Genetic elements
The gene expression cassette with specific enhancer sequences addresses the inefficiencies of eukaryotic protein expression, enhancing yields and reducing costs for biopharmaceutical and vaccine production by improving protein expression efficiency in mammalian cells.
Patent Information
- Application Number
- PCT/EP2025/078694
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-10-04
- Filing Date
- 2025-10-06
- Publication Date
- 2026-04-09
AI Technical Summary
Existing methods for eukaryotic protein expression are costly and inefficient, often resulting in low yields or no expression due to differences in post-translational processing and immunorecognition, making them unsuitable for biopharmaceutical and vaccine production.
A gene expression cassette comprising a promoter, open reading frame, and enhancer with specific nucleic acid sequences (SEQ ID NO: 1, 2, or 3) that enhance gene expression efficiency in eukaryotic cells, particularly mammalian cells, by increasing the yield of proteins of interest.
The enhanced gene expression cassette leads to increased yields of proteins, reducing costs and improving the efficiency of eukaryotic protein expression, especially for biopharmaceutical and vaccine production.
Smart Images

Figure EP2025078694_09042026_PF_FP_ABST
Abstract
Description
[0001] DARESBURY PROTEINS LTD.
[0002] GENETIC ELEMENTS
[0003] GENETIC ELEMENTS
[0004] Field of the Invention
[0005] The present invention relates generally to methods and materials for boosting gene expression in eukaryotic cells, for example the expression of heterologous genes encoding proteins of interest.
[0006] Background of the Invention
[0007] The need for large molecule protein expression is increasing, particularly for the biopharmaceutical and vaccine production market. Although prokaryotic protein expression is a cheaper and simpler process than eukaryotic protein expression, it is commonly unsuitable for the production eukaryotic proteins due to differences in post-translational processing, such as glycosylation and / or protein folding. These can be critical in achieving the protein’s desired physiological activity and / or minimising immunorecognition.
[0008] However, eukaryotic protein expression is considerably more expensive and challenging than prokaryotic protein expression. Previous solutions in this area include the creation of dedicated high-expression cell lines, improved media formulation and the design of high efficiency expression vectors. Various gene expression promoters, such as CMV promoters and CAG promoters have been developed to increase gene expression efficiency.
[0009] However, the use of these conventional techniques in the field of biotechnology regularly result in situations where almost no gene expression takes place or the amount of expressed protein is extremely low, depending on cell type or gene type. As such, there remains a need to reduce costs and / or increase yields.
[0010] WO 2017 / 068142 A1 (herein incorporated by reference) is useful in understanding the present invention. DARESBURY PROTEINS LTD.
[0011] GENETIC ELEMENTS
[0012] As such, there remains a need to reduce costs and / or increase yields in eukaryotic protein expression.
[0013] Summary of the Invention
[0014] An object of the present invention is to provide a method for increasing gene expression in eukaryotic cells, and an expression cassette capable of increasing gene expression in eukaryotic cells.
[0015] Without wishing to be bound by theory, it is believed that the present inventors have identified improved enhancer sequences that allow genes to be expressed with higher efficiency in a range of eukaryotic (preferably mammalian) cells, compared to established enhancer sequences. When used to express proteins, this results in an increased yield of a protein of interest.
[0016] SEQ ID NO: 1 (“dpE1”)
[0017] CGGGGCCGGCAGGCGGAAGCGGCCGGCTGGCCACTGGCTCAGCACCA TGGCGGCCGTGACCGCCTCCCCGGCTCTGAAGCGGCTGGATCTGCGC GATCCCAACGCGCTCTTCGAGACTCATGGAGCGGAGGAAATCCGCGGG CTGGAGCGCCAGGTTCGAGCCGAGATCGAGCACAAGAAGGAGGAGCTG CGGCAGATGGTGGGCGAGCGCTACCGCGACCTGATCGAGGCGGCCGA CACCATCGGCCAGATGCGCCGCTGCGCCGAGGGGCTGGTGGACGCCG TGCGGGCCACCGATCAGTACTGCGCTCGCCTCCGCCAGGCCGGCTCCG CCGCGCCCCGGCTCCCGCGGGCCCCGCAG
[0018] SEQ ID NO: 2 (“dpE2”)
[0019] CCTGCGCCCCAGCTGGGCAATCTGGTCCCCGCGAAGGGGGTGGTAGC AGGTCCGGCCCGGACGGAAGTAGAGGCTGGCCCGCGCCGCGCCAGCC AGCACCAGCATCAGCAGCACCAGCCGCGGCTGCTGCACCGACCCCGAC GACGCCATGCTCCTGCTCCGAGCCTGCTAGGATCCTGGGTCACGCGCT DARESBURY PROTEINS LTD.
[0020] GENETIC ELEMENTS
[0021] GCACCTTCGACCCTTTGACCTGACCCAAGGACCCACGCGCTCTGGCAG CCCCGCCCGGTCCTTTAG
[0022] SEQ ID NO: 3 (“dpE3”)
[0023] CTCGCTCCTCAGGTCCCGGCTTTTATTTTGGCTCTGTCGCTGCCACCCG TTCATCTTCAACATGATATGACCGAAGTGTGAGACTCAGGCTACTGACCT
[0024] Thus in a first aspect, the present invention provides a gene expression cassette, comprising: a. a promoter sequence, b. an open reading frame, c. a 3' untranslated region, and; d. at least one enhancer with a nucleic acid sequence with at least 80% sequence identity to SEQ ID NO: 1 , SEQ ID NO: 2 or SEQ ID NO: 3,
[0025] Wherein a., b, c and d are operably linked.
[0026] Without wishing to be bound by theory, it is believed that the gene expression cassette of the present invention provides an increased expression of the open reading frame, compared to existing enhancers such as SP163. This is particularly the case when integrated into the genome of an expression cell, especially under constitutive expression.
[0027] Suitably, the at least one enhancer has a nucleic acid sequence with at least 85%, at least 90%, at least 95%, at least 99% sequence identity to SEQ ID NO: 1 , SEQ ID NO: 2 or SEQ ID NO: 3. Preferably, the at least one enhancer has a nucleic acid sequence with at least 95% or at least 99% sequence identity to any one of SEQ ID NO: 1 , SEQ ID NO: 2 or SEQ ID NO: 3. Further preferably, the at least one enhancer has the nucleic acid sequence of SEQ ID NO: 1 , SEQ ID NO: 2 or SEQ ID NO: 3. DARESBURY PROTEINS LTD.
[0028] GENETIC ELEMENTS
[0029] Preferably, the at least one enhancer has a nucleic acid sequence with at least 80%, at least 85%, at least 90%, at least 95%, at least 99% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 2. Preferably, the at least one enhancer has a nucleic acid sequence with at least 95% or at least 99% sequence identity to any one of SEQ ID NO: 1 or SEQ ID NO: 2. Further preferably, the at least one enhancer has the nucleic acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2.
[0030] Suitably, the at least one enhancer has a nucleic acid sequence with at least 80%, at least 85%, at least 90%, at least 95%, at least 99% sequence identity to SEQ ID NO: 1 . Preferably, the at least one enhancer has a nucleic acid sequence with at least 95% or at least 99% sequence identity to SEQ ID NO:
[0031] 1 . Further preferably, the at least one enhancer has the nucleic acid sequence of SEQ ID NO: 1 .
[0032] Suitably, the at least one enhancer has a nucleic acid sequence with at least 80%, at least 85%, at least 90%, at least 95%, at least 99% sequence identity to SEQ ID NO: 2. Preferably, the at least one enhancer has a nucleic acid sequence with at least 95% or at least 99% sequence identity to SEQ ID NO:
[0033] 2. Further preferably, the at least one enhancer has the nucleic acid sequence of SEQ ID NO: 2.
[0034] Suitably, the at least one enhancer has a nucleic acid sequence with at least 80%, at least 85%, at least 90%, at least 95%, at least 99% sequence identity to SEQ ID NO: 3. Preferably, the at least one enhancer has a nucleic acid sequence with at least 95% or at least 99% sequence identity to SEQ ID NO:
[0035] 3. Further preferably, the at least one enhancer has the nucleic acid sequence of SEQ ID NO: 3.
