Use of solanum lycopersicum SGR1 gene in cultivating low-temperature-resistant solanum lycopersicum and method for cultivating low-temperature-resistant solanum lycopersicum
By editing the SGR1 gene of tomatoes with CRISPR/Cas9, the problems of low efficiency and high risk in the cultivation of cold-resistant tomatoes in the existing technology have been solved, and the tolerance of tomatoes to low temperatures and the physiological indicators have been improved.
Patent Information
- Application Number
- PCT/CN2025/078392
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-10-10
- Filing Date
- 2025-02-21
- Publication Date
- 2026-04-16
AI Technical Summary
Existing technologies for cultivating low-temperature resistant tomatoes suffer from low efficiency, high randomness, and high risk, making it difficult to effectively improve the low-temperature tolerance of tomatoes.
By editing the tomato SGR1 gene, especially using the CRISPR/Cas9 system, specific exon regions of the tomato SGR1 gene can be targeted and edited to inhibit or reduce the activity or expression of the SGR1 protein, thereby improving the low-temperature tolerance of tomatoes.
It improved the low-temperature tolerance of tomatoes, delayed leaf senescence, increased the content of lycopene, chlorophyll and β-carotene in leaves, inhibited the increase of MDA content, increased proline content, delayed the decrease of leaf water content, inhibited ROS burst, improved antioxidant enzyme activity and reduced low-temperature damage.
Smart Images

Figure CN2025078392_16042026_PF_FP_ABST
Abstract
Description
Application of the tomato SGR1 gene in breeding cold-resistant tomatoes and methods for breeding cold-resistant tomatoes Technical Field
[0001] This application belongs to the field of genetic engineering technology, specifically relating to the application of the tomato SGR1 gene in the cultivation of cold-resistant tomatoes and the method for cultivating cold-resistant tomatoes. Background Technology
[0002] Tomato (Solanum lycopersicum) is the world's largest vegetable crop, originating in the tropical and subtropical regions of South America. Its optimal temperature range for its entire growth period is 18–25°C, making it extremely sensitive to low temperatures. Low temperatures can adversely affect tomatoes at all stages of vegetative growth and fruit development, severely limiting their growth, yield, and quality. In recent years, with the frequent occurrence of extreme weather events globally, low temperatures have become one of the bottlenecks restricting tomato production. In the Yangtze River basin of my country, the use of greenhouses and other protected cultivation facilities can mitigate the chilling and frost damage to tomatoes in early spring and late autumn cultivation to some extent, but this requires significant investment and energy consumption, and the risk of damage from low temperatures remains substantial.
[0003] Selecting cold-resistant tomato varieties is one solution, but the available cold-resistant varieties on the market and the resistance resources available for breeding are currently limited. Furthermore, current methods for creating cold-resistant tomato materials mainly involve identifying naturally occurring variants through field screening, followed by hybridization to transfer the desired trait into the recipient material. This process is highly random and unpredictable, requires significant workload and screening time, and carries the risk of losing the desired trait and introducing cascading burdens. Therefore, obtaining cold-resistant tomato resources through bio-breeding technology has important scientific significance and application value for off-season vegetable production and ensuring year-round vegetable supply. Summary of the Invention
[0004] The purpose of this application is to provide the application of the tomato SGR1 gene in the breeding of cold-resistant tomatoes and a method for breeding cold-resistant tomatoes. This application, through gene editing of the tomato SGR1 gene, can obtain tomatoes with stronger cold resistance, and the process is time-efficient and highly effective. This application can be used for the creation of materials and variety improvement of cold-resistant tomatoes.
[0005] This application provides the application of gene editing of the tomato SGR1 gene or the reagents for gene editing of the tomato SGR1 gene in the cultivation of low-temperature resistant tomatoes, wherein the nucleotide sequence of the tomato SGR1 gene is shown in SEQ ID NO.1.
[0006] This application also provides the application of the reagents for gene editing of the tomato SGR1 gene in any one or more of ① to ⑥:
[0007] ① Inhibit the increase in MDA content in tomato leaves caused by low temperature stress;
[0008] ② Increase the proline content in tomato leaves under low temperature stress;
[0009] ③ It delays the decrease in water content of tomato leaves caused by low temperature stress;
[0010] ④ Inhibit the ROS surge in tomato leaves caused by low temperature stress;
[0011] ⑤ Inhibits the increase in catalase and peroxidase activity caused by low temperature stress;
[0012] ⑥ Improve the activity of antioxidant enzymes under low temperature stress; the antioxidant enzymes include CAT, SOD and POD.
[0013] Preferably, the gene editing includes editing the SGR1 gene to inhibit or reduce the activity of the SGR1 protein or the expression of the SGR1 gene in tomatoes.
