.

[0218] In some embodiments, the circular RNA polynucleotide comprises the following elements operably connected and arranged in the following sequence: (a) a 5’ internal spacer, (b) a 5’ internal duplex, (c) at least a portion of a monotron element, (d) at least a portion of a terminal element, (e) a 3’ internal duplex, (f) a 3’ internal spacer, and (g) an intervening region, optionally comprising a coding region, and IRES.

[0219] As a further non-limiting example, a circular RNA polynucleotide comprises the following elements operably connected and arranged in the following sequence: (a) at least a portion of a terminal element, (b) a 3ʹ exon segment comprising a 3ʹ nucleotide of a 3ʹ splice site dinucleotide, (c) an intervening region, (d) a 5ʹ exon segment comprising a 5ʹ nucleotide of a 5ʹ splice site dinucleotide, and (e) at least a portion of a monotron element; wherein the 5' and / or 3' splice site dinucleotides are distinct from the natural splice site dinucleotide(s) associated with a natural Group I or Group II intron sequence.

[0220] In some embodiments, element (d) comprises the first nucleotide of a 5ʹ Group I or Group II splice site dinucleotide and a natural exon sequence. In some embodiments, element (b) comprises the second nucleotide of a 3ʹ Group I or Group II exon splice site dinucleotide and a natural exon sequence.

[0221] In some embodiments, in the circular RNA polynucleotide, the 5ʹ exon element comprises the second nucleotide of a 3ʹ Group I or Group II exon splice site dinucleotide and a natural exon sequence. In some embodiments, the 3ʹ exon element fragment comprises the first nucleotide of a 5ʹ Group I or Group II splice site dinucleotide and a natural exon sequence. In some embodiments, the 5ʹ exon element comprises a 5ʹ internal duplex; and the 3ʹ exon element comprises a 3ʹ internal duplex. In some embodiments, the 5ʹ exon element comprises a 5ʹ internal spacer. In some embodiments, the 3ʹ exon element comprises a 3ʹ internal spacer.

[0222] In some embodiments, the circular RNA polynucleotide comprises a 5’ internalduplex and a 3’ internal duplex. See, e.g., supra.

[0223] In some embodiments, the circular RNA polynucleotide comprises a 5’ internal homology region and / or a 3’ internal homology region. See, e.g., supra.

[0224] In some embodiments, the circular RNA polynucleotide comprises internal spacers (IS) of different lengths, e.g., a 5’internal spacer and / or a 3’ internal spacer. See, e.g., supra.

[0225] In some embodiments, the circular RNA polynucleotide retains portions of the precursor RNA polynucleotides, described elsewhere herein in detail. In some embodiments, portions of the precursor RNA polynucleotide are removed upon circularization. For example, in some embodiments, the circular RNA polynucleotide does not comprise a 5’ external spacer and / or a 3’ external spacer. In some embodiments, the circular RNA polynucleotide does not comprise a 5’ intron segment and / or 3’ intron segment. In some embodiments, the circular RNA polynucleotide does not comprise affinity tags. In some embodiments, the circular RNA polynucleotide does not comprise external homology regions. In some embodiments, the circular RNA polynucleotide does not retain a portion of a monotron element. In certain embodiments, the circular RNA polynucleotide does not retain a monotron element.

[0226] In some embodiments, and as described in more detail elsewhere herein, the circular RNA polynucleotide comprises modified nucleotides and / or modified nucleosides, namely comprising at least one modified A, C, G, or U / T nucleotide or nucleoside. Exemplary modifications are described in detail elsewhere herein. See, e.g., infra. In some embodiments, a circular RNA polynucleotide comprises modified nucleotides and / or modified nucleosides where between 1% and 100%, 1% and 2%, 1% and 3%, 1% and 4%, 1% and 5%, 5% and 6%, 5% and 7%, 5% and 8%, 5% and 9%, 5% and 10%, 10% and 20%, 20% and 30%, 30% and 40%, 40% and 50%, 50% and 60%, 60% and 70%, 70% and 80%, 80% and 90%, or 90% and 100% of the nucleotides or nucleosides are modified. In some embodiments, portions of the polynucleotide comprise between 1% and 10% modification of the nucleotides or nucleosides. In some embodiments, portions of the circular RNA polynucleotide comprise less than 10% modification. In some embodiments, portions of the polynucleotide or the polynucleotide in its entirety comprise no nucleotide or nucleoside modifications. In some embodiments, a circular RNA polynucleotide may lack modifications, where the linear precursors used to produce the circular RNA polynucleotide contained modifications (e.g., in the introns).. In some embodiments, incorporation of a nucleotide or nucleoside modification to a precursor RNA polynucleotide hinders or lowers the capacity of the circular RNA to circularize, splice, or express. In some embodiments, the circular RNA polynucleotide is from about 50nucleotides to about 15 kilobases in length.

[0227] In some embodiments, the circular RNA polynucleotide has an in vivo duration of therapeutic effect in a subject of at least about 10 hours. In some embodiments, the circular RNA polynucleotide has a functional half-life of at least about 10 hours. In some embodiments, the circular RNA polynucleotide has a duration of therapeutic effect in a cell greater than or equal to that of an equivalent linear RNA polynucleotide comprising the same expression sequence. In some embodiments, the circular RNA polynucleotide has a functional half-life in a cell greater than or equal to that of an equivalent linear RNA polynucleotide comprising the same expression sequence. In some embodiments, the circular RNA polynucleotide has an in vivo duration of therapeutic effect in a subject greater than that of an equivalent linear RNA polynucleotide having the same expression sequence. In some embodiments, the circular RNA polynucleotide has an in vivo functional half-life in a subject greater than that of an equivalent linear RNA polynucleotide having the same expression sequence.

[0228] In some embodiments, provided herein is a non-naturally occurring RNA polynucleotide comprising a translation initiation element (TIE), an expression sequence encoding a BCMA binding molecule (e.g., with which the TIE is not naturally associated), and a means for self-splicing. In some embodiments, provided herein is a non-naturally occurring RNA polynucleotide comprising a translation initiation element (TIE), an expression sequence encoding a BCMA binding molecule (e.g., with which the TIE is not naturally associated), and a means for self-circularization. In some embodiments, provided herein is provided herein is a non-naturally occurring RNA polynucleotide comprising a translation initiation element (TIE), an expression sequence encoding a BCMA binding molecule (e.g., with which the TIE is not naturally associated), and an autocatalytic intron-exon means for self-splicing. In some embodiments, provided herein is a non-naturally occurring RNA polynucleotide comprising a translation initiation element (TIE), an expression sequence encoding a BCMA binding molecule (e.g., with which the TIE is not naturally associated), and an autocatalytic intron- exon means for self-circularization. In some embodiments, provided herein is a non-naturally occurring RNA polynucleotide comprising, in the following order, a 3’ exon segment means for self-splicing, a translation initiation element, an expression sequence encoding a BCMA binding molecule (e.g., with which the TIE is not naturally associated), and a 5’ exon segment means for self-splicing. In some embodiments, provided herein is a non-naturally occurring RNA polynucleotide comprising, in the following order, a 3’ exon segment means for self- circularization, a TIE, an expression sequence encoding a BCMA binding molecule (e.g., withwhich the TIE is not naturally associated), and a 5’ exon segment means for self- circularization. In some embodiments, provided herein is a non-naturally occurring RNA polynucleotide comprising, in the following order, a 3’ exon segment, a TIE, an expression sequence encoding a BCMA binding molecule, and a 5’ exon segment, wherein the exon segments are means for self-splicing. In some embodiments, provided herein is a non-naturally occurring RNA polynucleotide comprising, in the following order, a 3’ exon segment, a TIE, an expression sequence encoding a BCMA binding molecule, and a 5’ exon segment, wherein the exon segments are means for self-circularization. In some embodiments, provided herein is a circular RNA polynucleotide comprising, in the following order, a 3’ exon segment means for self-circularization, a TIE, an expression sequence encoding a BCMA binding molecule, and a 5’ exon segment means for self-circularization. In some embodiments, provided herein is a circular RNA polynucleotide comprising, in the following order, a 3’ exon segment, a TIE, an expression sequence encoding a BCMA binding molecule, and a 5’ exon segment, wherein the exon segments are means for self-splicing. A. PRECURSORS

[0229] Disclosed herein are precursor RNAs for producing circular RNAs. In some embodiments, the precursor RNA comprises both 5ʹ intron and exon elements and 3ʹ exon and intron elements or comprising only 3ʹ exon and intron elements for producing circular RNAs with enhanced circularization efficiency.

[0230] Accordingly, provided herein is a precursor RNA polynucleotide capable of producing a circular RNA polynucleotide after splicing, wherein the precursor RNA polynucleotide comprises both 5ʹ intron and exon elements and 3’ exon and intron elements (e.g., combined accessory elements). Also provided is a precursor RNA polynucleotide capable of producing a circular RNA polynucleotide after splicing, wherein the precursor RNA polynucleotide comprises only 3ʹ exon and intron elements.

[0231] In some embodiments, a provided precursor RNA polynucleotide comprises (i) 3ʹ permuted intron segment comprising a 5ʹ nucleotide of a 3ʹ splice site dinucleotide; and (ii) a 3ʹ exon segment comprising a 3ʹ nucleotide of a 3ʹ splice site dinucleotide. Exemplary splice site dinucleotides are provided in the Table set forth herein. In some embodiments, a provided precursor RNA polynucleotide comprises (i) a 5ʹ exon segment comprising a 5ʹ nucleotide of a 5ʹ splice site dinucleotide; and (ii) a 5ʹ permuted intron segment comprising a 3ʹ nucleotide of a 5ʹ splice site dinucleotide. In some embodiments, a provided precursor RNA polynucleotide comprises a terminal element comprising (a) an excised terminal segment anda retained terminal segment or (b) a natural exon or a fragment thereof.

[0232] In some embodiments, a provided precursor RNA polynucleotide comprises (i) a 5ʹ intron element comprising a 3ʹ permuted intron segment comprising a 5ʹ nucleotide of a 3ʹ splice site dinucleotide; (ii) a 5ʹ exon element comprising a 3ʹ exon segment comprising a 3ʹ nucleotide of a 3ʹ splice site dinucleotide; (iii) a 3ʹ exon element comprising a 5ʹ exon segment comprising a 5ʹ nucleotide of a 5ʹ splice site; and (iv) a 3ʹ intron element comprising a 5ʹ permuted intron segment comprising a 3ʹ nucleotide of a 5ʹ splice site dinucleotide. In some embodiments, a provided precursor RNA polynucleotide comprises (i) a terminal element comprising (a) an excised terminal segment and / or a retained terminal segment or (b) a natural exon or a fragment thereof; (ii) a 5ʹ intron element comprising a 3ʹ permuted intron segment comprising a 5ʹ nucleotide of a 3ʹ splice site dinucleotide; and (iii) a 5ʹ exon element comprising a 3ʹ exon segment comprising a 3ʹ nucleotide of a 3ʹ splice site dinucleotide.

[0233] In some embodiments, a provided precursor RNA polynucleotide comprises a 5’ combined accessory element comprising (i) a 3ʹ permuted intron segment comprising a 5ʹ nucleotide of a 3ʹ splice site dinucleotide; and (ii) a 3ʹ exon segment comprising a 3ʹ nucleotide of a 3ʹ splice site dinucleotide. In some embodiments, element (ii) is located upstream to the intervening region. In some embodiments, the 5ʹ combined accessory element comprises a 3ʹ exon segment comprising a Group I or Group II exon 3ʹ nucleotide of a 3ʹ splice site dinucleotide.

[0234] In some embodiments, a provided precursor RNA polynucleotide comprises a 3ʹ combined accessory element comprising (i) a 5ʹ exon segment comprising a 5ʹ nucleotide of a 5ʹ splice site dinucleotide; and (ii) a 5ʹ permuted intron segment comprising a 3ʹ nucleotide of a 5ʹ splice site dinucleotide. In some embodiments, element (ii) is located downstream to the intervening region. In some embodiments, a 3ʹ combined accessory element comprises a 5ʹ exon segment comprising a Group I or Group II exon 5ʹ nucleotide of a 5ʹ splice site dinucleotide.

[0235] In some embodiments, a provided precursor RNA polynucleotide comprises a 5’ combined accessory element, an intervening region, and a 3ʹ combined accessory element. In some embodiments, (a) the 5’ combined accessory element comprises (i) a 3ʹ permuted intron segment comprising a 5ʹ nucleotide of a 3ʹ splice site dinucleotide; and (ii) a 3ʹ exon segment comprising a 3ʹ nucleotide of a 3ʹ splice site dinucleotide; and (b) the 3ʹ combined accessory element comprising (i) a 5ʹ exon segment comprising a 5ʹ nucleotide of a 5ʹ splice site dinucleotide; and (ii) a 5ʹ permuted intron segment comprising a 3ʹ nucleotide of a 5ʹ splice sitedinucleotide. In some embodiments, the 5ʹ nucleotide of a 3ʹ splice site dinucleotide, 3ʹ nucleotide of a 3ʹ splice site dinucleotide, 5ʹ nucleotide of a 5ʹ splice site dinucleotide and 3ʹ nucleotide of a 5ʹ splice site dinucleotide are optionally a combination of nucleotides or a portion of a sequence selected from PCT / US2024 / 027627.

[0236] In some embodiments, the 5’ combined accessory element is located 5ʹ to the intervening region; and the intervening region is located is 5ʹ to the 3ʹ combined accessory element.

[0237] In some embodiments, a provided precursor RNA polynucleotide comprises a terminal element, an intervening region (e.g., comprising an expression sequence encoding a BCMA binding molecule), and a monotron element. In some embodiments, the monotron element is located 5’ to the intervening region, which is located 5’ to the terminal element. In other embodiments, the monotron element is located 3’ to the intervening region, which is located 3’ to the terminal element. As set forth in further detail below, in some embodiments, the terminal element comprises a splice site nucleotide and the monotron element comprises a splice site dinucleotide and a splice site nucleotide.

[0238] In some embodiments, the precursor RNA polynucleotide is linear.

[0239] In some embodiments, permuted intron-exon splicing results in circularization of the precursor RNA polynucleotide. During splicing, a transesterification reaction can occur at the 5’ splice site and a second transesterification reaction can occur at the 3’ splice site. In some embodiments, splicing of the precursor RNA polynucleotide results in the removal of the 3ʹ intron element and the 5ʹ intron element. Accordingly, the circular RNA polynucleotide produced after splicing of the precursor RNA polynucleotide lacks the 3ʹ intron segment and the 5ʹ intron segment, but retains the 3ʹ exon segment and the 5ʹ exon segment.

[0240] In some embodiments, the precursor RNA polynucleotide is capable of circularizing when incubated in the presence of one or more guanosine nucleotides or nucleoside (e.g., GTP) and a divalent cation (e.g., Mg2+).

[0241] In some embodiments, the precursor RNA polynucleotide is between 300 and 10000, between 400 and 9000, between 500 and 8000, between 600 and 7000, between 700 and 6000, between 800 and 5000, between 900 and 5000, between 1000 and 5000, between 1100 and 5000, between 1200 and 5000, between 1300 and 5000, between 1400 and 5000, or between 1500 and 5000 nucleotides (nt) in length. In some embodiments, the precursor RNA polynucleotide is at least 300 nt, at least 400 nt, at least 500 nt, at least 600 nt, at least 700 nt, at least 800 nt, at least 900 nt, at least 1000 nt, at least 1100 nt, at least 1200 nt, at least 1300 nt, at least 1400 nt, at least 1500 nt, at least 2000 nt, at least 2500 nt, at least 3000 nt, at least3500 nt, at least 4000 nt, at least 4500 nt, or at least 5000 nt in length. In some embodiments, the precursor RNA polynucleotide is no more than 3000 nt, no more than 3500 nt, no more than 4000 nt, no more than 4500 nt, no more than 5000 nt, no more than 6000 nt, no more than 7000 nt, no more than 8000 nt, no more than 9000 nt, or no more than 10000 nt in length. In some embodiments, the precursor RNA polynucleotide is about 300 nt, about 400 nt, about 500 nt, about 600 nt, about 700 nt, about 800 nt, about 900 nt, about 1000 nt, about 1100 nt, about 1200 nt, about 1300 nt, about 1400 nt, about 1500 nt, about 2000 nt, about 2500 nt, about 3000 nt, about 3500 nt, about 4000 nt, about 4500 nt, about 5000 nt, about 6000 nt, about 7000 nt, about 8000 nt, about 9000 nt, or about 10000 nt in length.

[0242] In various embodiments, provided herein are DNA templates that transcribe into precursor RNA polynucleotides of the disclosure. Accordingly, provided herein are DNA templates comprising sequences encoding the precursor RNAs of the disclosure. In some embodiments, the DNA template or polynucleotide of the present disclosure comprises a vector, a PCR product, a plasmid, a minicircle DNA, a cosmid, an artificial chromosome, a complementary DNA (cDNA), an extrachromosomal DNA (ecDNA), a doggybone DNA (dbDNA), a close-ended DNA (ceDNA), a viral polynucleotide, or a fragment thereof. In some embodiments, the polynucleotide of the present disclosure is selected from a DNA plasmid, a cosmid, a PCR product, dbDNA, close-ended DNA (ceDNA), and a viral polynucleotide. In some embodiments, the polynucleotide further comprises a promoter segment or sequence. In some embodiments, the DNA template is linearized. In other embodiments, the DNA template is non-linearized. In some embodiments, the DNA template is single-stranded. In some embodiments, the DNA template is double-stranded. In some embodiments, the DNA template comprises in whole or in part from a viral, bacterial or eukaryotic vector.

[0243] In various embodiments, provided herein is a circular RNA polynucleotide produced by circularization of a precursor RNA polynucleotide described herein.

[0244] In some embodiments, the circular RNA polynucleotide is produced inside a cell. In some embodiments, a provided precursor RNA is transcribed using a DNA template in the cytoplasm (e.g., by a bacteriophage RNA polymerase) or nucleus (e.g., by host RNA polymerase II) and then circularized.