[0036] Suitably, where the enhancer has a nucleic acid sequence with at least 80%, at least 85%, at least 90%, at least 95%, at least 99% sequence identity to SEQ ID NO: 1 , the sequence may be as follows:
[0037] SEQ ID NO: 4 DARESBURY PROTEINS LTD.
[0038] GENETIC ELEMENTS
[0039] CGGNGNNGGCNGGNGGNNGCNGNCGGCNGNNCNCNNGCNNNGCNCC NTGNCGGCCNNNNCCGCCTCCNCNGCNNNNAAGNGGNNGGANCNGCN CNANCCNNNCGNGCNCNTNGAGNNNNNNGNAGCGGAGGANANNNGCG GGCNGNNGCGNCAGNTNCGNGNCGAGANNGANCACAAGNAGGNGGAG NNGNGGNAGANGGTGGGCGAGNGNNNCCGCGNCCNGNNCGNGGCGG CNGACACCNTCGNCCNGANGCGCCGCTGCGNCGNGNGNCTGGNNGAC GCCGNGCNGGCCACCGNNCNNNNCNNCGCNCGCCNCCGNCNGGCNG GCNCCGNNNCNCCCNGGNNCCC
[0040] Suitably, where the enhancer has the given sequence identity to SEQ ID NO: 1 at a position functionally equivalent to residue 47 of SEQ ID NO: 1 , the residue may be a guanine, cytosine or thymine residue, preferably where the residue is a guanine residue (in bold, below). This embodiment is provided as it avoids an internal Kozak consensus sequence (underlined below).
[0041] Suitably, the enhancer may have the following sequence:
[0042] SEQ ID NO: 5 (“dpE1m”)
[0043] CGGGGCCGGCAGGCGGAAGCGGCCGGCTGGCCACTGGCTCAGCACCG TGGCGGCCGTGACCGCCTCCCCGGCTCTGAAGCGGCTGGATCTGCGC GATCCCAACGCGCTCTTCGAGACTCATGGAGCGGAGGAAATCCGCGGG CTGGAGCGCCAGGTTCGAGCCGAGATCGAGCACAAGAAGGAGGAGCTG CGGCAGATGGTGGGCGAGCGCTACCGCGACCTGATCGAGGCGGCCGA CACCATCGGCCAGATGCGCCGCTGCGCCGAGGGGCTGGTGGACGCCG TGCGGGCCACCGATCAGTACTGCGCTCGCCTCCGCCAGGCCGGCTCCG CCGCGCCCCGGCTCCCGCGGGCCCCGCAG
[0044] Alternatively, where the enhancer has the given sequence identity to SEQ ID NO: 4, at a position functionally equivalent to residue 47 of SEQ ID NO: 1 , the residue may be a guanine, cytosine or thymine residue, preferably where the residue is a guanine residue. Likewise, this embodiment is provided as it avoids an internal Kozak consensus sequence. DARESBURY PROTEINS LTD.
[0045] GENETIC ELEMENTS
[0046] Suitably, the enhancer may have the following sequence:
[0047] SEQ ID NO: 6
[0048] CGGNGNNGGCNGGNGGNNGCNGNCGGCNGNNCNCNNGCNNNGCNCC GTGNCGGCCNNNNCCGCCTCCNCNGCNNNNAAGNGGNNGGANCNGCN CNANCCNNNCGNGCNCNTNGAGNNNNNNGNAGCGGAGGANANNNGCG GGCNGNNGCGNCAGNTNCGNGNCGAGANNGANCACAAGNAGGNGGAG NNGNGGNAGANGGTGGGCGAGNGNNNCCGCGNCCNGNNCGNGGCGG CNGACACCNTCGNCCNGANGCGCCGCTGCGNCGNGNGNCTGGNNGAC GCCGNGCNGGCCACCGNNCNNNNCNNCGCNCGCCNCCGNCNGGCNG GCNCCGNNNCNCCCNGGNNCCC
[0049] Suitably, where the enhancer has a nucleic acid sequence with at least 80%, at least 85%, at least 90%, at least 95%, at least 99% sequence identity to SEQ ID NO: 2, the sequence may be as follows:
[0050] SEQ ID NO: 7
[0051] CCTGCGCCCCAGCTGGGCNANCTGGTCCCCGCGAAGGGGNNGGTAGC AGGTCNGGCCCGGNCGGAAGTAGAGGCTGGCCCGCGCCGCGCCNGCC AGCANCAGCATCAGCAGCACCAGCCGCNGCTGCTGCACCGACCCCGAC GACGCCATGCTCCTGCTCCNNGCCNNNTNGGATCCTGGNTCACGCGCN GCACCTTCGACCCNTTGACCNGACCCNNNGACCCACGCGCTCNGGCNG CCCCGCCCGGTCCTTTAG
[0052] In some embodiments, enhancers of the present invention are provided in reverse orientation (i.e. the reverse complement of the sequence, when looking at the coding strand) - particularly those upstream of the open reading frame and with the claimed sequence identity to SEQ ID NO: 2. This is preferable in this situation as the enhancer of SEQ ID NO: 2 was mapped onto / recovered from the reverse strand of coding DNA.
[0053] Notably, the reverse complement of SEQ ID NO: 2 is as follows: DARESBURY PROTEINS LTD.
[0054] GENETIC ELEMENTS
[0055] SEQ ID NO: 8 “dpE2m”
[0056] CTAAAGGACCGGGCGGGGCTGCCAGAGCGCGTGGGTCCTTGGGTCAG GTCAAAGGGTCGAAGGTGCAGCGCGTGACCCAGGATCCTAGCAGGCTC GGAGCAGGAGCATGGCGTCGTCGGGGTCGGTGCAGCAGCCGCGGCTG
[0057] GTGCTGCTGATGCTGGTGCTGGCTGGCGCGGCGCGGGCCAGCCTCTA CTTCCGTCCGGGCCGGACCTGCTACCACCCCCTTCGCGGGGACCAGAT TGCCCAGCTGGGGCGCAGG
[0058] In some embodiments, especially where SEQ ID NO: 7 is positioned upstream of the open reading frame, it may be provided in reverse orientation. Notably, the reverse complement of SEQ ID NO: 7 is as follows:
[0059] SEQ ID NO: 9
[0060] CTAAAGGACCGGGCGGGGCNGCCNGAGCGCGTGGGTCNNNGGGTCNG GTCAANGGGTCGAAGGTGCNGCGCGTGANCCAGGATCCNANNNGGCN NGGAGCAGGAGCATGGCGTCGTCGGGGTCGGTGCAGCAGCNGCGGCT
[0061] GGTGCTGCTGATGCTGNTGCTGGCNGGCGCGGCGCGGGCCAGCCTCT ACTTCCGNCCGGGCCNGACCTGCTACCNNCCCCTTCGCGGGGACCAGN TNGCCCAGCTGGGGCGCAGG
[0062] Suitably, where the enhancer has a nucleic acid sequence with at least 80%, at least 85%, at least 90%, at least 95%, at least 99% sequence identity to SEQ ID NO: 3, the sequence may be as follows:
[0063] SEQ ID NO: 10
[0064] CTCNCTCCTCAGGTNCCGGCTTTTATTTTGGCTCTGTCGCTGCCACCCG TTC ATCTTC AAC AN GATATG AN CGANGTNNNAGNCTCNN G CTACTGAC C T
[0065] Suitably, the gene expression cassette further comprises an enhancer known in the art, such as SP163. DARESBURY PROTEINS LTD.
[0066] GENETIC ELEMENTS
[0067] Suitably, the gene expression cassette may further comprise a second, third, fourth or a plurality of enhancers (hereafter “further enhancer(s)”). Preferably, the further enhancer(s) are independently selected from a group consisting of SP163, the 5' untranslated region (UTR) of human heat shock protein 70 mRNA (Hsp70), the tripartite leader sequence of human adenovirus mRNA linked with a major late promoter enhancer (TM), the post- transcriptional regulatory element derived from woodchuck hepatitis virus (WPRE), an enhancer with at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or 100% sequence identity to SEQ ID NO: 1 , an enhancer with at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or 100% sequence identity to SEQ ID NO: 2 and an enhancer with at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or 100% sequence identity to SEQ ID NO: 3.