[0014] This application also provides a method for cultivating cold-resistant tomatoes, including the following steps:
[0015] By editing the SGR1 gene in tomatoes, cold-resistant tomatoes were obtained.
[0016] Preferably, the gene editing includes editing the SGR1 gene to inhibit or reduce the activity of the SGR1 protein or the expression of the SGR1 gene in tomatoes.
[0017] Preferably, the gene editing includes gene editing using a CRISPR / Cas9 system.
[0018] Preferably, the target sequences for gene editing using the CRISPR / Cas9 system include nucleotides 30-48 of the third exon region and nucleotides 265-283 of the fourth exon region of the tomato SGR1 gene; the sequence of nucleotides 30-48 of the third exon region of the tomato SGR1 gene is shown in SEQ ID NO.10; the sequence of nucleotides 265-283 of the fourth exon region of the tomato SGR1 gene is shown in SEQ ID NO.11.
[0019] This application also provides a set of expression cassettes for cultivating low-temperature resistant tomatoes, the expression cassettes including sgRNA01 expression cassette and sgRNA02 expression cassette; the sgRNA01 expression cassette targets nucleotides 30-48 of the third exon region of the tomato SGR1 gene, and the sgRNA02 expression cassette targets nucleotides 265-283 of the fourth exon region of the tomato SGR1 gene; the sequence of nucleotides 30-48 of the third exon region of the tomato SGR1 gene is shown in SEQ ID NO.10; the sequence of nucleotides 265-283 of the fourth exon region of the tomato SGR1 gene is shown in SEQ ID NO.11.
[0020] This application also provides a plasmid for cultivating low-temperature resistant tomatoes, the plasmid comprising the expression cassette described in the above technical solution.
[0021] This application also provides a recombinant microbial strain for cultivating low-temperature resistant tomatoes, wherein the recombinant microbial strain includes the plasmid described in the above technical solution.
[0022] This application discloses the application of the tomato SGR1 gene in the breeding of cold-resistant tomatoes. This application utilizes gene editing for targeted improvement of cold-resistant tomato germplasm resources. By targeting the tomato SGR1 gene, tomatoes with stronger cold resistance can be obtained in a short time and with high efficiency. Experimental results show that editing the SGR1 gene to inhibit or reduce the activity of the SGR1 protein or the expression of the SGR1 gene in tomatoes can delay leaf senescence under low-temperature stress, increase the content of lycopene, chlorophyll, and β-carotene in tomatoes under low-temperature stress, and improve the cold resistance of tomato plants. It also inhibits the increase in MDA content in tomato leaves caused by low-temperature stress, increases the proline content in tomato leaves under low-temperature stress, delays the decrease in leaf water content caused by low-temperature stress, inhibits the ROS burst in tomato leaves caused by low-temperature stress, inhibits the increase in catalase and peroxidase activity caused by low-temperature stress, and increases the activity of antioxidant enzymes under low-temperature stress. This reduces the damage to tomatoes under low temperatures and improves their low-temperature tolerance.
[0023] Biological Preservation Information
[0024] Tomato seed (Solanum lycopersicum L.) T069, deposited at the China Center for Type Culture Collection (CCTCC) on August 5, 2024. Address: Wuhan University, Wuhan, China. Accession number: CCTCC NO: P202422. Attached Figure Description
[0025] To more clearly illustrate the technical solutions in the embodiments of this application or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0026] Figure 1 shows the results of the SlSGR1 gene structure and target site sequence analysis of homozygous edited lines provided in this application.
[0027] Figure 2 shows the results of the genotype translation process analysis of different edited plants provided in this application;
[0028] Figure 3 shows the performance of the wild-type plant T048 and the sgr1 mutant plant provided in this application in a winter greenhouse.
[0029] Figure 4 shows the effect of low temperature stress on the sgr1 mutant and wild-type T048 provided in this application; where A is the phenotypic diagram of tomato seedlings on the 5th day of cold stress treatment, B is the MDA content diagram, C is the proline content diagram, and D is the relative water content diagram.
[0030] Figure 5 shows the effect of low temperature stress on the sgr1 mutant and wild-type T069 provided in this application; where A is the phenotypic diagram of tomato seedlings on the 5th day of cold stress treatment, B is the MDA content diagram, C is the relative water content diagram, and D is the proline content diagram.
