Methods of manufacturing cell-laden scaffolds comprising lipid-producing cells
A method for manufacturing cell-laden scaffolds with lipid-producing cells using food-grade materials and media addresses the safety concerns of existing methods, enabling the production of viable lipid-producing cells for cultivated meat applications, thereby improving the quality and safety of cultivated meat products.
Patent Information
- Application Number
- PCT/SG2025/050656
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-10-09
- Filing Date
- 2025-10-09
- Publication Date
- 2026-04-16
AI Technical Summary
Current methods for cultivating fats for cultivated meat applications use specialized differentiation media containing chemical inducers that are not safe for human and animal consumption, necessitating the development of alternative methods for producing fats.
A method involving the preparation of a mixture comprising lipid-producing precursor cells and a food-grade polymeric solution, forming a three-dimensional environment, and culturing the cells in a food-grade differentiation medium to differentiate lipid-precursor cells into lipid-producing cells, without the use of unsafe chemical inducers.
This approach enables the production of viable lipid-producing cells within a three-dimensional environment, reducing contamination risks and ensuring the safety of the manufacturing process by eliminating the need for toxic chemicals, while enhancing the sensory and nutritional qualities of cultivated meat.
Smart Images

Figure 00000063_0000 
Figure 00000063_0001 
Figure 00000064_0000
Abstract
Description
METHODS OF MANUFACTURING CELL-LADEN SCAFFOLDS COMPRISING LIPID-PRODUCING CELLSCROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to the Singapore provisional application no. 10202403161 W, filed on 9 October 2024, the contents of it being hereby incorporated by reference in its entirety for all purposes.FIELD OF THE INVENTION
[0002] The present invention relates generally to the field of cellular agriculture. Particularly, it relates to methods of manufacturing an environment for producing lipids in vitro.BACKGROUND
[0003] Cellular agriculture is an emerging field that aims to manufacture agricultural products derived from cell culture technology rather than traditional farming and harvesting of livestock or plants Cellular agriculture has promising potential in large scale production of food products, with less environmental burden. In addition, cellular agriculture offers benefits such as no slaughtering of animals, easier pathogen control, and potentially antibiotic-free and pollution-free production in the production process.
[0004] Cell-based meat, also referred to as cultured meat, clean meat, lab-grown meat or cultivated meat, utilizes cellular agriculture techniques and biomanufacturing technology of animal cell lines in order to create edible food structures similar to animal meats. While muscles being the predominant constituent of meat products, fat, especially intramuscular fat, contributes to juiciness and tenderness in meat, hence improving palatability and satiation.
[0005] Currently, methods of cultivating and producing fats for cultivated meat application are limited, and known methods of cultivating fats use specialized differentiation medium containing chemical inducers that are not safe for human and animal consumption. There is therefore an unmet need for alternative methods of producing fats for cultivated meat applications.SUMMARY OF INVENTION
[0006] Tn one aspect, the present disclosure relates to a method of manufacturing a cell-laden scaffold comprising lipid-producing cells, the method comprising: (a) preparing a mixture comprising lipid-producing precursor cells and a food-grade polymeric solution; (b) forminga three-dimensional (3D) environment from the mixture from (a) such that the lipid-producing precursor cells are confined in the 3D environment; and (c) culturing the lipid-producing precursor cells confined in 3D environment from (b) in a food-grade differentiation medium for differentiating the lipid-precursor cells into lipid-producing cells to obtain the cell-laden scaffold.[007J In another aspect, the present disclosure relates to a cell-laden scaffold comprising lipid-producing cells, obtained or obtainable from the method as disclosed herein.
[0008] In another aspect, the present disclosure relates to a cell-laden scaffold comprising one or more food-grade scaffold materials and one or more types of cells, wherein the cell -laden scaffold is characterized by a stiffness of 0.1 - 15 kPa.
[0009] Tn yet another aspect, the present disclosure relates to a kit for obtaining a cell-laden scaffold comprising lipid-producing cells, the kit comprising: (a) one or more food-grade scaffold materials; (b) one or more populations of lipid-producing precursor cells; and (c) a food-grade differentiation medium for differentiating the lipid-producing precursor cells into the lipid-producing cells.
[0010] In another aspect, the present disclosure relates to a method of differentiating a lipid- producing precursor cell into a lipid-producing cell, wherein the method comprises culturing the lipid precursor cell in a food-grade differentiation medium consisting essentially of a basal cell growth medium with or without a serum, and optionally an antibiotic.
[0011] In another aspect, the present disclosure relates to a food-grade differentiation medium comprising one or more fatty acids, wherein the food-grade differentiation medium is serum- free or contains about 1-3% of a serum.BRIEF DESCRIPTION OF THE DRAWINGS
[0012] The invention will be better understood with reference to the detailed description when considered in conjunction with the non-limiting examples and the accompanying drawings, in which:
[0013] Figure 1 provides data to show the diameter of microfibers obtained from wet-spinning of an alginate-gelatin composition. Representative images of wet-spun microfibers of each alginate-gelatin composition wet-spun at flow rate of 0.1 ml / min, and drum speed of 80 rounds per minute (rpm) are shown in the figure. The lines in the figure indicate the diameter of the microfibers are shown on the top panel. Scalebar = 100 pm. Bar chart showing the average and standard errors of the diameter of the microfiber obtained are provided in the bottom panel. The samples are labelled “AYGX”, wherein “Y” represents the weight / volume (w / v)% ofalginate, denoted by “A”, and “X” represents the w / v% of gelatin, denoted by “G”. The average diameters of A3G3 and A3G4 microfibers were 99.44 ± 3.76 pm and 100.23 ± 3.65 pm, respectively, and did not differ significantly from each other (p>0.05). In contrast, A4G4 microfibers exhibited a larger average diameter of 113.86 ± 3.52 pm, which was statistically greater than both A3G3 and A3G4 (p<0.05). Statistical comparisons were conducted between each composition, with significance indicated as follows: samples labelled * denote a significant difference between A3G3 and A4G4, and samples labeled # denote a significant difference between A3G4 and A4G4. The number of microfibers quantified per group is 100 microfibers. Figure 1 provides an example of a possible basic scaffold structure in which the lipid-producing cells can differentiate and grow.
[0014] Figure 2 provides data to show the storage (G’) and loss (G”) modulus of hydrogels comprising different amount of alginate and gelatin when they are subjected to an amplitude sweep of 0.1-100% strain rate, at an angular frequency of 10 rad / s and at 37°C. The samples are labelled as “AYGX”, wherein “Y” represents the w / v% of alginate, denoted by “A”, and “X” represents the w / v% of gelatin, denoted by “G”.
[0015] Figure 3 provides data to show the storage (G’) and loss (G”) modulus of hydrogels comprising different amount of alginate and gelatin when they are subjected to a frequency sweep of 0.1-100 rad / s, at a strain of 1%, within the linear viscoelastic region (LVR) and at 37°C. The samples are labelled “AYGX”, in which “Y” represents the w / v% of alginate, denoted by “A”, and “X” represents the w / v% of gelatin, denoted by “G”.
[0016] Figure 4 provides data to show the gel strength or stiffness of the respective alginate- gelatin composite hydrogels as measured by storage modulus. The storage modulus of the hydrogels is taken at 1% strain and at angular frequency of 1 Hz. The samples are labelled “AYGX”, in which “Y” represents the w / v% of alginate, denoted by “A”, and “X” represents the w / v% of gelatin, denoted by “G”.
[0017] Figure 5 provides data to show that the porcine adipose derived stem cells (pADSCs) confined in a microfiber are capable of differentiating into adipocytes, which are characterized by expression of lipids. The figure shows inverted brightfield microscope images of pADSCs- laden microfibers scaffold containing 3% alginate and 3% gelatin (A3G3), stained with oil- red-O. Lipids were stained by oil -red-0 as indicated by white arrows Scalebar = 50 pm.
[0018] Figure 6 provides data showing the morphology of cell-laden microspheres (top) and size distribution (bottom) of fabricated microspheres based on a polymeric solution containing 0.5% alginate and 1.5% carboxymethyl cellulose (CMC) and electrosprayed at a flow rate of 2.5 mL / hr and an applied voltage of 11 kV. Scale bar = 100 pm.
[0019] Figure 7 provides representative brightfield images showing the morphology and size of fabricated microspheres from polymeric solutions containing 0.5% w / v alginate, or 0.5% w / v alginate and 0.5-2% w / v carboxymethyl cellulose (CMC) electrosprayed at 5 kV, 7 kV, 9 kV, 11 kV and 13 kV. Scalebar = 200 pm.
[0020] Figure 8 provides data showing the circularity of the microspheres (n=50) obtained from electrospraying a polymeric solution containing 0.5% w / v alginate and 1.0% w / v carboxymethyl cellulose (CMC, Figure 8A), 0.5% w / v alginate and 1.5% w / v CMC (Figure 8B) and 0.5% w / v alginate and 2.0% w / v CMC (Figure 8C) at applied voltages of 5 kV, 7 kV, 9 kV, 11 kV and 13 kV.
[0021] Figure 9 provides data showing the distribution of the diameter of microspheres (n=50) obtained from electrospraying a polymeric solution containing 0.5% w / v alginate and 1.0% w / v carboxymethyl cellulose (CMC, Figure 9A), 0.5% w / v alginate and 1.5% w / v CMC (Figure 9B) and 0.5% w / v alginate and 2.0% w / v CMC (Figure 9C) at applied voltages of 5 kV, 7 kV, 9 kV, 11 kV and 13 kV.
[0022] Figure 10 provides representative brightfield image of cells encapsulated in microspheres obtained from electrospraying a polymeric solution containing 0.5% w / v alginate and 1.5% w / v carboxymethyl cellulose (CMC) sprayed at applied voltage of 11 kV and 13 kV. Cells could be found outside of microspheres when an applied voltage of 13 kV was applied during electrospraying. Scale bar = 200 pm.
[0023] Figure 11 provides data showing the morphology and size of microspheres obtained from electrospraying polymeric solutions containing different amounts of alginate and carboxymethyl cellulose (CMC). Figure 11A shows brightfield images of microspheres obtained from electrospraying a polymeric solution containing 0.5% w / v alginate and 1.5% w / v CMC at voltages of 5 kV to 25 kV and flow rate of 2.5 mL / hr to 100 mL / hr. Scale bar = 200pm. As can be seen from Figure 11 A, increasing the flow rate of a polymeric solution containing 0.5% w / v alginate and 1.5% CMC during electrospraying from 2.5 mL / hr to 10 mL / hr produced morphologically uniform microspheres up to an applied voltage of 15 kV. When the flow rate was increased to 25 mL / hr, the fabricated microspheres were deformed indicating that the flow rate is too fast for electrospraying a polymeric solution containing 0.5% w / v alginate and 1.5% w / v CMC. When the viscosity of the polymeric solution is increased by increasing the amount of CMC to 2% w / v, uniform microspheres could be obtained at a flow rate of 100 mL / hr (Figure 1 IB) Microspheres having a diameter of up to about 1800 pm can be obtained from a polymeric solution containing 0.5% w / v alginate and 2% w / v CMC. The cells confined in large-diameter microspheres are also viable, which is shown in Figure 11C.Analysis of pADSCs cell viability confined in microspheres of about 350 pm, 550 pm and 1600 pm was performed using confocal microscopy. Green fluorescence indicates viable cells in Figure HC(i) while red fluorescence indicates dead cells show in Figure llC(ii). Representative maximum intensity projection obtained from confocal stacks are presented. Scalebar = 100 pm. Figure 11D provides the quantification of live (viable) and dead cells cultured in the microspheres having a diameter of about 350 pm, 550 pm and 1600 pm. The data shows that cells confined in microspheres having a larger diameter of 1600 pm are viable, similar to cells confined in smaller microsphere having a diameter of 350 pm.
[0024] Figure 12 provides data showing the stiffness of microspheres obtained from electrospraying a polymeric solution containing 0.5% w / v alginate and 1.5 % w / v carboxymethyl cellulose (CMC) (0.5 alg -1.5% CMC), 1% w / v alginate and 1.5% w / v CMC (1% alg-1.5% CMC) and 1.5% w / v alginate and 1.5 % w / v CMC (1.5% alg-1.5% CMC).
[0025] Figure 13 shows the effects of varying concentration of carboxymethyl cellulose (CMC) from 1% to 2% w / v while keeping the concentration of alginate at 0.5% w / v on the viscosity (Figure 13A), amplitude (strain) sweep curve (Figure 13B) and frequency sweep curves (Figure 13C) of the resultant hydrogel. An amplitude sweep was first performed to determine the linear viscoelastic region. This is to select for the strain to be used in subsequent frequency sweeps for measurement of storage modulus of the hydrogel. The strain to be selected should fall within the LVE region of all 3 hydrogel formulations where the moduli are constant, which was found to be in the range of 0.1 to 1% strain as shown in Figure 13B. The storage modulus of the different hydrogel formulations was determined via a frequency sweep of the material under a fixed strain of 0.1% as shown in Figure 13C.
[0026] Figure 14 provides data showing the swelling behavior of hydrogel containing 0.5% w / v alginate and 1.0 % w / v carboxymethyl cellulose (CMC), 0.5% w / v alginate and 1.5% w / v CMC, 0.5% w / v alginate and 2 % w / v CMC in terms of mean swelling capacity (Figure 14A) and mean water content (Figure 14B). The data shows an example of how varying the amount of CMC in hydrogel can affect swelling behavior. Data represents n=6 ± standard deviation of the mean. Comparison of means was done using one-way ANOVA with Tukey’s HSD post hoc test, *p<0.05, compared between hydrogels containing different CMC concentration.
[0027] Figure 15 provides quantification data of the cell viability of porcine adipose stem cells (pADSCs) confined in microsphere fabricated from 0.5% w / v alginate and 1.0 % w / v carboxymethyl cellulose (CMC) and cultured in a basal growth medium over 21 days Data represents average cell viability of cell-laden microspheres cultured in three independent wells (n=3) ± standard deviation of the mean.
[0028] Figure 16 provides photomicrographs showing the live and dead porcine adipose stem cells (pADSCs) confined in microsphere fabricated from 0.5% w / v alginate and 1.0 % w / v carboxymethyl cellulose (CMC) cultured over 21 days. Representative maximum intensity projection obtained from confocal stacks are presented. Scalebar = 100 pm.