[0068] Further preferably, the further enhancer(s) are independently selected from a group consisting of SP163, the 5' untranslated region (UTR) of human heat shock protein 70 mRNA (Hsp70), the tripartite leader sequence of human adenovirus mRNA linked with a major late promoter enhancer (TM), the post- transcriptional regulatory element derived from woodchuck hepatitis virus (WPRE), an enhancer with at least 95%, at least 99% or 100% sequence identity to any one of SEQ ID NO: 1 , an enhancer with at least 95%, at least 99% or 100% sequence identity to SEQ ID NO: 2, and an enhancer with at least 95%, at least 99% or 100% sequence identity to SEQ ID NO: 3.
[0069] Without wishing to be bound by theory, it is believed that a gene expression cassette of the present invention that comprises the enhancer and at least one further enhancer (preferably where the further enhancer has at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or 100% sequence identity to SEQ ID NO: 1 , SEQ ID NO: 2 or SEQ ID NO: 3 and / or preferably where there are either one or two further enhancers) the enhancer and the at least one further enhancer provide cooperative increases in transcriptional output. DARESBURY PROTEINS LTD.
[0070] GENETIC ELEMENTS
[0071] Suitably, the at least one enhancer may be either upstream or downstream of the open reading frame.
[0072] Suitably, in embodiments where the gene expression cassette comprises a plurality of enhancers, the plurality of enhancers may be upstream of the open reading frame, downstream of the open reading frame or a combination thereof. Preferably, all enhancers are upstream of the open reading frame.
[0073] Suitably, the at least one enhancer may be either upstream or downstream of the promoter. Preferably, the at least one enhancer is between the promoter and the open reading frame. Suitably, in embodiments where the gene expression cassette comprises a plurality of enhancers, the gene expression cassette may comprise a first enhancer upstream of the promoter and a second enhancer between the promoter and the open reading frame.
[0074] In a preferred embodiment, the enhancer and the further enhancer are operably linked upstream of the promoter and the open reading frame (preferably where the promoter is a CMV promoter) in the following order:
[0075] 1 . An enhancer with either at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or 100% sequence identity to SEQ ID NO: 1 or the nucleic acid sequence of SEQ ID NO: 5, preferably where at a position functionally equivalent to residue 47 of SEQ ID NO: 1 , the residue is a guanine, cytosine or thymine residue, further preferably where the residue is a guanine residue, and
[0076] 2. An enhancer with either at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or 100% sequence identity to SEQ ID NO: 2 or the nucleic acid sequence of SEQ ID NO: 7, preferably in reverse orientation.
[0077] In an alternative preferred embodiment, the enhancer and the further enhancer are operably linked upstream of the promoter and the open reading DARESBURY PROTEINS LTD.
[0078] GENETIC ELEMENTS frame (preferably where the promoter is a CMV promoter) in the following order:
[0079] 1 . An enhancer with either at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or 100% sequence identity to SEQ ID NO: 2 or the nucleic acid sequence of SEQ ID NO: 7 and preferably in reverse orientation.
[0080] 2. An enhancer with either at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or 100% sequence identity to SEQ ID NO: 1 or the nucleic acid sequence of SEQ ID NO: 5, preferably where at a position functionally equivalent to residue 47 of SEQ ID NO: 1 , the residue is a guanine, cytosine or thymine residue, further preferably where the residue is a guanine residue, and
[0081] In embodiments comprising a first further enhancer and a second further enhancer, the enhancer, the first further enhancer and the second further enhancer operably linked upstream of the promoter and the open reading frame (preferably where the promoter is a CMV promoter) in the following order:
[0082] 1 . An enhancer with either at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or 100% sequence identity to SEQ ID NO: 1 or the nucleic acid sequence of SEQ ID NO: 5, preferably where at a position functionally equivalent to residue 47 of SEQ ID NO: 1 , the residue is a guanine, cytosine or thymine residue, further preferably where the residue is a guanine residue,
[0083] 2. An enhancer with either at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or 100% sequence identity to SEQ ID NO: 3 or the nucleic acid sequence of SEQ ID NO: 10, and
[0084] 3. An enhancer with either at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or 100% sequence identity to SEQ ID NO: 2 or DARESBURY PROTEINS LTD.
[0085] GENETIC ELEMENTS the nucleic acid sequence of SEQ ID NO: 7 and preferably in reverse orientation.
[0086] In an alternative preferred embodiment, the enhancer, the first further enhancer and the second further enhancer are operably linked upstream of the promoter and the open reading frame (preferably where the promoter is a CMV promoter) in the following order:
[0087] 1 . An enhancer with either at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or 100% sequence identity to SEQ ID NO: 2 or the nucleic acid sequence of SEQ ID NO: 7 and preferably in reverse orientation.
[0088] 2. An enhancer with either at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or 100% sequence identity to SEQ ID NO: 3 or the nucleic acid sequence of SEQ ID NO: 10, and
[0089] 3. An enhancer with either at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or 100% sequence identity to SEQ ID NO: 1 or the nucleic acid sequence of SEQ ID NO: 5, preferably where at a position functionally equivalent to residue 47 of SEQ ID NO: 1 , the residue is a guanine, cytosine or thymine residue, further preferably where the residue is a guanine residue.
[0090] Suitable promoters are known in the art. Suitably, the promoter may be a promoter for constitutive expression, such as CMV or CVS. Suitably, the promoter may be a promoter for inducible expression, such as a doxycycline inducible promoter and a riboswitch. Preferably, the promoter is CMV.
[0091] Inducible promoters are particularly useful where the gene expression cassette encodes a gene whose expression is harmful to the cell in which it is to be expressed, such as a gene encoding a toxic protein. By using intermittent expression of the toxic protein, negative effects on the growth and proliferation of host cells by the toxic protein may be minimised or avoided. DARESBURY PROTEINS LTD. GENETIC ELEMENTS
[0092] An alternative strategy for expression of toxic proteins is to use riboswitches. A riboswitch is a regulator segment of a messenger RNA (mRNA) molecule that can bind a small molecule, resulting in a change in production of protein encoded by the mRNA. Thus, addition of the small molecule to the cell may stimulate production of the toxic protein from the mRNA, whereas the absence of the small molecule may allow the cells to grow and proliferate.
[0093] The 3' untranslated region is positioned immediately downstream of the stop codon of the open reading frame. Suitable 3' untranslated regions are known in the art, and may comprise regulatory regions that influence polyadenylation, translation efficiency, localisation and stability of mRNA translated from the expression vector. Preferably, the 3' untranslated region comprises a polyadenylation sequence (polyA tail), as this typically results in increased transcription efficiency.
[0094] Suitable polyadenylation sequences include:
[0095] - Growth hormone gene-derived poly A addition sequences, such as either a bovine growth hormone gene-derived poly A addition sequence or a human growth hormone gene-derived poly A addition sequence,
[0096] - an SV40 virus-derived poly A addition sequence, and
[0097] - a human or rabbit [3 globin gene-derived poly A addition sequence.
[0098] Suitably, the open reading frame may comprise a multiple cloning site (MCS). A multiple cloning site may also be referred to as a polylinker. An MCS contains a plurality of restriction endonuclease sites - these permit genes of interest to be inserted into the open reading frame. Suitable MCS’s are known in the art.
[0099] Suitably, the open reading frame may encode one or more proteins of interest, such as a eukaryotic protein, a mammalian protein or a viral protein. DARESBURY PROTEINS LTD. GENETIC ELEMENTS
[0100] Preferably, the protein is an antibody, a fusion protein, such as a bi-specific or tri-specif ic fusion protein, a growth factor or a cytokine.
[0101] Suitably, a protein of interest may be expressed as a fusion protein with a tag or other peptide sequence. In such cases, the fusion protein may be at least 1000 amino acids, at least 1200, at least 1400, at least 1600, at least 1800, at least 2000, or at least 2200 amino acids in length. Expression as a fusion protein may be particularly suitable where the protein to be expressed is a small protein or peptide. For example, the peptide may be 10 to 500 amino acids, 50 to 500, 100 to 400, 100 to 300, or 150 to 250 amino acids in length. Suitably, a protein of interest may be a small protein, which may be expressed as a fusion protein with a tag that increases the size of the protein to be expressed.
[0102] Suitably, the open reading frame may comprise one or more nucleic acids encoding one or more tags, signal peptides and / or leader sequences.