[0245] In some embodiments, the circular RNA polynucleotide is between 300 and 10000, between 400 and 9000, between 500 and 8000, between 600 and 7000, between 700 and 6000, between 800 and 5000, between 900 and 5000, between 1000 and 5000, between 1100 and 5000, between 1200 and 5000, between 1300 and 5000, between 1400 and 5000, or between 1500 and 5000 nucleotides (nt) in length. In some embodiments, the circular RNApolynucleotide is at least 300 nt, at least 400 nt, at least 500 nt, at least 600 nt, at least 700 nt, at least 800 nt, at least 900 nt, at least 1000 nt, at least 1100 nt, at least 1200 nt, at least 1300 nt, at least 1400 nt, at least 1500 nt, at least 2000 nt, at least 2500 nt, at least 3000 nt, at least 3500 nt, at least 4000 nt, at least 4500 nt, or at least 5000 nt in length. In some embodiments, the circular RNA polynucleotide is no more than 3000 nt, no more than 3500 nt, no more than 4000 nt, no more than 4500 nt, no more than 5000 nt, no more than 6000 nt, no more than 7000 nt, no more than 8000 nt, no more than 9000 nt, or no more than 10000 nt in length. In some embodiments, the circular RNA polynucleotide is about 300 nt, about 400 nt, about 500 nt, about 600 nt, about 700 nt, about 800 nt, about 900 nt, about 1000 nt, about 1100 nt, about 1200 nt, about 1300 nt, about 1400 nt, about 1500 nt, about 2000 nt, about 2500 nt, about 3000 nt, about 3500 nt, about 4000 nt, about 4500 nt, about 5000 nt, about 6000 nt, about 7000 nt, about 8000 nt, about 9000 nt, or about 10000 nt in length.

[0246] Circular RNA polynucleotides lack the free ends necessary for exonuclease- mediated degradation, causing them to be resistant to several mechanisms of RNA degradation and granting extended half-lives when compared to an equivalent linear RNA. Circularization may allow for the stabilization of RNA polynucleotides that generally suffer from short half- lives and may improve the overall efficacy of exogenous mRNA in a variety of applications.

[0247] In some embodiments, the circular RNA polynucleotide has a functional half-life of at least 5 hours, 10 hours, 15 hours, 20 hours, 30 hours, 40 hours, 50 hours, 60 hours, 70 hours, or 80 hours. In some embodiments, the circular RNA polynucleotide has a functional half-life of 5-80, 10-70, 15-60, or 20-50 hours. In some embodiments, the circular RNA polynucleotide has a functional half-life greater (e.g., at least 1.5-fold greater or at least 2-fold greater) than that of an equivalent linear RNA polynucleotide comprising the same expression sequence. In some embodiments, the circular RNA polynucleotide, or a pharmaceutical composition thereof, has a functional half-life in a human cell greater than or equal to that of a pre-determined threshold value. In some embodiments, the functional half-life is determined by a functional protein assay. For example, in some embodiments, the functional half-life is determined by an in vitro luciferase assay, wherein the activity of Gaussia luciferase (GLuc) is measured in the media of human cells (e.g., HepG2) expressing the circular RNA polynucleotide every 1, 2, 6, 12, or 24 hours over 1, 2, 3, 4, 5, 6, 7, or 14 days. In some embodiments, the functional half-life is determined by an in vivo assay, wherein levels of a protein encoded by the expression sequence of the circular RNA polynucleotide are measured in patient serum or tissue samples every 1, 2, 6, 12, or 24 hours over 1, 2, 3, 4, 5, 6, 7, or 14 days. In some embodiments, the pre-determined threshold value is the functional half-life of areference linear RNA polynucleotide comprising the same expression sequence as the circular RNA polynucleotide. In some embodiment, the functional half-life of a circular RNA polynucleotides provided herein in eukaryotic cells (e.g., mammalian cells, such as human cells) as assessed by protein synthesis is at least 20 hours (e.g., at least 80 hours).

[0248] In some embodiments, the circular RNA polynucleotide provided herein has higher functional stability than an mRNA comprising the same expression sequence. In some embodiments, the circular RNA provided herein has higher functional stability than an mRNA comprising the same expression sequence, 5moU modifications, optimized UTR, cap, and / or polyA tail.

[0249] In some embodiments, a provided circular RNA polynucleotide may have a higher magnitude of expression, e.g., a higher magnitude of expression 24 hours after administration of RNA to cells, than an equivalent linear mRNA. In some embodiments, the circular RNA polynucleotide has a higher magnitude of expression than an mRNA comprising the same expression sequence, 5moU modifications, optimized UTR, cap, and / or polyA tail.

[0250] In some embodiments, a provided circular RNA polynucleotide is transfected into a cell. In some embodiments, the DNA template, which transcribes into the precursor RNA polynucleotide from which the circular RNA polynucleotide is produced, is transfected into a cell and subsequently transcribed in the cell. Transcription of the circular RNA from the transfected DNA template may be induced via polymerases. In some embodiments, the polymerases are endogenous polymerases of the cell. In some embodiments, the polymerases are added to the cell. In some other embodiments, the polymerases are encoded by one or more nucleic acids transfected into the cell.

[0251] In some embodiments, the circular RNA polynucleotide is administered to an animal (e.g., a human) such that a BCMA binding molecule, e.g., BCMA CAR, encoded by the circular RNA polynucleotide is expressed inside the animal.

[0252] In some embodiments, a provided circular RNA is less immunogenic than an equivalent mRNA when exposed to an immune system of an organism or a certain type of immune cell. In some embodiments, the circular RNA is associated with modulated production of cytokines when exposed to an immune system of an organism or a certain type of immune cell. For example, in some embodiments, the circular RNA is associated with reduced production of IFN-β1, RIG-I, IL-2, IL-6, IFNγ, and / or TNFα when exposed to an immune system of an organism or a certain type of immune cell as compared to mRNA comprising the same expression sequence. In some embodiments, the circular RNA is associated with less IFN-β1, RIG-I, IL-2, IL-6, IFNγ, and / or TNFα transcript induction when exposed to an immunesystem of an organism or a certain type of immune cell as compared to mRNA comprising the same expression sequence. In some embodiments, the circular RNA is less immunogenic than mRNA comprising the same expression sequence. In some embodiments, the circular RNA is less immunogenic than mRNA comprising the same expression sequence, 5moU modifications, an optimized UTR, a cap, and / or a polyA tail.

[0253] In some embodiments, a provided circular RNA demonstrates increased expression as compared to linear mRNA comprising the same expression sequence. In some embodiments, a provided circular RNA demonstrates increased expression of an encoded protein of interest as compared to linear mRNA comprising the same expression sequence. In some embodiments, a provided circular RNA demonstrates increased expression of an encoded protein of interest over time (e.g., durability, such as following delivery to a subject) as compared to linear mRNA comprising the same expression sequence. In some embodiments, a provided circular RNA demonstrates improved cellular function (e.g., function of a immune cell, such as cell-mediated killing, or other function mediated by an encoded protein of interest) as compared to linear mRNA comprising the same expression sequence.

[0254] Various circular RNA, circular RNA constructs, compositions comprising circular RNA, precursor RNA, and related methods are described, for example in US patent application 17 / 853,576, WO2019236673, WO2020237227, WO2021113777, WO2021226597, WO2021189059, WO2021236855, WO2022261490, WO2023056033, WO2023081526, WO2023141586, WO2023250375, and WO2024102677, which are each incorporated by reference in their entireties. B. INTRON ELEMENTS, EXON ELEMENTS, TERMINAL ELEMENTS

[0255] Polynucleotides provided herein (e.g., DNA templates, precursor RNA polynucleotides, or circular RNA polynucleotides) may comprise one or more intron elements, exon elements, and / or terminal elements. In some embodiments, each intron element, exon element, and terminal element may independently comprise one or more spacers, intron segments, exon segments, duplex regions, affinity sequences, and / or untranslated elements. These sequence elements within the intron elements, exon elements, or terminal elements are arranged to optimize circularization and / or protein expression. a. INTRON AND EXON ELEMENTS

[0256] In various embodiments, an intron element (e.g., 3’ intron element or 5’ intron element) comprises a permuted intron segment. In some embodiments, a 3’ permuted intron segment is a contiguous sequence at least 75% homologous (e.g., at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% homologous) to a 3’ proximalfragment of a natural intron (e.g., a group I or group II intron) including the 5’ nucleotide of the 3’ splice site dinucleotide. In some embodiments, a 5’ permuted intron fragment is a contiguous sequence at least 75% homologous (e.g., at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% homologous) to a 5’ proximal fragment of a natural intron (e.g., a group I or group II intron) including the 3’ nucleotide of the 5’ splice site dinucleotide. Exemplary splice site dinucleotides are described in the Table herein.

[0257] In some embodiments, an intron element comprises an intron derived from a trans- splicing ribozyme. In some embodiments, the intron element comprises a Group I trans- splicing ribozyme (e.g., a Tetrahymena trans-splicing ribozyme) segment. In some embodiments, the trans-splicing ribozyme segment along with an exon segment that may cleave a target site (e.g., a sequence of interest and / or a coding element) and subsequently ligate cleaved targe site to a 3’ exon to form a circular RNA product.

[0258] In various embodiments, a provided polynucleotide (e.g., a DNA template or a precursor RNA polynucleotide) comprises a 5’ exon element located upstream to the intervening region. In some embodiments, a provided polynucleotide comprises a 3’ intron element located downstream to the intervening region. In various embodiments, a provided polynucleotide comprises a 3’ exon element located upstream to the intervening region. In some embodiments, a provided polynucleotide comprises a 3’ intron element located upstream to the intervening region.

[0259] According to the present disclosure, the 3’ exon element and 5’ exon element each comprise an exon segment. In some embodiments, the 5’ exon element comprises a 3’ exon segment. In some embodiments, the 3’ exon element comprises a 5’ exon segment. In some embodiments, the 3’ and / or 5’ exon segment is a self-spliced or self-splicing exon segment. In some embodiments, the self-spliced and / or self-splicing exon segment comprises in part or in whole a naturally occurring exon sequence from a virus, bacterium or eukaryotic DNA vector. In other embodiments, the self-spliced and / or self-splicing exon segment comprises in part or in whole a non-naturally occurring sequence.

[0260] In some embodiments, a 3’ exon segment is a contiguous sequence at least 75% homologous (e.g., at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% homologous) to the 5’-proximal end of an exon adjacent a 3’ intron segment as described herein, including the 3’ nucleotide of the splice site dinucleotide. In some embodiments, a 5’ exon segment is a contiguous sequence at least 75% homologous (e.g., at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% homologous) to the 3’-proximal end of an exon adjacent a 5’ intron segment as describedherein, including the 5’ nucleotide of the splice site dinucleotide.

[0261] In some embodiments, at least one of the exon segments is less than 15 nucleotides in length. In some embodiments, the 3ʹ exon segment and / or 5ʹ exon segment comprises a Group I exon segment or a Group II exon segment less than 15 nucleotides in length.

[0262] In some embodiments, the circular RNA comprises a self-spliced exon segment that is 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, or 15 nucleotides. In some embodiments, the circular RNA comprises a self-spliced exon segment that is 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, or 15 nucleotides from the exonic sequences of Table 2 (in which sequences are shown as 15-nucleotide exonic sequence, intronic sequence, 15-nucleotide exonic sequence), e.g., contiguous nucleotides from the 5’ or 3’ end of the exonic sequences of Table 2. In some embodiments, the circular RNA comprises a self-spliced exon segment that is 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, or 10 nucleotides from the exonic sequences of Table 3 (in which sequences are shown as 10- nucleotide exonic sequence, intronic sequence, 10-nucleotide exonic sequence), e.g., contiguous nucleotides from the 5’ or 3’ end of the exonic sequences of Table 3. See also PCT / US2024 / 027627.

[0263] In some embodiments, the intron segment is a Group I intron and the exon segment comprises a Group I self-splicing exon segment. In some embodiments, the intron segment is a Group II intron and the exon segment comprises a Group II self-splicing exon segment.

[0264] In some embodiments, the exon element comprises a sequence directed to a native Group I intron-adjacent exon segment sequence or Group II intron-adjacent exon segment sequence, or fragment thereof. In some embodiments, the exon element comprises at least one mutation of a native Group I intron-adjacent exon segment sequence or Group II intron- adjacent exon segment sequence, or fragment thereof. In some embodiments, the exon element comprises at least one deletion of a native Group I intron-adjacent exon segment sequence or Group II intron-adjacent exon segment sequence, or fragment thereof. In some embodiments, the exon element comprises at least one insertion of a native Group I intron-adjacent exon segment sequence or Group II intron-adjacent exon segment sequence, or fragment thereof. In some embodiments, the native Group I intron segment or Group II intron segment sequences are selected from a sequence in Table 2 or Table 3, below. b. TERMINAL ELEMENTS

[0265] In various embodiments, a provided polynucleotide (e.g., a DNA template or aprecursor RNA polynucleotide) comprises a terminal element. In some embodiments, the terminal element is located upstream to the intervening region. In some embodiments, the terminal element is non-intronic. In some embodiments, the terminal element lacks one or both nucleotides of a natural splice site dinucleotide associated with a natural Group I or Group II intron sequence. In some embodiments, a portion or the entire terminal element is excised after circularization of a precursor RNA polynucleotide comprising said terminal element.

[0266] In some embodiments, a polynucleotide comprises a terminal element, an intervening region, and a monotron. In some embodiments, the polynucleotide comprises, in the following order, a terminal element, an intervening region, and a monotron. In some embodiments, the polynucleotide comprises, in the following order, a monotron, an intervening region, and a terminal element. In some embodiments, the terminal element comprises a splice site nucleotide capable of engaging in a transesterification reaction with the monotron.

[0267] In some embodiments, the terminal element comprises an excised terminal segment and a retained terminal segment. In the same embodiments, the retained terminal segment is retained after circularization of a precursor RNA polynucleotide comprising such a terminal element. In the same embodiments, the exercised terminal segment is not retained after circularization of a precursor RNA polynucleotide comprising such a terminal element. In still the same embodiments, the nucleotide sequence of the terminal element is non-natural or synthetic.

[0268] In some embodiments, the terminal element comprises a natural exon or a fragment thereof. In some embodiments, the terminal element is retained after circularization of a precursor RNA polynucleotide comprising said terminal element.

[0269] In some embodiments, the terminal element is capable of binding to a 3’ intron element (e.g., the 3’ intron element comprised in the same polynucleotide). In some embodiments, the terminal element is capable of directing or functionalizing the splicing activity of a 3’ intron element (e.g., the 3’ intron element comprised in the same polynucleotide). c. MONOTRON

[0270] Provided herein is a precursor RNA polynucleotide comprising a monotron (also called a monotron element or monotron sequence) and a terminal element (also called a terminal sequence). In some embodiments, the monotron has ribozymatic activity that allows it to enzymatically self-cleave. In some embodiments, the monotron is capable of forming a phosphodiester bond with a terminal sequence, i.e., a sequence containing a splice site dinucleotide and optionally a natural exon sequence or fragment thereof. In someembodiments, the precursor RNA polynucleotide comprises a terminal element; an intervening region, and a monotron element.

[0271] In some embodiments, the precursor RNA polynucleotide comprises, in the following order, (a) a terminal element; (b) an intervening region (e.g., comprising an expression sequence encoding a BCMA binding molecule, e.g., BCMA CAR), and (c) a monotron element. In some embodiments, the terminal sequence is upstream of the monotron sequence in the precursor RNA polynucleotide. In such embodiments: (i) the terminal element comprises a splice site nucleotide, (ii) the monotron element comprises a splice site dinucleotide at or near the 5’ end of the monotron, and (iii) the monotron element is capable of interacting with a nucleophile that is capable of cleaving at the splice site dinucleotide at or near the 5’ end of the monotron, where the cleavage product of (iii) comprises a 5’ splice site nucleotide that is capable of cleaving at the splice site nucleotide of the terminal element. In some embodiments, the nucleophile is a free nucleophile that is introduced to the precursor RNA polynucleotide, e.g., not in cis and / or covalently linked to the precursor RNA polynucleotide. In some embodiments, the nucleophile is a guanosine that is capable of cleaving at the splice site dinucleotide at or near the 5’ end of the monotron. In some embodiments, the guanosine is a free guanosine that is introduced to the precursor RNA polynucleotide, e.g., not in cis and / or covalently linked to the precursor RNA polynucleotide. In some embodiments, the cleavage product of (iii) comprises a 5’ splice site nucleotide having a 3’ hydroxyl group that is capable of cleaving at the splice site nucleotide of the terminal element.

[0272] In some embodiments, the precursor RNA polynucleotide comprises, in the following order, (a) a monotron element; (b) an intervening region (e.g., comprising an expression sequence encoding a BCMA binding molecule, e.g., BCMA CAR), and (c) terminal element. In some embodiments, the monotron sequence is upstream of the terminal sequence in the precursor RNA polynucleotide. In such embodiments: (i) the monotron element comprises a splice site dinucleotide at or near the 3’ end of the monotron, (ii) the terminal element comprises a splice site nucleotide, and (iii) the monotron element is capable of interacting with a nucleophile that is capable of cleaving at the splice site nucleotide of the terminal element, where the cleavage product of (iii) comprises a 5’ splice site nucleotide that is capable of cleaving at the splice site dinucleotide at or near the 3’ end of the monotron. In some embodiments, the nucleophile is a free nucleophile that is introduced to the precursor RNA polynucleotide, e.g., not in cis and / or covalently linked to the precursor RNA polynucleotide. In some embodiments, the nucleophile is a guanosine that is capable ofcleaving at the splice site nucleotide of the terminal element. In some embodiments, the guanosine is a free guanosine that is introduced to the precursor RNA polynucleotide, e.g., not in cis and / or covalently linked to the precursor RNA polynucleotide. In some embodiments, the cleavage product of (iii) comprises a 5’ splice site nucleotide having a 3’ hydroxyl group that is capable of cleaving at the splice site nucleotide of the terminal element.