[0029] Figure 17 provides representative confocal fluorescence images of porcine adipose stem cells (pADSCs) cultured on 2D tissue culture plates (2D GM, Figure 17A1) or confined in microspheres (3D GM, Figure 17A2) over 21 days and stained with LipidTOX for lipids and DAPI for nuclei. The cells were cultured in a basal cell culture medium without any addition of exogenous adipogenic small molecules. Figure 17B shows the corresponding data of lipid area per cell (pm2) across n=3 biological triplicates from cells in 2D GM and 3D GM groups Figure 17C provides the comparison of lipid area per cell (pm2) between pADSCs cultured on 2D culture dish with those in 3D microspheres on day 21 of culture, which shows that culturing under 3D conditions increases lipid accumulation in the cells by 2.7x compared to culturing under 2D conditions. Day 0 data point was shared for both cultures (ns p > 0.05, * p < 0.05, ** p < 0.01 , t test). Data represents mean ± standard error. Scale bar = 100 pm.
[0030] Figure 18 provides representative confocal fluorescence images of fish adipose stem cells (fADSCs) showing viability of the cells enclosed in microspheres. The images in the ‘Live’ row indicate viable cells; while images in the ‘Dead’ row indicate dead cells. Representative maximum intensity projection obtained from confocal stacks are presented. Scalebar = 100 pm.
[0031] Figure 19 provides the quantification of percentage of fish adipose stem cells (fADSCs) confined in microspheres and cultured over 21 days in growth media. Cell viability is measured as the percentage of the number of live cells over the total cell number of cells (live cells plus dead cells).
[0032] Figure 20 shows representative confocal fluorescence images of fish adipose stem cells (fADSCs)-laden microspheres cultured in a growth medium over 21 days on 2D culture plate (Figure 20A1) or confined in 3D microspheres (Figure 20A2). The cells were stained with the adipocyte marker, LipidTOX, and DAPI. Representative images were taken every 7 days from Day 0 to Day 21 . Representative maximum intensity projection obtained from confocal stacks are presented.
[0033] Figure 21 provides data showing the quantification of lipid produced per 10 million cells in mg over 21 days in cells from 2D GM group cultured on 2D cell culture plates and 3D GM group confined in 3D microsphere. The lipid produced was measured using Abeam triglyceride assay. Corresponding data of lipid produced in mg across n=3 biological triplicates.The data shows that culturing under 3D conditions increases lipid production in the cells. Day 0 data point was shared for both cultures (ns p > 0.05, *, # p < 0.05, t test). Data represents mean ± standard error.
[0034] Figure 22 provides representative confocal fluorescence images of fish adipose stem cells (fADSCs)-laden microspheres cultured in specialized differentiation medium over 21 days. Cells were stained with the adipocyte marker, LipidTOX and the nuclei marker, DAPI Representative images were taken every 7 days from Day 0 to Day 21. Representative maximum intensity projection obtained from confocal stacks are presented. Scalebar = 100pm.
[0035] Figure 23 provides data for comparing the differentiation of porcine adipose-derived stem cells (pADSCs) cultured under 2D conditions in specialized adipogenic medium or cultured in 3D conditions confined within microspheres in food-grade (edible) differentiation medium. Fold change of PPARg (left) and adiponectin (right) gene expression after 21 days of culture in control group (pADSCs cultured on 2D culture dish with edible (food-grade) differentiation media), adipogenic medium group (pADSCs cultured on 2D culture dish with adipogenic differentiating medium consisting of DMEM +10% FBS supplemented with IBMX, insulin and dexamethasone) and 3D encapsulated cells group (pADSCs cultured in 3D microspheres with food-grade differentiation media) are shown. Figure 23 is an example to show that confining cells in a 3D environment can effectively induce differentiation of pADSCs with a food-grade differentiation medium without small molecule adipogenic factors.
[0036] Figure 24 shows confocal fluorescence images of porcine adipose-derived stem cells (pADSCs) cultured in food-grade (edible) differentiation media under varying conditions. Top panel: pADSCs cultured on 2D tissue culture plate with (A) only food-grade differentiation media, (C) specialized adipogenic medium cocktail or (D) food-grade differentiation media with ImM decanoate. Bottom panel: pADSCs cultured in alginate-CMC microspheres with (B) only food-grade differentiation media, (E) specialized adipogenic medium cocktail or (F) foodgrade differentiation media with ImM decanoate. All samples were cultured over 21 days with lipid stained with (i) lipidTOX and (ii) nuclei stained with DAPI for nuclei. Scale bar = 50 pm.
[0037] Figure 25 provides confocal confocal fluorescence images showing viability of porcine adipose-derived stem cells (pADSCs) confined in microspheres cultured in a basal growth medium comprising 0.25 mM to 1 mM sodium decanoate (DEC) by staining for live and dead cells. Viable cells are shown in Figure 25(i) while dead cells are shown in Figure 25(ii). Representative maximum intensity projection obtained from confocal stacks are presented. Scalebar = 100 pm.
[0038] Figure 26 provides the quantification of cell viability of porcine adipose-derived stem cells (pADSCs) confined in microspheres cultured in a basal growth medium (GM) or basal growth medium containing ImM sodium decanoate (DEC ImM) across 21 days. Cell viability is measured as the percentage of the number of live cells over the total cell number of cells (live cells plus dead cells).
[0039] Figure 27 provides the quantification of the amount of lipid produced per 10 million cells (in mg) obtained from porcine adipose-derived stem cells (pADSCs) confined in microspheres cultured in a basal growth medium without or with 0.25 mM to 1 mM of sodium decanoate for over 21 days. The data shows that culturing of pADSCs in the presence of 1 mM sodium decanoate can increase the amount of lipid produced in the cells confined in the microsphere. The amount of lipid was measured using Abeam triglyceride assay. Data is obtained from 3 biological replicates. The Day 0 data point was shared across different cultures (*, p < 0.05, t test) Data represents mean ± standard error
[0040] Figure 28 provides representative confocal fluorescence images showing lipid staining in porcine adipose-derived stem cells (pADSCs) confined in microspheres cultured in a growth medium without or with 0.25 mM to 1 mM of sodium decanoate for over 21 days. Cells were stained with the adipocyte marker, LipidTOX (Figure 28(i)), and their nuclei stained with DAPI (Figure 28(ii)). The images were taken every 7 days from Day 0 to Day 21. Representative maximum intensity projection obtained from confocal stacks are presented. Scalebar = 100pm.
[0041] Figure 29 provides data to show the synergic effect of culturing porcine adipose- derived stem cells (pADSCs) confined in microspheres supplemented with 1 mM of sodium decanoate, by quantifying the lipid produced per 10 million cells (mg) from the following conditions: pADSCs cultured in basal growth medium under 2D conditions (GM-2D); pADSCs confined in 3D microspheres cultured in basal growth media (GM-3D); pADSCs cultured in basal growth medium supplemented with 1 mM of sodium decanoate (dec-2D); and pADSCs confined in 3D microspheres cultured in basal growth media supplemented with 1 mM of sodium decanoate (dec-3 D). Comparing between GM-2D and GM-3D groups, culturing cells in 3D environment increases the amount of lipid by 2.7x. When cultured in the presence of 1 mM sodium decanoate, the amount of lipid is increased by 10.8x in 3D condition versus 2D condition, indicating a synergistic effect of combining the culturing cells in a 3D environment in the presence of sodium decanoate. The amount of lipid was as measured using Abeam triglyceride assay. Data is obtained from 3 biological triplicates. Day 0 data point was shared across different cultures (*, p < 0.05, t test). Data represents mean ± standard error.
[0042] Figure 30 provides brightfi eld images showing the morphology of porcine adipose- derived stem cells (pADSCs) cultured in a basal growth medium without and with 10 pM to 1 mM of sodium oleate (SO) and compared against 1 mM of sodium decanoate (SD). Changes in morphology are presented as pre- and 24-hour post treatment in the top and bottom panel respectively. Scalebar = 200 pm.
[0043] Figure 31 provides confocal fluorescence images showing the viability of porcine adipose-derived stem cells (pADSCs) confined in microspheres cultured in a basal growth medium without or with 10 pM to 1 mM of sodium oleate (SO), and compared against 1 mM of sodium decanoate (SD) after culturing for 1 day. Viable cells are labeled as LIVE row while dead cells are labelled as DEAD. Scalebar = 200 pm
[0044] Figure 32 provides confocal fluorescence images showing viability of porcine adipose- derived stem cells (pADSCs) confined in microspheres cultured in a basal growth medium without or with lOpM to ImM of sodium oleate, and compared against 1 mM of sodium decanoate (SD) after culturing for 7 days. Viable cells are labeled as LIVE while dead cells are labelled as DEAD. Scalebar = 200 pm
[0045] Figure 33 provides data showing the viability of porcine adipose-derived stem cells (pADSCs) cultured in 2D conditions on culture plates with basal growth medium without or with 10 pM to 1 mM of sodium oleate, compared against 1 mM of sodium decanoate (SD) Cell viability is assessed by absorbance values of CCK-8 in each group at absorbance of 450 nm. Data represents mean ± standard error from 4 biological replicates (n=4) at each timepoint of Day 0, Day 1 and Day 7.
[0046] Figure 34 provides confocal fluorescence images showing viability of porcine adipose- derived stem cells (pADSCs) confined in microspheres cultured in a basal growth medium without (Control) or with 250 pM to 1000 pM of sodium oleate (SO), and compared against 1000 pM of sodium decanoate (SD), after 1 day in culture. Viable cells are labeled as LIVE row; while dead cells are labelled as DEAD. Scalebar = 100 pm
[0047] Figure 35 provides confocal fluorescence images showing viability of porcine adipose- derived stem cells (pADSCs) confined in microspheres cultured in a basal growth medium without (Control) or with 250 pM to 1000 pM of sodium oleate (SO), and compared against 1000 pM of sodium decanoate (SD), after 7 days in culture. Viable cells are labeled as LIVE row; while dead cells are labelled as DEAD. Scalebar = 100 pm
[0048] Figure 36 provides the quantification of cell viability of porcine adipose-derived stem cells (pADSCs) confined in microspheres cultured in a basal growth medium without (Control) or with 250 pM to 1000 pM of sodium oleate (SO), and compared against 1000 pM of sodiumdecanoate (SD), after 1 day or 7 days in culture. Cell viability is measured as the percentage of the number of live cells over the total cell number of cells (live cells plus dead cells).
[0049] Figure 37 provides representative confocal fluorescence images showing lipid staining in porcine adipose-derived stem cells (pADSCs) confined in microspheres cultured without (Control) or with 250 pM to 1000 pM of sodium oleate (SO), and compared against 1000 pM of sodium decanoate (SD) after 1 day in culture. Cells were stained with the adipocyte marker, LipidTOX, and their nuclei stained with DAPI Representative phase contrast image of the cellladen microsphere and a maximum intensity projection obtained from confocal stacks are presented in the top panel and bottom two panels respectively. Scalebar = 200pm.
[0050] Figure 38 provides representative confocal fluorescence images showing lipid staining in porcine adipose-derived stem cells (pADSCs) confined in microspheres cultured without (Control) or with 250 pM to 1000 pM of sodium oleate (SO), and compared against 1000 pM of sodium decanoate (SD) after 1 day in culture. Cells were stained with the adipocyte marker, LipidTOX, and their nuclei stained with DAPI. Representative phase contrast image of the cellladen microsphere and a maximum intensity projection obtained from confocal stacks are presented in the top and bottom two panels, respectively. Scalebar = 200 pm
[0051] Figure 39 provides representative confocal fluorescence images showing lipid staining in porcine adipose-derived stem cells (pADSCs) confined in microspheres cultured without (Control) or with 250 pM to 1000 pM of sodium oleate (SO), and compared against 1000 pM of sodium decanoate (SD) after 14 days in culture. Cells were stained with the adipocyte marker, LipidTOX, and their nuclei stained with DAPI. Representative phase contrast image of the cell-laden microsphere and a maximum intensity projection obtained from confocal stacks are presented in the top and bottom two panels, respectively. Scalebar = 200 pm
[0052] Figure 40 provides representative confocal fluorescence images showing lipid staining in porcine adipose-derived stem cells (pADSCs) confined in microspheres cultured without (Control) or with 250 pM to 1000 pM of sodium oleate (SO), and compared against 1000 pM of sodium decanoate (SD) after 21 days in culture. Cells were stained with the adipocyte marker, LipidTOX, and their nuclei stained with DAPI. Representative phase contrast image of the cell-laden microsphere and a maximum intensity projection obtained from confocal stacks are presented in the top and bottom two panels respectively. Scalebar = 200 pm
[0053] Figure 41 provides representative fluorescence images of fish adipose-derived stem cells (fADSCs) confined in 3D microspheres and differentiated under different conditions: in a growth medium (GM); in a growth medium supplemented with 50 pM to 500 pM of sodium oleate (SO), which are examples of a food-grade differentiation medium; or in a specializeddifferentiation media supplemented with adipogenic factors (DM), after 6 days in culture. Cells were stained with the adipocyte marker, LipidTOX as shown in Figure 41 (i), and their nuclei stained with DAPI as shown in Figure 41(ii). Figure 41 is an example showing that a foodgrade (edible) culture medium supplementation of 500 pM of sodium oleate (SO) could achieve a similar level of adipogenesis as compared to the use of specialized adipogenic differentiation medium comprising small molecule adipogenic factors. Representative phase contrast image of the cells and fluorescence images are presented as the top and bottom panel respectively. Scalebar = 200 pm.
[0054] Figure 42 provides representative fluorescence images of fish adipose-derived stem cells (fADSCs) confined in 3D microspheres and differentiated under different conditions: in a growth medium (GM) containing about 15% fetal bovine serum (FBS) ; in a growth medium supplemented with 500 pM of sodium oleate (SO) and 3-6 % of fetal bovine serum (FBS), which are examples of a food-grade differentiation medium; in a growth medium supplemented with 500pM of sodium decanoate (SD), which is an example of a food-grade culture medium; or in a specialized differentiation media supplemented with adipogenic factors (DM) including dexamethasone, IBMX, and linoleic-oleic acid in bovine serum albumin, from Day 0 to Day 14 in culture. Cells were stained with the adipocyte marker, LipidTOX, as shown in Figure 42(i), and their nuclei stained with DAPI as shown in Figure 42(ii) Figure 42 is an example showing that differentiation of adipocytes can be improved under reduced serum (FBS) conditions when the food-grade culture medium is supplemented with 500 pM of sodium oleate (SO).