[0031] Figure 6 shows the H2O2 and O2 levels in the T048 tomato material under low-temperature stress caused by the mutation of the SlSGR1 gene provided in this application. - Figures showing the results of decreased content and increased antioxidant enzyme activity; where A is the staining pattern of DAB and NBT, and B is the staining pattern of H2O2 and O2. - Content graph, C represents antioxidant enzyme activity graph;
[0032] Figure 7 shows the H2O2 and O2 levels in the T069 tomato material under low-temperature stress caused by the mutation of the SlSGR1 gene provided in this application. - Figures showing the results of decreased content and increased antioxidant enzyme activity; where A is the staining pattern of DAB and NBT, and B is the staining pattern of H2O2 and O2. - Content graph, C represents antioxidant enzyme activity graph. Detailed Implementation
[0033] This application discloses the application of gene editing of the tomato SGR1 gene or reagents for gene editing of the tomato SGR1 gene in the cultivation of cold-resistant tomatoes. The nucleotide sequence of the tomato SGR1 gene is shown in SEQ ID NO.1. The stay-green gene 1 (STAY-GREEN1, SGR1) is a key factor in chlorophyll degradation and organ senescence during plant growth and development; its loss of function leads to a stay-green phenotype in green plants. However, research on the tomato stay-green gene 1 (Solanum lycopersicum STAY-GREEN1, SGR1) has largely focused on improving fruit quality. This application is the first to discover that the tomato SGR1 gene plays a regulatory role in tomato cold stress. By gene editing of the tomato SGR1 gene, specifically by editing the SGR1 gene to inhibit or reduce the activity of the SGR1 protein or the expression of the SGR1 gene in tomatoes, cold-resistant tomatoes can be obtained.
[0034] This application also provides the application of the reagents for gene editing of the tomato SGR1 gene in any one or more of ① to ⑥:
[0035] ① Inhibit the increase in MDA content in tomato leaves caused by low temperature stress;
[0036] ② Increase the proline content in tomato leaves under low temperature stress;
[0037] ③ It delays the decrease in water content of tomato leaves caused by low temperature stress;
[0038] ④ Inhibit the ROS surge in tomato leaves caused by low temperature stress;
[0039] ⑤ Inhibits the increase in catalase and peroxidase activity caused by low temperature stress;
[0040] ⑥ Improve the activity of antioxidant enzymes under low temperature stress; the antioxidant enzymes include CAT, SOD and POD.
[0041] In this application, the gene editing preferably includes editing the SGR1 gene to inhibit or reduce the activity of the SGR1 protein or the expression of the SGR1 gene in tomatoes. This application does not specifically limit the method of gene editing; conventional gene editing methods, such as using the CRISPR / Cas9 system, are acceptable.
[0042] This application also provides a method for cultivating cold-resistant tomatoes, including the following steps:
[0043] By editing the SGR1 gene in tomatoes, cold-resistant tomatoes were obtained.
[0044] In this application, the gene editing includes editing the SGR1 gene to inhibit or reduce the activity of the SGR1 protein or the expression of the SGR1 gene in tomatoes. This application achieves the acquisition of cold-resistant tomatoes by constructing transgenic tomato plants with loss of SGR1 protein function. In this application, the gene editing preferably includes gene editing using a CRISPR / Cas9 system. In this application, the target sequences for gene editing using the CRISPR / Cas9 system preferably include nucleotides 30-48 of the third exon region and nucleotides 265-283 of the fourth exon region of the tomato SGR1 gene; the sequence of nucleotides 30-48 of the third exon region of the tomato SGR1 gene is shown in SEQ ID NO. 10; the sequence of nucleotides 265-283 of the fourth exon region of the tomato SGR1 gene is shown in SEQ ID NO. 11.
[0045] In this application, the tomato varieties preferably include large-fruited tomato material T048 or cherry-type material T069.
[0046] Using the method described in this application, four different types of low-temperature resistant tomatoes with different editing types were obtained, namely the tomato material T048 gene-edited strain sgr1-4. # -10、sgr1-12 # -1 and sgr1-22 # -12 and tomato material T069 gene-edited strain sgr1-7 # -7. sgr1-4 # The -10 strain underwent a 564 bp sequence inversion between the two editing sites sgRNA01 and sgRNA02; sgr1-12 # The -1 strain showed an insertion of one A base at the sgRNA01 target site and a deletion of four bases at the sgRNA02 target site; sgr1-22 # -12 resulted in a 26-base deletion at the sgRNA01 target site and an 11-base deletion at the sgRNA02 target site; sgr1-7 # -7 A 552bp deletion occurred between the two editing sites, sgRNA01 and sgRNA02. All four tomato lines successfully edited the tomato SGR1 gene, inhibiting or reducing the activity of the SGR1 protein or the expression of the SGR1 gene in tomatoes. Furthermore, the low-temperature tolerance of all four edited tomato lines was significantly improved compared to the wild type.
[0047] This application also provides a set of expression cassettes for cultivating low-temperature resistant tomatoes, the expression cassettes including sgRNA01 expression cassette and sgRNA02 expression cassette; the sgRNA01 expression cassette targets nucleotides 30-48 of the third exon region of the tomato SGR1 gene, and the sgRNA02 expression cassette targets nucleotides 265-283 of the fourth exon region of the tomato SGR1 gene; the sequence of nucleotides 30-48 of the third exon region of the tomato SGR1 gene is shown in SEQ ID NO.10; the sequence of nucleotides 265-283 of the fourth exon region of the tomato SGR1 gene is shown in SEQ ID NO.11.