[0273] In some embodiments where the terminal sequence is upstream to the monotron, the monotron can perform two transesterification reactions. The monotron can (a) self-cleave and (b) form a phosphodiester bond with the terminal sequence. In some embodiments, the reactions (a) and (b) are sequential. In some embodiments, (a) the monotron is capable of interacting with a nucleophile that is capable of cleaving at the splice site dinucleotide at or near the 5’ end of the monotron, and (b) the cleavage product of (a), i.e., the 5’ splice site nucleotide, e.g., having a 3’ hydroxyl group, engages in a transesterification reaction (cleaves) at the splice site nucleotide of the terminal sequence, yielding a circular RNA or oRNA. In these embodiments, the monotron interacts with the nucleophile by forming a binding pocket with the nucleophile, and the linear precursor is capable of adopting a conformation in which the nucleophile is in proximity to and is capable of cleaving at the splice site dinucleotide at or near the 5’ end of the monotron. In some embodiments, the nucleophile can be a guanosine, e.g., a free guanosine that is introduced to the precursor RNA polynucleotide.

[0274] In some embodiments where the monotron sequence is upstream of the terminal sequence, the monotron can also perform two transesterification reactions. In some embodiments, (a) the monotron is capable of interacting with a nucleophile that is capable of cleaving at the splice site nucleotide of the terminal element, and (b) the cleavage product of (a), i.e., the 5’ splice site nucleotide, e.g., having a 3’ hydroxyl group, engages in a transesterification reaction (cleaves) at the splice site dinucleotide at or near the 3’ end of the monotron, yielding a circular RNA or oRNA. In these embodiments, the monotron interacts with the nucleophile by forming a binding pocket with the nucleophile, and the linear precursor is capable of adopting a conformation in which the nucleophile is in proximity to and is capable of cleaving the splice site nucleotide of the terminal element. In some embodiments, the nucleophile can be a guanosine, e.g., a free guanosine that is introduced to the precursor RNA polynucleotide.

[0275] In some embodiments, the monotron comprises a 5’ proximal end of a natural group I or group II intron including the splice site dinucleotide and optionally a natural exon sequence or fragment thereof. In some embodiments, the 5’ end of the monotron refers to nucleotides within the 5’ half of the monotron. In some embodiments, the 3’ end of the monotron refers tonucleotides within the 3’ half of the monotron. In some embodiments, at or near the 5’ end of the monotron refers to within the 5’ half of the monotron. In some embodiments, at or near the 5’ end of the monotron refers to within the first ten 5’ positions in the monotron. In some embodiments, at the 5’ end of the monotron refers to the first 5’ position(s) in the monotron. In some embodiments, at or near the 3’ end of the monotron refers to within the 3’ half of the monotron. In some embodiments, at or near the 3’ end of the monotron refers to within the last ten 3’ positions in the monotron. In some embodiments, at the 3’ end of the monotron refers to last 3’ position(s) in the monotron.

[0276] In some embodiments, the splice site nucleotide of the terminal element is not a natural splice site dinucleotide associated with a natural Group I or Group II intron sequence. In some embodiments, the terminal element comprises at least a portion of a natural exon or a fragment of a natural exon. In some embodiments, the natural exon is a Group I or Group II exon. In some embodiments, the natural exon or fragment thereof is 10-20 nucleotides in length. In some embodiments, the terminal element comprises a synthetic derivative of a natural exon or fragment thereof. In some embodiments, the terminal element comprises an exon or synthetic nucleotides that are longer than the splice site nucleotide that can help with splicing.

[0277] In some embodiments, the terminal element sequence has a percent sequence identity of about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more to an exon fragment of a sequence selected from Table 2 or Table 3. In some embodiments, the terminal element sequence comprises an exon fragment comprising one, two, three, four, five, six, seven, eight, nine, ten, or more mutations to a sequence selected from Table 2 or Table 3. The mutations are, for example, selected from insertions, deletions, mutations, additions, and subtractions. In some embodiments, the terminal element or exon fragment thereof comprises a polynucleotide sequence selected from a sequence set forth in PCT / US2024 / 027627.

[0278] In some embodiments, the terminal element is less than 500, less than 450, less than 400, less than 350, less than 300, less than 250, less than 200, less than 150, less than 100, less than 90, less than 80, less than 70, less than 60, less than 50, less than 40, less than 30, less than 20, or less than 10 nucleotides in length.

[0279] In some embodiments, the terminal element is capable of directing or functionalizing the splicing activity of the monotron element.

[0280] In some embodiments, a portion of the terminal segment is retained upon circularization. In some embodiments, a portion of the terminal segment is excised uponcircularization. In some embodiments, all or a portion of the terminal element is excised post- circularization. In some embodiments, the terminal element is not excised upon cleavage and is retained post-cleavage.

[0281] In some embodiments, the monotron element comprises at least a portion of a Group I or Group II intron. In some embodiments, Group I or Group II intron is selected from a genus and / or species described in Table 2 or Table 3. In some embodiments, the Group I or Group II intron is from a gene selected from Cyanobacterium Anabaena sp., T4 phage, Hypocrea pallida, Bulbithecium hyalosporum, Myoarachis inversa, Geosmithia argillacea, Coxiella burnetii, Agrobacterium tumefaciens, Azoarcus, Nostoc, Cordyceps capitata, Prochlorothrix hollandica, and Tilletiopsis orzyzicola. In some embodiments, the monotron element or a fragment thereof has a percent sequence identity of about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more to a sequence selected from Table 2 or Table 3. In some embodiments, the monotron element sequence or fragment thereof comprises one, two, three, four, five, six, seven, eight, nine, ten, or more mutations to a sequence selected from Table 2 or Table 3. The mutations are, for example, selected from insertions, deletions, additions, and subtractions. In some embodiments the monotron element sequence or fragment thereof comprises a polynucleotide sequence having a percent sequence identity of about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more to a portion of a sequence set forth in PCT / US2024 / 027627.

[0282] In some embodiments, the Group I or Group II intron or introns, or portion thereof, are at least 10 nucleotides in length.

[0283] In some embodiments, the monotron element comprises at least one mutation of a native Group I intron-adjacent exon sequence or Group II intron-adjacent exon sequence. In some embodiments, the at least one mutation is at least one substation mutation of a native Group I intron-adjacent exon sequence or Group II intron-adjacent exon sequence. In some embodiments, the at least one mutation is at least one deletion of a native Group I intron- adjacent exon sequence or Group II intron-adjacent exon sequence. In some embodiments, at least one of the exon segments is less than 15 nucleotides in length. In some embodiments, the monotron element comprises a 3ʹ exon segment and / or 5ʹ exon segment, wherein the 3’ or 5’ exon segment comprises a Group I exon segment or a Group II exon segment less than 15 nucleotides in length. In some embodiments, the 3ʹ exon segments and / or 5ʹ exon segments, have a percent sequence identity of about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more to a native Group I intron-adjacent exon sequence or Group II intron-adjacent exon sequence.

[0284] In some embodiments, the monotron element is less than 500 nucleotides in length.

[0285] In some embodiments, the monotron element is capable of inducing circularization when it interacts with the terminal element. In some embodiments, a portion of the monotron element is excised post-circularization. In some embodiments, the monotron element is fully excised post-circularization. In some embodiments, a portion of the monotron element and a portion of the terminal element are retained and excised post-circularization.

[0286] In some embodiments, the precursor RNA polynucleotide comprises at least one affinity tag or affinity sequence. Affinity sequences are described in further detail herein. In some embodiments, the affinity tag comprises a polyA sequence or is a polyA affinity tag. In some embodiments the terminal element comprises an affinity tag. In some embodiments, the terminal element comprises a 5ʹ affinity tag or a 3ʹ affinity tag. In some embodiments, the monotron element comprises an affinity tag. In some embodiments, the monotron element comprises a 3ʹ affinity tag or a 5ʹ affinity tag.

[0287] In some embodiments, the precursor RNA polynucleotide comprises an internal and / or external spacer. Spacers of the present disclosure are described in further detail herein. In some embodiments, the precursor RNA polynucleotide comprises an internal spacer sequence positioned between the terminal element and the intervening region. In some embodiments, the precursor RNA polynucleotide comprises an internal spacer sequence positioned between the intervening region and the monotron element. In some embodiments, the precursor RNA polynucleotide comprises an external spacer. In some embodiments, the external spacer is positioned adjacent to the terminal element. In some embodiments, the external spacer is positioned adjacent to the monotron element. In some embodiments, the precursor RNA polynucleotide comprises internal spacers and / or external spacers. The internal spacers and external spacers can each comprise an unstructured, structured or randomly generated polynucleotide sequence. In some embodiments, the internal spacers and external spacers are at least 5 nucleotides in length and can be about 5 - 60 nucleotides in length. In some embodiments, the internal and external spacers are 5 - 60 nucleotides in length, inclusive.

[0288] In some embodiments, the precursor RNA polynucleotide comprises one or more duplexes. Duplexes of the present disclosure are described in further detail herein. In some embodiments, the precursor RNA polynucleotide comprises a 5ʹ internal duplex sequence and a 3ʹ internal duplex sequence. In embodiments where the terminal element is upstream of the monotron element, the 5ʹ internal duplex sequence is positioned between the terminal element and the intervening region, and the 3ʹ internal duplex sequence is positioned between the intervening region and the monotron element. In embodiments where the monotron element isupstream of the terminal element, the 5ʹ internal duplex sequence is positioned between monotron and the intervening region, and the 3ʹ internal duplex sequence is positioned between the intervening region and the terminal element. In some embodiments, the 5ʹ internal duplex sequence and 3ʹ internal duplex sequence are at least 80% complementary. In some embodiments, a duplex is 3-100 nucleotides in length. In some embodiments, a duplex is 5-20 nucleotides in length, inclusive. In some embodiments, the 5' and 3' internal duplex sequences are capable of forming, and are predicted to form, a contiguous duplex. In some embodiments, the continuous duplex has a length of no longer than about 35 nucleotides. In some embodiments, the 5ʹ internal duplex sequence and / or 3ʹ internal duplex sequence each have a GC content of at least 10%.

[0289] In some embodiments, the precursor RNA polynucleotide comprises at least one affinity tag and at least one external spacer. In some embodiments, the precursor RNA polynucleotide comprises at least one internal duplex and at least one internal spacer, for example a 5’ affinity tag and 5’ internal spacer and / or a 3’ affinity tag and 3’ internal spacer. In embodiments where the polynucleotide comprises a 5’ affinity tag, the 5ʹ affinity tag is positioned adjacent to the 5ʹ external spacer, and in certain embodiments is positioned 5ʹ to the 5ʹ external spacer. In some embodiments where the polynucleotide comprises a 3ʹ affinity tag, the 3ʹ affinity tag is positioned adjacent to the 3’ external spacer, and in certain embodiments is positioned 3ʹ to the 3ʹ external spacer.

[0290] In some embodiments, the precursor RNA polynucleotide comprises at least one duplex and at least one internal spacer. In some embodiments, the precursor RNA polynucleotide comprises at least one internal duplex and at least one internal spacer, for example a 5’ internal duplex and a 5’ internal spacer and / or a 3’ internal duplex and a 3’ internal spacer. In some embodiments where the polynucleotide comprises a 5ʹ internal duplex, the 5ʹ internal duplex is positioned adjacent to the 5ʹ internal spacer, and in certain embodiments is positioned 5ʹ to the 5ʹ internal spacer. In some embodiments where the polynucleotide comprises a 3ʹ internal duplex, the 3ʹ internal duplex is positioned adjacent to the 3ʹ internal spacer, and in certain embodiments, the 3ʹ internal duplex is positioned 3ʹ to the 3ʹ internal spacer.

[0291] In some embodiments, the precursor polynucleotide comprises a 3’ and / or 5’ exon segment. In some embodiments, at least a portion of the 3’ and / or 5’ exon segment is codon optimized.

[0292] In some embodiments, the precursor RNA polynucleotide described above further comprises a leading untranslated sequence and / or a lagging untranslated sequence. Forexample, the precursor RNA polynucleotide can comprise a 5ʹ external spacer that is positioned between a leading untranslated sequence and the terminal element if the terminal element is upstream of the monotron element; or between a leading untranslated sequence and the monotron element if the monotron element is upstream of the terminal element. In some embodiments, the precursor RNA polynucleotide comprises a 3ʹ external spacer that is positioned between the monotron element and a lagging untranslated sequence if the terminal element is upstream of the monotron element; or between the terminal element and a lagging untranslated sequence if the monotron element is upstream of the terminal element.

[0293] As described in detail elsewhere herein, the intervening region of the precursor RNA polynucleotide can comprise sequences directed to, for example, an aptamer, an expression sequence encoding a BCMA binding molecule, a stop codon or stop cassette, an intervening region comprising an untranslated region, a noncoding element. In some embodiments, the intervening region comprises an untranslated region, which can comprise one or more non-coding element, including but not limited to, a natural 5ʹ Untranslated Region (UTR), a natural 3ʹ Untranslated Region (UTR), a synthetic spacer sequence, an aptamer, TIE, a viral or eukaryotic IRES, or sequences selected from, e.g., lncRNA, miRNA, or a miRNA sponge.

[0294] In some embodiments, the polynucleotide comprises at least one mutation of a native Group I intron-adjacent exon sequence or Group II intron-adjacent exon sequence. The mutation can be, for example, at least one mutation of a native Group I or native Group II intron-adjacent exon sequence. For example, the mutation can be one substitution, at least one deletion, and / or at least one insertion of a native Group I or Group II intron-adjacent exon sequence. In some embodiments, at least one of the exon segments is less than 15 nucleotides in length. In some embodiments, the 3ʹ exon segment and / or 5ʹ exon segment comprises a Group I exon segment or a Group II exon segment. In some embodiments, the at least one exon segment is less than 15 nucleotides in length. In some embodiments, the at least one exon segment has a percent sequence identity of about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more to a native Group I intron-adjacent exon sequence or Group II intron-adjacent exon sequence. In some embodiments, the at least one segment is selected from a 3ʹ exon segment, 5ʹ exon segment, or a 3ʹ and 5ʹ permuted exon segment. In some embodiments, the exon sequence or fragment is in the terminal element.

[0295] Also provided herein are polynucleotides encoding the precursor RNA polynucleotides described above that comprise a monotron and terminal element. Polynucleotides, for example, DNA templates comprising sequences encoding the precursorRNAs described above, and their uses in related methods are described elsewhere herein. Polynucleotides of the present disclosure can comprise, for example, an expression vector, DNA plasmid, a cosmid, a PCR product, dbDNA close-ended DNA (ceDNA), and a viral polynucleotide. In some embodiments, the polynucleotides can comprises a promoter segment, for example a T7 promoter, SP6 promoter or a fragment thereof.

[0296] Also provided herein are circular RNA polynucleotides produced by the precursor RNAs described above that comprise a monotron and terminal element. Circular RNAs are described in detail elsewhere herein. In some embodiments, a circular RNA polynucleotide comprises: at least a portion of a terminal element, an intervening region comprising an expression sequence encoding a BCMA binding molecule, and at least a portion of a monotron element. In some embodiments, a circular RNA comprises: (a) at least a portion of a terminal element, (b) a 3ʹ exon segment comprising a 3ʹ nucleotide of a 3ʹ splice site dinucleotide, (c) an intervening region comprising an expression sequence encoding a BCMA binding molecule, (d) a 5ʹ exon segment comprising a 5ʹ nucleotide of a 5ʹ splice site dinucleotide, and (e) at least a portion of a monotron element. In some embodiments, (d) comprises the first nucleotide of a 5ʹ Group I or Group II splice site dinucleotide and a natural exon sequence and (b) comprises the second nucleotide of a 3ʹ Group I or Group II exon splice site dinucleotide and a natural exon sequence. In some embodiments, the 5' and / or 3' splice site dinucleotides are distinct from the natural splice site dinucleotide(s) associated with a natural Group I or Group II intron sequence. In some embodiments, the circular RNA polynucleotides comprise additional elements, including but not limited to, a 5ʹ internal duplex and / or 3ʹ internal duplex; a 5ʹ internal spacer and / or 3ʹ internal spacer. In some embodiments, the circular RNA polynucleotide is from about 50 nucleotides to about 15 kilobases in length.

[0297] Related cells comprising the precursor RNA polynucleotides, delivery or transfer vehicles, and pharmaceutical compositions thereof are described elsewhere herein in further detail. Related methods of producing circularized RNA and related methods of treating a subject in need thereof are also provided herein.

[0298] Also provided herein are methods of identifying a monotron element and terminal element pair that allows production of a circular RNA that is translatable or biologically active inside a eukaryotic cell, comprising, for example: (i) inserting a mutated 5ʹ and 3ʹ Group I or Group II intron sequence derived from a database of native intronic sequence to form a monotron element into a precursor RNA polynucleotide described above; (ii) inserting a synthetic polynucleotide sequence to form a terminal element into a precursor RNA polynucleotide described above; (iii) transcribing the polynucleotide into RNA in vitro orallowing the polynucleotide to be transcribed into RNA by a cell; and (iv) determining the circularization efficiency of the RNA produced by the polynucleotide by identifying the amount of circularized RNA, the amount of excised intronic sequences, the amount of precursor RNA remaining after circularization, and combinations thereof. In some embodiments, the mutated 5ʹ and 3ʹ Group I or Group II intron sequence comprises at least one deletion, insertion or substitution of at least one nucleotide. In some embodiments, the 5ʹ or 3ʹ Group I or Group II intronic sequences, or combinations thereof are sequenced.