[0103] Tags may be useful for facilitating expression and / or isolating a protein of interest expressed from the gene expression cassette and are well known in the art.
[0104] Suitable tags include a SUMO tag or a SUMOstar tag, an Fc tag, a GST (Glutathione-S-Transferase)-tag, HA-tag, Myc-tag, His-tag, V5-tag, Flag-tag, CBP (chitin binding protein)-tag, MBP (maltose binding protein)-tag, GFP (green fluorescent protein)-tag and its modifications, RFP (red fluorescent protein)-tag and its modifications, YFP (yellow fluorescent protein)-tag and its modifications, Lumio-tag, Nus-tag, Streptavidin-tag, T7-tag, S-tag, thioredoxin-tag and Softag. How these tags are positioned in the open reading frame (C-terminal only, N-terminal only, etc.) is known in the art. Preferably, the open reading frame comprises nucleotides encoding a SUMO tag, a SUMOstar tag or an Fc tag, more preferably the open reading frame comprises nucleotides encoding a His tag or an Fc tag upstream of the nucleotides encoding a protein of interest. DARESBURY PROTEINS LTD. GENETIC ELEMENTS
[0105] Signal proteins and leader sequences may be useful as they direct protein to a certain location in the cell or to the outer environment (secretion). Secretion of the protein of interest out of the host cell reduces the metabolic burden on the cell, enables the correct post-translational modifications (such as glycosylation) and / or makes downstream purification process much more efficient / easier.
[0106] Suitable signal proteins or leader sequences include the signal peptide from Gaussia luciferase (GLUC), and metalloproteinase inhibitor 1 (TIMP1) N- terminal signal peptide, N-terminal murine HC signal peptide, azurocidin preproprotein N-terminal signal peptide, serum albumin preproprotein N- terminal signal peptide, Ig kappa chain V-lll region MOPC 63-like precursor N-terminal signal peptide, Ig kappa chain V-lll region VG precursor N-terminal signal peptide.
[0107] Proteins of interest particularly suited to the methods and gene expression cassette of the present invention include antibodies, cytokines and growth factors, large proteins, secreted proteins, membrane proteins, kinases and receptors; metalloproteinases, and fusion proteins. Suitably, the antibodies may be derivatives of antibodies, such as bi-specifics, tri-specifics, nanobodies and other formats known in the art. Suitably, the fusion proteins are Fc-fusion proteins or Album in-fusion proteins.
[0108] The gene expression cassette of the present invention is particularly useful for the expression of antibodies and / or fusion proteins in mammalian cells. As such, the protein of interest is preferably an antibody. Alternatively, the protein of interest is preferably a fusion protein, such as...
[0109] Large proteins that may be expressed using the gene expression cassette include proteins larger than THSD7A (Thrombospondin Type 1 Domain containing 7A; GenBank: NM_015204.2 Uniprot Q9UPZ6, Gl: 259013332 or Gl: 20521710) and PLA2R (phospholipase A2 receptor 1 ; GenBank: NM_001 132708.1 , Uniprot Q13018, Gl: 197098169 or Gl: 691753). The protein may DARESBURY PROTEINS LTD.
[0110] GENETIC ELEMENTS be at least 1000 amino acids, at least 1200, at least 1400, at least 1600, at least 1800, at least 2000, or at least 2200 amino acids in length.
[0111] Secreted proteins which may be expressed using the gene expression cassette include sVAP1 (vascular adhesion protein; GenBank: NM_053052.3, Gl: 224465201 , Uniprot Q16853 or Gl: 1399032) and CD73 (cluster of differentiation 73; GenBank: BC065937.1 , Gl: 42406318, Uniprot P21589 or Gl: 23897), and BMP4 (bone morphogenetic protein 4; GenBank P12644;
[0112] Uniprot P12644 or Gl 1-15073).
[0113] Cytokines and growth factors that may be expressed using the gene expression cassette include Noggin (GenBank: U31202.1 , Uniprot Q13253 or Gl: 1 1 17816) and IFNb-1a (Interferon beta 1a; DrugBank: DB00060 (BIGD00093, BTD00093).
[0114] Metalloproteinases that may be expressed using the gene expression cassette include MMP12 (matrix metallopeptidase 12; GenBank: NM_002426.4, Gl: 261878521 , Uniprot P39900 or Gl: 435970).
[0115] Kinases and receptors that may be expressed using the gene expression cassette include RET (RET proto-oncogene; GenBank: KR709953.1 Gl: 823670247, Uniprot P07949 or Gl: 36001 ).
[0116] An example of a membrane protein is Heparanase (GenBank Q9Y251 .2 Gl 296434532).
[0117] Suitably, the gene expression cassette comprises:
[0118] - a CMV promoter sequence,
[0119] - an enhancer with a nucleic acid sequence with at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NO: 1 , 2 or 3,
[0120] - an open reading frame comprising: DARESBURY PROTEINS LTD. GENETIC ELEMENTS o A multiple cloning site, or o A nucleic acid encoding one or more proteins of interest, and
[0121] - a 3' untranslated region comprising a polyadenylation sequence,
[0122] Wherein the enhancer is between the promoter and the open reading frame or precedes the promoter.
[0123] Preferably, the enhancer has a nucleic acid sequence with at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NO: 1 or 2.
[0124] Preferably, the gene expression cassette comprises a second enhancer independently selected from an enhancer with at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NO: 1 , 2 or 3. More preferably, the enhancer and the second enhancer are independently selected from enhancers with a nucleic acid sequence with at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NO: 1 or 2.
[0125] In a second aspect, the present invention provides a vector comprising at least one of the gene expression cassettes of the first aspect.
[0126] Suitably, the vector may comprise a plurality of gene expression cassettes of the present invention. For example, where a vector comprises two gene expression cassettes, co-expressing the heavy and light chains of an antibody.
[0127] Suitably, the vector may comprise a further gene expression cassette encoding for the expression of a selectable marker. Suitable selectable markers are known in the art, such as an antibiotic resistance genes or metabolic resistance genes. Suitable antibiotic resistance genes include those that confer resistance to puromycin, ampicillin, zeocin, kanamycin, blasticidin, geneticin (G418), neomycin, hygromycin, chloramphenicol or DARESBURY PROTEINS LTD. GENETIC ELEMENTS tetracycline. Suitable metabolic resistance genes include glutamine synthetase, for use in glutamine synthetase knockout host cells.
[0128] In certain aspects disclosed herein, the vector does not comprise a sequence encoding F1 ori, or a sequence having at least 80%, 85%, 90%, 95% or 100% sequence identity to a sequence encoding F1 ori, or does not comprise a sequence encoding EM7, or a sequence having at least 80%, 85%, 90%, 95% or 100% sequence identity to a sequence encoding EM7.
[0129] In a third aspect, the present invention provides a eukaryotic cell comprising the gene expression cassette of the first aspect.
[0130] Suitably, the gene expression cassette may form part of a vector or may be integrated into the genome of the cell, to enable stable constitutive expression. Methods of integration (e.g. transfection, electroporation and transduction) are known, such as those disclosed in PCT Publication No: WO2018096343A1 (herein incorporated by reference).
[0131] Suitably, the eukaryotic cell may be a yeast cell, a plant cell, insect cell or, most preferably, a mammalian cell. Suitably, the cell may be a Human embryonic kidney cells (HEK293, particularly HEK293T cells, but also HEK293-EBNA1 cells and HEK293 / TR cells), Chinese Hamster Ovary (CHO), CHO cell derivatives such as CHO-K1 , CHOpro-3, Freestyle CHO-S, CHOZN and CHO GS KO (glutamine synthetase knockout) cells, DUKX-X11 , DG44, COS cells (monkey kidney cells), including COS-1 and COS-7 cells, Vero cells (African monkey kidney cells), HeLa cells (cervical adenocarcinoma cells), NSO cells (murine melanoma), Jurkat cells (immortalized human T lymphocytes), BHK cells (baby hamster kidney), MCF cells (Michigan Cancer Foundation) such as MCF-7 cells, PER.C6, and L cell mouse fibroblasts such as those deposited at ATCC CRL 2648.
[0132] In a fourth aspect, the present invention provides a method of expressing a gene of interest from the gene expression cassette of the first aspect, the method comprising: DARESBURY PROTEINS LTD. GENETIC ELEMENTS
[0133] • Providing a cell of the third aspect,
[0134] • Culturing the cell under conditions suitable for growth.