[0048] This application also provides a plasmid for cultivating cold-resistant tomatoes, the plasmid comprising the expression cassette described in the above-mentioned technical solution. This application does not specifically limit the construction method of the plasmid; conventional recombinant vector construction methods can be used. In this application, the base plasmid for constructing the plasmid preferably includes the pKSE401 vector.
[0049] This application also provides a recombinant microbial strain for cultivating low-temperature resistant tomatoes, wherein the recombinant microbial strain includes the plasmid described in the above-mentioned technical solution. In this application, the host bacteria for constructing the recombinant microbial strain preferably include Escherichia coli or Agrobacterium.
[0050] To further illustrate this application, the application of the tomato SGR1 gene provided in this application in the cultivation of cold-resistant tomatoes and the method for cultivating cold-resistant tomatoes are described in detail below with reference to the accompanying drawings and embodiments. However, these descriptions should not be construed as limiting the scope of protection of this application.
[0051] Both tomato materials "T048" and "T069" are excellent high-generation inbred lines, exhibiting indeterminate growth. "T048" produces large-fruited, pink tomatoes with an average single fruit weight of 164g, no green shoulders, vigorous growth, and strong fruit setting ability. "T069" is a cherry tomato, also pink, with soluble solids reaching 9.72%, vigorous growth, and strong fruit setting ability. An article based on "T048" material, titled "Creating New High-Lycopene Tomato Materials Using CRISPR / Cas9 Technology," has been published in the *Journal of Horticulture*, Volume 2, Issue 51, 2024. The tomato materials were cultivated in the Modern Agricultural Science and Technology Innovation Demonstration Park of the Sichuan Academy of Agricultural Sciences under normal water and fertilizer management.
[0052] The CRISPR / Cas9 system-related vector pKSE401 and intermediate vector pCBC-DT1T2 were purchased from Addgene (https: / / www.addgene.org / ). Escherichia coli DH5α competent cells and Agrobacterium tumefaciens GV3101 competent cells were both purchased from Chengdu Qingke Zixi Biotechnology Co., Ltd.
[0053] The DNA sequence of the SlSGR1 gene described in this application is shown in SEQ ID NO.1:
[0054] ATGGGAACTTTGACTACTTCTCTAGTGGTTCCATCTAAGCTCAACAATGAACAACAGAGCTCTATTTTTATACACAAAACTAGAAGGAAATGCAAGAAGAATCAATCCATAGTACCTGTGGCAAGGTTATTTGGACCAGCTATATTTGAAGCTTCAAAATTGAAGGTACTTTTTTTGGGAGTTGATGAAGAAAAGCATCCAGGAAAGTTGCCAAGAACATATACACTGACTCATAGTGATATTACTTCTAAACTTACTTTGGCTATCTCCCAAACCATCAATAATTCTCAGTTGCAAGGTTGGTATAACAGACTTCAAAGAGATGAAGTTGTTGCAGAGTGGAAGAAAGTAAAAGGGAAGATGTCACTTCATGTCCATTGCCACATTAGTGGAGGCCATTTTATGTTAGACTTATTTGCTAGACTCAGAAACTACATCTTCTGCAAAGAACTCCCTGTGGTTCTCAAGGCTTTTGTTCATGGAGATGAGAATTTACTAAGGAATTATCCAGAGTTACAAGAAGCTTTAGTTTGGGTATATTTTCATTCAAACATTCAAGAATTCAACAAAGTAGAATGTTGGGGTCCACTCAGAGATGCAACTTCCCCCTCATCTTCTTCTGGTGGGGTAGGTGGGGTGAAGAGTACAAGTTTTACAAGCAATAGCAACAAAAAATGGGAATTACCAAAGCCTTGTGAAGAGGCTTGTGCCTGTTGCTTTCCCCCAGTGAGTGTTATGCCTTGGCTTTCTTCAAATCTTGATGGGGTAGGTGAGGAAAATGGGACCATCCAACAAGGCTTGCAAGAGCAGCAAAGTTGA, the underlined part is the target site sequence.
[0055] Example 1
[0056] Obtaining tomato SlSGR1 gene-edited lines.