[0299] Also provided herein are methods for determining a polynucleotide sequence that improves RNA circularization efficiency compared to a polynucleotide comprising a native intronic sequence or to a parent polynucleotide with a known sequence, the method comprising modifying a DNA sequence encoding the precursor RNA polynucleotide described above, the modifying comprising: (i) mutating at least one nucleotide and / or altering the length of the terminal element and / or monotron element of the DNA sequence encoding the precursor RNA polynucleotide described above; (ii) altering the length of the 5ʹ and / or 3ʹ internal and / or external spacer sequence of the DNA sequence encoding precursor RNA polynucleotide described above; (iii) altering the length of the 5ʹ and / or 3ʹ internal duplex sequence of the DNA sequence encoding the precursor RNA polynucleotide described above; (iv) altering the length of the 5ʹ and / or 3ʹ exon sequence of the DNA sequence encoding the precursor RNA polynucleotide described above; (iv) or combinations thereof; and transcribing the polynucleotide comprising the DNA sequence into RNA in vitro or allowing the polynucleotide comprising the DNA sequence to be transcribed into RNA by a cell; and determining the circularization efficiency of the RNA produced by the polynucleotide comprising the DNA sequence by identifying the amount of circularized RNA, the amount of excised intronic sequences, the amount of precursor RNA remaining after circularization, and combinations thereof. In some embodiments, the methods further comprise comparing the circularization efficiency of the polynucleotide with a polynucleotide comprising a native intronic sequence, or a parent polynucleotide. d. EXEMPLARY ELEMENTS

[0300] For means of example and not intended to be limiting, in some embodiments, a 5’ intron element comprises, in the following 5’ to 3’ order: a 5’ leading sequence, an optional 5’ external duplex, a 5’ affinity tag, a 5’ external spacer, and a 3’ permuted intron segment. In the same embodiments, the 5’ exon element comprises, in the following 5’ to 3’ order: a 3’ exon segment, an optional 5’ internal duplex, and a 5’ internal spacer. In the same embodiments, the 3’ exon element comprises, in the following 5’ to 3’ order: a 3’ internal spacer, an optional 3’internal duplex, and a 5’ exon segment. In still the same embodiments, the 3’ intron element comprises, in the following 5’ to 3’ order: a 5’ permuted intron segment, a 3’ external spacer, an optional 3’ external duplex, a 3’ affinity tag, and a 3’ lagging sequence.

[0301] As another exemplary embodiment, a terminal element comprises, in the following 5’ to 3’ order: a 5’ leading sequence, a 5’ external spacer, an excised terminal segment, a retained terminal segment, an optional 5’ internal duplex, and a 5’ internal spacer. In the same embodiments, the 3’ exon element comprises, in the following 5’ to 3’ order: a 3’ internal spacer, an optional 3’ internal duplex, and a 5’ exon segment. In still the same embodiments, the 3’ intron element comprises, in the following 5’ to 3’ order: a 5’ permuted intron segment, a 3’ external spacer, an optional 3’ external duplex, and a 3’ lagging sequence.

[0302] In some embodiments, the terminal element sequence has a percent sequence identity of about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more to an exon fragment of a sequence selected from Table 2 or Table 3.

[0303] For means of example and not intended to be limiting, in some embodiments, a 3’ intron element comprises in the following 5’ to 3’ order: a leading untranslated sequence, a 5’ affinity tag, an optional 5’ external duplex region, a 5’ external spacer, and a 3’ intron fragment. In the same embodiments, the 3’ exon element comprises in the following 5’ to 3’ order: a 3’ exon fragment, an optional 5’ internal duplex region, an optional 5’ internal duplex region, and a 5’ internal spacer. In the same embodiments, the 5’ exon element comprises in the following 5’ to 3’ order: a 3’ internal spacer, an optional 3’ internal duplex region, and a 5’ exon fragment. In still the same embodiments, the 3’ intron element comprises in the following 5’ to 3’ order: a 5’ intron fragment, a 3’ external spacer, an optional 3’ external duplex region, a 3’ affinity tag, and a trailing untranslated sequence. In some embodiments, the affinity tag is a polyA affinity tag.

[0304] In some embodiments, the 5ʹ intron element is located 5ʹ to the 5ʹ exon element. In some embodiments, the 5ʹ intron element is adjacent to the 5ʹ exon element. In some embodiments, the 3ʹ intron element is located 3ʹ to the 3ʹ exon element. In some embodiments, the 3ʹ intron element is adjacent to the 3ʹ exon element.

[0305] In some embodiments, the 5ʹ exon element comprises a 5ʹ internal duplex sequence located 3ʹ to the 3ʹ exon segment. In some embodiments, the 3ʹ exon element comprises a 3ʹ internal duplex sequence located 5ʹ to the 5ʹ exon segment. In some embodiments, the 5ʹ intron element comprises a 5ʹ external duplex sequence located 5ʹ to the 3ʹ permuted intron segment. In some embodiments, the 3ʹ intron element comprises a 3ʹ external duplex sequence located 3ʹ to the 5ʹ permuted intron segment. In some embodiments, the 5ʹ intron element is adjacentto the 5ʹ exon element. In some embodiments, the 3ʹ intron element is located 3ʹ to the 3ʹ exon element. In some embodiments, the 3ʹ intron element is adjacent to the 3ʹ exon element.

[0306] In some embodiments, the 5ʹ intron comprises a 5ʹ affinity tag, a 5ʹ external spacer, and the 3ʹ permuted intron segment. In some embodiments, the 5ʹ exon comprises the 3ʹ exon segment, a 5ʹ internal duplex sequence, and a 5ʹ internal spacer. In some embodiments, the 5ʹ affinity tag is adjacent to the 5ʹ external spacer. In some embodiments, the 5ʹ affinity tag is located 5ʹ to the 5ʹ external spacer. In some embodiments, the 5ʹ internal duplex sequence is adjacent to the 5ʹ internal spacer. In some embodiments, the 5ʹ internal duplex sequence is located 5ʹ to the 5ʹ internal spacer. In some embodiments, the 3ʹ exon comprises a 3ʹ internal spacer, 3ʹ internal duplex sequence, and the 5ʹ exon segment. In some embodiments, the 3ʹ intron comprises the 5ʹ permuted intron segment, a 3ʹ external spacer, and a 3ʹ affinity tag. In some embodiments, the 3ʹ affinity tag is adjacent to the 3ʹ external spacer. In some embodiments, the 3ʹ affinity tag is located 3ʹ to the 3ʹ external spacer. In some embodiments, the 3ʹ internal duplex sequence is adjacent to the 3ʹ internal spacer. In some embodiments, the 3ʹ internal duplex sequence is located 3ʹ to the 3ʹ internal spacer. In some embodiments, the affinity tag is a polyA affinity tag.

[0307] In some embodiments, the 5ʹ exon comprises a 5ʹ internal duplex sequence located between the 3ʹ exon segment and the intervening region. In some embodiments, the 3ʹ exon comprises a 3ʹ internal duplex sequence positioned between the intervening region and the 5ʹ exon segment. In some embodiments, the polynucleotide comprises a 5ʹ internal duplex sequence and a 3ʹ internal duplex sequence.

[0308] In some embodiments, the 3ʹ and 5ʹ permuted intron segments each independently comprise a Group I intron segment, a Group II intron segment, a synthetic intron segment, or a variant thereof. In some embodiments, the 3ʹ permuted intron segment comprises a 3ʹ Group I intron segment or a variant thereof. In some embodiments, the 5ʹ permuted intron segment comprises a 5ʹ Group I intron segment or a variant thereof. In some embodiments, the 3ʹ permuted intron segment comprises a 3ʹ Group II intron segment or a variant thereof. In some embodiments, the 5ʹ permuted intron segment comprises a 5ʹ Group II intron segment or a variant thereof.

[0309] In some embodiments, the 3ʹ permuted intron segment or element, 5ʹ permuted intron segment or element, or both the 3ʹ and 5ʹ permuted intron segments or elements are at least 100, at least 90, at least 80, at least 70, at least 60, and / or at least 50 nucleotides in length. In some embodiments, the 3ʹ permuted intron element, 5ʹ permuted intron element, or both the 3ʹ and 5ʹ permuted intron elements are at least 50 nucleotides in length. In some embodiments,the 3ʹ permuted intron element, 5ʹ permuted intron element, or both the 3ʹ and 5ʹ permuted intron elements have a percent sequence identity of about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more to a naturally occurring intron.

[0310] In some embodiments, the 3ʹ permuted intron element, 5ʹ permuted intron element, or both the 3ʹ and 5ʹ permuted intron elements comprise a native Group I intron segment or Group II intron segment sequence. In some embodiments, the 3ʹ permuted intron element, 5ʹ permuted intron element, or both the 3ʹ and 5ʹ permuted intron elements comprise one or more nucleotide substitutions of a native Group I intron segment or Group II intron segment sequence. In some embodiments, the 3ʹ permuted intron element, 5ʹ permuted intron element, or both the 3ʹ and 5ʹ permuted intron elements comprise one or more nucleotide insertions of a native Group I intron segment or Group II intron segment sequence. In some embodiments, the 3ʹ permuted intron element, 5ʹ permuted intron element, or both the 3ʹ and 5ʹ permuted intron elements comprise one or more nucleotide deletions of a native Group I intron segment or Group II intron segment sequence. In some embodiments, the 3ʹ permuted intron element, 5ʹ permuted intron element, or both the 3ʹ and 5ʹ permuted intron elements comprise a nucleotide substitution of one or both the dinucleotide of a native Group I or Group II intron splice site dinucleotide. In some embodiments, the 3ʹ Group I or Group II intron segment or the 5ʹ Group I or Group II intron segment comprises one, two, three, four, five, six, seven, eight, nine, ten, or more mutations of a native Group I intron or Group II intron sequence. In some embodiments, the mutations are selected from insertion, deletion, mutation, addition, and subtraction. In some embodiments, the mutations are deletions of two or more nucleotides of the 3ʹ Group I or Group II intron segment or the 5ʹ Group I or Group II intron segment, or combinations thereof. In some embodiments, the mutations are two or more deletions of the 5ʹ Group I intron segment at the 3ʹ end or two or more deletions of the 3ʹ Group I intron segment at the 5ʹ end.

[0311] In some embodiments, the native Group I intron segment or Group II intron segment sequences are selected from a sequence in Table 2 or Table 3, below. In some embodiments, the 3ʹ and / or 5ʹ permuted intron element comprise a polynucleotide sequence having a percent sequence identity of about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more to a naturally occurring intron selected from a sequence set forth in Table 2 or Table 3, or a fragment or segment thereof, or PCT / US2024 / 027627.

[0312] In some embodiments, the 3ʹ permuted intron segment comprises a 3ʹ Group I or Group II intron segment derived from a gene selected from a genus and / or species selected from column 2 of Table 2 or Table 3; and / or the 5ʹ permuted intron segment comprises a 5ʹGroup I or Group II intron segment derived from a gene selected from a genus and / or species selected from column 2 of Table 2 or Table 3.

[0313] In some embodiments, the 3ʹ Group I or Group II intron segment or the 5ʹ Group I or Group II intron segment are derived from a gene selected from a species selected from: Cyanobacterium Anabaena sp., T4 phage, Hypocrea pallida, Bulbithecium hyalosporum, Myoarachis inversa, Geosmithia argillacea, Coxiella burnetii, Agrobacterium tumefaciens, Azoarcus, Nostoc, Cordyceps capitata, Prochlorothrix hollandica, Tilletiopsis orzyzicola, Tetrahymena thermophila, and Staphylococcus phage Twort._ g gg g gg g g g g g g g g g gggggg g ggaaagcgagccccggagcgaaagcccggggaggaccgcagaaccgcgagc aaccaaaacagccggg g g gg gg g g ggg gg g ggg gggg gg g ggggg ggg g ggg gg g g g ggg g g g gaccaagccgacgccgaaaggcgccggggccggggaagacccagggacggaacaacg caggagcgccaagggg gg g gg g g gggaacgc gcgagcggccacgcaaccggggcggagacgcccaaggg gggcg cg g gg g g g gg g ggg gg g gggg gg gggg g ggg ggg g g g g g ggg gggg gg ggg ggg ggg gg gg g g gg g g g gg2 2Table 3: Group II introns (flanked by 10nt exons)aaaaaaaaa gaaaa a ggaaccagaaacaagacaagccacaa cgaca ccaacccgaaaa gaacgag g g gg gg ggg gggg g g g g g g g ggg g gg g g gg g g gg ggg g ggg g g gg ggg ggg g gg ggg g ggg g g g ggg ggg ggggggggggg gg g ggggg g g g ggggggg g g gg g g g g gg gg g g g g gg g ggggg ggg g g ggg g ggggggg gggg gg g ggggg ggg g ggg g g g g gggg gg g g gggggg g g g g g g g ggg gg g gg g g ggg ggg g ggg gggg gg g g gggg g ggg gggg gg gggg g ggggggg g g gg g gggg gg ggg gg g g ggg ggg gg ggg g g gg gg g g g ggg gggg g ggg g g g ggggggggg ggg gg ggg g g g g ggg g gg gg gg g gg g g ggggg g ggg gg g g ggg g ggggg g g g g g g g g g gg gg g g ggg gg g g ggg g g gg g g gggg gg gg gg gg g g ggg g g g g gg gg g ggggggg g g

[0314] In some embodiments, the 3ʹ or 5’ intron segments and / or 3’ or 5’ exon segmentsare derived from a gene selected from a species selected from: Cyanobacterium Anabaena sp., T4 phage, Coxiella burnetii, Azoarcus, Tetrahymena thermophila, and Staphylococcus phage Twort. In some embodiments, the 3’ or 5’ intron segment and / or 3’ or 5’ exon segment are developed from permuting at a position along a Cyanobacterium Anabaena sp., T4 phage, Coxiella burnetii, Azoarcus, Tetrahymena thermophila, and Staphylococcus phage Twort intron and / or exon sequence. In some embodiments, the 5’ or 3 monotron element are derived from a gene selected from a species selected from: Cyanobacterium Anabaena sp., T4 phage, Coxiella burnetii, Azoarcus, Tetrahymena thermophila, and Staphylococcus phage Twort. In some embodiments, the 3’ or 5’ intron segment and / or 3’ or 5’ exon segment are developed from permuting at a position along a Cyanobacterium Anabaena sp., T4 phage, Coxiella burnetii, Azoarcus, Tetrahymena thermophila, and Staphylococcus phage Twort intron and / or exon sequence.

[0315] In some embodiments, the intron segments and / or exon segments of a provided polynucleotide are derived from a gene from the same species (e.g., a polynucleotide comprises Azoarcus 3’ and 5’ exon segments and Azoarcus 3’ and 5’ intron segments). In other embodiments, the 3’ or 5’ intron segments or 3’ or 5’ exon segments of a provided polynucleotide are derived from genes of different species (e.g., a polynucleotide comprises an Anabaena intron segment and Staphylococcus phage Twort exon segment). In certain embodiments, the monotron element of a provided polynucleotide is derived from a gene of a different species than the 3’ or 5’ intron segments and / or 3’ or 5’ exon segments (e.g., a polynucleotide comprises a Staphylococcus phage Twort montron element and an Anabaena intron segment). In some embodiments, use of genes of one species of an intron segment and / or exon segment may allow for more efficient or effective circularization or self-splicing of one or more polynucleotides as compared to another gene of a different species. In certain embodiments, the gene used of one species develop an intron segment may more efficiently promote the interaction between an intron segment and a nucleophile (e.g., form a more efficient or effective binding pocket that promotes the transesterification reaction of a splice site nucleotide) as compared to an intron segment developed from a gene of a different species. In some embodiments, the gene of one species from which an intron segment is derived may be more efficient in forming a binding pocket for a nucleophile as compared to a different gene of the same species. In some embodiments, the species of gene from which the intron segment is derived may be more efficient in forming a binding pocket for a nucleophile as compared to a species of genes comprising the same and / or homologous sequence from a different species.

[0316] As described herein, in some embodiments, a provided polynucleotide comprisesan intron segment and / or exon segment derived from permuting at a position along a Group I or Group II gene selected from Table 2 or Table 3. Location or position of the permutation sites may enhance the ability of an intron segment to effectively splice and / or circularize in a provided polynucleotide. In some embodiments, the Group I or Group II genes are permuted at a position that enhances splicing or circularization activity of an intron segment of a provided polynucleotide as compared to a different permutation site. In certain embodiments, the Group I or II genes are permuted at a position in an intron segment of a provided polynucleotide that enhances the provided polynucleotide’s ability to self-circularize as compared to a different permutation site. In some embodiments, the Group I or II genes are permuted at a position that enhances or promotes the splicing activity of an intron segment to another intron segment, monotron element and / or exon segment. In some embodiments, the Group I or II genes are permuted at a position that allows the intron segment to more efficiently splice or self-splice than an intron segment permuted at a different position. In certain embodiments, a position of a permutation site may promote the interaction between an intron segment and a nucleophile (e.g., form a more efficient or effective binding pocket that promotes the transesterification reaction of a splice site nucleotide).

[0317] As described herein, permutation sites positions are described to mean that the permutation of the natural or synthetic intron occurs at the junction between the listed amino acid and the adjacent downstream amino acid (e.g., an Anabaena position 189 permutation site corresponds herein to a permutation site between amino acids 189 and 190).

[0318] In some embodiments, a provided polynucleotide comprises an intron segment derived from permuting at a position along a gene selected from a species selected from: Cyanobacterium Anabaena sp., T4 phage, Coxiella burnetii, Azoarcus, Tetrahymena thermophila, and Staphylococcus phage Twort. In certain embodiments, a provided polynucleotide comprises an intron segment derived from permuting a Cyanobacterium Anabaena sp. gene. In these embodiments, the permutation site of the Cyanobacterium Anabaena sp. gene may be downstream relative to amino acid positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164,165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, or 265 of the Cyanobacterium Anabaena sp. gene. In certain embodiments, a provided polynucleotide comprises an intron segment derived from permuting an Azoarcus gene. In these embodiments, the permutation site of the Azoarcus gene may be downstream relative to amino acid positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, or 221 of the Azoarcus gene. In certain embodiments, a provided polynucleotide comprises an intron segment derived from permuting an Coxiella burnetii gene. In these embodiments, the permutation site of the Coxiella burnetii gene may be downstream relative to amino acid positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258,259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, or 390 of the Coxiella burnetii gene. In certain embodiments, a provided polynucleotide comprises an intron segment derived from permuting a Tetrahymena thermophila gene. In these embodiments, the permutation site of the Tetrahymena thermophila gene may be downstream relative to amino acid positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, or 436 of a Tetrahymena thermophila gene. In certain embodiments, a provided polynucleotide comprises an intron segment derived from permuting an T4 phage (td) gene. In these embodiments, thepermutation site of the T4 phage (td) gene may be downstream relative to amino acid positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, or 289 of the T4 phage (td) gene. In certain embodiments, a provided polynucleotide comprises an intron segment derived from permuting a Staphylococcus phage Twort gene. In these embodiments, the permutation site of the Staphylococcus phage Twort gene may be downstream relative to amino acid positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, or 281 of the Staphylococcus phage Twort gene.