[0135] Suitably, the method may further comprise inducing the expression of the gene of interest. Suitable means of inducing expression are known in the art. Alternatively, expression of the gene of interest may be constitutive.
[0136] Suitably, the method may further comprise inserting a nucleic acid encoding a gene of interest into a vector.
[0137] Suitably, the method may further comprise transfecting the nucleic acid expression vector comprising the gene of interest into a eukaryotic cell to provide the cell of the third aspect, and optionally selecting the transfected eukaryotic cell, such as by antibiotic selection or nucleic acid analysis.
[0138] Suitably, the method may further comprise integrating the gene expression cassette into the genome of the cell.
[0139] Suitably, the gene of interest may encode a protein of interest. Thus, expression of the gene of interest provides expression of the one or more proteins or peptides of interest. Suitably, the method may further comprise purifying the one or more proteins or peptides of interest from the cell.
[0140] Methods of producing a peptide of interest may involve culture or fermentation of a cell modified to express the peptide. The culture or fermentation may be performed in a bioreactor provided with an appropriate supply of nutrients, air / oxygen and / or growth factors. Culture, fermentation and separation techniques are well known to those of skill in the art.
[0141] Following culture of cells that express peptide of interest, that peptide is preferably isolated from the supernatant or culture medium, which may contain other protein and non-protein components. Suitable methods for separating proteins from cell culture are known in the art. DARESBURY PROTEINS LTD.
[0142] GENETIC ELEMENTS
[0143] Once the protein of interest has been isolated from culture it may be necessary to concentrate the protein. Several methods for concentrating a protein of interest are known in the art, such as ultrafiltration, lyophilisation or centrifugal concentration.
[0144] In a fifth aspect, the present invention provides a kit comprising the vector of the second aspect or a eukaryotic cell of the third aspect.
[0145] Suitably, the kit may further comprise reagents suitable for cloning a nucleic acid of interest into the vector, and / or reagents for transfecting a host cell with the vector. Suitably, the kit may include a host cell. Suitably, the kit may comprise instructions for use.
[0146] In a sixth aspect, the present invention provides a viral vector comprising the gene expression cassette of the first aspect, wherein the viral vector is selected from a group consisting of an adenovirus (Ad) vector, an adeno-associated virus (AAV) vector and a lenti viral vector, and wherein the gene of interest is one that is suitable for use in
[0147] - The diagnosis or treatment of a disease, such as cancer,
[0148] - The prevention of a disease, such as through the provision of an adenovirus-based or lentiviral-based vaccine, or
[0149] - Gene therapy.
[0150] Suitable adenovirus vector backbones, adeno-associated virus vector backbones or lentiviral vector backbones are known in the art.
[0151] Suitably, the viral vector may be modified to provide a peptide on its outer shell that selectively binds to a target cell (e.g. RGD), directing the viral vector to those cells. The cells are then infected by the viral vector and the gene expression cassette of the present invention is expressed. DARESBURY PROTEINS LTD. GENETIC ELEMENTS
[0152] Where the gene of interest is a reporter gene such as a luciferase gene, the target cells can be detected with light emission or the like. When the target cells are cancer cells, through administration of the vector to a subject, cancer cells in the subject can be detected and then the subject can be diagnosed as having or not having cancer.
[0153] Where the gene of interest is a therapeutic gene, its expression may be used to provide therapeutic effects. For example, when target cells are cancer cells and a cancer suppressor gene such as a REIC / Dkk-3 gene is used, through administration thereof to a subject, such a cancer therapeutic gene is delivered to cancer cells of the subject, the gene is expressed in cancer cells, and thus it exhibits therapeutic effects.
[0154] When the gene of interest is a cancer suppressor gene such as a human REIC / Dkk-3 gene, examples of cancers treated by the present invention include: cranial nerve tumor, skin cancer, gastric cancer, lung cancer, hepatic cancer, lymphoma / leukemia, colon cancer, pancreatic cancer, anal / rectal cancer, esophageal cancer, uterine cancer, breast cancer, adrenal cancer, kidney cancer, renal pelvic and ureteral cancer, bladder cancer, prostate cancer, urethral cancer, penile cancer, testicular cancer, osteoma / osteosarcoma, leiomyoma, rhabdomyoma, and mesothelioma.
[0155] The viral vector of the present invention can be used for treatment of primary cancer and metastatic cancer.
[0156] Where the gene of interest is an antigen, the viral vector may be used as a vaccine. For example, when the gene of interest encodes a cancer-specific antigen protein, administration of the viral vector in vivo via subcutaneous injection or the like, results in the in vivo expression of the antigen. This permits the activation of a host's active immune system against the antigen, providing immunity. Thus, the gene expression cassette of the present invention may be used for prevention or treatment of disease such as cancer through the use thereof as a vaccine as described above. DARESBURY PROTEINS LTD. GENETIC ELEMENTS
[0157] As such, when used in a viral vector as described herein, an advantage provided by the invention is that is that an increased amount of the gene of interest is produced, improving the efficacy of the intended use. This may cause an increased immunoresponse, or may permit the use of fewer viral vectors to achieve the same result (reducing side-effects).
[0158] Examples of therapeutic genes that can be used for the treatment of specific diseases and / or for use as diagnostic agents in the detection of diseases and the like or reagents to be used for experiments include tumor suppressor genes such as REIC / Dkk-3, p53 and Rb, and genes encoding proteins that can be used as drugs (e.g., interleukin 1 (IL-1 ), IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11 , IL-12, IL-13, IL-14, IL-15, a-interferon, [3-interferon, y- interferon, angiostatin, thrombospondin, endostatin, METH-1 , METH-2, GM- CSF, G-CSF, M-CSF, tumour necrosis factor, hepatocyte growth factor, erythropoietin, thrombopoietin, insulin, growth hormone, antibody (IgG light chain or IgG heavy chain), protein G, and protein A). Suitably, not only a full- length gene thereof, but also a fragment thereof can be used.
[0159] Alternatively, the gene of interest may not encode a protein, instead providing therapeutic activity by other means. Examples include DNA and the like encoding siRNA, shRNA, miRNA, and the like having RNA interference action. When RNA having RNA interference action is used, such RNA is transcribed and produced using a transfer RNA promoter, so that the suppressed expression of a specific gene becomes possible.
[0160] A reporter gene may also be contained for detection or diagnosis of disease.
[0161] In a seventh aspect, the present invention provides a pharmaceutical composition comprising the viral vector of the sixth aspect and a pharmaceutically acceptable excipient.
[0162] Suitably, the pharmaceutical composition further comprises an adjuvant. DARESBURY PROTEINS LTD.
[0163] GENETIC ELEMENTS
[0164] Suitably, where the intended use of the pharmaceutical composition is the treatment of a disease, the pharmaceutical composition may further comprise a known pharmaceutical compound suitable for treating that disease (a codrug or combination therapy). This may be provided to a patient in need thereof either concurrently or consecutively with the pharmaceutical composition.
[0165] In an eighth aspect, the present invention provides use of the pharmaceutical composition of the seventh aspect in the diagnosis, treatment or prevention of a disease.
[0166] Suitably, the disease is selected from a group consisting of infectious diseases, deficiency diseases, hereditary diseases, oncological diseases and physiological diseases.
[0167] In a ninth aspect, the present invention provides the use of a method for the treatment or prophylaxis of a disease in a mammal in need thereof, the method comprising administering to the mammal an effective amount of the pharmaceutical composition of the seventh aspect.
[0168] In an eleventh aspect, the present invention provides the use of the recombinant virus of the sixth aspect for the manufacture of a medicament for the treatment of infectious diseases, deficiency diseases, hereditary diseases, oncological diseases or physiological diseases.
[0169] The invention includes the combination of the aspects and preferred features described except where such a combination is clearly impermissible or expressly avoided.
[0170] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.
[0171] Aspects and embodiments of the present invention will now be illustrated, by way of example, with reference to the accompanying figures. Further aspects DARESBURY PROTEINS LTD.
[0172] GENETIC ELEMENTS and embodiments will be apparent to those skilled in the art. All documents mentioned in this text are incorporated herein by reference.
[0173] Brief Description of the Figures
[0174] Figure 1A-F: Plasmids comprising gene expression cassettes of the present invention.