[0057] (1) Target site design and construction of CRISPR / Cas9 expression vector
[0058] Target sites for the tomato chlorosis gene SlSGR1 (Gene_ID: Solyc08g080090) were designed using the online plant genome editing target site design software CRISPR-P v2.0 (http: / / crispr.hzau.edu.cn / CRISPR2 / ). Several target sites with a predicted on-score greater than 0.5 and located within the CDS (Coding sequence) region were selected. Tomato genome BLAST (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) alignment analysis was performed on the selected target sites to exclude non-specific targets. The nucleotide sequence of the sgRNA01 target is 5'-AGATGAAGTTGTTGCAGAG-3' (SEQ ID NO.10), corresponding to nucleotides 321-339 in SEQ ID NO.1; the nucleotide sequence of the sgRNA02 target is 5'-CCAGTGAGTGTTATGCCTT-3' (SEQ ID NO.11), corresponding to nucleotides 724-742 in SEQ ID NO.1. A Bsa I endonuclease recognition sequence was added to the 5' end and a PCR overlapping sequence was added to the 3' end, forming primer pairs SGR1-target1-F (SEQ ID NO.2) and SGR1-target2-R (SEQ ID NO.3) (Table 1), which were synthesized by Chengdu Qingke Zixi Biotechnology Co., Ltd.
[0059] Using the pCBC-DT1T2 intermediate vector as a template, PCR amplification was performed using PrimeSTAR HSDNA polymerase (TaKaRa, Dalian), and primer pairs SGR1-target1-F and SGR1-target2-R. The amplified products were digested with BsaI, and the digested products were ligated into the pKSE401 vector, which was also digested with BsaI. The recombinant vector was then transformed into *E. coli* DH5α competent cells using a heat shock method. Positive clones were detected by PCR using primers M13-F (SEQ ID NO.4) and SGR1-target2 (SEQ ID NO.5) (Table 1). Positive bacterial cultures were sent to Chengdu Qingke Zixi Biotechnology Co., Ltd. for first-generation sequencing verification. The successfully constructed vector was named pKSE401-SGR1 and transformed into *Agrobacterium* GV3101 competent cells using a heat shock method. After positive verification, 85% glycerol was added, and the cells were stored at -80°C for later use.
[0060] Table 1 Primers used in this application
[0061] (2) Agrobacterium-mediated genetic transformation of tomato
[0062] Tomato genetic transformation was performed using Agrobacterium-mediated cotyledon transformation. Tomato seeds were sterilized with sodium hypochlorite solution and sown in 1 / 2 MS medium, cultured at 25°C under long-day conditions for 6–7 days. When the cotyledons were fully expanded, the middle section of each cotyledon was taken and spread flat on pre-cultured medium in the dark for 1 day. Agrobacterium containing the pKSE401-SGR1 plasmid was activated overnight to prepare the Agrobacterium infection solution, and the OD was adjusted. 600 =0.1, after infecting the cotyledons for 20 minutes, the bacterial solution was aspirated and cultured in the dark for 2 days; then the cotyledons were transferred to selection medium for culture, and the medium was replaced with fresh medium every 3-4 weeks for subculturing; finally, resistant adventitious buds were cut off and transferred to rooting medium to induce rooting. When the tomato seedlings grew to about 10cm, a small number of leaves were taken for testing.
[0063] (3) Identification of transgenic positive plants and detection of target sites
[0064] Genomic DNA was extracted from the leaves of the transgenic plants to be tested using the CTAB method. Using the extracted genomic DNA as a template, the Cas9 gene was amplified by PCR using Cas9-F (SEQ ID NO. 6) and Cas9-R primers (SEQ ID NO. 7) (Table 1) to identify positive transgenic lines. Subsequently, using the DNA of the positive transgenic lines as a template, DNA high-fidelity polymerase was used... FastPfu DNA Polymerase (Quanshijin, Beijing) and primers SGR1-Seqtarget-F (SEQ ID NO.8) and SGR1-Seqtarget-R (SEQ ID NO.9) (Table 1) amplified genomic sequences containing two target sites. The PCR products were sent to Chengdu Qingke Zixi Biotechnology Co., Ltd. for first-generation sequencing. The sequencing results were analyzed using the DSDecodeM website (http: / / skl.scau.edu.cn / dsdecode / ) and Geneious software. The results showed that using large-fruited tomato T048 and cherry tomato T069 as materials, the target gene S1SGR1 was directionally edited using the CRISPR-Cas9 editing system, resulting in edited plants with different genotypes. The T0 generation gene-edited plants were self-crossed twice to obtain the T2 generation gene-edited plants. Using tomato T048 as material, three homozygous edited lines were obtained: sgr1-4. # -10、sgr1-12 # -1 and sgr1-22 # -12. sgr1-4 #The -10 strain underwent a 564 bp sequence inversion between the sgRNA01 and sgRNA02 editing sites, corresponding to nucleotides 329–733 of SEQ ID NO. 1; sgr1-12 # The -1 strain showed an insertion of one A base at the sgRNA01 target site and a deletion of four bases at the sgRNA02 target site, corresponding to the insertion of one A base between nucleotides 336 and 337 of SEQ ID NO.1 and the deletion of nucleotides 730 to 733, respectively; sgr1-22 # -12 showed a 26-base deletion at the sgRNA 01 target site and an 11-base deletion at the sgRNA 02 target site, corresponding to the deletions of nucleotides 313–338 and 728–738 in SEQ ID NO. 1, respectively; using tomato T069 as material, a homozygous edited line, sgr1-7, was obtained. # -7 indicates a 552 bp deletion in the genome between the sgRNA01 and sgRNA02 editing sites, corresponding to nucleotides 337–727 of SEQ ID NO. 1. These results demonstrate that the SlSGR1 gene can be directionally edited in different tomato cultivars, yielding edited plants with different genotypes. Furthermore, homozygous edited plants without exogenous DNA can be obtained through continuous self-pollination. Figure 1 shows the SlSGR1 gene structure and the results of target site sequence analysis in homozygous edited lines.