[0319] Also provided herein are methods of identifying an exon and / or intron element oridentifying a combined accessory element comprising a mutated Group I or Group II exon and / or intron segment (as described herein) that allows production of a circular RNA that is translatable or biologically active inside a eukaryotic cell. In some embodiments, such a method comprises: (i) inserting 5ʹ and 3ʹ Group I or Group II intronic sequences derived from a database of native intronic sequence into a precursor RNA polynucleotide; (ii) transcribing the polynucleotide into RNA in vitro or allowing the polynucleotide to be transcribed into RNA by a cell; and (iii) determining the circularization efficiency of the RNA produced by the polynucleotide by identifying the amount of circularized RNA, the amount of excised intronic sequences, the amount of precursor RNA remaining after circularization, and combinations thereof.

[0320] In some embodiments, the mutated Group I or Group II exon and / or intron element or segment comprises a deletion, insertion or substitution of at least one nucleotide, including but not limited to a nucleotide substitution of one or both the dinucleotides of the 5ʹ and / or 3ʹ Group I splice site dinucleotides. In some embodiments, the 5ʹ or 3ʹ Group I or Group II intronic sequences, or combinations thereof are sequenced. In some embodiments, the method further comprises comparing the circularization efficiency of the polynucleotide with a polynucleotide comprising a native intronic sequence, or a parent polynucleotide.

[0321] Also provided herein are methods of identifying or determining a polynucleotide sequence that improves RNA circularization efficiency compared to a polynucleotide comprising a native intronic sequence or to a parent polynucleotide with a known sequence, the method comprising modifying a DNA sequence encoding the precursor RNA polynucleotide described herein comprising: (i) modifying at least one nucleotide and / or altering the length of the 5ʹ intron element and / or 3ʹ intron element of the DNA sequence encoding the precursor RNA polynucleotide described herein; (ii) altering the length of the 5ʹ and / or 3ʹ internal and / or external spacer sequence of the DNA sequence encoding precursor RNA polynucleotide; (iii) altering the length of the 5ʹ and / or 3ʹ internal duplex sequence of the DNA sequence encoding the precursor RNA polynucleotide; (iv) altering the length of the 5ʹ and / or 3ʹ exon sequence of the DNA sequence encoding the precursor RNA polynucleotide; or (v) combinations thereof; andtranscribing the polynucleotide comprising the DNA sequence into RNA in vitro or allowing the polynucleotide comprising the DNA sequence to be transcribed into RNA by a cell; and determining the circularization efficiency of the RNA produced by the polynucleotide comprising the DNA sequence by identifying the amount of circularized RNA, the amount of excised intronic sequences, the amount of precursor RNA remaining after circularization, and combinations thereof. In some embodiments, the method further comprises comparing the circularization efficiency of the polynucleotide with a polynucleotide comprising a native intronic sequence, or a parent polynucleotide. e. SPACER

[0322] In various embodiments, a provided polynucleotide (e.g., a DNA template, a precursor RNA polynucleotide, or a circular RNA polynucleotide) comprises one or more spacers.

[0323] In certain embodiments, the DNA template, precursor linear RNA polynucleotide and circular RNA provided herein comprise a 5’ and / or a 3’ spacer. In some embodiments, the polynucleotide comprises one or more spacers in the intron elements. In some embodiments, the polynucleotide comprises one or more spacers in the exon elements. In some embodiments, the polynucleotide comprises a spacer in the 3’ intron fragment (also referred to as “5’ external spacer”). In some embodiments, the polynucleotide comprises a spacer in the 5’ intron fragment (also referred to as “3’ external spacer”). In some embodiments, the polynucleotide comprises a spacer in the 3’ exon fragment (also referred to as “5’ internal spacer”). In some embodiments, the polynucleotide comprises a spacer in the 5’ exon fragment (also referred to as “3’ internal spacer”).

[0324] In certain embodiments, the polynucleotide comprises a spacer in the 3’ intron fragment and / or a spacer in the 5’ intron fragment. In some embodiments, the 5ʹ external spacer is located 5ʹ to the 3ʹ permuted intron segment. In some embodiments, the 5ʹ internal spacer is located 3ʹ to the 3ʹ exon segment. In some embodiments, the 3ʹ external spacer is located 3ʹ to the 5ʹ permuted intron segment. In some embodiments, the 3ʹ external spacer is located 5ʹ to the 5ʹ exon segment.

[0325] In certain embodiments, the polynucleotide comprises a 5ʹ external spacer located between a leading untranslated sequence and the 5ʹ or 3ʹ intron element. In certain embodiments, the polynucleotide comprises a 3ʹ external spacer located between the 3ʹ or 5ʹ intron element and a lagging untranslated sequence.

[0326] In certain embodiments where the polynucleotide comprises a monotron, the polynucleotide can comprise an internal spacer sequence positioned between the terminalelement and the intervening region, and / or between the intervening region and the monotron element. In certain embodiments, the polynucleotide can comprise an external spacer positioned adjacent to the terminal element and / or an external spacer positioned adjacent to the monotron element.

[0327] In certain embodiments, the spacers aid with circularization or protein expression due to symmetry created in the overall sequence of the precursor RNA polynucleotide. In certain embodiments, including a 5’ internal spacer and / or including a spacer between the 3’ group I intron fragment and the intervening region may conserve secondary structures in those regions by preventing them from interacting, thus increasing splicing efficiency. In certain embodiments, there is a spacer, for example, between the 3’ permuted intron segment and the intervening region, wherein the spacer may prevent structured regions of an IRES or aptamer of a TIE comprised in the intervening region from interfering with the folding of the 3’ permuted intron segment or reduces the extent to which this occurs.

[0328] In some embodiments, the polynucleotide further comprises an aptamer. In some embodiments, the aptamer is synthetic.

[0329] In some embodiments, the first spacer (e.g., between the 3’ group I or II intron fragment and intervening region) and second spacer (e.g., between the two expression sequences and intervening region) comprise additional base pairing regions that are predicted to base pair with each other and not to the first and second duplex regions. In other embodiments, the first spacer (e.g., between 3’ group I or II intron fragment and intervening region) and second spacer (e.g., between the one of the intervening region and 5’ group I or II intron fragment) comprise additional base pairing regions that are predicted to base pair with each other and not to the first and second duplex regions.

[0330] In certain embodiments, the polynucleotide comprises a first (5’) and a second (3’) spacer. In some embodiments, the polynucleotide comprises a 5’ external spacer and a 3’ external spacer, wherein the spacers comprise additional base pairing regions that are predicted to base pair with each other and not to the first and second duplex regions. In other embodiments, the polynucleotide comprises a 5’ internal spacer and a 3’ internal spacer, wherein the spacers comprise additional base pairing regions that are predicted to base pair with each other and not to the first and second duplex regions. In some embodiments, such spacer base pairing brings the permuted intron segments in close proximity to each other, which may increase splicing efficiency. Additionally, in some embodiments, the combination of base pairing between the first and second duplex regions, and separately, base pairing between the first and second spacers, promotes the formation of a splicing bubble containing the permutedintron segments flanked by adjacent regions of base pairing.

[0331] Typical spacers are contiguous sequences with one or more of the following qualities: (1) predicted to avoid interfering (e.g., forming duplex) with proximal structures, for example, the IRES, expression sequence, aptamer, or intron; (2) is at least 5 nt long and no longer than 100 nt; (3) is located adjacent to the permuted intron segment; and (4) contains one or more of the following: (a) an unstructured region at least 5 nt long, (b) a region of base pairing at least 5 nt long to a distal sequence, such as another spacer, and (c) a structured region at least 5 nt long limited in scope to the sequence of the spacer. In various embodiments, a spacer is not predicted to form a duplex of more than 8 nucleotides in length with any sequences within 250 nucleotides in either direction. In some embodiments, the spacer is not predicted to form a duplex of more than 8 nucleotides in length with any sequences within 1000 nucleotides in either direction. In some embodiments, the spacer comprises an unstructured, structured or randomly generated polynucleotide sequence. Spacers may have several regions, including an unstructured region, a base pairing region, a hairpin / structured region, and combinations thereof. In an embodiment, the spacer has a structured region with high GC content. In an embodiment, a region within a spacer base pairs with another region within the same spacer. In an embodiment, a region within a spacer base pairs with a region within another spacer. In an embodiment, a spacer comprises one or more hairpin structures. In an embodiment, a spacer comprises one or more hairpin structures with a stem of 4 to 12 nucleotides and a loop of 2 to 10 nucleotides.

[0332] In some embodiments, a spacer sequence is at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, or 30 nucleotides in length. In some embodiments, a spacer sequence is no more than 100, 90, 80, 70, 60, 50, 45, 40, 35, or 30 nucleotides in length. In some embodiments, a spacer sequence is between 5 and 50, 10 and 50, 20 and 50, 20 and 40, and / or 25 and 35 nucleotides in length. In certain embodiments, a spacer sequence is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides in length. In some embodiments, the spacer sequence is at least 5 nucleotides in length, and / or about 5 to about 60 nucleotides in length.

[0333] In some embodiments, a spacer sequence is a polyA sequence. In some embodiments, a spacer sequence is a polyAC sequence. In some embodiments, a spacer comprises about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% polyAC content. In some embodiments, a spacer comprises about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% polypyrimidine (C / T or C / U) content.f. DUPLEX

[0334] In various embodiments, a provided polynucleotide (e.g., a DNA template, a precursor RNA polynucleotide, or a circular RNA polynucleotide) comprises one or more duplexes.

[0335] In some embodiments, the polynucleotide comprises a 5’ external duplex located within the 3’ intron fragment. In some embodiments, the polynucleotide comprises a 3’ external duplex located within the 5’ intron fragment. In some embodiments, the polynucleotide comprises a 5ʹ internal duplex sequence and a 3ʹ internal duplex sequence. In some embodiments, the polynucleotide comprises a 5’ internal duplex located within the 3’ exon fragment. In some embodiments, the 5ʹ internal duplex sequence is positioned between the 5ʹ exon element and the intervening region. In some embodiments, the polynucleotide comprises a 3’ internal duplex located within the 5’ exon fragment. In some embodiments, the 3ʹ internal duplex sequence is positioned between the intervening region and the 3ʹ exon element. In certain embodiments, the polynucleotide comprises a 5’ external duplex located within the 3’ intron fragment and a 3’ external duplex located within the 5’ intron fragment. In some embodiments, the polynucleotide comprises a 5’ internal duplex located within the 3’ exon fragment and a 3’ internal duplex located within the 5’ exon fragment. In some embodiments, the polynucleotide comprises a 5’ external duplex, 5’ internal duplex, a 3’ internal duplex region, and a 3’ external duplex.

[0336] In some embodiments, the polynucleotide comprises a monotron element, intervening region, and terminal element, and a 5ʹ internal duplex sequence and a 3ʹ internal duplex sequence. In some embodiments, if the terminal element is upstream of the monotron element, the 5ʹ internal duplex sequence is positioned between the terminal element and the intervening region, and the 3ʹ internal duplex sequence is positioned between the intervening region and the monotron element. In some embodiments, if the monotron element is upstream of the terminal element, the 5ʹ internal duplex sequence is positioned between monotron and the intervening region, and the 3ʹ internal duplex sequence is positioned between the intervening region and the terminal element. In some embodiments, the 5’ or 3’ internal duplex is positioned adjacent to a 5’ or 3’ internal spacer.

[0337] In some embodiments, the polynucleotide comprises a first (5’) duplex and a second (3’) duplex (e.g., a 5’ external duplex region and a 3’ external duplex region). In certain embodiments, the first and second duplex regions may form perfect or imperfect duplexes. Thus, in certain embodiments, at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%,96%, 97%, 98%, 99% or 100% of the first duplex and second duplex may be base paired with one another. In some embodiments, the duplexes regions are predicted to have less than 50% (e.g., less than 45%, less than 40%, less than 35%, less than 30%, less than 25%) base pairing with unintended sequences in the RNA (e.g., non-duplex sequences). In some embodiments, the 5ʹ internal duplex sequence and 3ʹ internal duplex sequence are at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% complementary. In some embodiments, including such first duplex and second duplex on the 5’ and 3’ ends of the precursor RNA strand, respectively, and adjacent or very close to the permuted intron segment, bring the permuted intron segments in close proximity to each other, increasing splicing efficiency.

[0338] In some embodiments, a duplex, whether, e.g., a 5’ internal duplex sequence or 3’ internal duplex sequence, is 3-100 nt in length (e.g., 3-75 nt in length, 3-50 nt in length, 20-50 nt in length, 35-50 nt in length, 5-25 nt in length, 5-20 nt in length, 9-19 nt in length). In some embodiments, a duplex has a length of about 9 to about 50 nt. In one embodiment, a duplex has a length of about 9 to about 19 nt. In one embodiment, a duplex has a length of about 5 to about 20 nt nucleotides in length, inclusive. In one embodiment, the 5ʹ internal duplex sequence and 3ʹ internal duplex sequence are each independently about 9 to about 50 nt, about 9 to about 19 nt, or about 5 to about 20 nt nucleotides in length, inclusive. In one embodiment, a duplex has a length of about 20 to about 40 nt. In some embodiments, a duplex is about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nt in length. In certain embodiments, a duplex has a length of about 30 nt. In certain embodiments, the 5' and 3' internal duplex sequences are predicted to form a contiguous duplex. In some embodiments, the contiguous duplex has a length of 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nt in length. In some embodiments, the contiguous duplex has a length of no longer than 35 nucleotides. In some embodiments, at least one of the exon segments is less than 15 nucleotides in length.

[0339] In some embodiments, the 5ʹ internal duplex sequence and / or 3ʹ internal duplex sequence each have a GC content of at least 10%.

[0340] In other embodiments, the polynucleotide does not comprise of any duplex to optimize translation or circularization. g. AFFINITY SEQUENCES

[0341] In various embodiments, a provided polynucleotide (e.g., a DNA template, aprecursor linear RNA polynucleotide, or a circular RNA polynucleotide) may comprise an affinity sequence (or affinity tag) In some embodiments, a precursor RNA polynucleotide comprises at least one affinity tag. In some embodiments, the affinity tag is located in the 3’ intron element. In some embodiments, the affinity tag is located in the 5’ intron element. In some embodiments, both (3’ and 5’) intron elements each comprise an affinity tag. In some embodiments, the 5ʹ affinity tag is located 5ʹ to the 3ʹ permuted intron segment. In some embodiments, the 3ʹ affinity tag is located 3ʹ to the 5ʹ permuted intron segment.

[0342] In some embodiments, the polynucleotide comprises a monotron element comprising an affinity tag and / or terminal element comprising an affinity tag. In some embodiments, the terminal element comprises (a) a 5ʹ affinity tag if the terminal element is located upstream of the monotron element, wherein the 5ʹ affinity tag is located 5ʹ to the terminal element; or (b) a 3ʹ affinity tag if the monotron element is located upstream of the terminal element, wherein the 3ʹ affinity tag is located 3ʹ to the terminal element. In some embodiments, the monotron element comprises (a) a 3ʹ affinity tag if the terminal element is located upstream of the monotron element, wherein the 3ʹ affinity tag is located 3ʹ to the monotron element; or (b) a 5ʹ affinity tag if the monotron element is located upstream of the terminal element, wherein the 5ʹ affinity tag is located 5ʹ to the monotron element. In some embodiments, if the precursor RNA polynucleotide comprises an external spacer, the 5’ or 3’ affinity tag is positioned adjacent to the external spacer.

[0343] In one embodiment, an affinity tag of the 3’ intron element is the length as an affinity tag in the 5’ intron element. In some embodiments, an affinity tag of the 3’ intron element is the same sequence as an affinity tag in the 5’ intron element. In some embodiments, the affinity sequence is placed to optimize oligo-dT purification.

[0344] In some embodiments, the one or more affinity tags present in a precursor RNA polynucleotide are removed upon circularization. See, for example, Figures 97A and 97B from WO2022261490, which are incorporated by reference herein in entirety. In some embodiments, affinity tags are added to remaining linear RNA after circularization of precursor RNA is performed. In some such embodiments, affinity tags are added enzymatically to linear RNA. The presence of one or more affinity tags in linear RNA and their absence from circular RNA can facilitate purification of circular RNA. In some embodiments, such purification is performed using a negative selection or affinity-purification method. In some embodiments, such purification is performed using a binding agent that preferentially or specifically binds to the affinity tag.

[0345] In some embodiments, an affinity sequence, such as biotin, is added to linear RNAby ligation. In some embodiments, an oligonucleotide comprising an affinity sequence is ligated to linear RNA. In some embodiments, an oligonucleotide conjugated to an affinity handle is ligated to the linear RNA. In some embodiments, a solution comprising the linear RNA ligated to the affinity sequence or handle and the circular RNA that does not comprise an affinity sequence or handle are contacted with a binding agent comprising a solid support conjugated to an oligonucleotide complementary to the affinity sequence or to a binding partner of the affinity handle, such that the linear RNA binds to the binding agent, and the circular RNA is eluted or separated from the solid support.

[0346] In some embodiments, an affinity tag comprises a polyA sequence or is a polyA affinity tag. In some embodiments the polyA sequence is at least 15, 30, or 60 nt in length. In some embodiments, the affinity tag comprising a polyA sequence is present in two places in a precursor linear RNA. In some embodiments, one or both polyA sequences are 15-50 nt in length. In some embodiments, one or both polyA sequences are 20-25 nt in length. In some embodiments, the polyA sequence(s) is removed upon circularization. Thus, an oligonucleotide hybridizing with the polyA sequence, such as a deoxythymidine oligonucleotide (oligo(dT)) conjugated to a solid surface (e.g., a resin), can be used to separate circular RNA from its precursor RNA.