[0175] Figure 2A-B: Testing the effect of enhancers of the present invention on the transient and stable expression of Albumin in HEK293 cells. Negative controls are non-transfected cells. Positive controls are the same expression vectors but without enhancers.
[0176] Figure 3A-B: Testing the effect of enhancers of the present invention on the transient and stable expression of Adalimumab in HEK293 cells. Negative controls are non-transfected cells. Positive controls are the same expression vectors but without enhancers.
[0177] Figure 4A-B: Testing the effect of enhancers of the present invention on the transient and stable expression of Adalimumab in CHO cells. Negative controls are non-transfected cells. Positive controls are the same expression vectors but without enhancers.
[0178] Figure 5: Stable expression of Adalimumab (P2A) in HEK293 cells with triple enhancer placed upstream of a single promoter; Coomassie-stained SDS- PAGE with heavy / light bands indicated.
[0179] Lane 1 - NEB Broad Spectrum Marker
[0180] Lane 2 - ADM P2A without enhancers- Day 8 SFM
[0181] Lane 3 - ADM P2A with SEQ ID NO: 5, SEQ ID NO: 3 then SEQ ID NO: 2 combination - Day 8 SFM
[0182] Lane 4 - ADM P2A with SEQ ID NO: 2, SEQ ID NO: 3 then SEQ ID NO: 5 combination - Day 8 SFM DARESBURY PROTEINS LTD.
[0183] GENETIC ELEMENTS
[0184] Figure 6A & B: Transient expression of BMP4 in HEK293 cells with dual or triple enhancers placed upstream of a single promoter; Coomassie-stained SDS-PAGE and Western Blot with heavy / light bands indicated.
[0185] Lane 1 - NEB Broad Spectrum Ladder #7719
[0186] Lane 2 - conditioned medium from HEK293 cells, Negative Control
[0187] Lane 3 - BMP4 in pPEF5.2 without enhancers, Positive Control
[0188] Lane 4 - BMP4 with SEQ ID NO: 5, SEQ ID NO: 3 then SEQ ID NO: 2 combination
[0189] Lane 5 - BMP4 SEQ ID NO: 2, SEQ ID NO: 3 then SEQ ID NO: 5 combination
[0190] Lane 6 - BMP4 with SEQ ID NO: 5 then SEQ ID NO: 8 combination
[0191] Lane 7 - BMP4 with SEQ ID NO: 8 then SEQ ID NO: 5 combination
[0192] Figure 7A & B: Transient expression of BMP4 in L929 cells with dual or triple enhancers placed upstream of a single promoter; Coomassie-stained SDS- PAGE and Western Blot with heavy / light bands indicated.
[0193] Lane 1 - NEB Broad Spectrum Ladder #7719
[0194] Lane 2 - conditioned medium from HEK293 cells, Negative Control
[0195] Lane 3 - BMP4 in pPEF5.2 without enhancers, Positive Control
[0196] Lane 4 - BMP4 with SEQ ID NO: 5, SEQ ID NO: 3 then SEQ ID NO: 2 combination
[0197] Lane 5 - BMP4 SEQ ID NO: 2, SEQ ID NO: 3 then SEQ ID NO: 5 combination
[0198] Lane 6 - BMP4 with SEQ ID NO: 5 then SEQ ID NO: 8 combination DARESBURY PROTEINS LTD.
[0199] GENETIC ELEMENTS
[0200] Lane 7 - BMP4 with SEQ ID NO: 8 then SEQ ID NO: 5 combination
[0201] Definitions
[0202] Throughout the specification, unless the context demands otherwise, the terms ‘comprise’ or ‘include’, or variations such as ‘comprises’ or ‘comprising’, ‘includes’ or ‘including’ will be understood to imply the includes of a stated integer or group of integers, but not the exclusion of any other integer or group of integers.
[0203] As used herein, the articles “a” and “an” refer to one or to more than one (for example to at least one) of the grammatical object of the article.
[0204] As used herein, “about” shall generally mean an acceptable degree of error for the quantity measured given the nature or precision of the measurements.
[0205] As used herein, "treat", “treating" or "treatment" refers to therapy, prevention and prophylaxis and particularly refers to the administration of medicine or the performance of medical procedures with respect to a patient, for either prophylaxis (prevention) or to cure or reduce the extent of or likelihood of occurrence of the infirmity or malady or condition or event in the instance where the patient is afflicted.
[0206] As used herein, a “gene expression cassette” is a synthetic nucleotide sequence in line with the first aspect, composed of one or more genes operably linked to the sequences controlling their expression (e.g. promoter, enhancer, 3’ untranslated region).
[0207] As used herein “a protein of interest” is synonymous with “one or more proteins or peptides of interest”.
[0208] As used herein, "operably linked" refers to where a regulatory nucleotide sequence (e.g. a promoter and / or an enhancer) is in the correct location and orientation to a nucleic acid that is to be transcribed, such that the regulatory DARESBURY PROTEINS LTD.
[0209] GENETIC ELEMENTS nucleotide sequence can control the initiation of transcription by RNA polymerase. Where appropriate, the resulting transcript may then be translated into a protein or polypeptide of interest. Notably, due to the manner in which enhancers enhance transcription, an enhancer “operably linked” to an open reading frame includes where the enhancer is in either forward or reverse orientation (reverse complement).
[0210] As used herein, “vector” or “vectors” refer to autonomously replicating nucleic acid molecules that can be used to carry nucleic acid(s) (“genes of interest”) encoding one or more proteins of interest.
[0211] As used herein, “promoter” refers to a nucleotide sequence required to facilitate transcription from a transcriptional start site, which is the site at which the first nucleotide of the transcript is transcribed, the nucleotide being complementary to the corresponding nucleotide in the nucleic acid. A promoter operably linked to a transcriptional start site means that the promoter is capable of driving transcription from the transcriptional start site in the absence of further nucleotide sequences.
[0212] As used herein, “enhancer” refers to a nucleic acid sequence that increases the level of transcription from a promoter. Enhancers need not be in any specified position in the nucleic acid in relation to the promoter, transcriptional start site, or transcriptional termination site. All that is required for a specific enhancer to be operably linked to a specific promoter is that the presence of the enhancer increases transcription driven by that promoter. Specifically, two or more (a plurality of) same enhancers may be used or a plurality of different enhancers may be used in combination. Also, when a plurality of different enhancers are used, the order thereof is not limited.
[0213] As used herein, “transcriptional termination signal” refers to a nucleic acid sequence that terminates transcription of a transcript. A variety of transcriptional termination signals are known in the art. DARESBURY PROTEINS LTD. GENETIC ELEMENTS
[0214] As used herein, "upstream" and "downstream" refer to a relative position in the nucleic acid sequence. Nucleic acid sequence has a 5' end and a 3' end. The 5' end is the upstream end, and the 3' is the downstream end.
[0215] Transcription begins at the 5' end and moves along the nucleic acid sequence towards the 3' end. Where the nucleic acid is double stranded, such as with dsDNA, the terms are used in the context of the strand that encodes the gene of interest, or the "coding strand".
[0216] As used herein, “selectable marker” refers to a gene introduced into a cell that confers a trait suitable for artificial selection.
[0217] As used herein, percentage (%) sequence identity refers to the percentage of nucleic acid residues in a candidate sequence that are identical with residues in the given listed sequence (referred to by the SEQ ID No.) after aligning the sequences and introducing gaps if necessary, to achieve the maximum sequence identity, and not considering any conservative substitutions as part of the sequence identity. Sequence identity is preferably calculated over the entire length of the respective sequences. Where the aligned sequences are of different length, sequence identity of the shorter comparison sequence may be determined over the entire length of the longer given sequence or, where the comparison sequence is longer than the given sequence, sequence identity of the comparison sequence may be determined over the entire length of the shorter given sequence.