[0055] Figure 43 provides data showing the fatty acid composition of porcine adipose-derived stem cells (pADSCs) differentiated in different conditions and pork lard, expressed as a percentage over its total fatty acid content.
[0056] Figure 44 provides images showing a representative fat construct obtained from binding together lipid-producing cell-laden microspheres obtained from methods as disclosed herein. Figure 44A shows a representative acellular microsphere construct made from 0.5% (w / v) alginate and 1.5% (w / v) carboxymethyl cellulose (CMC), which remained translucent due to absence of cells in the construct. Figure 44B shows a representative fat construct obtained from assembling together lipid-producing cell-laden microspheres obtained from methods as disclosed herein, which is opaque, cohesive and white, similar to commercially available pork lard shown in Figure 44CDEFINITION OF TERMS
[0057] In general, the term “fat” when used herein, can be understood as referring to either “fat tissue” or “fat molecule”, depending on the context of discussion. As used herein, the term “fat” refers to “fatty tissue” or “adipose tissue”, which is a connective tissue consisting mainly of fat cells. It is found mainly under the skin (subcutaneous fat) but also in deposits within or between the muscles (intermuscular fat and intramuscular fat), in the internal organs and in their membrane folds (visceral fat, for example, mesenteric fat), and bone marrow. The fat stored in adipose tissue comes from dietary fats or is produced in the animal body.
[0058] As used herein, the term “scaffold” refers to a three-dimensional structural framework comprising a material or a composition of materials that provides a surface suitable for adherence and proliferation of cells. A scaffold can provide mechanical stability and support. A scaffold can be in a particular shape or form so as to influence or delimit a three-dimensional shape or form assumed by a population of cells. Such shapes or forms can include, but are not limited to, films, ribbons, cords, sheets, flat discs, cylinders, spheres, fibres, or any three- dimensional amorphous shapes. Amorphous means that the surface shape is not uniform, for example, the shape of a scaffold material having irregularities. Many cells, for example stem cells, require a three-dimensional surrounding to grow and, in case of stem cells, differentiate into a desired cell type.
[0059] As used herein, the term “cell-laden scaffold” is a biomaterial construct that incorporates living cells into a three-dimensional structural support. In the present disclosure the cell-laden scaffold comprises edible (food-grade), cell-supporting three-dimensional structures that provide framework for cell growth. In some examples, the cell-laden scaffold can be a hydrogel.
[0060] As used herein, the term “food-grade” is used to describe materials, substances and equipment safe enough for direct contact with food or for human and animal consumption being non-toxic and unlikely to leach harmful substances or foreign particles into the food.
[0061] As used herein, the term “polymeric solution” refers to a mixture where polymer molecules are evenly dispersed and dissolved in a liquid solvent, such as water or an organic liquid. The term “polymeric solution” is used interchangeably with “polymer solution”. An example of a polymeric solution is a pre-gel solution. Polymer molecules in a polymeric solution can be crosslinked to form a three-dimensional structure. In the context of this disclosure, a polymeric solution comprises material suitable for forming a scaffold wherein cells can be confined or encapsulated for growth and differentiation.
[0062] As used herein, the term “mechano-transduction” refers to a process by which cells sense mechanical properties of their surrounding microenvironment and convert these cues or stimuli into intracellular biochemical signals that regulate cell fate (i.e. differentiation) and function.
[0063] As disclosed herein the term “lipid” refers to a macro biomolecule that is soluble in nonpolar solvents, for example, hydrocarbons. Lipids include fatty acids, waxes, sterols, fatsoluble vitamins (such as vitamins A, D, E, and K), monoglycerides, di glycerides, triglycerides, and phospholipids.
[0064] As disclosed herein, the tenn “lipid-producing cells” refers to cells that have the capability or the ability to produce and accumulate fats or lipids.
[0065] As disclosed herein, the term “lipid-producing precursor cells” refers to cells that have the capability or the ability to differentiate into lipid-producing cells.
[0066] As disclosed herein, the term “stiffness” refers to a mechanical characteristic of a material or structure to resist deformation under an applied force. As disclosed herein, compressive modulus and storage modulus represent different readouts of mechanical stiffness. The compressive modulus reflects bulk stiffness under static loading conditions, whereas the storage modulus reflects the elastic response of the material structure under dynamic oscillatory strain Both compressive modulus and storage modulus are used to describe the stiffness of materials, scaffold materials or hydrogels as disclosed herein, and in practice they provide complementary measures of a mechanical environment. As described herein, storage modulus is used for the determining stiffness of fiber structures, such as hydrogel fibers exemplified in the present application because their final geometry is amenable to oscillatory shear rheology, which reports the elastic response under shear deformation. Compressive modulus is used for determining the stiffness the of microspheres structures, as their approximately isotropic geometry makes uniaxial compression the most appropriate and reproducible test.
[0067] As disclosed herein, the term cell “differentiation” means the development of immature or less specialized cell into specific cell types with specific functions. It is the process by which unspecialized cells, such as stem cells, become specialized to perform distinct functions. For example, in the present invention, lipid-producing precursor cells develop or differentiate into lipid-producing cells.
[0068] As disclosed herein, the term “differentiation medium” or “cell differentiation medium” refers to a cell culture medium that promotes cells to develop from one type to another, typically from a less specialized type to a more specialized type. A differentiation medium for promoting differentiation of stem cells into neurons is referred to as a neuro differentiationmedium, while a differentiation medium that promotes differentiation of stem cells into lipid- producing cells such as an adipocyte is referred to as an adipogenic differentiation medium. A differentiation medium can comprise factors that can direct a cell to a particular cell fate, for example, from a lipid-producing precursor cell into the fate of a lipid-producing cell Such factors can include, but are not limited to growth factors, morphogenetic factors, and / or small molecules. These factors can activate cellular pathways in the less specialized cell to induce lineage commitment. For example, a specialized adipogenic differentiation medium can contain 3 -Isobutyl-1 -methylxanthine (IBMX), rosiglitazone, dexamethasone, D- panthothenate, insulin and biotin to direct differentiation of adipose-derived stem cells into mature adipocytes.
[0069] As disclosed herein, the term “hydrogel” refers to is a three-dimensional network of hydrophilic polymers that can absorb and retain large amount of water without dissolving. Hydrogels are prepared using a variety of polymeric materials, which can be broadly divided into natural or synthetic material. In the present disclosure, for example, the materials used for forming the hydrogel are food-safe, edible polymeric material, which can include, but are not limited to alginate, pectin, agarose, carrageenan, gellan gum, konj c glucomannan, xanthan gum, guar gum, locust bean gum, gum arabic, starches and derivatives thereof, pullulan; p- glucans, cellulose and derivatives thereof, gelatin, collagen, whey protein, casein, caseinates, soy protein, pea protein, gluten, glutenin, zein and combinations thereof. In some examples, the carrageenan can be kappa, iota, or lambda carrageenan, characterized by different gelling properties. In some examples, the cellulose derivatives can include, but are not limited to carboxymethyl cellulose (CMC), methylcellulose (MC), hydroxyethylcellulose (HEC), hydroxypropyl methylcellulose (HPMC), or bacterial nanocellulose.DETAILED DESCRIPTION
[0070] Within the burgeoning field of cultivated meat, fats play a critical role as a functional ingredient to replicate the texture, taste, flavor and nutritional profile of animal meat. Fats are pivotal for enhancing the sensory experience of cultivated meat as they impart the characteristic flavors and aromas that make meat delectable, while also contributing to its mouthwatering richness and succulence. Their high smoke point and ability to facilitate Maillard reaction (browning) and caramelization further elevate the taste and visual appeal of meat. Additionally, fats are instrumental in replicating the marbled appearance of traditional meat, offering a visually enticing quality. Beyond sensory aspects, fats carry substantial nutritional value in cultivated meat such as the provision of essential fatty acids. In essence, fats are an integralcomponent in cultivated meat production, enabling the creation of meat alternatives that closely mirror the taste, texture, and overall appeal of conventional meat while promoting sustainability and nutritional balance.
[0071] The present disclosure describes methods of manufacturing lipid-producing cells suitable for use in cultivated meat applications. Specifically, the present disclosure describes methods of manufacturing cell-laden scaffolds comprising lipid-producing cells. As used herein, a cell-laden scaffold refers to a biomaterial construct that incorporates living cells into a three-dimensional structural support formed from scaffold materials. The methods described herein involve confining lipid-producing precursor cells within a three-dimensional environment that is formed from one or more scaffold materials which enables the differentiation of the lipid-precursor cells into lipid-producing cells through mechanotransduction principles. By confining lipid-producing precursor cells within a mechanically compliant three-dimensional environment through the fabrication of a scaffold, the present disclosure shows that the lipid-producing precursor cells confined in scaffold are viable and can be differentiated into lipid-producing cells without the use of specialized adipogenic differentiation medium that contains toxic chemicals which are unsafe for human and animal consumption. As shown in Figure 5, lipid-producing precursor cells confined in the structural form of a microfiber are viable and can be differentiated into lipid-producing cells In another example shown in Figures 6 and 15-17, lipid-producing precursor cells confined in the structural form of a microsphere are viable and can differentiate into lipid-producing cells.
[0072] Therefore, in one aspect, there is provided a method of manufacturing a cell-laden scaffold comprising lipid-producing cells, the method comprising: (a) preparing a mixture comprising lipid-producing precursor cells and a food-grade (edible) polymeric solution; (b) forming a three-dimensional (3D) environment from the mixture from (a) such that the lipid- producing precursor cells are confined in the 3D environment, and (c) culturing the lipid- producing precursor cells confined in 3D environment from (b) in a food-grade differentiation medium to obtain the cell-laden scaffold.
[0073] Known methods in the art for manufacturing cultivated fats require multiples steps during the manufacturing process, which include the fabrication or production of a scaffold followed by seeding precursor cells onto the fabricated scaffold. The methods known in the art comprise multiple steps which require more time and additional cost for quality control to ensure that each manufacturing step meets food safety standards. Tn one of many aspects, the method as disclosed herein is different as it combines the fabrication of scaffold and seeding of cells in one step, that is, a three-dimensional cell-laden scaffold is formed directly from amixture comprising lipid-producing precursor cells and a polymeric solution, thus obviating the need for the multiple steps known in the art, which will reduce the risk of contamination.
[0074] In the method of manufacturing a cell-laden scaffold as described herein, the cell-laden scaffold can comprise lipid-producing cells. Lipid-producing cells are cells that are capable or have the ability to produce lipids. Lipid-producing cells comprised in the cell-laden obtained from the method as disclosed herein can include, but are not limited to adipocytes, hepatocytes, sebocytes, mammary epithelial cells or keratinocytes. In one example, the lipid-producing cells are adipocytes.
[0075] As described herein, lipid-producing precursor cells are cells that can divide and differentiate into lipid-producing cells. In some examples, a lipid-producing cell can include, but are not limited to adipose-derived stem cells, preadipocytes, adipocyte progenitor cells, mesenchymal stem cells, induced-pluripotent stem cells, embryonic stem cells, or combinations thereof.
[0076] As described herein, the lipid-producing cells and lipid-producing precursor cells are of animal origin. In some examples, the lipid-producing cells can be of avian, amphibian, bovine, fish, ovine, porcine or reptilian origin.
[0077] In the method of manufacturing a cell-laden scaffold comprising lipid-producing cells as disclosed herein, the method comprises the step of preparing a mixture comprising lipid- producing precursor cells and a food-grade polymeric or polymer solution.
[0078] In some examples, the food-grade polymeric solution can comprise one or more types of polymeric material suitable for constructing the scaffold. In some examples, the one or more types of material can include, but are not limited to alginate, pectin, agarose, carrageenan, gellan gum, konjac glucomannan, xanthan gum, guar gum, locust bean gum, gum arabic, starches and derivatives thereof, pullulan; P-glucans, cellulose and derivatives thereof, gelatin, collagen, whey protein, casein, caseinates, soy protein, pea protein, gluten, glutenin, zein and combinations thereof. In some examples, the carrageenan can be kappa, iota, or lambda carrageenan, characterized by different gelling properties. In some examples, the cellulose derivatives can include, but are not limited to carboxymethyl cellulose (CMC), methylcellulose (MC), hydroxyethylcellulose (HEC), hydroxypropyl methylcellulose (HPMC) or bacterial nanocellulose.
[0079] In some examples, the polymeric solution comprises one type of material. In some examples, the polymeric solution comprises more than one type of material Thus, in these examples, the polymeric solution can comprise a combination or a composition of materials. In some examples, the polymeric solution comprises two, three, four, five, six, seven, eight,nine or ten types of material. In some examples, the polymeric solution comprises two types of material. In some examples, the polymeric solution comprises alginate. In some examples, the polymeric solution comprises alginate and cellulose. In some examples, the polymeric solution comprises alginate and gelatin.
[0080] In some examples, the one or more material in the polymeric solution is present at an amount of about 0.1% to about 5.0% weight / volume (w / v) for each material. In other examples, the one or more material in the polymeric solution is present at an amount of about 0.5% to 4.0%, about 1.0% to 3.0%, about 1.5% to 2.5%, or about 1.0% to 2.0% w / v for each material. In some examples, the one or more material in the polymeric solution is present at an amount of about 0.1%, 0.5%, 1%, 1.5%, 2.0%, 2.5%, 3.0%, 3.5%, 4.0%, 4.5% or 5% w / v for each aterial.
[0081] In some examples, the polymeric solution comprises about 0. l%-5% w / v of alginate. In some examples, the polymeric solution comprises about 0.5% to 4.0%, about 1.0% to 3.0%, about 1.5% to 2.5%, or about 1.0% to 2.0% w / v of alginate. In some examples, the polymeric solution comprises about 0.1%, 0.5%, 1%, 1.5%, 2.0%, 2.5%, 3.0%, 3.5%, 4.0%, 4.5% or 5% w / v of alginate. In some examples, the polymeric solution comprises about 0. l%-5% w / v of carboxymethyl cellulose (CMC). In some examples, the polymeric solution comprises about 0.5% to 4.0%, about 1.0% to 3.0%, about 1.5% to 2.5%, or about 1.0% to 2.0% w / v of carboxymethyl cellulose (CMC). In some examples, the polymeric solution comprises about 0.1%, 0.5%, 1%, 1.5%, 2.0%, 2.5%, 3.0%, 3.5%, 4.0%, 4.5% or 5.0% w / v of carboxymethyl cellulose (CMC). In some examples, the polymeric solution comprises about 0. l%-5% w / v of gelatin. In some examples, the polymeric solution comprises about 0.5% to 4.0%, about 1.0% to 3.0%, about 1.5% to 2.5%, or about 1.0% to 2.0% w / v of gelatin. In some examples, the polymeric solution comprises about 0.1%, 0.5%, 1%, 1.5%, 2.0%, 2.5%, 3.0%, 3.5%, 4.0%, 4.5% or 5% w / v of gelatin In some examples, the polymeric solution comprises about 0.1%- 5% w / v of pectin. In some examples, the polymeric solution comprises about 0.5% to 4.0%, about 1.0% to 3.0%, about 1.5% to 2.5%, or about 1.0% to 2.0% w / v of pectin. In some examples, the polymeric solution comprises about 0.1%, 0.5%, 1%, 1.5%, 2.0%, 2.5%, 3.0%, 3.5%, 4.0%, 4.5% or 5.0% w / v of pectin.