[0065] Analysis of the protein structures generated by translation under four different editing types of the SGR1 gene revealed that sgr1 # In the -4-10 strain, inversion at two sites led to premature termination of SGR1 translation. Similarly, in sgr1-12... # -1 and sgr1-22 # The -12 edited strain experienced a 1 bp insertion and a 26 bp deletion at the sgRNA01 editing site, both of which induced premature termination of SGR1 translation (Figure 2); while in sgr1-7 # In plants with the -7 mutation, a polypeptide lacking 130 amino acids is encoded (Figure 2), which also leads to premature termination of SGR1 translation. These mutations all disrupt the CRM (Cysteine Rich Motif) domain, a key structural domain for the SGR1 protein to catalyze the removal of magnesium ions from chlorophyll a, thereby causing inactivation of the SGR1 protein.
[0066] Example 2
[0067] Low-temperature tolerance test of SlSGR1 gene-edited plants
[0068] Compared to wild-type tomato T048, edited plants sgr1-4 # -10 Leaves show delayed senescence, mature fruit peels are rust-red, and the pulp and pectin are rust-colored and green, respectively. Compared with wild-type tomato T048, the edited strains show 3.2 times, 6.88 times, and 8.65 times higher contents of lycopene, chlorophyll, and β-carotene, respectively. The T3 generation gene-edited plant sgr1-4 # -10 and wild-type plants (T048) were sown at the end of August 2022 and transplanted at the end of September into the research greenhouse of the Institute of Horticulture, Sichuan Academy of Agricultural Sciences (Jinjiang District, Chengdu, Sichuan Province). Normal fertilizer and water management was implemented, and photographs were taken in mid-December. In mid-December, the average daytime temperature inside the greenhouse was approximately 12℃, and the average nighttime temperature was approximately 5℃. As shown in Figure 3, under the lower greenhouse temperature, the leaves of the wild-type plants turned yellow, and the entire plant wilted. In contrast, the gene-edited plant sgr1-4... # It can still grow normally at -10. Figure 3 shows the performance of wild-type plants T048 and sgr1 mutant plants in a greenhouse during winter.
[0069] T3 generation gene-edited plant sgr1-4 # -10、sgr1-12 # -1、sgr1-22 # -12 and sgr1-7 # Seeds from wild-type plants (T048 and T069) were sown at -7°C. Four weeks later, the plants were treated at 25°C and 4°C in an artificial incubator. After 6 days of low-temperature treatment, the low-temperature stress treatment group was compared with the control group under the same conditions without low-temperature treatment to observe the phenotypes of wild-type and gene-edited plants. The results showed that after low-temperature treatment, the leaves of wild-type tomato plants curled more than those of gene-edited plants, indicating that wild-type tomatoes wilted more under low temperatures (A in Figure 4 and A in Figure 5).
[0070] Example 3
[0071] Physiological parameters of plants after low temperature stress test
[0072] Physiological parameters of tomato leaves were measured after 5 days of low-temperature treatment at 4℃, including malondialdehyde (MDA) content, proline content, leaf relative water content (RWC), and superoxide anion (O2) content. -The results of hydrogen peroxide (H2O2), catalase (CAT), peroxidase (POD), and superoxide dismutase (SOD) activities were measured. MDA content, proline content, and relative water content are shown in Figures 4 and 5. Figure 4 shows the effects of low-temperature stress on the sgr1 mutant and wild-type T048; (A) phenotypes of the sgr1 mutant and wild-type after 5 days of 4℃ low-temperature treatment; (BD) malondialdehyde (MDA) and proline content, as well as relative water content (RWC) of leaves in the sgr1 mutant and wild-type after 5 days of 4℃ low-temperature treatment; sgr1-4 # -10、sgr1-12 # -1、sgr1-22 # -12: sgr1 mutant. Figure 5 shows the effects of low temperature stress on the sgr1 mutant and wild-type T069; (A) phenotypes of the sgr1 mutant and wild-type after 5 days of treatment at 4℃; (BD) malondialdehyde (MDA) and proline content, as well as relative water content (RWC) of leaves of the sgr1 mutant and wild-type after 5 days of treatment at 4℃; sgr1-7 # -7: sgr1 mutant.