[0347] Any purification method for circular RNA described herein may comprise one or more buffer exchange steps. In some embodiments, buffer exchange is performed after in vitro transcription (IVT) and before additional purification steps. In some such embodiments, the IVT reaction solution is buffer exchanged into a buffer comprising Tris. In some embodiments, the IVT reaction solution is buffer exchanged into a buffer comprising greater than 1 mM or greater than 10 mM one or more monovalent salts, such as NaCl or KCl, and optionally comprising EDTA. In some embodiments, buffer exchange is performed after purification of circular RNA is complete. In some embodiments, buffer exchange is performed after IVT and after purification of circular RNA. In some embodiments, the buffer exchange that is performed after purification of circular RNA comprises exchange of the circular RNA into water or storage buffer. In some embodiments, the storage buffer comprises 1mM sodium citrate, pH 6.5. h. LEADING SEQUENCES & LAGGING SEQUENCES

[0348] In various embodiments, provided polynucleotide (e.g., a DNA template, a precursor linear RNA polynucleotide, or a circular RNA polynucleotide) comprises a leading untranslated sequence. In some embodiments, the leading untranslated sequence is located at the 5’ end in the 3’ intron fragment (also referred to as “5’ leading sequence”). In someembodiments, the leading untranslated sequence comprises the last nucleotide of a transcription start site (TSS). In some embodiments, the TSS is chosen from a viral, bacterial, or eukaryotic DNA template. In one embodiment, the leading untranslated sequence comprises the last nucleotide of a TSS and 0 to 100 additional nucleotides. In some embodiments, the TSS is a spacer. In some embodiments, the leading untranslated sequence contains a guanosine at the 5’ end.

[0349] In various embodiments, provided polynucleotide (e.g., a DNA template, a precursor linear RNA polynucleotide, or a circular RNA polynucleotide) comprises a lagging untranslated sequence (also referred to as “trailing sequence”). In some embodiments, the lagging untranslated sequence is located at the 3’ end. In some embodiments, the polynucleotide comprises a 3ʹ external spacer located between the 3ʹ intron element and a lagging untranslated sequence. In some embodiments, the polynucleotide a leading untranslated sequence at the 5ʹ end. In some embodiments, the polynucleotide comprises a 5ʹ external spacer located between a leading untranslated sequence and the 5ʹ intron element.

[0350] In some embodiments, the polynucleotide comprises a monotron element and a leading untranslated sequence. In some embodiments, the polynucleotide comprises a 5ʹ external spacer positioned between a leading untranslated sequence and either the terminal element or monotron element. In some embodiments, the polynucleotide comprises a monotron element and a lagging untranslated sequence. In some embodiments, the polynucleotide comprises a 3’ external spacer positioned between the lagging untranslated sequence and either the monotron element or terminal element.

[0351] In some embodiments, the lagging untranslated sequence comprises a restriction site sequence or a fragment thereof. In certain embodiments, the restriction site sequence or fragment thereof is used to linearize the polypeptide (e.g., DNA template). In some embodiments, the restriction site sequence is derived from a natural viral, bacterial or eukaryotic DNA template. C. INTERVENING REGION

[0352] In various embodiments, a provided polynucleotide (e.g., a DNA template, a linear precursor RNA polynucleotide, or a circular RNA polynucleotide) comprises an intervening region.

[0353] In some embodiments, the intervening region and / or core functional element comprises one or more noncoding elements, e.g., microRNA binding site, IRES transacting factor region, restriction site, a RNA editing region, structural or sequence element, a granule site, a zip code element, or an RNA trafficking element. In some embodiments, the interveningregion and / or core functional element comprises one or more expression sequences encoding a BCMA binding molecule, e.g., BCMA CAR. In some embodiments, the intervening region and / or core functional element comprises a combination of coding and noncoding elements. In some embodiments, the coding or non-coding region is a part of the core functional element or intervening region located between the 5’ end and 3’ end of the linear precursor RNA polynucleotide and resultant circular RNA.

[0354] In some embodiments, the coding element encodes two or more polypeptides (e.g., wherein at least one polypeptide comprises a BCMA binding molecule). In some embodiments, the coding element may encode one or more subunits of a polynucleotide. In some embodiments, the sequences encoding the two or more polypeptides are separated by a ribosomal skipping element or a nucleotide sequence encoding a protease cleavage site. In certain embodiments, the ribosomal skipping element encodes thosea-asigna virus 2A peptide (T2A), porcine teschovirus-1 2 A peptide (P2A), foot-and-mouth disease virus 2 A peptide (F2A), equine rhinitis A vims 2A peptide (E2A), cytoplasmic polyhedrosis vims 2A peptide (BmCPV 2A), or flacherie vims of B. mori 2A peptide (BmIFV 2A). Coding elements or regions and payloads are described in further detail elsewhere herein.

[0355] In some embodiments, the intervening region comprises at least one translation initiation element (TIE). TIEs are designed to allow translation efficiency of an encoded protein. In some embodiments, core functional elements comprising one or more coding elements will further comprise one or more TIEs. In some embodiments, a translation initiation element (TIE) comprises a synthetic TIE. In some embodiments, a synthetic TIE comprises aptamer complexes, synthetic IRES or other engineered TIEs capable of initiating translation of a linear RNA or circular RNA polynucleotide. In certain embodiments, the presence of a synthetic TIE (e.g., a synthetic IRES) in a circular RNA polynucleotide may enhance translation compared to circular RNA polynucleotide comprising a non-synthetic TIE (e.g., a non-synthetic IRES). In certain embodiments, the presence of a synthetic TIE (e.g., a synthetic IRES) in a circular RNA polynucleotide may have comparable translation functions as compared to a circular RNA polynucleotide comprising a non-synthetic TIE (e.g., non- synthetic IRES).

[0356] In some embodiments, the intervening region comprises one or more noncoding elements. In some embodiments, the noncoding element comprises an untranslated region (UTR) or fragment thereof. In some embodiments, the noncoding element is a natural 5ʹ UTR. In some embodiments, the noncoding element is a natural 3ʹ UTR. In some embodiments, the noncoding element is a synthetic spacer sequence. In some embodiments, the noncodingelement is an aptamer. In some embodiments, the noncoding element is or comprises a translation initiation element (TIE). In some embodiments, the noncoding element comprises a lncRNA, miRNA, or a miRNA sponge.

[0357] In some embodiments, the intervening region comprises a TIE comprising an untranslated region (UTR) or a fragment thereof, an aptamer complex or a fragment thereof, or a combination thereof. In certain embodiments, the TIE contains modified nucleotides.

[0358] In certain embodiments, the TIE provided herein comprise an internal ribosome entry site (IRES). In certain embodiments, the TIE provided herein comprise a viral or eukaryotic internal ribosome entry site (IRES) or a fragment or variant thereof. In certain embodiments, the IRES comprises one or more modified nucleotides compared to the wild- type viral IRES or eukaryotic IRES. See, e.g., PCT Application No. US2022 / 33091, which is incorporated herein by reference in its entirety.

[0359] In some embodiments, the noncoding element comprises an untranslated region (UTR). In some embodiments, the noncoding element is a natural 5’ UTR. In some embodiments, the noncoding element is a natural 3’ UTR. In some embodiments, the noncoding element is a synthetic spacer sequence. In some embodiments, the noncoding element is an aptamer or synthetic aptamer. In some embodiments, the noncoding element is or comprises a translation initiation element (TIE). a. TRANSLATION INITIATION ELEMENT

[0360] In some embodiments, the DNA template, linear RNA polynucleotide, and circular RNA polynucleotide comprise an intervening region and / or core functional element. In some embodiments, the intervening region and / or core functional element comprises an expression sequence encoding a BCMA binding molecule, e.g., BCMA CAR. In some embodiments, the intervening region and / or core functional element further comprises a translation initiation element (TIE) upstream to the expression sequence encoding the BCMA binding molecule, and / or a termination element.

[0361] In some embodiments, the polynucleotide comprises a translation initiation element (TIE). In some embodiments, the intervening region comprises at least one TIE. In some embodiments, the TIE is upstream to the expression sequence encoding the BCMA binding molecule. In some embodiments, TIEs are designed to allow translation efficiency of an encoded protein. Accordingly, in some embodiments, an intervening region comprising one or more coding elements further comprises one or more TIEs. In other embodiments, an intervening region comprising only noncoding elements lacks any TIEs.

[0362] In some embodiments, a TIE comprises an internal ribosome entry site (IRES). Incertain embodiments, the TIE provided herein comprise a viral or eukaryotic internal ribosome entry site (IRES) or a fragment or variant thereof. In some embodiments, inclusion of an IRES permits the translation of one or more open reading frames from a circular RNA (e.g., open reading frames that form the expression sequences). In some embodiments, IRES attracts a eukaryotic ribosomal translation initiation complex and promotes translation initiation. See, e.g., PCT Publication No. WO202261490, which is incorporated herein by reference in its entirety. i. Natural TIES: viral & eukaryotic / cellular IRES

[0363] In certain embodiments, as provided herein, the payload encoded by the circular RNA polynucleotide may be optimized through use of a specific internal ribosome entry sites (IRES) within the translation initiation element (TIE). In some embodiments, IRES specificity within a circular RNA can significantly enhance expression of specific proteins encoded within the coding element. In some embodiments, the IRES comprises a viral IRES or eukaryotic IRES.

[0364] A multitude of IRES sequences are available and include sequences derived from a wide variety of viruses, such as from leader sequences of picornaviruses such as the encephalomyocarditis virus (EMCV) UTR (Jang et al., J. Virol. (1989) 63: 1651-1660), the polio leader sequence, the hepatitis A virus leader, the hepatitis C virus IRES, human rhinovirus type 2 IRES (Dobrikova et al., Proc. Natl. Acad. Sci. (2003) 100(25): 15125- 15130), an IRES element from the foot and mouth disease virus (Ramesh et al., Nucl. Acid Res. (1996) 24:2697- 2700), a giardiavirus IRES (Garlapati et al., J. Biol. Chem. (2004) 279(5):3389-3397), and the like.

[0365] Inclusion of an IRES permits the translation of one or more open reading frames from a circular RNA (e.g., open reading frames that form the expression sequences). The IRES element attracts a eukaryotic ribosomal translation initiation complex and promotes translation initiation. See, e.g., Kaufman et al., Nuc. Acids Res. (1991) 19:4485-4490; Gurtu et al., Biochem. Biophys. Res. Comm. (1996) 229:295-298; Rees et al., BioTechniques (1996) 20: 102-110; Kobayashi et al., BioTechniques (1996) 21 :399-402; and Mosser et al., BioTechniques 199722 150-161. In some embodiments, the IRES is capable of facilitating expression of a protein encoded by the precursor RNA in a cell. In some embodiments, the IRES is capable of facilitating expression of the protein, such that the expression level of the protein is comparable to or higher than when a control IRES is used.

[0366] Different IRES sequences have varying ability to drive protein expression, and the ability of any particular identified or predicted IRES sequence to drive protein expression fromlinear mRNA or circular RNA constructs is unknown and unpredictable. In certain embodiments, potential IRES sequences can be bioinformatically identified based on sequence positions in viral sequences. However, the activity of such sequences has been previously uncharacterized. As demonstrated herein, such IRES sequences may have differing protein expression capability depending on cell type, for example in T cells, liver cells, or muscle cells. In some embodiments, the novel IRES sequences described herein may have at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, or 100 fold increased expression in a particular cell type compared to previously described EMCV IRES sequences.

[0367] In some embodiments, for driving protein expression, a polynucleotide (e.g., a DNA template, a linear precursor RNA polynucleotide, or a circular RNA polynucleotide) comprises an IRES operably linked to a protein coding sequence. In some embodiments, the IRES comprises a sequence selected from the sequences in Table 4 or a fragment thereof or a sequence from PCT / US2022 / 033091 or PCT / US2023 / 084046. In some embodiments, the IRES comprises a sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to a sequence selected from the sequences in Table 4 or a fragment thereof or a sequence from PCT / US2022 / 033091 or PCT / US2023 / 084046.

[0368] In some embodiments, the IRES is derived from Aalivirus, Ailurivirus, Ampivirus, Anativirus, Aphthovirus, Aquamavirus, Avihepatovirus, Avisivirus, Boosepivirus, Bopivirus, Caecilivirus, Cardiovirus, Cosavirus, Crahelivirus, Crohivirus, Danipivirus, Dicipivirus, Diresapivirus, Enterovirus, Erbovirus, Felipivirus, Fipivirus, Gallivirus, Gruhelivirus, Grusopivirus, Harkavirus, Hemipivirus, Hepatovirus, Hunnivirus, Kobuvirus, Kunsagivirus, Limnipivirus, Livupivirus, Ludopivirus, Malagasivirus, Marsupivirus, Megrivirus, Mischivirus, Mosavirus, Mupivirus, Myrropivirus, Orivirus, Oscivirus, Parabovirus, Parechovirus, Pasivirus, Passerivirus, Pemapivirus, Poecivirus, Potamipivirus, Pygoscepivirus, Rabovirus, Rafivirus, Rajidapivirus, Rohelivirus, Rosavirus, Sakobuvirus, Salivirus, Sapelovirus, Senecavirus, Shanbavirus, Sicinivirus, Symapivirus, Teschovirus, Torchivirus, Tottorivirus, Tremovirus, Tropivirus, Hepacivirus, Pegivirus, Pestivirus, or Flavivirus. In some embodiments herein, the IRES is selected from an Enterovirus, Kobuvirus, Parechovirus, Hunnivirus, Passerivirus, Mischivirus, and Cardiovirus.

[0369] In some embodiments, the IRES is an IRES sequence derived from Taura syndrome virus, Triatoma virus, Theiler's encephalomyelitis virus, Simian Virus 40, Solenopsis invicta virus 1, Rhopalosiphum padi virus, Reticuloendotheliosis virus, Human poliovirus 1, Plautia stali intestine virus, Kashmir bee virus, Human rhinovirus 2, Homalodisca coagulata virus- 1, Human Immunodeficiency Virus type 1, Himetobi P virus, Hepatitis C virus, Hepatitis A virus,Hepatitis GB virus, Foot and mouth disease virus, Human enterovirus 71, Equine rhinitis virus, Ectropis obliqua picorna-like virus, Encephalomyocarditis virus, Drosophila C Virus, Human coxsackievirus B3, Crucifer tobamovirus, Cricket paralysis virus, Bovine viral diarrhea virus 1, Black Queen Cell Virus, Aphid lethal paralysis virus, Avian encephalomyelitis virus, Acute bee paralysis virus, Hibiscus chlorotic ringspot virus, Classical swine fever virus, Human FGF2, Human SFTPA1, Human AML1 / RUNX1, Drosophila antennapedia, Human AQP4, Human AT1R, Human BAG-1, Human BCL2, Human BiP, Human c-IAPl, Human c-myc, Human eIF4G, Mouse NDST4L, Human LEF1, Mouse HIF1 alpha, Human n.myc, Mouse Gtx, Human p27kipl, Human PDGF2 / c-sis, Human p53, Human Pim-1, Mouse Rbm3, Drosophila reaper, Canine Scamper, Drosophila Ubx, Human UNR, Mouse UtrA, Human VEGF-A, Human XIAP, Drosophila hairless, S. cerevisiae TFIID, S. cerevisiae YAP1, tobacco etch virus, turnip crinkle virus, EMCV-A, EMCV-B, EMCV-Bf, EMCV-Cf, EMCV pEC9, Picobirnavirus, HCV QC64, Human Cosavirus E / D, Human Cosavirus F, Human Cosavirus JMY, Rhinovirus NAT001, HRV14, HRV89, HRVC-02, HRV-A21, Salivirus A SH1, Salivirus FHB, Salivirus NG-J1, Human Parechovirus 1, Crohivirus B, Yc-3, Rosavirus M-7, Shanbavirus A, Pasivirus A, Pasivirus A 2, Echovirus E14, Human Parechovirus 5, Aichi Virus, Hepatitis A Virus HA16, Phopivirus, CVA10, Enterovirus C, Enterovirus D, Enterovirus J, Human Pegivirus 2, GBV-C GT110, GBV-C K1737, GBV-C Iowa, Pegivirus A 1220, Pasivirus A 3, Sapelovirus, Rosavirus B, Bakunsa Virus, Tremovirus A, Swine Pasivirus 1, PLV-CHN, Pasivirus A, Sicinivirus, Hepacivirus K, Hepacivirus A, BVDV1, Border Disease Virus, BVDV2, CSFV-PK15C, SF573 Dicistrovirus, Hubei Picorna-like Virus, CRPV, Salivirus A BN5, Salivirus A BN2, Salivirus A 02394, Salivirus A GUT, Salivirus A CH, Salivirus A SZ1, Salivirus FHB, CVB3, CVB1, Echovirus 7, CVB5, EVA71, CVA3, CVA12, EV24, or an aptamer to eIF4G.