[0082] In some examples, the polymeric solution comprises alginate and carboxymethyl cellulose (CMC), wherein alginate is present at an amount of about 0.1%-5.0% w / v and wherein carboxymethyl cellulose (CMC) is present at an amount of about 0.1 %-5.0% w / v. In some examples, the polymeric solution comprises alginate and carboxymethyl cellulose (CMC), wherein alginate is present at an amount of about 0.5% to 4.0%, about 1.0% to 3.0%,about 1.5% to 2.5%, or about 1.0% to 2.0% w / v and wherein carboxymethyl cellulose (CMC) is present at an amount of about 0.5% to 4.0%, about 1.0% to 3.0%, about 1.5% to 2.5%, or about 1.0% to 2.0% w / v. In some examples, the polymeric solution comprises alginate and carboxymethyl cellulose (CMC), wherein alginate is present at an amount of about 0.1%, 0.5%, 1%, 1.5%, 2.0%, 2.5%, 3.0%, 3.5%, 4.0%, 4.5% or 5% w / v and wherein carboxymethyl cellulose (CMC) is present at an amount of about 0.1%, 0.5%, 1%, 1.5%, 2.0%, 2.5%, 3.0%, 3.5%, 4.0%, 4.5% or 5% w / v. In some examples, the polymeric solution comprises alginate and carboxymethyl cellulose (CMC), wherein alginate is present at an amount of about 0.5% w / v and wherein carboxymethyl cellulose (CMC) is present at an amount of about 1.0%-2.0% w / v. In some examples, the polymeric solution comprises alginate and carboxymethyl cellulose (CMC), wherein alginate is present at an amount of about 0.5% w / v and wherein carboxymethyl cellulose (CMC) is present at an amount of about 0.5% w / v. In some examples, the polymeric solution comprises alginate and carboxymethyl cellulose (CMC), wherein alginate is present at an amount of about 0.5% w / v and wherein carboxymethyl cellulose (CMC) is present at an amount of about 1.0% w / v. In some examples, the polymeric solution comprises alginate and carboxymethyl cellulose (CMC), wherein alginate is present at an amount of about 0.5% w / v and wherein carboxymethyl cellulose (CMC) is present at an amount of about 1.5% w / v. In some examples, the polymeric solution comprises alginate and carboxymethyl cellulose (CMC), wherein alginate is present at an amount of about 0.5% w / v and wherein carboxymethyl cellulose (CMC) is present at an amount of about 1.5% w / v. In some examples, the polymeric solution comprises alginate and carboxymethyl cellulose (CMC), wherein alginate is present at an amount of about 0.5%, w / v and wherein carboxymethyl cellulose (CMC) is present at an amount of about 2.0% w / v.
[0083] In some examples, the polymeric solution comprises alginate and gelatin, wherein alginate is present at an amount of about 0.1 %-5.0% w / v and wherein gelatin is present at an amount of about 0. l%-5.0% w / v. In some examples, the polymeric solution comprises alginate and gelatin, wherein alginate is present at an amount of about 0.5% to 4.0%, about 1.0% to 3.0%, about 1.5% to 2.5%, about 1.0% to 2.0% w / v or about 3.0% to 4.0% w / v, and wherein gelatin is present at an amount of about 0.5%, to 4.0%, about 1.0% to 3.0%, about 1.5% to 2.5%, about 1.0% to 2.0% or about 3.0% to 4.0% w / v. In some examples, the polymeric solution comprises alginate and gelatin, wherein alginate is present at an amount of about 0. 1%, 0.5%, 1%, 1 .5%, 2.0%, 2.5%, 3.0%, 3.5%, 4.0%, 4.5% or 5% w / v and wherein gelatin is present at an amount of about 0.1%, 0.5%, 1%, 1.5%, 2.0%, 2.5%, 3.0%, 3.5%, 4.0%, 4.5% or 5% w / v. In some examples, the polymeric solution comprises alginate and gelatin, wherein alginate ispresent at an amount of about 3.0%-4.0% w / v and wherein gelatin is present at an amount of about 3.0%-4.0% w / v. In some examples, the polymeric solution comprises alginate and gelatin, wherein alginate is present at an amount of about 3% w / v and wherein gelatin is present at an amount of about 3% w / v.
[0084] As described in the methods disclosed herein, the method of manufacturing a cell -laden scaffold comprising lipid-producing cells comprises the step of preparing a mixture comprising lipid-producing precursor cells and a food-grade polymeric solution to form a polymer cell mixture. One or more types of polymer material can be mixed together with one population of lipid-producing precursor cells or more than one population of lipid-producing cells to prepare the mixture as disclosed here. In some examples, the one or more types of polymer material in the mixture can include, but are not limited to: alginate, pectin, agarose, carrageenan, gellan gum, konjac glucomannan, xanthan gum, guar gum, locust bean gum, gum arabic, starches and derivatives thereof, pullulan; 0-glucans, cellulose and derivatives thereof, gelatin, collagen, whey protein, casein, caseinates, soy protein, pea protein, gluten, glutenin, zein and combinations thereof. In some examples, the carrageenan can be kappa, iota, or lambda carrageenan, characterized by different gelling properties. In some examples, the cellulose derivatives can include, but are not limited to carboxymethyl cellulose (CMC), methylcellulose (MC), hydroxyethylcellulose (HEC), hydroxypropyl methylcellulose (HPMC), or bacterial nanocellulose. In some examples, the lipid-precursor cells in the mixture can include, but are not limited to adipose-derived stem cells, preadipocytes, adipocyte progenitor cells, mesenchymal stem cells, induced-pluripotent stem cells, embryonic stem cells, or combinations thereof. In some examples, the mixture can comprise alginate, carboxymethyl cellulose (CMC) and adipose-derived stem cells. In some examples, the mixture can comprise alginate, gelatin and adipose-derived stem cells.
[0085] In some examples, the mixture comprises about 5 million to 20 million lipid-producing precursor cells / mL. In some examples, the mixture comprises about 8 million to 16 million cells / mL, about 8 million to 12 million cells / mL, about 10 million to 20 million cells / mL, about 10 million to 20 million cells / mL or about 10 million to 15 million cells / mL. In some examples, the mixture comprises about 5 million, 6 million, 7 million, 8 million, 9 million, 10 million, 11 million, 12 million, 13 million, 14 million, 15 million, 16 million, 17 million, 18 million, 19 million or 20 million cells / mL. In some examples, the mixture comprises about 10 million cells / mL mix with one or more types of polymer material.
[0086] In some examples, the mixture can comprise alginate, carboxymethyl cellulose (CMC), and adipose-derived stem cells. In some examples, the mixture can comprise 0. l%-5% w / valginate, 0. l%-5% w / v carboxym ethyl cellulose (CMC) and 5 million to 20 million adipose- derived stem cells / mL. In other examples, the mixture can comprise 0.5% w / v alginate, 0.5%- 2.0% w / v carboxymethyl cellulose (CMC) and 5 million to 20 million adipose-derived stem cells / mL.
[0087] In some examples, the mixture can comprise alginate, carboxymethyl cellulose (CMC), and adipose-derived stem cells. In some examples, the mixture can comprise 0.1%-5% w / v alginate, 0. l%-5% w / v carboxymethyl cellulose (CMC) and 8 million to 12 million adipose- derived stem cells / mL. In other examples, the mixture can comprise 0.5% w / v alginate, 0.5%- 2.0% w / v carboxymethyl cellulose (CMC) and 8 million to 12 million adipose-derived stem cells / mL.
[0088] Tn other examples, the mixture can comprise 0.5% w / v alginate, 0.5%-2.0% w / v carboxymethyl cellulose (CMC) and about 10 million adipose-derived stem cells / mL. In one example, the mixture comprises 0.5% w / v alginate, 1.5% w / v carboxymethyl cellulose (CMC) and about 10 million adipose-derived stem cells / mL.
[0089] In some examples, the mixture can comprise alginate, gelatin, and adipose-derived stem cells. In some examples, the mixture can comprise 0.1%-5.0% w / v alginate, 0.1%-5.0% w / v gelatin, and 5 million to 20 million adipose-derived stem cells. In some examples, the mixture can comprise 3.0%-4.0% w / v alginate, 3.0%-4.0% w / v gelatin, and 5 million to 20 million adipose-derived stem cells. In some examples, the mixture can comprise alginate, gelatin, and adipose-derived stem cells. In some examples, the mixture can comprise 0.1%-5.0% w / v alginate, 0.1%-5.0% w / v gelatin, and 8 million to 12 million adipose-derived stem cells. In some examples, the mixture can comprise 3.0%-4.0% w / v alginate, 3.0%-4.0% w / v gelatin, and 8 million to 12 million adipose-derived stem cells. In some examples, the mixture can comprise 3.0%-4.0% w / v alginate, 3.0%-4.0% w / v gelatin, and 10 million adipose-derived stem cells.
[0090] In some examples, the mixture comprising lipid-producing precursor cells and one or more types of scaffold material can further comprise a crosslinking agent. A crosslinking agent is a substance that forms bonds between polymers or polymer chains to create a three- dimensional network structure. As can be appreciated by a person skilled in the art, the crosslinking agent added to the mixture is selected based on the polymer present in the mixture. For example, if the polymer is gelatin, a suitable crosslinking agent can include, but are not limited to transglutaminase, tyrosinases, horseradish peroxidases, genipin, glyceraldehyde or citric acid.
[0091] In the method as disclosed herein, the method comprises the step of forming a three- dimensional (3D) environment from the mixture comprising a polymeric solution and lipid- producing precursor cells, such that the lipid-producing precursor cells are confined in the 3D environment.
[0092] As described herein, the lipid-producing precursor cells can be confined into different three-dimensional structural forms for culturing and differentiation into lipid-producing cells. Thus, the resulting structure of the cell-laden scaffold is dependent on the shape of the 3D environment which the cells are confined or encapsulated in. In some examples, the cells are confined into a sphere, fibre, sheet, film, ribbon, cord, flat disc, cylinder or any three- dimensional amorphous shapes. Therefore, the resultant manufactured cell-laden scaffold is in the structural form of a sphere, fibre, sheet, film, ribbon, cord, flat disc, cylinder or any three- dimensional amorphous shapes. In some examples, the cell-laden scaffold can be formed or fabricated by a method comprising any one of electrospraying, electrospinning, wet-spinning, 3D printing, microfluidic droplet generation or bulk encapsulation. As shown in Examples 1 and 2, the lipid-producing precursor cells can be confined in the form of a microfiber (Figure 5) fabricated by a wet spinning method or in the form of a microsphere (Figure 6) fabricated by an electrospinning method.
[0093] In the method of manufacturing a cell-laden scaffold as disclosed herein, the lipid- producing precursor cells confined in the 3D environment as disclosed herein are cultured in a food-grade differentiation medium for differentiating the lipid-producing precursor cells into lipid-producing cells.
[0094] Known methods of culturing and differentiating lipid-producing cells in the art typically use a specialized adipogenic differentiation medium to differentiate lipid-producing precursor cells such as, but not limited to, pre-adipocytes or adipose-tissue derived stem cells into mature lipid-producing cells, such as adipocytes. Such specialized adipogenic differentiation medium can contain chemical inducers that include, but are not limited to 3- Isobutyl-1 -methylxanthine (IB MX), rosiglitazone, dexamethasone, D-panthothenate, insulin and biotin. Among the abovementioned chemical inducers, IBMX and rosiglitazone are toxic and not food-compatible to be used in cultivated meat applications. In the present disclosure, a food-grade differentiation medium for differentiating lipid-producing precursor cells to lipid- producing cells is provided. The food-grade differentiation medium is devoid of chemical inducers or any other components, such as 3-Isobutyl-1 -methylxanthine (IBMX), rosiglitazone and / or dexamethasone, which are not suitable for food applications.
[0095] Thus, as described herein, the present disclosure provides a food-grade differentiation medium that does not contain small molecules or chemical inducers that are toxic and not foodcompatible. In some examples, the food-grade differentiation medium is also referred to as an edible differentiation medium. Therefore, in another aspect, there is provided a food-grade differentiation medium that can be used for differentiating lipid-producing-precursor cells into lipid-producing cells. In some examples, the food-grade differentiation medium can be used for differentiating adipose-derived stem cells (ADSCs) into adipocytes. In some examples, the food-grade differentiation medium can be used for differentiating preadipocytes into adipocytes. In some examples, the food-grade differentiation medium can be used for differentiating mesenchymal stem cells into adipocytes. In other examples, the food-grade differentiation medium can be used for differentiating embryonic stem cells or, induced pluripotent stem cells into adipocytes.
[0096] In some examples, the food-grade differentiation medium for differentiation lipid- producing precursor cells into lipid-producing cells comprises a basal cell growth medium. In some examples, the food-grade differentiation medium comprises a basal cell growth medium with or without a serum. In some examples, the serum is fetal bovine serum.
[0097] In one example, the food-grade differentiation medium for differentiating lipid- producing precursor cells into lipid-producing cells comprises a fatty acid. In some examples, the food-grade differentiation medium comprises about 0.1 mM to 1.5 mM of fatty acids. In some examples, the food-grade differentiation medium comprises about 0.25 mM to 1.25 mM, or about 0.5 mM to 1.0 mM of fatty acid. In some examples, the food-grade differentiation medium comprises about 0.1 mM, 0.25 mM, 0.5 mM, 0.75 mM, 1.0 mM, 1.25 mM or 1.5 mM of fatty acid.