[0073] The results showed that the MDA content in the sgr1 mutant was significantly lower than that in the wild type, while the proline content was significantly higher. Furthermore, the RWC of the mutant leaves was significantly higher than that of the wild type (B-D in Figure 4, B-D in Figure 5). These results indicate that the sgr1 mutant is less damaged by low temperatures compared to the wild type.
[0074] The sgr1 mutation leads to increased H2O2 and O2 in plants. - The content decreased and the antioxidant enzyme activity increased, as shown in Figures 6 and 7. Figure 6 shows the results of the decrease in ROS content under low temperature stress in T048 tomato material caused by the mutation of the SlSGR1 gene and the effect of cold stress on the antioxidant enzyme system; among them, (A) DAB (top) and NBT (bottom) staining showed that the mutation of SlSGR1 inhibited the ROS burst caused by low temperature stress; (B) H2O2 and O2 before and after low temperature treatment - Content detection; (C) Detection of CAT, SOD and POD enzyme activities before and after low-temperature treatment; sgr1-4 # -10、sgr1-12 # -1、sgr1-22 #-12: sgr1 mutant. Figure 7 shows the results of the decrease in ROS content under low temperature stress in T069 tomato material due to the mutation of the SlSGR1 gene and the effect of cold stress on the antioxidant enzyme system; among them, (A) DAB (top) and NBT (bottom) staining showed that the mutation of SlSGR1 inhibited the ROS burst caused by low temperature stress; (B) H2O2 and O2 before and after low temperature treatment - Content detection; (C) Detection of CAT, SOD and POD enzyme activities before and after low-temperature treatment; sgr1-7 # -7: sgr1 mutant.
[0075] After low-temperature treatment, the H2O2 and O2 of the sgr1 mutant plants - The content of harmful substances was significantly reduced compared to the wild type. Furthermore, compared to wild-type tomatoes, the sgr1 mutant plants showed increased activities of catalase (CAT), peroxidase (POD) (Figure 6A and 6B, Figure 7A and 7B), and significantly increased superoxide dismutase (SOD) activity (Figure 6C, Figure 7C). These results indicate that mutations in the SlSGR1 gene can alleviate ROS accumulation in tomatoes after low-temperature stress and stimulate increased antioxidant enzyme activity, thereby improving the low-temperature tolerance of tomatoes.
[0076] Furthermore, it has been verified that after the gene mutation, the soluble solids and vitamin C levels that affect the taste of tomatoes did not change significantly.
[0077] Although the above embodiments have provided a detailed description of this application, they are only some embodiments of this application, not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of this application.
Claims
1. Application of the tomato SGR1 gene in the cultivation of cold-resistant tomatoes, wherein the nucleotide sequence of the tomato SGR1 gene is shown in SEQ ID NO.
1.
2. The application of gene editing of the tomato SGR1 gene or the reagent for gene editing of the tomato SGR1 gene in the cultivation of low-temperature resistant tomatoes, wherein the nucleotide sequence of the tomato SGR1 gene is shown in SEQ ID NO.
1.
3. The application of the reagents used for gene editing of the tomato SGR1 gene, or in any one or more of ① to ⑥: ① Inhibit the increase in MDA content in tomato leaves caused by low temperature stress; ② Increase the proline content in tomato leaves under low temperature stress; ③ It delays the decrease in water content of tomato leaves caused by low temperature stress; ④ Inhibit the ROS surge in tomato leaves caused by low temperature stress; ⑤ Inhibits the increase in catalase and peroxidase activity caused by low temperature stress; ⑥ Enhance the activity of antioxidant enzymes under low temperature stress; the antioxidant enzymes include CAT, SOD and POD; The nucleotide sequence of the tomato SGR1 gene is shown in SEQ ID NO.
1.
4. The application according to claim 2 or 3, characterized in that, The gene editing includes editing the tomato SGR1 gene to inhibit or reduce the activity of the SGR1 protein or the expression of the SGR1 gene in tomatoes.
5. The application according to claim 2 or 3, characterized in that, The gene editing involves editing the tomato SGR1 gene to cause the tomato SGR1 protein to lose its function.
6. The application according to claim 2 or 3, characterized in that, The reagents used for gene editing of the tomato SGR1 gene include those used in gene editing with the CRISPR / Cas9 system.
7. The application according to claim 6, characterized in that, The target sequences for the gene editing include nucleotides 30–48 of the third exon region and nucleotides 265–283 of the fourth exon region of the tomato SGR1 gene; the sequence of nucleotides 30–48 of the third exon region of the tomato SGR1 gene is shown in SEQ ID NO.10; the sequence of nucleotides 265–283 of the fourth exon region of the tomato SGR1 gene is shown in SEQ ID NO.