[0218] An embodiment of the present invention will now be described by way of example only, with reference to the accompanying figures. DARESBURY PROTEINS LTD. GENETIC ELEMENTS Detailed Description of the Invention
[0219] Example 1 : Testing Putative Enhancers - Low-Expression Albumin
[0220] A gene expression cassette was provided on the expression vector pPEF5.2, where the gene expression cassette comprised:
[0221] 1 . A CMV enhancer, 2. A CMV promoter
[0222] 3. A multiple cloning site,
[0223] 4. A His-tag,
[0224] 5. A bGH poly(A) sequence
[0225] Wherein each of these components are operably linked. Enhancers SEQ ID NO: 1 , SEQ ID NO: 2 and SEQ ID NO: 3 were then cloned either directly upstream of the CMV promoter or between the CMV promoter and the multiple cloning site, creating six plasmids in total, dpE1 - dpE6:
[0226] Table 1 : Positioning of various enhancers of the present invention. DARESBURY PROTEINS LTD. GENETIC ELEMENTS
[0227] The sequences of the six gene expression cassettes are as shown in the accompanying sequence listing (SEQ ID NO: 11-16).
[0228] A portion of each vector was then modified to provide the gene encoding albumin into the multiple cloning site - operably linked with the CMV promoter and the enhancer of the present invention.
[0229] These vectors were used to test the effect of the different enhancers and their positions on the expression levels of albumin in a relatively low-expressing cell line (HEK293).
[0230] The above vectors were transformed into the HEK293 cells with Lipofectamine™ transfection reagent (ThermoFisher / lnvitrogen / Life Technologies) following the manufacturer’s instructions. For stable transfections, a selective reagent, zeocin, was added 48 hours posttransfection. Pools of stable colonies were established and expanded after 3- 4 weeks of culturing in complete medium (DMEM 10% FBS) supplemented with zeocin for the first 2 weeks. Once the stable cells reached 100% confluency in a T25 culture flask, the complete medium was replaced with serum-free one (SFM) and cultured for 7 days. The SFM was then harvested and analysed for the presence of a secreted protein by Coomassie staining of SDS PAGE with media samples.
[0231] Transient transfections were carried out with Lipofectamine™ transfection reagent (ThermoFisher / lnvitrogen / Life Technologies) following the manufacturer’s instructions in low-serum medium. The medium was replaced with SFM 24 hours post-transfection. Media samples were collected after further 2-5 days subculturing.
[0232] The transient and stable expression of albumin in these cells was then analysed using SDS-PAGE. Figure 2 shows that constructs dpE1-4, induced a large increase in protein expression, while dpE5-6 had no effect. DARESBURY PROTEINS LTD. GENETIC ELEMENTS
[0233] Example 2: Testing Putative Enhancers - High-Expression Adalimumab
[0234] Adalimumab is a relatively high-expressing protein. As such, to validate the enhancers’ ability to further increase protein expression, vectors were prepared in line with Example 1 , but with two gene expression cassettes - one for Adalimumab’s light chain, one for Adalimumab’s light chain, with the same putative enhancer in the same position with respect to a CMV promoter as shown above.
[0235] Using the same protocol as described above, these vectors were then used in the transient and stable expression of Adalimumab in HEK293 cells. The results were again reviewed using SDS-PAGE, as shown in Figure 3.
[0236] Contrary to Example 1 , all the putative enhancers demonstrated significantly increased expression of both Adalimumab’s heavy and light chains, demonstrating the powerful effects of these sequences in both cloning sites.
[0237] Thus, this experiment suggests that SEQ ID NO: 1 , SEQ ID NO: 2 and SEQ ID NO: 3 are suitable for use as enhancers.
[0238] Example 3: Testing Putative Enhancers - Low-Expression Adalimumab
[0239] To further exemplify these sequences’ applicability, their enhancing abilities were validated in CHO cells. This cell line is considered more pharmaceutically-relevant than HEK293 cells.
[0240] As shown in Figure 4, Adalimumab protein expression was significantly increased when expressed with all of the enhancing sequences. DARESBURY PROTEINS LTD.
[0241] GENETIC ELEMENTS
[0242] Example 4: Consensus Sequences
[0243] Homologues and paralogues of SEQ ID NO: 1-3 were identified, where percentage identity was >85%. These sequences were used to create consensus sequences SEQ ID NO: 4-6.
[0244] Example 5: Triple Enhancer Antibody Expression
[0245] A bicistronic Adalimumab construct was prepared in which heavy and light chains are separated by a self-cleaving P2A sequence and expressed from a single CMV promoter (pPEF5.2 backbone).
[0246] Triple enhancer Adalimumab constructs were generated, with the following enhancer combinations cloned upstream of a CMV promoter in ADM P2A_pPEF5.2: a) SEQ ID NO: 5, SEQ ID NO: 3 then SEQ ID NO: 2, and b) SEQ ID NO: 2, SEQ ID NO: 3 then SEQ ID NO: 5.
[0247] HEK293 cells were stably transfected with the resulting constructs and conditioned media was harvested after 8 days of subculturing in serum-free media to assess vis SDS-PAGE the relative expression levels exerted by the constructs compared to the positive control (ADM P2A_pPEF5.2).
[0248] As shown in Figure 5, both gene cassettes of the present invention increased stable antibody expression in HEK293 cells - particularly the one comprising SEQ ID NO: 2, SEQ ID NO: 3 then SEQ ID NO: 5.
[0249] Example 6: Transient Expression of BMP4 in HEK293 and L929 Cells
[0250] Human BMP4 was cloned into a pPEF5.2 plasmid and served as the positive control. Triple enhancer and dual enhancer BMP4 constructs were generated, DARESBURY PROTEINS LTD.
[0251] GENETIC ELEMENTS with the following enhancer combinations cloned upstream of a CMV promoter: a) SEQ ID NO: 5, SEQ ID NO: 3 then SEQ ID NO: 2, b) SEQ ID NO: 2, SEQ ID NO: 3 then SEQ ID NO: 5 c) SEQ ID NO: 5 then SEQ ID NO: 8, and d) SEQ ID NO: 8 then SEQ ID NO: 5.
[0252] Exemplary nucleic acid sequences for these constructs are provided by SEQ ID NO: 17-22 in the accompanying sequence listing.
[0253] HEK293 cells were transiently transfected with the BMP4 constructs in a 6- well format.
[0254] Serum-free conditioned media samples were collected from 1 well per replicate on Day 5 post transfection. Aliquots of harvested media were run on gel under reducing conditions and stained with Coomassie stain, and a Western Blot was also performed with anti-BMP4 monoclonal antibody (PeproTech®, Invitrogen™ 500-M121-500UG). Secondary antibody: Antimouse IgG HRP, Cell Signalling 7076.
[0255] As shown in Figure 6A and B, all four embodiments of the present invention demonstrate upregulating effects on BMP4 transient expression in HEK293 cells over the enhancer-free positive control, particularly Lane 7, SEQ ID NO: 8 then SEQ ID NO: 5.
[0256] L929 cells, a mouse fibroblast cell line, were also transiently transfected with the BMP4 constructs in a 6-well format.
[0257] Again, serum-free conditioned media samples were collected from 1 well per replicate on Day 5 post transfection. Aliquots of harvested media were run on gel under reducing conditions and stained with Coomassie stain, and a Western Blot was also performed with anti-BMP4 monoclonal antibody DARESBURY PROTEINS LTD.
[0258] GENETIC ELEMENTS
[0259] (PeproTech®, Invitrogen™ 500-M121-500UG). Secondary antibody: Antimouse IgG HRP, Cell Signalling 7076.
[0260] As shown in Figure 7A and B, all four embodiments of the present invention demonstrate upregulating effects on BMP4 transient expression in L929 cells over the enhancer-free positive control, particularly Lane 6 SEQ ID NO: 5 then SEQ ID NO: 8 and Lane 7, SEQ ID NO: 8 then SEQ ID NO: 5.
[0261] These examples also demonstrate that dual combinations wherein one enhancer is provided in reverse orientation (e.g. SEQ ID NO: 2) are functional and that the effects are observed across different cell lines (HEK293, L929) and across transient and stable expression modes, complementing earlier data.
[0262] Without wishing to be bound by theory, combinations of multiple enhancer modules may provide additive or synergistic recruitment of transcriptional machinery and / or chromatin remodelling, including when one enhancer is provided in reverse orientation.
[0263] Preferred compositions, features and embodiments of each aspect of the invention are as for each of the other aspects mutatis mutandis unless context demands otherwise.
[0264] Each document, reference, patent application or patent cited in this text is expressly incorporated herein in their entirety by reference, which means it should be read and considered by the reader as part of this text. That the document, reference, patent application or patent cited in the text is not repeated in this text is merely for reasons of conciseness.