[0098] In another example, the fatty acid is a medium chain fatty acid and / or a long chain fatty acid. In some examples, the food-grade differentiation medium comprises a medium chain fatty acid. In some examples, the medium chain fatty acid is fatty acid characterized an aliphatic tail of 6 to 12 carbon atom. In some examples, the medium chain fatty can be, but not limited to: hexanoic acid (C6:0), octanoic acid (C8:0), decanoic acid (C10:0) and dodecanoic (C12:0) acid or combinations thereof. In some examples, the medium chain fatty acid can be provided in in the differentiation medium as the form of a salt, such as hexanoate, octanoate, decanoate or dedecanoate. In one example, the food-grade differentiation medium comprises decanoic acid or decanoate. In some examples, the food-grade differentiation medium comprises about 0.1 mM to 1.5 mM of decanoic acid or decanoate. In some examples, the food-grade differentiation medium comprises about 0.25 mM to 1.25 mM, or about 0.5 mM to 1.0 mM of decanoic acidor decanoate. In some examples, the food-grade differentiation medium comprises about 0.1 mM, 0.25 mM, 0.5 mM, 0.75 mM, 1.0 mM, 1.25 mM or 1.5 mM of decanoic acid or decanoate. In some examples, the food-grade differentiation medium comprises about 1 mM of decanoic acid or decanoate.
[0099] In another example, the food-grade differentiation medium comprises a long chain fatty acid. In one example, the long chain fatty acid is a fatty acid having a long carbon chain of 14 to 22 carbons in length. In some examples, the long chain fatty acid can include, but are not limited to palmitic acid (C16:0), stearic acid (C18:0), linoleic acid (C18:2 cis-9,12), oleic acid (C18:l c / s-9), eicosapentaenoic acid (EPA, C20:5(z?-3)) or docosahexaenoic acid (DHA, 22:6(n-3)). In another example, the food-grade differentiation medium comprises oleic acid or oleate In some examples, the food-grade differentiation medium comprises about 0.1 mM to 1.5 mM of oleic acid or oleate. In some examples, the food-grade differentiation medium comprises about 0.25 mM to 1.25 mM, or about 0.5 mM to 1.0 mM of oleic acid or oleate. In some examples, the food-grade differentiation medium comprises about 0. 1 mM, 0.25 mM, 0.5 mM, 0.75 mM, 1.0 mM, 1.25 mM or 1.5 mM of oleic acid or oleate. In some examples, the food-grade differentiation medium comprises about 1 mM of oleic acid or oleate. The culturing of lipid-producing precursor cells confined in a 3D environment in a food-grade differentiation medium comprising a fatty acid is shown in Examples 8 and 9.
[0100] In some examples, the food-grade differentiation medium comprises a basal cell growth medium and a fatty acid. In some examples, the food-grade differentiation medium comprises a basal cell growth medium, about 3% to 15 % of fetal bovine serum (FBS), and a fatty acid. In some examples, the food-grade differentiation medium comprises about 3%, 4%, 5%, 6%, 7%, 8%, 9% 10%, 11%, 12%, 13%, 14% or 15% FBS. In some examples, 3% FBS is used in the food-grade differentiation medium. In these examples, presence of 3% FBS or less is referred to as a reduced serum condition In some examples, differentiating lipid-producing precursor cells in a reduced serum condition can exert an adipogenic influence, likely through favoring activation of C / EBP and PPARy transcriptional cascades. Thus, reducing the amount of serum in the food-grade differentiation medium can improve differentiation of the lipid- producing cells in the methods as disclosed herein (see Figure 42 of Example 9). Therefore, in some examples, the food-grade differentiation medium comprises 3% FBS and a fatty acid. In some examples, the food-grade differentiation medium comprises 3% FBS and decanoic acid or decanoate In some examples, the food-grade differentiation medium comprises 3% FBS and oleic acid or oleate.
[0101] In some examples, the food-grade differentiation medium comprises a basal cell growth culture medium, about 3% to 15% fetal bovine serum and a fatty acid, wherein the fatty acid is a medium chain fatty acid or a long chain fatty acid. In some examples, the food-grade differentiation medium is serum-free, that is, the food-grade differentiation medium does not contain a serum, such as fetal bovine serum (FBS). Thus, in these examples, the food-grade differentiation can comprise a basal cell growth culture medium and a fatty acid, wherein the fatty acid is a medium chain fatty acid and / or a long chain fatty acid.
[0102] As can be appreciated by a person skilled in the art, a basal cell growth medium is a fundamental nutrient medium that can be used to support the growth and proliferation of cells cultured in vitro. A basal cell growth medium provides essential nutrients like amino acids, vitamins, glucose, salts, L-glutamine and sodium pyruvate. The basal cell growth medium can be supplemented with serum or other factors to support specific cell types. In some examples, the basal growth medium can be any suitable basal growth medium commonly used for mammalian cell culture. In some examples, the basal growth medium can include, but are not limited to Dulbecco's Modified Eagle Medium (DMEM), Roswell Park Memorial Institute medium (RPMI-1640), Minimum Essential Medium (MEM), a - EM or Ham’s F-12. In some examples disclosed herein, the basal growth medium is Dulbecco's Modified Eagle Medium (DMEM). In some examples, the food-grade medium can optionally include low amount of antibiotics, such as penicillin and / or streptomycin. As known in the art, these antibiotics are commonly used in mammalian cell culture to prevent bacterial contamination and also used as an injectable to treat bacterial infection in livestock.
[0103] The present disclosure shows that the food-grade differentiation medium comprising a fatty acid as disclosed herein can direct the differentiation of lipid-producing precursor cells into lipid-producing cells. For example as shown in Figure 24, the effects of culturing lipid-producing precursor cells in specialized adipogenic medium are compared with the food-grade differentiation medium containing decanoate, using the food-grade differentiation medium without chemical factors or fatty acids as control. The example shows that supplementation of 1 mM decanoate in the food-grade differentiation media (labelled as edible differentiation medium in Figure 24) can induce differentiation of porcine adipose tissue derived stem cells (pADSCs) into mature adipocytes in 2D culture or 3D culture systems (wherein cells are confined in a 3D environment). In this example, it is also shown that addition of decanoate to the edible differentiation medium increases the amount of lipid production to the extend which is similar to that of specialized adipogenic medium cocktail. The data indicated that culturing of lipid-producing precursor cells confined in a 3D environment in thefood-grade differentiation medium comprising decanoate induce differentiation of lipid- producing cells as cells cultured in the specialized adipogenic differentiation medium.
[0104] In some examples, the effects of differentiating lipid-precursor cells confined in a 3D environment using the food-grade medium supplemented with fatty acid as disclosed herein are compared with the 2D culture system. As shown in Figure 29, the amount of lipid produced by lipid-producing cells confined in 3D microspheres is increased by 2.7-fold compared to lipid-producing cells in 2D culture when cultured in the food-grade medium without supplementation with ImM of sodium decanoate. This observation indicates that the 3D confinement of cells could improve differentiation of lipid-producing and increase lipid accumulation in the lipid-producing. Further, when the cells were cultured in food-grade medium supplemented with 1 mM of sodium decanoate, the amount of lipid produced by cells confined in the 3D microsphere was increased by 10.8-fold compared to cells in 2D culture. The greater fold change in lipid production of pADSCs cultured in 2D and 3D system with the addition of sodium decanoate to the food-grade medium is indicative of a synergistic effect between the fatty acid supplementation in the food-grade differentiation medium and mechanotransduction effect of confining cells in 3D microspheres in upregulating adipogenesis.
[0105] In the method for manufacturing a cell-laden scaffold as disclosed herein, the lipid-producing precursor cells confined in the 3D environment are cultured in the food-grade differentiation medium as disclosed herein for about 5 days to 23 days to obtain a cell-laden scaffold comprising lipid-producing cells. In some examples, the lipid-producing precursor cells are cultured for about 7 days to 21 days, about 10 days to 20 days or about 12 days to 18 days. In some examples the lipid-producing precursor cells are cultured for about 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days or 23 days. In some examples, the lipid- producing precursor cells confined in the 3D environment are cultured in the food-grade differentiation medium as disclosed herein for about 7 days to obtain a cell-laden scaffold comprising lipid-producing cells. In some examples, the lipid-producing precursor cells confined in the 3D environment are cultured in the food-grade differentiation medium as disclosed herein for 14 days to obtain a cell-laden scaffold comprising lipid-producing cells In some examples, the lipid-producing precursor cells confined in the 3D environment are cultured in the food-grade differentiation medium as disclosed herein for about 21 days to obtain a cell-laden scaffold comprising lipid-producing cells.
[0106] In some examples, in the method of manufacturing a cell-laden scaffold as disclosed herein, the lipid-producing precursor cells confined in the 3D environment are cultured in a food-grade differentiation, comprising a medium chain fatty acid for about 21 days to obtain the cell-laden scaffold comprising lipid-producing cells. In one example, the fatty acid profile of lipids obtained from the lipid-producing cells cultured in the food-grade culture medium with or without supplementation with a fatty acid is shown in Example 10 and is compared with fatty acid profile obtained from pork lard, which a representative of a source of dietary fat. As shown in Figure 42 of Example 10, the lipid-producing precursor cells differentiated in a 3D microsphere environment with and without sodium decanoate could produce lipids with similar fatty acid profile as pork lard. This observation indicates that the method as disclosed herein could provide a cell-laden scaffold comprising lipid-producing cells that is capable of producing lipids of similar fatty acid profile as a commonly consumed animal fat product, pork lard, which underscores the applicability of the method as disclosed herein for cultivated meat applications.
[0107] In the method as disclosed herein, the confinement or encapsulation of the lipid- producing precursor cells in a 3D environment formed by the materials in the polymeric solution forms a cell-laden scaffold comprising lipid-producing precursor cells. Also disclosed herein, the cell-laden scaffold comprising the lipid-producing precursor cells is cultured in a food-grade differentiation medium comprising a fatty acid such that the confined lipid- producing precursor cells are differentiated into lipid-producing cells to obtain a cell-laden scaffold comprising lipid-producing cells.
[0108] Thus, in another aspect, the present disclosure provides a cell-laden scaffold comprising lipid-producing cells obtained from the method as disclosed herein. In another aspect, the present disclosure provides a cell-laden scaffold comprising one or more food-grade scaffold materials and one or more types of cells, wherein the cell-laden scaffold is characterized by a stiffness of about 0.1 kPa to 15 kPa. In some examples, the cell-laden scaffold is characterized by a stiffness of about 0.5 kPa to 14 kPa, about 1.0 kPa to 12 kPa, about 2 kPa to 10 kPa, about 4 kPa to 8 kPa, about 3 kPa to 5 kPa, about 0.2 kPa to 2.5 kPa, about 0.5 kPa to 4 kPa, about 0.6 to 3.5 kPa, about 5 kPa to 8 kPa, or about 6 kPa to 9 kPa. In some examples, the cell-laden scaffold is characterized by a stiffness of about 0.1 kPa, 0.2 kPa,0.3 kPa, 0.4 kPa, 0.6 kPa, 0.6 kPa, 0.7 kPa, 0.8 kPa, 0.9 kPa, 1.0 kPa, 1.2 kPa, 1.4 kPa, 1.6 kPa,1 .8 kPa, 2.0 kPa, 2.5 kPa, 3.0 kPa, 3.5 kPa, 4.0 kPa, 4.5 kPa, 5.0 kPa, 5.5 kPa, 6.0 kPa, 6.5 kPa,7.0 kPa, 7.5 kPa, 8.0 kPa, 8.5 kPa, 9.0 kPa, 9.5 kPa 10 kPa, 10.5 kPa, 11 kPa, 11.5 kPa, 12 kPa,12.5 kPa, 13 kPa, 13.5 kPa, 14.0 kPa, 14.5 kPa or 15 kPa. In some examples, the stiffness ofthe cell-laden scaffold is about 0.6 kPa. In some examples, the stiffness of the cell-laden scaffold is about 3.5 kPa. In some examples, the stiffness of the cell-laden scaffold is about 6 kPa. In some examples, the stiffness of the cell-laden scaffold is about 10 kPa. Without being bound by theory, the stiffness of the cell-laden scaffold can change over time due to cell- mediated remodeling, or enzymatic degradation of the scaffold. For example, by day 21 of culture, cell-mediated remodeling, or enzymatic degradation may cause measurable softening or stiffening of the scaffold. Nonetheless, as described herein, the stiffness of the cell -laden scaffold in the range of 0.1 kPa to 15 kPa supports the differentiation of lipid-producing precursor cells into lipid-producing cells when cultured in the food-grade differentiation medium as disclosed herein.
[0109] In some examples, the cell-laden scaffold can be a hydrogel. As is known in the art, a hydrogel is a three-dimensional network of hydrophilic polymers that can absorb and retain large amount of water without dissolving. Therefore, the food-grade polymers or scaffold materials used for manufacturing the cell-laden scaffold as disclosed herein can form a three- dimensional structure while holding large amount of water. In some examples, the cell-laden scaffold comprises one or more food-grade scaffold material. In some examples, the food-grade scaffold material can include, but is not limited to alginate, pectin, agarose, carrageenan, gellan gum, konjac glucomannan, xanthan gum, guar gum, locust bean gum, gum arabic, starches and derivatives thereof, pullulan, (3-glucans, cellulose and derivatives thereof, gelatin, collagen, whey protein, casein, caseinates, soy protein, pea protein, gluten, glutenin, zein and combinations thereof. In some examples, the carrageenan can be kappa, iota, or lambda carrageenan, characterized by different gelling properties. In some examples, the cellulose derivatives can include, but are not limited to carboxymethyl cellulose (CMC), methylcellulose (MC), hydroxyethylcellulose (HEC), hydroxypropyl methylcellulose (HPMC), or bacterial nanocellulose
[0110] In some examples, the food-grade scaffold material comprises one type of material. In some examples, the food-grade scaffold material comprises more than one type of material. Thus, in these examples, the food-grade scaffold material can comprise a combination or a composition of materials. In some examples, the food-grade scaffold material comprises two, three, four, five, six, seven, eight, nine or ten types of material. In some examples, the food-grade scaffold material comprises two types of material. In some examples, the foodgrade scaffold material comprises alginate. In some examples, the food-grade scaffold material comprises alginate and cellulose. In some examples, the food-grade scaffold materialcomprises alginate and gelatin. In some examples, the food-grade scaffold material comprises alginate and gelatin.