[0370] In some embodiments, the IRES comprises in whole or in part a eukaryotic or cellular IRES. In certain embodiments, the IRES is an IRES sequence derived from a human gene, wherein the human gene is ABCF1, ABCG1, ACAD10, ACOT7, ACSS3, ACTG2, ADCYAP1, ADK, AGTR1, AHCYL2, AHI1, AKAP8L, AKR1A1, ALDH3A1, ALDOA, ALG13, AMMECR1L, ANGPTL4, ANK3, AOC3, AP4B1, AP4E1, APAF1, APBB1, APC, APH1A, APOBEC3D, APOM, APP, AQP4, ARHGAP36, ARL13B, ARMC8, ARMCX6, ARPC1A, ARPC2, ARRDC3, ASAP1, ASB3, ASB5, ASCL1, ASMTL, ATF2, ATF3, ATG4A, ATP5B, ATP6V0A1, ATXN3, AURKA, AURKA, AURKA, AURKA, B3GALNT1, B3GNTL1, B4GALT3, BAAT, BAG1, BAIAP2, BAIAP2L2, BAZ2A, BBX, BCAR1, BCL2, BCS1L, BET1, BID, BIRC2, BPGM, BPIFA2, BRINP2, BSG, BTN3A2, C12orf43, C14orf93,C17orf62, C1orf226, C21orf62, C2orf15, C4BPB, C4orf22, C9orf84, CACNA1A, CALCOCO2, CAPN11, CASP12, CASP8AP2, CAV1, CBX5, CCDC120, CCDC17, CCDC186, CCDC51, CCN1, CCND1, CCNT1, CD2BP2, CD9, CDC25C, CDC42, CDC7, CDCA7L, CDIP1, CDK1, CDK11A, CDKN1B, CEACAM7, CEP295NL, CFLAR, CHCHD7, CHIA, CHIC1, CHMP2A, CHRNA2, CLCN3, CLEC12A, CLEC7A, CLECL1, CLRN1, CMSS1, CNIH1, CNR1, CNTN5, COG4, COMMD1, COMMD5, CPEB1, CPS1, CRACR2B, CRBN, CREM, CRYBG1, CSDE1, CSF2RA, CSNK2A1, CSTF3, CTCFL, CTH, CTNNA3, CTNNB1, CTNNB1, CTNND1, CTSL, CUTA, CXCR5, CYB5R3, CYP24A1, CYP3A5, DAG1, DAP3, DAP5, DAXX, DCAF4, DCAF7, DCLRE1A, DCP1A, DCTN1, DCTN2, DDX19B, DDX46, DEFB123, DGKA, DGKD, DHRS4, DHX15, DIO3, DLG1, DLL4, DMD UTR, DMD ex5, DMKN, DNAH6, DNAL4, DUSP13, DUSP19, DYNC1I2, DYNLRB2, DYRK1A, ECI2, ECT2, EIF1AD, EIF2B4, EIF4G1, EIF4G2, EIF4G3, ELANE, ELOVL6, ELP5, EMCN, ENO1, EPB41, ERMN, ERVV-1, ESRRG, ETFB, ETFBKMT, ETV1, ETV4, EXD1, EXT1, EZH2, FAM111B, FAM157A, FAM213A, FBXO25, FBXO9, FBXW7, FCMR, FGF1, FGF1, FGF1A, FGF2, FGF2, FGF-9, FHL5, FMR1, FN1, FOXP1, FTH1, FUBP1, G3BP1, GABBR1, GALC, GART, GAS7, gastrin, GATA1, GATA4, GFM2, GHR, GJB2, GLI1, GLRA2, GMNN, GPAT3, GPATCH3, GPR137, GPR34, GPR55, GPR89A, GPRASP1, GRAP2, GSDMB, GSTO2, GTF2B, GTF2H4, GUCY1B2, HAX1, HCST, HIGD1A, HIGD1B, HIPK1, HIST1H1C, HIST1H3H, HK1, HLA-DRB4, HMBS, HMGA1, HNRNPC, HOPX, HOXA2, HOXA3, HPCAL1, HR, HSP90AB1, HSPA1A, HSPA4L, HSPA5, HYPK, IFFO1, IFT74, IFT81, IGF1, IGF1R, IGF1R, IGF2, IL11, IL17RE, IL1RL1, IL1RN, IL32, IL6, ILF2, ILVBL, INSR, INTS13, IP6K1, ITGA4, ITGAE, KCNE4, KERA, KIAA0355, KIAA0895L, KIAA1324, KIAA1522, KIAA1683, KIF2C, KIZ, KLHL31, KLK7, KRR1, KRT14, KRT17, KRT33A, KRT6A, KRTAP10-2, KRTAP13-3, KRTAP13-4, KRTAP5-11, KRTCAP2, LACRT, LAMB1, LAMB3, LANCL1, LBX2, LCAT, LDHA, LDHAL6A, LEF1, LINC-PINT, LMO3, LRRC4C, LRRC7, LRTOMT, LSM5, LTB4R, LYRM1, LYRM2, MAGEA11, MAGEA8, MAGEB1, MAGEB16, MAGEB3, MAPT, MARS, MC1R, MCCC1, METTL12, METTL7A, MGC16025, MGC16025, MIA2, MIA2, MITF, MKLN1, MNT, MORF4L2, MPD6, MRFAP1, MRPL21, MRPS12, MSI2, MSLN, MSN, MT2A, MTFR1L, MTMR2, MTRR, MTUS1, MYB, MYC, MYCL, MYCN, MYL10, MYL3, MYLK, MYO1A, MYT2, MZB1, NAP1L1, NAV1, NBAS, NCF2, NDRG1, NDST2, NDUFA7, NDUFB11, NDUFC1, NDUFS1, NEDD4L, NFAT5, NFE2L2, NFE2L2, NFIA, NHEJ1, NHP2, NIT1, NKRF, NME1-NME2, NPAT, NR3C1, NRBF2, NRF1, NTRK2, NUDCD1, NXF2, NXT2, ODC1, ODF2, OPTN, OR10R2, OR11L1, OR2M2, OR2M3,OR2M5, OR2T10, OR4C15, OR4F17, OR4F5, OR5H1, OR5K1, OR6C3, OR6C75, OR6N1, OR7G2, p53, P2RY4, PAN2, PAQR6, PARP4, PARP9, PC, ...

Claims

1. CLAIMS 1. A circular RNA comprising: a. a translation initiation element comprising a sequence that is at least 80% identical to a sequence selected from Table 4 or Table 5 or a functional fragment thereof, and b. at least one expression sequence encoding a BCMA binding molecule that is at least 80% identical to a sequence selected from Table 5, Table 9, or Table 10 or a functional fragment thereof.

2. The RNA of claim 1, wherein the translation initiation element comprises an internal ribosome entry site (IRES).

3. The RNA of claim 1 or 2, wherein the translation initiation element comprises a sequence that is at least 90% identical to the sequence selected from Table 4 or Table 5 or a functional fragment thereof.

4. The RNA of any one of claims 1-3, wherein the translation initiation element comprises a sequence that is at least 95% identical to the sequence selected from Table 4 or Table 5 or a functional fragment thereof 5. The RNA of any one of claims 1-4, comprising in the following order: a. a 3ʹ self-spliced exon segment; b. the translation initiation element; c. the at least one expression sequence encoding a BCMA binding molecule; and d. a 5ʹ self-spliced exon segment.

6. The RNA of claim 5, wherein the 3’ self-spliced exon segment is a Group I or Group II self-spliced exon segment, and / or the 5’ self-spliced exon segment is a Group I or Group II self-spliced exon segment.

7. The RNA of any one of claims 1-6, further comprising a 5’ internal duplex and / or a 3’ internal duplex.

8. The RNA of any one of claims 1-7, further comprising a 5’ internal spacer and / or a 3’ internal spacer.

9. The RNA of any one of claims 1-8, wherein the circular RNA is 50 nucleotides to 15 kilobases in length.

10. A linear RNA comprising at least one expression sequence encoding a BCMA binding molecule that is at least 80% identical to a sequence selected from Table 5, Table 9, or Table 10, or a functional fragment thereof.

11. The RNA of any one of claims 1-10, wherein the functional fragment of the BCMA binding molecule comprises a first complementary determining region (CDR1), a second complementary determining region (CDR2), and a third complementary determining region (CDR3) selected from Table 5, Table 9, or Table 10.

12. The RNA of any one of claims 1-11, wherein the BCMA binding molecule is a sdAb or a scFv.

13. The RNA of any one of claims 1-11, wherein the BCMA binding molecule is a nanobody or a VHH.

14. The RNA of any one of claims 1-13, wherein the BCMA binding molecule is a CAR.

15. The RNA of claim 14, wherein the CAR comprises a CD28 or 4-1BB costimulatory domain.

16. The RNA of any one of claims 1-15, comprising at least one modified A, C, G, or U nucleotide or nucleoside.

17. The RNA of any one of claims 1-16, wherein the modified nucleotide or nucleoside: a) is selected from one or more of m5U (5-methyluridine); m6A (N6-methyladenosine); s2U (2-thiouridine); Ψ (pseudouridine); Um (2′-O-methyluridine); m1A (1- methyladenosine); m2A (2-methyladenosine); Am (2’-O-methyladenosine); ms2m6A (2-methylthio-N6-methyladenosine); i6A (N6-isopentenyladenosine); ms2i6A (2- methylthio-N6isopentenyladenosine); io6A (N6-(cis-hydroxyisopentenyl)adenosine); ms2io6A (2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine); g6A (N6- glycinylcarbamoyladenosine); t6A (N6-threonylcarbamoyladenosine); ms2t6A (2- methylthio-N6-threonyl carbamoyladenosine); m6t6A (N6-methyl-N6- threonylcarbamoyladenosine); hn6A(N6-hydroxynorvalylcarbamoyladenosine); ms2hn6A (2-methylthio-N6-hydroxynorvalyl carbamoyladenosine); Ar(p) (2’-O- ribosyladenosine (phosphate)); I (inosine); m1I (1-methylinosine); m1Im (1,2’-O- dimethylinosine); m3C (3-methylcytidine); Cm (2’-O-methylcytidine); s2C (2- thiocytidine); ac4C (N4-acetylcytidine); f5C (5-formylcytidine); m5Cm (5,2′-O- dimethylcytidine); ac4Cm (N4-acetyl-2’-O-methylcytidine); k2C (lysidine); m1G (1- methylguanosine); m2G (N2-methylguanosine); m7G (7-methylguanosine); Gm (2′-O- methylguanosine); m22G (N2,N2-dimethylguanosine); m2Gm (N2,2’-O- dimethylguanosine); m22Gm (N2,N2,2’-O-trimethylguanosine); Gr(p) (2’-O- ribosylguanosine(phosphate)); yW (wybutosine); o2yW (peroxywybutosine); OHyW (hydroxywybutosine); OHyW* (undermodified hydroxywybutosine); imG (wyosine); mimG (methylwyosine); Q (queuosine); oQ (epoxyqueuosine); galQ (galactosyl-queuosine); manQ (mannosyl-queuosine); preQ0(7-cyano-7-deazaguanosine); preQ1(7-aminomethyl-7-deazaguanosine); G+(archaeosine); D (dihydrouridine); m5Um (5,2’-O-dimethyluridine); s4U (4-thiouridine); m5s2U (5-methyl-2-thiouridine); s2Um (2-thio-2’-O-methyluridine); acp3U (3-(3-amino-3-carboxypropyl)uridine); ho5U (5-hydroxyuridine); mo5U (5-methoxyuridine); cmo5U (uridine 5-oxyacetic acid); mcmo5U (uridine 5-oxyacetic acid methyl ester); chm5U (5- (carboxyhydroxymethyl)uridine)); mchm5U (5-(carboxyhydroxymethyl)uridine methyl ester); mcm5U (5-methoxycarbonylmethyluridine); mcm5Um (5- methoxycarbonylmethyl-2’-O-methyluridine); mcm5s2U (5-methoxycarbonylmethyl- 2-thiouridine); nm5S2U (5-aminomethyl-2-thiouridine); mnm5U (5- methylaminomethyluridine); mnm5s2U (5-methylaminomethyl-2-thiouridine); mnm5se2U (5-methylaminomethyl-2-selenouridine); ncm5U (5- carbamoylmethyluridine); ncm5Um (5-carbamoylmethyl-2′-O-methyluridine); cmnm5U (5-carboxymethylaminomethyluridine); cmnm5Um (5- carboxymethylaminomethyl-2′-O-methyluridine); cmnm5s2U (5- carboxymethylaminomethyl-2-thiouridine); m62A (N6,N6-dimethyladenosine); Im (2’-O-methylinosine); m4C (N4-methylcytidine); m4Cm (N4,2’-O-dimethylcytidine); hm5C (5-hydroxymethylcytidine); m3U (3-methyluridine); cm5U (5- carboxymethyluridine); m6Am (N6,2’-O-dimethyladenosine); m62Am (N6,N6,O-2’- trimethyladenosine); m2,7G (N2,7-dimethylguanosine); m2,2,7G (N2,N2,7- trimethylguanosine); m3Um (3,2’-O-dimethyluridine); m5D (5-methyldihydrouridine); f5Cm (5-formyl-2’-O-methylcytidine); m1Gm (1,2’-O-dimethylguanosine); m1Am (1,2’-O-dimethyladenosine); τm5U (5-taurinomethyluridine); τm5s2U (5- taurinomethyl-2-thiouridine)); imG-14 (4-demethylwyosine); imG2 (isowyosine); or ac6A (N6-acetyladenosine); pyridin-4-one ribonucleoside, 5-aza-uridine, 2-thio-5-aza- uridine, 2-thiouridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxyuridine, 3-methyluridine, 5-carboxymethyl-uridine, 1-carboxymethyl-pseudouridine, 5- propynyl-uridine, 1-propynyl-pseudouridine, 5-taurinomethyluridine, 1- taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uridine, 1-taurinomethyl-4-thio- uridine, 5-methyl-uridine, 1-methyl-pseudouridine, 4-thio-1-methyl-pseudouridine, 2- thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1- deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 2-thio-dihydrouridine, 2- thio-dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy- pseudouridine, 4-m ethoxy-2-thio-pseudouridine, 5-aza-cytidine, pseudoisocytidine,3-methyl-cytidine, N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5- hydroxymethylcytidine, 1-methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo- pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio- pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-1-deaza- pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4-methoxy-1-methyl- pseudoisocytidine, 2-aminopurine, 2, 6-diaminopurine, 7-deaza-adenine, 7-deaza-8- aza-adenine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2-aminopurine, 7-deaza-2,6- diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyladenosine, N6- methyladenosine, N6-isopentenyladenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl) adenosine, N6- glycinylcarbamoyladenosine, N6-threonylcarbamoyladenosine, 2-methylthio-N6- threonyl carbamoyladenosine, N6,N6-dimethyladenosine, 7-methyladenine, 2- methylthio-adenine, 2-methoxy-adenine, inosine, 1-methyl-inosine, wyosine, wybutosine, 7-deaza-guanosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7- deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7- methyl-guanosine, 7-methylinosine, 6-methoxy-guanosine, 1-methylguanosine, N2- methylguanosine, N2,N2-dimethylguanosine, 8-oxo-guanosine, 7-methyl-8-oxo- guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, N1- methylpseudouridine, and N2,N2-dimethyl-6-thio-guanosine; or b) is selected from one or more of: 5-propynyluridine, 5-propynylcytidine, 6- methyladenine, 6-methylguanine, N,N,-dimethyladenine, 2-propyladenine, 2- propylguanine, 2-aminoadenine, 1-methylinosine, 3-methyluridine, 5- methylcytidine, 5-methyluridine, 5-(2-amino)propyl uridine, 5- halocytidine, 5- halouridine, 4-acetylcytidine, 1-methyladenosine, 2-methyladenosine, 3- methyicytidine, 6-methyluridine, 2-methylguanosine, 7-methylguanosine, 2,2- dimethylguanosine, 5-methylaminoethyluridine, 5-methyloxyuridine, 7-deaza- adenosine, 6- azouridine, 6-azocytidine, 6-azothymidine, 5-methyl-2-thiouridine, 2-thiouridine, 4- thiouridine, 2-thiocytidine, dihydrouridine, pseudouridine, queuosine, archaeosine, naphthyl substituted naphthyl groups, an O- and N- alkylated purines and pyrimidines, N6- methyladenosine, 5- methylcarbonylmethyluridine, uridine 5-oxyacetic acid, pyridine-4-one, pyridine- 2-one, aminophenol, 2,4,6-trimethoxy benzene, modified cytosines that act as G-clamp nucleotides, 8-substituted adenines and guanines, 5-substituted uracils and thymines, azapyrimidines, carboxyhydroxyalkyl nucleotides, carboxyalkylaminoalkyl nucleotides, N1-methylpseudouridine, and alkylcarbonylalkylated nucleotides; or c) is selected from one or more of: 5-methylcytidine, 5-methoxyuridine, 1-methyl- pseudouridine, N6-methyladenosine, pseudouridine, and combinations thereof.

18. A pharmaceutical composition comprising: a. the RNA of any one of claims 1-17; and b. a lipid nanoparticle comprising: i. one or more ionizable lipids; ii. one or more phospholipids, in an amount of about 20 mol% to about 60 mol% of the total lipid content of the lipid nanoparticle; iii. one or more structural lipids; and iv. one or more PEG lipids.

19. The pharmaceutical composition of claim 18, wherein the lipid nanoparticle comprises about 25 mol% to about 45 mol% of the one or more ionizable lipids, as a proportion of the total lipid content of the lipid nanoparticle.

20. The pharmaceutical composition of claim 18 or 19, wherein the lipid nanoparticle comprises about 15 mol% to about 35 mol% of the one or more structural lipids, as a proportion of the total lipid content of the lipid nanoparticle.

21. The pharmaceutical composition of any one of claims 18-20, wherein the lipid nanoparticle comprises about 1 mol% to about 3 mol% of the one or more PEG lipids, as a proportion of the total lipid content of the lipid nanoparticle.

22. The pharmaceutical composition of any one of claims 18-21, wherein the lipid nanoparticle comprises (a) about 1 mol% to about 3 mol% of the one or more PEG lipids; (b) about 15 mol% to about 35 mol% of the one or more structural lipids; (c) about 30 mol% to about 60 mol% of the one or more phospholipids; and (d) about 25 mol% to about 45 mol% of the one or more ionizable lipids.

23. The pharmaceutical composition of any one of claims 18-22, wherein the lipid nanoparticle comprises (a) about 1.5 mol% to about 2.5 mol% of the one or more PEG lipids; (b) about 20 mol% to about 30 mol% of the one or more structural lipids; (c) about 35 mol% to about 45 mol% of the one or more phospholipids; and (d) about 28 mol% to about 40 mol% of the one or more ionizable lipids.

24. The pharmaceutical composition of any one of claims 18-23, wherein the one or more ionizable lipids comprises a compound selected from those depicted in any one of Tables (I- A), (I-B), (I-C), (I-D), (I-E), (I-F), (I-G), (I-H), (I-I), (I-J), (I-K), or (I-L), an enantiomer thereof, or any mixture of enantiomers thereof, or a pharmaceutically acceptable salt of any such compound.