[0265] Reference to cited material or information contained in the text should not be understood as a concession that the material or information was part of the common general knowledge or was known in any country. DARESBURY PROTEINS LTD.
[0266] GENETIC ELEMENTS Although the invention has been particularly shown and described with reference to particular examples, it will be understood by those skilled in the art that various changes in the form and details may be made therein without departing from the scope of the present invention.
[0267] This work has identified and characterised three novel enhancing elements that have been validated in two protein targets and two cell lines, and have shown significant enhancing abilities. Their amenability to plug into different transient and stable cell line production further exemplifies their useability.
Claims
DARESBURY PROTEINS LTD.GENETIC ELEMENTSClaims1 . A gene expression cassette, comprising: a. A promoter sequence, b. An open reading frame, c. A 3' untranslated region, and; d. At least one enhancer with a nucleic acid sequence with at least 80% sequence identity to SEQ ID NO: 1 , SEQ ID NO: 2 or SEQ ID NO: 3,Wherein a., b., c. and d. are operably linked.
2. The gene expression cassette of claim 1 , wherein the at least one enhancer has a nucleic acid sequence with at least 80% sequence identity to SEQ ID NO: 1 , wherein at a position functionally equivalent to residue 47 of SEQ ID NO: 1 , the residue may be a guanine, cytosine or thymine residue.
3. The gene expression cassette of claim 1 , wherein the at least one enhancer has a nucleic acid sequence with at least 80% sequence identity to SEQ ID NO: 2, wherein the at least one enhancer is provided in reverse orientation with respect to the open reading frame.
4. The gene expression cassette of claim 1 , wherein the at least one enhancer has the nucleic acid sequence of SEQ ID NO: 1 , SEQ ID NO: 2 or SEQ ID NO: 3.
5. The gene expression cassette of any one of claims 1 -3, wherein one of the following:DARESBURY PROTEINS LTD.GENETIC ELEMENTS a. Where the at least one enhancer has a nucleic acid sequence with at least 80% sequence identity to SEQ ID NO: 1 , the enhancer has the nucleic acid sequence of SEQ ID NO: 4, b. Where the at least one enhancer has a nucleic acid sequence with at least 80% sequence identity to SEQ ID NO: 2, the enhancer has the nucleic acid sequence of SEQ ID NO: 7, or c. Where the at least one enhancer has a nucleic acid sequence with at least 80% sequence identity to SEQ ID NO: 3, the enhancer has the nucleic acid sequence of SEQ ID NO: 9.
6. The gene expression cassette of any one of the preceding claims, wherein the at least one enhancer has the nucleic acid sequence with at least 80% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 2.
7. The gene expression cassette of any one of the preceding claims, wherein the gene expression cassette further comprises a second enhancer with at least 80% sequence identity to SEQ ID NO: 1 , SEQ ID NO: 2 or SEQ ID NO: 3.
8. The gene expression cassette of any one of the preceding claims, wherein the at least one enhancer is a. upstream of the promoter, b. between the promoter and the open reading frame, or c. downstream of the open reading frame.
9. The gene expression cassette of claim 8, wherein the at least one enhancer is between the promoter and the open reading frame.
10. The gene expression cassette of any one of the preceding claims, wherein the promoter is either CMV or CVS.DARESBURY PROTEINS LTD.GENETIC ELEMENTS11 . The gene expression cassette of any one of the preceding claims, wherein the 3' untranslated region comprises a polyadenylation sequence.
12. The gene expression cassette of any one of the preceding claims, wherein the open reading frame comprises: a. A multiple cloning site, or b. A nucleic acid sequence encoding one or more of: a eukaryotic protein, a mammalian protein, a fusion protein with a tag or other peptide sequence, Thrombospondin Type 1 Domain containing 7A, Pongo abelii phospholipase A2 receptor 1 , synaptosomal associated protein, cluster of differentiation 73, bone morphogenetic protein 4, Noggin, Interferon beta 1 a, matrix metallopeptidase 12, RET proto-oncogene, Heparanase, REIC / Dkk-3, p53, Rb, interleukin 1 (IL-1 ), IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11 , IL-12, IL-13, IL-14, IL-15, a- interferon, [3-interferon, y-interferon, angiostatin, thrombospondin, endostatin, METH-1 , METH-2, GM-CSF, G- CSF, M-CSF, tumour necrosis factor, hepatocyte growth factor, erythropoietin, thrombopoietin, insulin, growth hormone, antibody (IgG light chain or IgG heavy chain), protein G, and protein A).
13. The gene expression cassette of any one of the preceding claims, wherein the open reading frame comprises at least one tag for facilitating expression and / or isolating a protein of interest expressed from the gene expression cassette.
14. The gene expression cassette of claim 13, wherein the at least one tag is selected from a group consisting of: the signal peptide from Gaussia luciferase, a SUMO tag, a SUMOstar tag, a GST-tag, a HA-tag, a Myc- tag, a His-tag, a V5-tag, a Flag-tag, a CBP (chitin binding protein)-tag,DARESBURY PROTEINS LTD.GENETIC ELEMENTS an MBP (maltose binding protein)-tag, a GFP-tag and its modifications, an RFP-tag and its modifications, a YFP-tag and its modifications, a Lumio-tag, a Nus-tag, a Streptavidin-tag, a T7-tag, an S-tag, a thioredoxin-tag and a Softag.
15. A vector comprising at least one of the gene expression cassettes of any one of the preceding claims.
16. The vector of claim 15, wherein the vector comprises a plurality of the gene expression cassettes of any one of claims 1-14.
17. A eukaryotic cell comprising the gene expression cassette of any one of claims 1-14.
18. The cell of claim 17, wherein the gene expression cassette is either a. Provided by a vector of either of claims 15 or 16, or b. Integrated into the genome of the cell.
19. The cell of either claim 17 or 18, wherein the cell is selected from a group consisting of a yeast cell, a plant cell, insect cell and a mammalian cell.
20. The cell of either claim 17 or 18, wherein the cell is selected from a group consisting of Human embryonic kidney cells such as HEK293T, HEK293-EBNA1 or HEK293 / TR cells; Chinese Hamster Ovary cells such as CHO-K1 , CHOpro-3, Freestyle CHO-S, CHOZN and CHO GS KO cells; DUKX-X11 , DG44, COS cells such as COS-1 and COS-7 cells; Vero cells, HeLa cells, NSO cells, Jurkat cells, BHK cells, MCF cells such as MCF-7 cells; PER.C6, and L cell mouse fibroblasts such as those deposited at ATCC CRL 2648.21 .A method of expressing a gene of interest from the gene expression cassette of the first aspect, the method comprising:DARESBURY PROTEINS LTD.GENETIC ELEMENTSProviding a cell of any one of claims 17-20,• Culturing the cell under conditions suitable for growth.
22. The method of claim 21 , wherein the method further comprises one or more of:• Inducing the expression of the gene of interest,• Inserting a nucleic acid encoding a gene of interest into a vector,• Transfecting the vector comprising the gene of interest into a eukaryotic cell to provide the cell of any one of claims 15-18, andOptionally selecting the transfected eukaryotic cell, and• integrating the gene expression cassette into the genome of the cell.
23. The method of either claim 21 or 22, further comprising purifying or isolating one or more proteins of interest.
24. A kit comprising either the vector of either claim 15 or 16 or the cell of any one of claims 17-20.
25. A viral vector comprising the gene expression cassette of any one of claims 1 -14, wherein the viral vector is selected from a group consisting of an adenovirus (Ad) vector, an adeno-associated virus (AAV) vector and a lentiviral vector, and wherein the open reading frame includes a gene of interest suitable for use in:The diagnosis or treatment of a disease,DARESBURY PROTEINS LTD.GENETIC ELEMENTS • The prevention of disease, or• Gene therapy.
26. A pharmaceutical composition comprising the viral vector of claim 25 and a pharmaceutically acceptable excipient.
27. Use of the pharmaceutical composition of claim 26 in the diagnosis, treatment or prevention of a disease.
Citation Information
Patent Citations
Controllable transcription
WO2018096343A1
Composition and method for site-specific recombination in hamster cells
CN103305504A
Expression in mammalian cells with gaussia luciferase signal peptide
WO2017068142A1
AU2018234918A1