[0111] In some examples, the one or more food-grade scaffold material is present at an amount of about 0.1% to about 5.0% weight / volume (w / v) for each material. In other examples, the one of more food-grade scaffold material is present at an amount of about 0.5% to 4.0%, about 1.0% to 3.0%, about 1.5% to 2.5%, or about 1.0% to 2.0% w / v for each material. In some examples, the one of more food-grade scaffold material is present at an amount of about 0.1%, 0.5%, 1%, 1.5%, 2.0%, 2.5%, 3.0%, 3.5%, 4.0%, 4.5% or 5% w / v for each material.
[0112] In some examples, the one or more food-grade scaffold material comprises about 0.1%-5% w / v of alginate. In some examples, the one or more food-grade scaffold material comprises about 0.5% to 4.0%, about 1.0% to 3.0%, about 1.5% to 2.5%, or about 1.0% to 2.0% w / v of alginate. In some examples, the one or more food-grade scaffold material comprises about 0.1%, 0.5%, 1%, 1.5%, 2.0%, 2.5%, 3.0%, 3.5%, 4.0%, 4.5% or 5% w / v of alginate. In some examples, the one or more food-grade scaffold material comprises about 0. l%-5% w / v of carboxymethyl cellulose (CMC). In some examples, the one or more foodgrade scaffold material comprises about 0.5% to 4.0%, about 1.0% to 3.0%, about 1.5% to 2.5%, or about 1.0% to 2.0% w / v of carboxymethyl cellulose (CMC). In some examples, the one or more food-grade scaffold material comprises about 0. 1%, 0.5%, 1%, 1.5%, 2.0%, 2.5%, 3.0%, 3.5%, 4.0%, 4.5% or 5.0% w / v of carboxymethyl cellulose (CMC). In some examples, the one or more food-grade scaffold material comprises about 0. l%-5% w / v of gelatin. In some examples, the one or more food-grade scaffold material comprises about 0.5% to 4.0%, about 1.0% to 3.0%, about 1.5% to 2.5%, or about 1.0% to 2.0% w / v of gelatin. In some examples, the one or more food-grade scaffold material comprises about 0.1%, 0.5%, 1%, 1.5%, 2.0%, 2.5%, 3.0%, 3.5%, 4.0%, 4.5% or 5% w / v of gelatin. In some examples, the one or more foodgrade scaffold material comprises about 0. 1 %-5% w / v of pectin. In some examples, the one or more food-grade scaffold material comprises about 0.5% to 4.0%, about 1.0% to 3.0%, about 1.5% to 2.5%, or about 1.0% to 2.0% w / v of pectin. In some examples, the one or more foodgrade scaffold material comprises about 0.1%, 0.5%, 1%, 1.5%, 2.0%, 2.5%, 3.0%, 3.5%, 4.0%, 4.5% or 5.0% w / v of pectin.
[0113] In some examples, the one or more food-grade scaffold material comprises alginate and carboxymethyl cellulose (CMC), wherein alginate is present at an amount of about 0.1 %-5 0% w / v and wherein carboxymethyl cellulose (CMC) is present at an amount of about 0.1%-5.0% w / v. In some examples, the one or more food-grade scaffold material comprises alginate and carboxymethyl cellulose (CMC), wherein alginate is present at an amount of about0.5% to 4.0%, about 1.0% to 3.0%, about 1.5% to 2.5%, or about 1.0% to 2.0% w / v and wherein carboxymethyl cellulose (CMC) is present at an amount of about 0.5% to 4.0%, about 1.0% to 3.0%, about 1.5% to 2.5%, or about 1.0% to 2.0% w / v. In some examples, the one or more food-grade scaffold material comprises alginate and carboxymethyl cellulose (CMC), wherein alginate is present at an amount of about 0.1%, 0.5%, 1%, 1.5%, 2.0%, 2.5%, 3.0%, 3.5%, 4.0%, 4.5% or 5% w / v and wherein carboxymethyl cellulose (CMC) is present at an amount of about 0.1%, 0.5%, 1%, 1.5%, 2.0%, 2.5%, 3.0%, 3.5%, 4.0%, 4.5% or 5% w / v. In some examples, the one or more food-grade scaffold material comprises alginate and carboxymethyl cellulose (CMC), wherein alginate is present at an amount of about 0.5% w / v and wherein carboxymethyl cellulose (CMC) is present at an amount of about 1.0%-2.0% w / v. In some examples, the one or more food-grade scaffold material comprises alginate and carboxymethyl cellulose (CMC), wherein alginate is present at an amount of about 0.5% w / v and wherein carboxymethyl cellulose (CMC) is present at an amount of about 0.5% w / v. In some examples, the one or more food-grade scaffold material comprises alginate and carboxymethyl cellulose (CMC), wherein alginate is present at an amount of about 0.5% w / v and wherein carboxymethyl cellulose (CMC) is present at an amount of about 1.0% w / v. In some examples, the one or more food-grade scaffold material comprises alginate and carboxymethyl cellulose (CMC), wherein alginate is present at an amount of about 0.5% w / v and wherein carboxymethyl cellulose (CMC) is present at an amount of about 1.5% w / v. In some examples, the one or more food-grade scaffold material comprises alginate and carboxymethyl cellulose (CMC), wherein alginate is present at an amount of about 0.5% w / v and wherein carboxymethyl cellulose (CMC) is present at an amount of about 1.5% w / v. In some examples, the one or more food-grade scaffold material comprises alginate and carboxymethyl cellulose (CMC), wherein alginate is present at an amount of about 0.5% w / v and wherein carboxymethyl cellulose (CMC) is present at an amount of about 2.0% w / v.
[0114] In some examples, the one or more food-grade scaffold material comprises alginate and gelatin, wherein alginate is present at an amount of about 0.1%-5.0% w / v and wherein gelatin is present at an amount of about 0. l%-5.0% w / v. In some examples, the one or more food-grade scaffold material comprises alginate and gelatin, wherein alginate is present at an amount of about 0.5% to 4.0%, about 1.0% to 3.0%, about 1.5% to 2.5%, about 1.0% to 2.0% w / v or about 3.0% to 4.0% w / v, and wherein gelatin is present at an amount of about 0.5% to 4.0%, about 1 .0% to 3.0%, about 1 .5% to 2.5%, about 1 .0% to 2.0% or about 3.0% to 4.0% w / v. In some examples, the one or more food-grade scaffold material comprises alginate and gelatin, wherein alginate is present at an amount of about 0.1%, 0.5%, 1%, 1.5%, 2.0%,2.5%, 3.0%, 3.5%, 4.0%, 4.5%, or 5.0% w / v and wherein gelatin is present at an amount of about 0.1%, 0.5%, 1%, 1.5%, 2.0%, 2.5%, 3.0%, 3.5%, 4.0%, 4.5% or 5% w / v. In some examples, the one or more food-grade scaffold material comprises alginate and gelatin, wherein alginate is present at an amount of about 3.0%-4.0% w / v and wherein gelatin is present at an amount of about 3.0%-4.0% w / v. In some examples, the one or more food-grade scaffold material comprises alginate and gelatin, wherein alginate is present at an amount of about 3% w / v and wherein gelatin is present at an amount of about 3% w / v.
[0115] As described herein, the cell-laden scaffold comprises one or more types of cells. In some examples, the one or more types of cells comprises lipid-producing precursor cells and / or lipid-producing cells. In some examples, the lipid-producing precursor cells can include, but are not limited to adipose-derived stem cells, preadipocytes, adipocyte progenitor cells, mesenchymal stem cells, embryonic stem cells, induced-pluripotent stem cells, or combinations thereof. In some examples, the lipid-producing cells can include, but are not limited to adipocytes, hepatocytes, sebocytes, mammary epithelial cells or keratinocytes
[0116] In some examples, the cell density in the cell-laden scaffold is about 8,000 to 12,000 cells / mm3. In some examples, the cell density is about 8,500 to 11,500 cells / mm3, about 9,000 to 11,000 cells / mm3or about 9,500 to 10,500 cells / mm3. In some examples, the cell density in the cell-laden scaffold is about 8,000 cells / mmJ, 8,500 cells / mm3, 9,000 cells / mm3, 9,500 cells / mm3, 10,000 cells / mm3, 10,500 cells / mm3, 11,000 cells / mm3, 11,500 cells / mm3or 12,000 cells / mm3. In some examples, the cell density is about 10,000 cells / mm3. As can be appreciated by a person skilled in the art, the cell density in the cell-laden scaffold is dependent on the density of cells of the cell -polymeric solution mixture used to fabricate or form the scaffold. Thus, the density of cells in the cell-laden scaffold can be modified by changing the density of cells in the cell-polymeric solution mixture when fabricating the scaffold.
[0117] In other examples, the lipid-producing precursor cells and lipid-producing cells are of animal origin. In some examples, the lipid-producing cells can be of avian, amphibian, bovine, fish, ovine, porcine or reptilian origin. In some examples, the cell-laden scaffold as disclosed herein can also comprise lipid-producing cells from bacterial, fungal or algal origin.
[0118] In some examples, the cell-laden scaffold can comprise alginate, carboxymethyl cellulose (CMC), and adipose-derived stem cells. In some examples, the cell-laden scaffold can comprise alginate, carboxymethyl cellulose (CMC), and preadipocytes. In some examples, the cell-laden scaffold can comprise alginate, carboxymethyl cellulose (CMC), and mesenchymal stem cells. In some examples, the cell-laden scaffold can comprise alginate, carboxymethyl cellulose (CMC), and adipose progenitor cells. In some examples, the cell-laden scaffold can comprise alginate, carboxymethyl cellulose (CMC), and embryonic stem cells. In some examples, the cell-laden scaffold can comprise alginate, carboxymethyl cellulose (CMC), and induced pluripotent stem cells.
[0119] In some examples, the cell-laden scaffold can comprise alginate, carboxymethyl cellulose (CMC), and adipocytes. In some examples, the cell-laden scaffold can comprise alginate, carboxymethyl cellulose (CMC), and hepatocytes. In some examples, the cell-laden scaffold can comprise alginate, carboxymethyl cellulose (CMC), and sebocytes. In some examples, the cell-laden scaffold can comprise alginate, carboxymethyl cellulose (CMC), and mammary epithelial cells. In some examples, the cell-laden scaffold can comprise alginate, carboxymethyl cellulose (CMC), and keratinocytes.
[0120] In some examples, the cell-laden scaffold can comprise 0.1 %-5% w / v alginate, 0.1%-5% w / v carboxymethyl cellulose (CMC) and adipose-derived stem cells. In other examples, the cell-laden scaffold can comprise 0.5% w / v alginate, 0.5%-2.0% w / v carboxymethyl cellulose (CMC) and adipose-derived stem cells. In one example, the cell-laden scaffold comprises 0.5% w / v alginate, 1.5% w / v carboxymethyl cellulose (CMC) and adipose- derived stem cells. In some examples, the cell-laden scaffold can comprise 0.1%-5% w / v alginate, 0. l%-5% w / v carboxymethyl cellulose (CMC) and preadipocytes. In other examples, the cell-laden scaffold can comprise 0.5% w / v alginate, 0.5%-2.0% w / v carboxymethyl cellulose (CMC) and preadipocytes. In one example, the cell-laden scaffold comprises 0.5% w / v alginate, 1.5% w / v carboxymethyl cellulose (CMC) and preadipocytes. In some examples, the cell-laden scaffold can comprise 0.1%-5% w / v alginate, 0.1%-5% w / v carboxymethyl cellulose (CMC) and adipose progenitor cells. In other examples, the cell-laden scaffold can comprise 0.5% w / v alginate, 0.5%-2.0% w / v carboxymethyl cellulose (CMC) and adipose progenitor cells. In one example, the cell-laden scaffold comprises 0.5% w / v alginate, 1.5% w / v carboxymethyl cellulose (CMC) and adipose progenitor cells. In some examples, the cellladen scaffold can comprise 0.1%-5% w / v alginate, 0.1%-5% w / v carboxymethyl cellulose (CMC) and mesenchymal stem cells. In other examples, the cell-laden scaffold can comprise 0.5% w / v alginate, 0.5%-2.0% w / v carboxymethyl cellulose (CMC) and mesenchymal stem cells. In one example, the cell-laden scaffold comprises 0.5% w / v alginate, 1.5% w / v carboxymethyl cellulose (CMC) and mesenchymal stem cells. In some examples, the cell-laden scaffold can comprise 0. l%-5% w / v alginate, 0. l%-5% w / v carboxymethyl cellulose (CMC) and embryonic stem cells. In other examples, the cell-laden scaffold can comprise 0.5% w / v alginate, 0.5%-2.0% w / v carboxymethyl cellulose (CMC) and embryonic stem cells. In one example, the cell-laden scaffold comprises 0.5% w / v alginate, 1.5% w / v carboxymethylcellulose (CMC) and embryonic stem cells. In some examples, the cell-laden scaffold can comprise 0.1%-5% w / v alginate, 0. l%-5% w / v carboxymethyl cellulose (CMC) and induced pluripotent stem cells. In other examples, the cell-laden scaffold can comprise 0.5% w / v alginate, 0.5%-2.0% w / v carboxymethyl cellulose (CMC) and induced pluripotent stem cells. In one example, the cell-laden scaffold comprises 0.5% w / v alginate, 1.5% w / v carboxymethyl cellulose (CMC) and induced pluripotent stem cells.