25. The pharmaceutical composition of any one of claims 18-23, wherein the one or more ionizable lipids comprises a compound of Formula (AX)or a pharmaceutically acceptable salt thereof, wherein: A is selected from an optionally substituted bridged carbocyclic or heterocyclic core selectedfn is and integer selected from 1 or 2; R1is selected from the group consisting of -OH, -OAc, -NR2,, , , ,each R is independently -H or C1-C6aliphatic; X1and XAare each independently a bond or optionally substituted C1-C6 aliphatic; Y1is selected from the group consisting of, , , , , , ,, and bond; wherein the bond marked with an "*" is attached to X1;each X2and X3is independently a bond or optionally substituted C1-C12aliphatic; each Y2and Y3is independently selected from the group consisting of; wherein the bond marked with an "*" is attached to X2or X3; each X4and X5is independently optionally substituted C1-C6 aliphatic; R2is -CH(OR6)(OR7), -CH(SR6)(SR7), -CH(R6)(R7), -R10, optionally substituted C5-C18 aliphatic, or optionally substituted C1-C14 aliphatic-R10, wherein one or more methylene linkages of R2are each optionally and independently replaced with an optionally substituted C3-C8cycloalkylenyl, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)-, or -C(O)O-; each R3is independently -CH(OR8)(OR9), -CH(SR8)(SR9), -CH(R8)(R9), -R11, optionally substituted C5-C18 aliphatic, or optionally substituted C1-C14 aliphatic-R11, wherein one or more methylene linkages of R3are each optionally and independently replaced with an optionally substituted C3-C8 cycloalkylenyl, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)-, or -C(O)O-; R6and R7are each independently optionally substituted -C1-C14 aliphatic, -R10, or optionally substituted -C1-C14aliphatic-R10; wherein one or more methylene linkages of R6and R7are each optionally and independently replaced with an optionally substituted C3-C8 cycloalkylenyl, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)-, or - C(O)O-; R8and R9are each independently optionally substituted -C1-C14 aliphatic, -R11, or optionally substituted -C1-C14aliphatic-R11; wherein one or more methylene linkages of R8and R9are each optionally and independently replaced with an optionally substituted C3-C8 cycloalkylenyl, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)-, or - C(O)O-; each R10and R11is independently an optionally substituted cylic, bicyclic, bridged bicyclic, multicyclic or bridged multicyclic C4-C14 cycloalkyl or optionally substituted cylic, bicyclic, bridged bicyclic, multicyclic or bridged multicyclic 4-14 membered heterocyclyl, or two R10or two R11taken together form an optionally substituted bridged bicyclic or multicyclic C4- C14 cycloalkyl or optionally substituted bridged bicyclic or multicyclic 4-14 membered heterocyclyl.

26. The pharmaceutical composition of any one of claims 18-25, wherein the one or more phospholipids are selected from 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2- dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-dilinoleoyl-sn-glycero-3- phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1.2-dioleoyl- sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn- glycero-3-phosphocho line (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 Diether PC), 1-oleoyl-2-cholesterylhemisuc cinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dilinolenoyl-sn- glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2- didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-diphytanoylsn-glycero-3- phosphoethanolamine (ME 16.0 PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2- dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3- phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2- didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho- rac-(1-glycerol) sodium salt (DOPG), sodium (S)-2-ammonio-3-((((R)-2-(oleoyloxy)-3- (stearoyloxy)propoxy)oxidophosphoryl)oxy)propanoate (L-α-phosphatidylserine; Brain PS), dimyristoyl phosphatidylcholine (DMPC), dimyristoyl phosphoethanolamine (DMPE), dimyristoylphosphatidylglycerol (DMPG), dioleoyl-phosphatidylethanolamine4-(N- maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dioleoylphosphatidylglycerol (DOPG), 1,2-dioleoyl-sn-glycero-3-(phospho-L-serine) (DOPS), acell-fusogenicphospholipid (DPhPE), dipalmitoylphosphatidylethanolamine (DPPE), 1,2-Dielaidoyl-sn- phosphatidylethanolamine (DEPE), dipalmitoylphosphatidylglycerol (DPPG), dipalmitoylphosphatidylserine (DPPS), distearoyl-phosphatidyl-ethanolamine (DSPE), distearoyl phosphoethanolamineimidazole (DSPEI), 1,2-diundecanoyl-sn-glycero- phosphocholine (DUPC), egg phosphatidylcholine (EPC), 1,2-dioleoyl-sn-glycero-3- phosphate (18:1 PA; DOPA), ammonium bis((S)-2-hydroxy-3-(oleoyloxy)propyl) phosphate (18:1 DMP; LBPA), 1,2-dioleoyl-sn-glycero-3-phospho-(1’-myo-inositol) (DOPI; 18:1 PI), 1,2-distearoyl-sn-glycero-3-phospho-L-serine (18:0 PS), 1,2-dilinoleoyl-sn-glycero-3- phospho-L-serine (18:2 PS), 1-palmitoyl-2-oleoyl-sn-glycero-3-phospho-L-serine (16:0-18:1 PS; POPS), 1-stearoyl-2-oleoyl-sn-glycero-3-phospho-L-serine (18:0-18:1 PS), 1-stearoyl-2- linoleoyl-sn-glycero-3-phospho-L-serine (18:0-18:2 PS), 1-oleoyl-2-hydroxy-sn-glycero-3- phospho-L-serine (18:1 Lyso PS), 1-stearoyl-2-hydroxy-sn-glycero-3-phospho-L-serine (18:0Lyso PS), and sphingomyelin, or combinations of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 of the above phospholipids.

27. The pharmaceutical composition of any one of claims 18-25, wherein the one or more phospholipids are selected from DSPC and egg sphingomyelin, or a combination thereof.

28. The pharmaceutical composition of any one of claims 18-25, wherein the one or more phospholipids comprises 16:0 SM (N-palmitoyl-D-erythro-sphingosylphosphorylcholine).

29. The pharmaceutical composition of any one of claims 18-25, wherein the one or more phospholipids comprises one or more selected from phosphatidylcholine, phosphatidylserine, phosphoethanolamine, and sphingoid lipids or a combination thereof.

30. The pharmaceutical composition of any one of claims 18-25, wherein the one or more phospholipids comprises 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), sphingomyelin or a combination thereof.

31. The pharmaceutical composition of any one of claims 18-29, wherein the one or more phospholipids comprises two or more phospholipids, such that no single phospholipid makes up more than 30 mol% of the total lipid content of the nanoparticle.

32. The pharmaceutical composition of any one of claims 18- 29, wherein the lipid nanoparticle comprises about 40 mol% 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC).

33. The pharmaceutical composition of any one of claims 18- 29, wherein the lipid nanoparticle comprises about 40 mol% sphingomyelin.

34. The pharmaceutical composition of any one of claims 18-33, wherein the one or more structural lipids are selected from cholesterol, fecosterol, fucosterol, beta sitosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, cholic acid, sitostanol, litocholic acid, tomatine, ursolic acid, alpha-tocopherol, Vitamin D3, Vitamin D2, Calcipotriol, botulin, lupeol, oleanolic acid, beta-sitosterol-acetate and any combinations thereof.

35. The pharmaceutical composition of any one of claims 18-34, wherein the one or more structural lipids comprises cholesterol.

36. The pharmaceutical composition of any one of claims 18-35, wherein the one or more PEG lipids is selected from DMG-PEG2k, DSPE-PEG2k, DSG-PEG2k, DMPE-PEG2k, DPPE-PEG2k and mixtures thereof.

37. The pharmaceutical composition of any one of claims 18-35, wherein the one or more PEG lipids is a lipid of Formula (P1-a):wherein r is an integer from 35 to 55, inclusive.

38. The pharmaceutical composition of any one of claims 18-35, wherein the phospholipid is sphingomyelin, the structural lipid is cholesterol, and the PEG lipid is DMG- PEG2k.

39. The pharmaceutical composition of any one of claims 18-27, wherein the ionizable lipid is a compound of Formula (AX), the phospholipid is sphingomyelin, the structural lipid is cholesterol, and the PEG lipid is DMG-PEG2k.

40. The pharmaceutical composition of any one of claims 18-29, wherein the lipid nanoparticle comprises (a) about 1 mol% to about 3 mol% of DMG-PEG2k; (b) about 15 mol% to about 35 mol% cholesterol; (c) about 30 mol% to about 60 mol% sphingomyelin; and (d) about 25 mol% to about 45 mol% of the one or more ionizable lipids.

41. The pharmaceutical composition of any one of claims 18-29, wherein the lipid nanoparticle comprises (a) about 1 mol% to about 3 mol% of DMG-PEG2k; (b) about 15 mol% to about 35 mol% cholesterol; (c) about 30 mol% to about 60 mol% sphingomyelin; and (d) about 25 mol% to about 45 mol% of an ionizable lipid of Formula (AX).

42. The pharmaceutical composition of any one of claims 18-29, wherein the lipid nanoparticle comprises (a) about 1.5 mol% to about 2.5 mol% of DMG-PEG2k; (b) about 20 mol% to about 30 mol% cholesterol; (c) about 35 mol% to about 45 mol% sphingomyelin; and (d) about 28 mol% to about 40 mol% of the one or more ionizable lipids.

43. The pharmaceutical composition of any one of claims 18-29, wherein the lipid nanoparticle comprises (a) about 1.5 mol% to about 2.5 mol% of DMG-PEG2k; (b) about 20 mol% to about 30 mol% cholesterol; (c) about 35 mol% to about 45 mol% sphingomyelin; and (d) about 28 mol% to about 40 mol% of an ionizable lipid of Formula (AX).

44. The pharmaceutical composition of any one of claims 18-29, wherein the lipid nanoparticle comprises (a) about 2 mol% of DMG-PEG2k; (b) about 25 mol% cholesterol; (c) about 40 mol% sphingomyelin; and (d) about 33 mol% of an ionizable lipid of Formula (AX).

45. The pharmaceutical composition of any one of claims 18-29, wherein the lipid nanoparticle comprises (a) about 2 mol% of DMG-PEG2k; (b) about 25 mol% cholesterol; (c) about 40 mol% sphingomyelin; and (d) about 33 mol% of the one or more ionizable lipids.

46. The pharmaceutical composition of any one of claims 18-22 and 24-29, wherein the lipid nanoparticle comprises (a) about 1 mol% to about 3 mol% of DMG-PEG2k; (b) about 15 mol% to about 35 mol% cholesterol; (c) about 30 mol% to about 60 mol% DSPC; and (d) about 25 mol% to about 45 mol% of the one or more ionizable lipids.

47. The pharmaceutical composition of any one of claims 18-22 and 24-29, wherein the lipid nanoparticle comprises (a) about 1 mol% to about 3 mol% of DMG-PEG2k; (b) about 15 mol% to about 35 mol% cholesterol; (c) about 30 mol% to about 60 mol% DSPC; and (d) about 25 mol% to about 45 mol% of an ionizable lipid of Formula (AX).

48. The pharmaceutical composition of any one of claims 18-29, wherein the lipid nanoparticle comprises (a) about 1.5 mol% to about 2.5 mol% of DMG-PEG2k; (b) about 20 mol% to about 30 mol% cholesterol; (c) about 35 mol% to about 45 mol% DSPC; and (d) about 28 mol% to about 40 mol% of the one or more ionizable lipids.

49. The pharmaceutical composition of any one of claims 18-29, wherein the lipid nanoparticle comprises (a) about 1.5 mol% to about 2.5 mol% of DMG-PEG2k; (b) about 20 mol% to about 30 mol% cholesterol; (c) about 35 mol% to about 45 mol% DSPC; and (d) about 28 mol% to about 40 mol% of an ionizable lipid of Formula (AX).

50. The pharmaceutical composition of any one of claims 18-29, wherein the lipid nanoparticle comprises (a) about 2 mol% of DMG-PEG2k; (b) about 25 mol% cholesterol; (c) about 40 mol% DSPC; and (d) about 33 mol% of an ionizable lipid of Formula (AX).

51. The pharmaceutical composition of any one of claims 18-29 and 32, wherein the one or more phospholipids comprises a mixture of sphingomyelin and DSPC, the structural lipid is cholesterol, and the PEG lipid is DMG-PEG2k.

52. The pharmaceutical composition of any one of claims 18-29 and 32, wherein the ionizable lipid of Formula (AX), the one or more phospholipids comprise a mixture of sphingomyelin and DSPC, the structural lipid is cholesterol, and the PEG lipid is DMG- PEG2k.

53. The pharmaceutical composition of any one of claims 18-22, 24-29 and 32, wherein the lipid nanoparticle comprises (a) about 1 mol% to about 3 mol% of DMG-PEG2k; (b) about 15 mol% to about 35 mol% cholesterol; (c) about 30 mol% to about 60 mol% of a combination of sphingomyelin and DSPC; and (d) about 25 mol% to about 45 mol% of the one or more ionizable lipids.

54. The pharmaceutical composition of any one of claims 18-22, 24-29 and 32, wherein the lipid nanoparticle comprises (a) about 1 mol% to about 3 mol% of DMG-PEG2k; (b) about 15 mol% to about 35 mol% cholesterol; (c) about 30 mol% to about 60 mol% of acombination of sphingomyelin and DSPC; and (d) about 25 mol% to about 45 mol% of an ionizable lipid of Formula (AX).

55. The pharmaceutical composition of any one of claims 18-29 and 32, wherein the lipid nanoparticle comprises (a) about 1.5 mol% to about 2.5 mol% of DMG-PEG2k; (b) about 20 mol% to about 30 mol% cholesterol; (c) about 35 mol% to about 45 mol% of a combination of sphingomyelin and DSPC; and (d) about 28 mol% to about 40 mol% of the one or more ionizable lipids.

56. The pharmaceutical composition of any one of claims 18-29 and 32, wherein the lipid nanoparticle comprises (a) about 1.5 mol% to about 2.5 mol% of DMG-PEG2k; (b) about 20 mol% to about 30 mol% cholesterol; (c) about 35 mol% to about 45 mol% of a combination of sphingomyelin and DSPC; and (d) about 28 mol% to about 40 mol% of an ionizable lipid of Formula (AX).

57. The pharmaceutical composition of any one of claims 18-29 and 32, wherein the lipid nanoparticle comprises (a) about 2 mol% of DMG-PEG2k; (b) about 25 mol% cholesterol; (c) about 40 mol% of a combination of sphingomyelin and DSPC; and (d) about 33 mol% of an ionizable lipid of Formula (AX).

58. The pharmaceutical composition of any one of claims 18-29 and 32, wherein the lipid nanoparticle comprises (a) about 2 mol% of DMG-PEG2k; (b) about 25 mol% cholesterol; (c) about 40 mol% of a combination of sphingomyelin and DSPC; and (d) about 33 mol% of the one or more ionizable lipids.

59. The pharmaceutical composition of any one of claims 18-29, wherein the lipid nanoparticle comprises about 20 mol% 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC) and about 20 mol% sphingomyelin.

60. The pharmaceutical composition of claim 37, wherein the lipid nanoparticle comprises (a) about 1 mol% to about 3 mol% of Formula (P1-a); (b) about 15 mol% to about 35 mol% cholesterol; (c) about 20 mol% to about 50 mol% phospholipid; and (d) about 25 mol% to about 45 mol% of the one or more ionizable lipids.

61. The pharmaceutical composition of claim 37, wherein the lipid nanoparticle comprises (a) about 1 mol% to about 3 mol% of Formula (P1-a); (b) about 15 mol% to about 35 mol% cholesterol; (c) about 20 mol% to about 50 mol% phospholipid; and (d) about 25 mol% to about 45 mol% of an ionizable lipid of Formula (AX).

62. The pharmaceutical composition of claim 37, wherein the lipid nanoparticle comprises (a) about 1.5 mol% to about 2.5 mol% of Formula (P1-a); (b) about 20 mol% toabout 35 mol% cholesterol; (c) about 25 mol% to about 35 mol% phospholipid; and (d) about 28 mol% to about 40 mol% of the one or more ionizable lipids.

63. The pharmaceutical composition of claim 37, wherein the lipid nanoparticle comprises (a) about 1.5 mol% to about 2.5 mol% of Formula (P1-a); (b) about 20 mol% to about 35 mol% cholesterol; (c) about 25 mol% to about 35 mol% phospholipid; and (d) about 28 mol% to about 40 mol% of an ionizable lipid of Formula (AX).

64. The pharmaceutical composition of claim 37, wherein the lipid nanoparticle comprises (a) about 2 mol% of Formula (P1-a); (b) about 25 mol% cholesterol; (c) about 30 mol% phospholipid; and (d) about 38 mol% of an ionizable lipid of Formula (AX).

65. The pharmaceutical composition of claim 37, wherein the lipid nanoparticle comprises (a) about 2 mol% of Formula (P1-a); (b) about 30 mol% cholesterol; (c) about 30 mol% phospholipid; and (d) about 38 mol% of the one or more ionizable lipids.

66. The pharmaceutical composition of any one of claims 60-65, wherein the one or more phospholipid is 16:0 SM.

67. The pharmaceutical composition of any one of claims 60-65, wherein the one or more phospholipid is Egg Sphingomyelin.

68. The pharmaceutical composition of any one of claims 60-65, wherein the one or more phospholipid is DSPC.

69. The pharmaceutical composition of any one of claims 18-68, wherein the one or more ionizable lipids is compound AX-6.

70. A method of expressing CAR in an immune cell by administering the pharmaceutical composition of any one of claims 18-69.

71. A method of expressing CAR in a T cell by administering the pharmaceutical composition of any one of claims 18-69.

72. A method of expressing CAR in blood, optionally selected from whole blood or peripheral blood, by administering the pharmaceutical composition of any one of claims 18- 69.

73. A method of expressing CAR in spleen by administering the pharmaceutical composition of any one of claims 18-69.

74. A method of expressing CAR in bone marrow by administering the pharmaceutical composition of any one of claims 18-69.

75. A method of treating a subject in need thereof, comprising administering to the subject the pharmaceutical composition of any one of claims 18-69.

76. The pharmaceutical composition of any one of claims 18-69 for use as a medicament.

77. Use of a pharmaceutical composition of any one of claims 18-69 for the manufacture of a medicament for treatment of a disease or disorder in a subject in need thereof.

78. The method of claim 75, the pharmaceutical composition for use of claim 76 or the use of claim 77, wherein the subject’s B cell count is decreased post-treatment as compared to pre-treatment.

Citation Information

Patent Citations

  • Beta-secretase crystals and methods for preparing and using the same

    US20040014194A1

  • Circular rnas and their use in immunomodulation

    US20190345503A1

  • Genetic elements driving circular RNA translation and methods of use

    US20220251578A1

  • Circular RNA modification and methods of use

    US20220288176A1

  • Consumer product comprising a plurality of microcapsules defined by the mean total surface area

    US20230084046A1