11.
8. A method for cultivating low-temperature resistant tomatoes, characterized in that, Includes the following steps: The tomato SGR1 gene was edited to obtain a low-temperature resistant tomato; the nucleotide sequence of the tomato SGR1 gene is shown in SEQ ID NO.
1.
9. The method according to claim 8, characterized in that, The gene editing includes editing the tomato SGR1 gene to inhibit or reduce the activity of the SGR1 protein or the expression of the SGR1 gene in tomatoes.
10. The method according to claim 8, characterized in that, The gene editing involves editing the tomato SGR1 gene to cause the tomato SGR1 protein to lose its function.
11. The method according to any one of claims 8 to 10, characterized in that, The gene editing includes gene editing using the CRISPR / Cas9 system.
12. The method according to claim 11, characterized in that, The target sequences for gene editing using the CRISPR / Cas9 system include nucleotides 30–48 of the third exon region and nucleotides 265–283 of the fourth exon region of the tomato SGR1 gene; the sequence of nucleotides 30–48 of the third exon region of the tomato SGR1 gene is shown in SEQ ID NO.10; the sequence of nucleotides 265–283 of the fourth exon region of the tomato SGR1 gene is shown in SEQ ID NO.
11.
13. The method according to claim 12, characterized in that, The gene editing using the CRISPR / Cas9 system includes any of the following gene editing operations on the target gene: a 564 bp sequence inversion between the two editing sites sgRNA01 and sgRNA02; an insertion of one A base at the sgRNA01 target site and a deletion of four bases at the sgRNA02 target site; a deletion of 26 bases at the sgRNA01 target site and an deletion of 11 bases at the sgRNA02 target site; or a 552 bp deletion between the two editing sites sgRNA01 and sgRNA02.
14. A set of expression boxes for cultivating low-temperature resistant tomatoes, characterized in that, The expression cassette includes an sgRNA01 expression cassette and an sgRNA02 expression cassette; the sgRNA01 expression cassette targets nucleotides 30-48 of the third exon region of the tomato SGR1 gene, and the sgRNA02 expression cassette targets nucleotides 265-283 of the fourth exon region of the tomato SGR1 gene; the sequence of nucleotides 30-48 of the third exon region of the tomato SGR1 gene is shown in SEQ ID NO.10; the sequence of nucleotides 265-283 of the fourth exon region of the tomato SGR1 gene is shown in SEQ ID NO.
11.
15. A plasmid for cultivating low-temperature resistant tomatoes, characterized in that, The plasmid includes the expression cassette as described in claim 8.
16. The plasmid according to claim 15, characterized in that, The base plasmid of the plasmid includes the pKSE401 vector.
17. A recombinant microbial strain for cultivating low-temperature resistant tomatoes, characterized in that, The recombinant microbial strain includes the plasmid described in claim 15 or 16.
18. A cold-resistant tomato plant, sgr1-4 # -10 strain, characterized by The low-temperature resistant tomato SGR1-4 # The -10 strain, based on the tomato material T048, has a 564 bp sequence inversion between two editing sites, sgRNA01 and sgRNA02; sgRNA01 is nucleotides 30-48 of the third exon region of the tomato SGR1 gene, and sgRNA02 is nucleotides 265-283 of the fourth exon region of the tomato SGR1 gene.
19. A cold-resistant tomato plant, sgr1-12 # -1 strain, characterized by, The low-temperature resistant tomato SGR1-12 # The -1 strain, based on tomato material T048, has an insertion of one A base at the sgRNA01 target site and a deletion of four bases at the sgRNA02 target site; sgRNA01 is nucleotides 30-48 in the third exon region of the tomato SGR1 gene, and sgRNA02 is nucleotides 265-283 in the fourth exon region of the tomato SGR1 gene.
20. A cold-resistant tomato plant sgr1-22 # -12 strain, characterized by, The low-temperature resistant tomato SGR1-22 # The -12 strain, based on the tomato material T048, exhibited a 26-base deletion at the sgRNA01 target site and an 11-base deletion at the sgRNA02 target site. The sgRNA01 is nucleotides 30-48 in the third exon region of the tomato SGR1 gene, and the sgRNA02 is nucleotides 265-283 in the fourth exon region of the tomato SGR1 gene.
21. A cold-resistant tomato plant, sgr1-7 # -7 strain, characterized by The low-temperature resistant tomato SGR1-7 # The -7 strain, based on the tomato material T069, had a 552 bp deletion between two editing sites, sgRNA01 and sgRNA02. sgRNA01 is nucleotide 30-48 of the third exon region of the tomato SGR1 gene, and sgRNA02 is nucleotide 265-283 of the fourth exon region of the tomato SGR1 gene.
Citation Information
Cited By
Molecular marker related to low-temperature resistance of tomato and application of molecular marker
CN122038645A