[0121] In some examples, the cell-laden scaffold can comprise 0. l%-5% w / v alginate, 0.1%-5% w / v carboxymethyl cellulose (CMC) and adipocytes. In other examples, the cellladen scaffold can comprise 0.5% w / v alginate, 0.5%-2.0% w / v carboxymethyl cellulose (CMC) and adipocytes. In one example, the cell-laden scaffold comprises 0.5% w / v alginate, 1.5% w / v carboxymethyl cellulose (CMC) and adipocytes. In some examples, the cell-laden scaffold can comprise 0. l%-5% w / v alginate, 0. l%-5% w / v carboxymethyl cellulose (CMC) and hepatocytes. In other examples, the cell-laden scaffold can comprise 0.5% w / v alginate, 0.5%-2.0% w / v carboxymethyl cellulose (CMC) and hepatocytes. In one example, the cellladen scaffold comprises 0.5% w / v alginate, 1.5% w / v carboxymethyl cellulose (CMC) and hepatocytes. In some examples, the cell-laden scaffold can comprise 0.1%-5% w / v alginate, 0. l%-5% w / v carboxymethyl cellulose (CMC) and sebocytes. In other examples, the cell-laden scaffold can comprise 0.5% w / v alginate, 0.5%-2.0% w / v carboxymethyl cellulose (CMC) and sebocytes. In one example, the cell-laden scaffold comprises 0.5% w / v alginate, 1.5% w / v carboxymethyl cellulose (CMC) and sebocytes. In some examples, the cell-laden scaffold can comprise 0. l%-5% w / v alginate, 0. l%-5% w / v carboxymethyl cellulose (CMC) and mammary epithelial cells. In other examples, the cell-laden scaffold can comprise 0.5% w / v alginate, 0.5%-2.0% w / v carboxymethyl cellulose (CMC) and mammary epithelial cells. In one example, the cell-laden scaffold comprises 0.5% w / v alginate, 1.5% w / v carboxymethyl cellulose (CMC) and mammary epithelial cells In some examples, the cell-laden scaffold can comprise 0.1%-5% w / v alginate, 0.1%-5% w / v carboxymethyl cellulose (CMC) and keratinocytes. In other examples, the cell-laden scaffold can comprise 0.5% w / v alginate, 0.5%- 2.0% w / v carboxymethyl cellulose (CMC) and keratinocytes. In one example, the cell-laden scaffold comprises 0.5% w / v alginate, 1.5% w / v carboxymethyl cellulose (CMC) and keratinocytes.
[0122] In some examples, the cell-laden scaffold can comprise alginate, gelatin, and adipose-derived stem cells. Tn some examples, the cell-laden scaffold can comprise alginate, gelatin, and preadipocytes. In some examples, the cell-laden scaffold can comprise alginate, gelatin, and adipose progenitor cells. In some examples, the cell-laden scaffold can comprisealginate, gelatin, and mesenchymal stem cells. In some examples, the cell-laden scaffold can comprise alginate, gelatin, and induced pluripotent stem cells. In some examples, the cell-laden scaffold can comprise alginate, gelatin, and embryonic stem cells.
[0123] In some examples, the cell-laden scaffold can comprise alginate, gelatin, and adipocytes. In some examples, the cell-laden scaffold can comprise alginate, gelatin, and hepatocytes. In some examples, the cell-laden scaffold can comprise alginate, gelatin, and sebocytes. In some examples, the cell-laden scaffold can comprise alginate, gelatin, and mammary epithelial cells. In some examples, the cell-laden scaffold can comprise alginate, gelatin, and keratinocytes.
[0124] In some examples, the cell-laden scaffold can comprise 0.1%-5.0% w / v alginate, 0.1%-5.0% w / v gelatin, adipose-derived stem cells. In some examples, the cell-laden scaffold can comprise 3.0%-4.0% w / v alginate, 3.0%-4.0% w / v gelatin, and adipose-derived stem cells. In some examples, the cell-laden scaffold can comprise 3.0%-4.0% w / v alginate, 3.0%-4.0% w / v gelatin, and adipose-derived stem cells. In some examples, the cell-laden scaffold can comprise 0. l%-5.0% w / v alginate, 0.1%-5.0% w / v gelatin, preadipocytes. In some examples, the cell-laden scaffold can comprise 3.0%-4.0% w / v alginate, 3.0%-4.0% w / v gelatin, and preadipocytes. In some examples, the cell-laden scaffold can comprise 3.0%-4.0% w / v alginate, 3.0%-4.0% w / v gelatin, and preadipocytes. In some examples, the cell-laden scaffold can comprise 0. l%-5.0% w / v alginate, 0.1%-5.0% w / v gelatin, adipose progenitor cells. In some examples, the cell-laden scaffold can comprise 3.0%-4.0% w / v alginate, 3.0%- 4.0% w / v gelatin, and adipose progenitor cells. In some examples, the cell-laden scaffold can comprise 3.0%-4.0% w / v alginate, 3.0%-4.0% w / v gelatin, and adipose progenitor cells. In some examples, the cell-laden scaffold can comprise 0.1%-5.0% w / v alginate, 0.1%-5.0% w / v gelatin, mesenchymal stem cells. In some examples, the cell-laden scaffold can comprise 3.0%- 4.0% w / v alginate, 3.0%-4.0% w / v gelatin, and mesenchymal stem cells. In some examples, the cell-laden scaffold can comprise 3.0%-4.0% w / v alginate, 3.0%-4.0% w / v gelatin, and mesenchymal stem cells. In some examples, the cell -laden scaffold can comprise 0.1%-5.0% w / v alginate, 0.1%-5.0% w / v gelatin, induced pluripotent stem cells. In some examples, the cell-laden scaffold can comprise 3.0%-4.0% w / v alginate, 3.0%-4.0% w / v gelatin, and induced pluripotent stem cells. In some examples, the cell-laden scaffold can comprise 3.0%-4.0% w / v alginate, 3.0%-4.0% w / v gelatin, and induced pluripotent stem cells. In some examples, the cell-laden scaffold can comprise 0. 1 %-5.0% w / v alginate, 0.1 %-5.0% w / v gelatin, embryonic stem cells. In some examples, the cell-laden scaffold can comprise 3.0%-4.0% w / v alginate,3.0%-4.0% w / v gelatin, and embryonic stem cells. In some examples, the cell-laden scaffold can comprise 3.0%-4.0% w / v alginate, 3.0%-4.0% w / v gelatin, and embryonic stem cells.
[0125] In some examples, the cell-laden scaffold can comprise 0.1%-5.0% w / v alginate, 0.1%-5.0% w / v gelatin, and adipocytes. In some examples, the cell-laden scaffold can comprise 3.0%-4.0% w / v alginate, 3.0%-4.0% w / v gelatin, and adipocytes. In some examples, the cell-laden scaffold can comprise 3.0%-4.0% w / v alginate, 3.0%-4.0% w / v gelatin, and adipocytes. In some examples, the cell-laden scaffold can comprise 0.1%-5.0% w / v alginate, 0.1%-5.0% w / v gelatin, and hepatocytes. In some examples, the cell-laden scaffold can comprise 3.0%-4.0% w / v alginate, 3.0%-4.0% w / v gelatin, and hepatocytes. In some examples, the cell-laden scaffold can comprise 3.0%-4.0% w / v alginate, 3.0%-4.0% w / v gelatin, and hepatocytes. In some examples, the cell-laden scaffold can comprise 0.1 %-5.0% w / v alginate, 0.1%-5.0% w / v gelatin, and sebocytes. In some examples, the cell-laden scaffold can comprise 3.0%-4.0% w / v alginate, 3.0%-4.0% w / v gelatin, and sebocytes. In some examples, the cellladen scaffold can comprise 3.0%-4.0% w / v alginate, 3.0%-4.0% w / v gelatin, and sebocytes. In some examples, the cell-laden scaffold can comprise 0.1%-5.0% w / v alginate, 0.1%-5.0% w / v gelatin, and mammary epithelial cells. In some examples, the cell-laden scaffold can comprise 3.0%-4.0% w / v alginate, 3.0%-4.0% w / v gelatin, and mammary epithelial cells. In some examples, the cell-laden scaffold can comprise 3.0%-4.0% w / v alginate, 3.0%-4.0% w / v gelatin, and mammary epithelial cells. In some examples, the cell -laden scaffold can comprise 0.1%-5.0% w / v alginate, 0.1%-5.0% w / v gelatin, and keratinocytes. In some examples, the cell-laden scaffold can comprise 3.0%-4.0% w / v alginate, 3.0%-4.0% w / v gelatin, and keratinocytes. In some examples, the cell-laden scaffold can comprise 3.0%-4.0% w / v alginate, 3.0%-4.0% w / v gelatin, and keratinocytes.
[0126] As disclosed herein, the cell-laden scaffold can be in the form of a three- dimensional shape. In some examples, the cell-laden scaffold in the form of a sphere, fiber, sheet, film, ribbon, cord, flat disc, cylinder or any amorphous shapes. In some examples, the cell-laden scaffold can be formed or fabricated by a method comprising any one of electrospraying, electrospinning, wet-spinning, 3D printing, microfluidic droplet generation or bulk encapsulation.
[0127] In one example, the cell-laden scaffold can be in the form of a sphere. In some examples, the sphere has a diameter of about 10 pm to about 1800 pm. In some examples, the sphere has a diameter of about 50 pm to 1500 pm, 100 pm to 1200 pm, 200 pm to 1000 pm, 300 pm to 800 pm, 350 pm to 700 pm, 300 pm to 500 pm or 250 pm to 400 pm. In some examples, the sphere has a diameter of about 10 pm, 50 pm, 100 pm, 150 pm, 200 pm, 250gm, 300 gm, 350 gm, 400 gm, 450 pm, 500 gm, 550 gm, 600 gm, 650 gm, 700 gm, 750 gm, 800 gm, 850 gm, 900 gm, 950 gm, 1000 gm, 1100 gm, 1200 gm, 1300 gm, 1400 gm, 1500 gm, 1600 gm, 1700 gm or 1800 gm. In some examples, the sphere is about 250 pm to 350 gm. In some examples, the sphere is about 300 gm In some examples, the sphere is about 350 gm. In some examples, the sphere is about 550 gm. In some examples, the sphere is about 1600 gm. In some examples, microspheres of smaller diameter are preferred for supporting cell viability. Without being bound by theory, the microspheres fabricated should be less than 300gm in diameter to ensure effective nutrient and waste diffusion between the external environment and the encapsulated cells, to support high cell survival. In some examples, the present disclosure shows that larger diameter microspheres of about 1600 gm are also viability and shows at least 85% cell viability over 21 days in culture (Figure 11C and 11D). In these examples, the viability of large diameter microspheres fabricated using the method as disclosed herein may be attributed to the intrinsic porosity of the material and differences in initial cell seeding density. The ability to sustain high cell viability within large microspheres allows for scalability of the method disclosed, as larger batches of microspheres can be fabricated more efficiently compared to smaller ones.
[0128] In some examples, the stiffness of the microsphere scaffold is determined by methods of rheological analysis known in the art. In some examples, the stiffness of the microsphere scaffold is about 0.1 kPa to 5 kPa. In some examples, the stiffness of the microsphere scaffold is about 0.5 kPa to 4.5 kPa, 1 kPa to 4 kPa, 1.5 kPa to 3.5 kPa, 2 kPa to 3 kPa or 0.5 kPa to 1.5 kPa. In some examples, the stiffness of the microsphere scaffold is about 0.1 kPa, 0.2 kPa, 0.3 kPa, 0.4 kPa, 0.5 kPa, 0.6 kPa, 0.7 kPa, 0.8 kPa, 0.9 kPa, 1.0 kPa, 1.2 kPa, 1.4 kPa, 1.5 kPa, 1.6 kPa, 1.8 kPa, 2.0 kPa, 2.2 kPa, 2.4 kPa, 2.5 kPa, 2.6 kPa, 2.8 kPa, 3 kPa, 3.2 kPa, 3.4 kPa, 3.5 kPa, 3.6 kPa, 3.8 kPa, 4.0 kPa, 4.2 kPa, 4.4 kPa, 4.5 kPa, 4.6 kPa, 4.8 kPa or 5 kPa In some examples, the microsphere scaffold can have a stiffness of about 2 kPa. In some examples, the microsphere scaffold can have a stiffness of about 3.5 kPa. In some examples, the stiffness of a microsphere scaffold comprising 0.5% alginate and 0.5-2.0% alginate is about 0.6 to 5 kPa. Without being bound by theory, the stiffness of the cell-laden scaffold can change over time due to cell-mediated remodelling, or enzymatic degradation of the scaffold. For example, by day 21 of culture, cell-mediated remodelling, or enzymatic degradation may cause measurable softening or stiffening of the scaffold. Nonetheless, as described herein, the stiffness of the cell-laden microsphere scaffold in the range of 0. 1 kPa to 5 kPa supports the differentiation of lipid-producing precursor cells into lipid-producing cells when cultured in the food-grade differentiation medium as disclosed herein.
[0129] In some examples, the cell-laden scaffold as disclosed herein is in the form of a microsphere. As can be appreciated by a person skilled in the art, the method of electrospraying can be used to obtain the cell-laden microsphere scaffold as disclosed here. Electrospraying is a voltage-driven technique that uses a high-voltage electric field to break a low-viscosity liquid into micro- or nano-scale particles and nanodroplets. In some examples, the electrospraying technique for forming the microspheres involves pumping the mixture comprising the polymeric solution and lipid-producing precursor cells from an emitter, such as a needle. In some examples, a high voltage is applied to the emitter, causing charges to accumulate on the liquid’s surface and deform it into a cone shape, known as the Taylor cone. In some examples, at the apex of the Taylor cone, an electrically charged jet of liquid is ejected towards a collector. In some examples, the jet breaks into many smaller droplets due to electrostatic repulsion forces. In some examples, the solvent from the droplets evaporates during transit, leading to the formation of solid dense particles. In some examples, the resulting electrosprayed micro- or nanoparticles are deposited on a collector. In some examples, the collector bath can comprise a crosslinking agent to allow crosslinking of the materials in the polymeric solution to form a 3D environment in the form of a sphere. The crosslinking agent in collector solution is dependent on the material of the polymeric solution. For example, if the material is alginate, the crosslinking agent can be a multivalent cation. Examples of such multivalent cations can include but are not limited to calcium ions, barium ions, strontium ions or iron (III) ions. In some examples, the crosslinking agent for alginate is calcium ions (Ca2+) from calcium chloride. In this example, a spraying mixture comprising alginate can be electrosprayed into a collector bath comprising calcium ions to form a gel.
[0130] As can be appreciated by a person skilled in the art, the size and morphology of the electrosprayed product is dependent on parameters including, but are not limited to the voltage applied to the mixture being electrosprayed, the physical property of the mixture, and the flow rate, which is the rate at which the mixture is pumped through the emitter. The effects of voltage, flow rate, composition of the polymeric solution on the morphology of and size of the microspheres obtained from electrospraying are provided in Example 2.
[0131] In some examples, the spraying mixture is loaded and infused through a needle tip at a constant flow rate of 2.5 mL / hr to 100 ml / hr. In some examples, the flow rate is about 2.5 mL / hr to 50 mL / hr or 25 mL / hr to 50 mL / hr. In some examples, the flow rate is about 2.5 mL / hr, 10 mL / hr, 25 mL / hr, 50 mL / hr or 100 mL / hr. In some examples, the flow rate is 2.5 mL / hr. In some examples, the flow rate is 100 mL / hr. In some examples, a voltage of about 5 kV to 25 kV is applied as the spraying mixture is ejected from the needle into a collector bath.In some examples, a voltage of about 8 kV to 22 kV, 10 kV to 20 kV, 12 kV to 18 kV, 12 kV to 15 kV or 14 kV to 16kV. In some examples, the applied voltage is 5 kV, 7 kV, 9 kV, 11 kV, 15 kV, 20 kV or 25 kV. In some examples, the applied voltage is 11 kV. In some examples, fabrication parameters were tuned by increasing the applied voltage for generating the smaller microspheres across different flow rates.
[0132] In some examples, the cell-laden scaffold can be in the form of a fiber. In some examples, the cell-laden fiber scaffold can have a diameter of about 80 pm to about 140 pm. In some example, the fiber can have a diameter of about 90 pm to 130 pm or 100 pm to 120 pm. In some examples, the fiber scaffold can have a diameter of about 80 pm, 90 pm, 100 pm, 110 pm, 120 pm, 130 pm or 140 pm. In some examples, the cell-laden fiber scaffold can have a diameter about 100 pm. In some examples, the stiffness of the fiber scaffold is determined by methods of rheological analysis known in the art. In some examples, the stiffness of the microfiber scaffold is about 5 kPa to 15 kPa. In some examples, the stiffness of the microfiber scaffold is about 6 kPa to 14 kPa, 7 kPa to 12 kPa, 8 kPa to 10 kPa or 9 kPa to 10 kPa. In some examples, the stiffness of the microfiber scaffold is about 5 kPa, 5.5 kPa, 6 kPa, 6.5 kPa, 7 kPa, 7.5 kPa, 8 kPa, 8.5 kPa, 9 kPa, 9.5 kPa, 10 kPa, 10.5 kPa, 11 kPa, 11.5 kPa, 12 kPa, 12.5 kPa, 13 kPa, 13.5 kPa, 14.0 kPa, 14.5 kPa or 15 kPa. In some examples, stiffness of a microfiber scaffold obtained from a combination of 3% alginate and 3% gelatin is about 10 kPa. Without being bound by theory, the stiffness of the cell -laden scaffold can change over time due to cell- mediated remodeling, or enzymatic degradation of the scaffold. For example, by day 21 of culture, cell-mediated remodeling, or enzymatic degradation may cause measurable softening or stiffening of the scaffold. Nonetheless, as described herein, the stiffness of the cell -laden microfiber scaffold in the range of 5 kPa to 15 kPa supports the differentiation of lipid- producing precursor cells into lipid-producing cells when cultured in the food-grade differentiation medium as disclosed herein.
[0133] In some examples, the cell-laden scaffold as disclosed herein is in the form of a microfiber. As known in the art, wet spinning is a method of producing polymer fiber by extruding a polymeric or polymer solution through a spinneret into a coagulation bath that solidifies the polymer into a 3D filament structure. In some examples, the wet spinning method comprises the steps of extruding the polymeric solution through the fine orifice of a spinneret into a coagulation bath, and collecting of the resultant fibers in the coagulation bath to obtain the fiber. In one example, the coagulation bath comprises a crosslinking agent that can used to crosslink the materials contained in the polymeric solution to form a 3D structure. Examples of cell-laden scaffold in the form of a microfiber are provided in Example 1.
[0134] In another aspect, the present disclosure provides a kit for obtaining a cell-laden scaffold comprising lipid-producing cells, the kit comprising: (a) a one or more food-grade scaffold material; (b) one or more populations of lipid-producing precursor cells; and (c) a food-grade differentiation medium for differentiating the lipid-producing precursor cells into the lipid-producing cells. In some examples, the food-grade differentiation medium comprises a fatty acid.
[0135] The method of manufacturing a cell-laden scaffold comprising lipid-producing cells as disclosed herein, as well as the cell-laden scaffold product obtained from the method as disclosed herein can be applicable for use in cultivating a food product, such as cultivated meat. For example, fatty acid profile analysis of lipids obtained from lipid-producing cells cultured in the cell-laden scaffold is of a similar fatty acid profile as an animal source of fat (Figure 42).
[0136] Thus, in another aspect, the present disclosure provides a method of manufacturing the cell-laden scaffold comprising lipid-producing cells as disclosed herein can be used for cultivating a food product or part of a food product. In some examples, the cultivated food product is cultivated meat. In another aspect, the present disclosure also provides a food product comprising the cell-laden scaffold as disclosed herein. In some examples, the food product is cultivated meat In another aspect, there is also provided a lipid composition isolated from the lipid-producing cells obtained from culturing the cell-laden scaffold.
[0137] In another aspect, the present disclosure provides a method of differentiating a lipid-producing precursor cell into a lipid-producing cell, wherein the method comprises culturing the lipid-precursor cell in a food-grade differentiation medium consisting essentially of or consisting of a basal cell growth medium with or without a serum, and optionally an antibiotic. In some examples, the serum is fetal bovine serum.
[0138] In another aspect, the present disclosure provides a food-grade differentiation medium comprising one or more fatty acids, wherein the food-grade differentiation medium is serum-free or contains about 1-3% of a serum. In some examples, the serum is fetal bovine serum (FBS). In some examples, the one or more fatty acids can include, but are not limited to oleate, decanoate, linoleate, palmitate, stearate, and combinations thereof. In some examples, the food-grade differentiation medium as disclosed herein can further comprise an edible carrier. In some examples, the edible carrier is a lipid or a protein carrier In some examples, the edible carrier can include, but is not limited to lecithin, phospholipids, glycerols such as monoacylglycerols or di acylglycerols, a non-ionic surfactant, such as polysorbates, sucroseesters of fatty acids, cyclodextrins, natural oils, liposomes. In some examples, the phospholipids can include, but are not limited to phosphatidylcholine or phospholipids obtained from milk. In some examples, the glycerols can include, but are not limited to glyceryl monooleate or glyceryl monostearate. In some examples, the polysorbates can include but are not limited to polysorbate 20, also known as Tween 20, or polysorbate 80 also known as Tween 80. In some examples, the sucrose esters of fatty acids can include, but are not limited to sucrose monolaurate, sucrose monopalmitate, or sucrose monooleate. In some examples, the cyclodextrins can include, but are not limited to a-cyclodextrin, [3-cyclodextrin, y-cyclodextrin. In some examples, the natural oils can include, but are not limited to medium-chain triglyceride (MCT) oil, olive oil or microemulsions. In some examples, the liposomes can be lipid vesicles formed from phospholipids and / or cholesterols obtained from plants and / or other edible sources.
[0139] The invention illustratively described herein may suitably be practiced in the absence of any element or elements, limitation or limitations, not specifically disclosed herein. Thus, for example, the terms "comprising", "including", "containing", etc. shall be read expansively and without limitation. Further, as used herein the term “consisting essentially of’ describes an invention that includes the listed elements but also allows for other components, provided those additional components do not materially affect the invention's basic and novel characteristics. Additionally, the terms and expressions employed herein have been used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention claimed. Thus, it should be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features, modification and variation of the inventions embodied therein herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention.
[0140] As used in this application, the singular form “a,” “an,” and “the” include plural references unless the context clearly dictates otherwise For example, the term “a genetic marker” includes a plurality of genetic markers, including mixtures and combinations thereof.
[0141] As used herein, the term “about”, in the context of concentrations of components of the formulations, typically means + / - 5% of the stated value, more typically + / - 4% of the stated value, more typically + / - 3% of the stated value, more typically, + / - 2% of thestated value, even more typically + / - 1% of the stated value, and even more typically + / - 0.5% of the stated value.
[0142] Throughout this disclosure, certain embodiments may be disclosed in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the disclosed ranges. Accordingly, the description of a range should be considered to have specifically disclosed all the possible sub-ranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed sub-ranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.
[0143] Certain embodiments may also be described broadly and generically herein. Each of the narrower species and sub-generic groupings falling within the generic disclosure also form part of the disclosure. This includes the generic description of the embodiments with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the excised material is specifically recited herein.
[0144] The invention has been described broadly and generically herein. Each of the narrower species and sub-generic groupings falling within the generic disclosure also form part of the invention. This includes the generic description of the invention with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the excised material is specifically recited herein.
[0145] Other embodiments are within the following claims and non- limiting examples.In addition, where features or aspects of the invention are described in terms of Markush groups, those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group.
[0146] It should further be appreciated that the exemplary examples are only examples, and are not intended to limit the scope, applicability, dimensions, or configuration of the disclosure in any way. Rather, the foregoing detailed description will provide those skilled in the art with a convenient road map for implementing an exemplary embodiment of the disclosure, it being understood that various changes may be made in the function and arrangement of elements and method of fabrication described in an exemplary embodiment without departing from the scope of the disclosure as set forth in the appended claims.EXAMPLESExample 1: Wet-spun microfibers
[0147] Representative images of the wet-spun microfibers from 3% alginate-3% gelatin (A3G3), 3% alginate-4% gelatin (A3G4) and 4% alginate-4% gelatin (A4G4) as well as the average diameter of the respective microfibres are shown in Figure 1. A3G3 microfibers have an average diameter of 99.44 ± 3 ,76um, while the diameters of A3G4 microfibers average about 100.23 ± 3.65um. The diameters of A3G3 and A3G4 microfibers are similar while the diameters of A4G4 microfibers are greater with an average of 113.86 ± 3.52 pm and is statistically significant with p>0.05 from the other two compositions.
[0148] Figure 4 provides the analysis of gel strength of the above-mentioned alginate- gelatin composite hydrogels, which was taken as the storage modulus of the hydrogels at 1% strain, and at the angular frequency of 1 Hz. As can be seen from Figure 4, A3G3 hydrogel has a gel strength or stiffness of 9.84 ± 0.238 kPa (n=3), while A3G4 has a gel strength of 19.2 ± 0.252 kPa (n=3) and A4G4 has a gel strength of 32.8 ± 0.259 kPa (n=3). A3G3 hydrogel has the lowest gel strength as compared to other microfibers and could mimic the soft and compliant microenvironment of native adipose tissue the most.
[0149] The presence of lipids in the cells confined in A3G3 microfibres was confirmed with Oil-red-O staining. Oil-red-O-stained cells are indicated by the white arrows in Figure 5. This data shows that porcine adipose-derived stem cells (pADSCs), when confined in A3G3 microfibers, can be differentiated into lipid-producing cells.Example 2: Electro-sprayed microspheres
[0150] A representative image of electro-sprayed cell-laden microspheres is shown in Figure 6, which have a diameter of about 305 ± 42.98 pm. The base material used to obtain the electrosprayed microspheres in Figure 6 is 0.5% alginate and 1.5% CMC, electrosprayed at a flow rate of 2.5 mL / hr at a voltage of 1 1 kV.
[0151] The diameter of the microspheres can be varied by adjusting the composition of the base material and the parameters of the electrospray, such as flow rate and voltage. Five different compositions were used for the fabrication of microsphere, namely 0.5% alginate, 0.5% alginate-0.5% CMC, 0.5% alginate-1% CMC, 0.5% alginate-1.5% CMC and 0.5% alginate-2% CMC. Electrospraying a polymeric solution comprising 0.5% alginate or composition of alginate and CMC in equal part at 0.5% was not optimal for forming homogenous spherical microspheres as shown in Figure 7. As the CMC concentration increases from 1%, homogenously spherical microspheres were fabricated across differentapplied voltages. Additionally, increasing the applied voltage can also reduce the size of the microspheres.
[0152] To understand the effect of applied voltage on the morphology of the electrosprayed microsphere, circularity, diameter and size distribution of the fifty electrosprayed microspheres (n=50) were randomly chosen for each composition and analyzed using an image analysis software (Image J) as shown in Figures 8 and 9. As shown in Figure 8, applying a voltage of 5kV resulted in microspheres with the highest mean circularity and narrowest spread while microspheres with the lowest mean circularity and widest spread were observed at 13kV for all 3 concentrations. In the context of Figure 8A, the circularity of the microspheres obtained from a composition of 0.5% alginate - 1% CMC were lower and had wider spread than other combinations of concentration and voltage This observation was similar to the brightfield images captured in Figure 7 as well, where microspheres were concaved and crumpled when sprayed from 7kV to 13kV for composition of 0.5% alginate - 1% CMC. The size of microspheres fabricated as a function of applied voltage and CMC concentration was analyzed and shown in Figure 9. Increasing CMC concentration from 1% to 1.5% and 2% led to an increase in average microsphere diameter, from 390.47 ± 49.04pm to 523.95 ± 64.08pm, to 1754.62 ± 24pm respectively. Secondly, increasing applied voltage from 5kV to 13kV led to a decrease in average microsphere diameter. While 0.5% alginate - 1.5% CMC electrosprayed at a voltage of 13kV allowed the fabrication of the smallest microspheres with good circularity, microspheres electrosprayed at 13kV showed some level of cell leakage from the microspheres, which was not otherwise observed in microspheres electrosprayed at l lkV (see Figure 10).
[0153] The effect of flow rate on the morphology of the microspheres was also investigated and shown in Figure 11. Figure 11 shows a panel of microspheres composed of 0.5% alginate and 1.5% CMC, fabricated under electrospray conditions with systematically varied voltages (5 kV to 25 kV) and flow rates (2.5 mL / hr to 100 mL / hr), as visualized using an inverted light microscope. The data demonstrates that higher flow rates, of up to 100 mL / hr, can be employed to enhance production throughput while maintaining uniform microsphere morphology, particularly using a polymeric solution composed of 0.5% alginate and 2% CMC (Figure 11B). A flow rate of 2.5 mL / hr was selected for subsequent experiments, as this condition consistently yielded the smallest microsphere size at any fixed voltage.
[0154] The capability of larger microspheres to sustain cell viability was also investigated to evaluate scalability. As shown in Figures 11C and 11D, encapsulation of pADSCs within microspheres ranging from 350 pm to 1600 pm in diameter achieved high cellviability of at least 85% over 21 days of culture. These findings demonstrate that the porous, plant-derived scaffold obtained from the electrospraying conditions disclosed could provide a favorable environment for the encapsulation and subsequent differentiation of pADSCs into adipocytes, irrespective of microsphere size.
[0155] The viscoelastic properties of fabricated microspheres are shown in Figure 12 and 13. From Figure 13, the storage modulus (G’) of the base material was higher than the loss modulus (G”) for all 3 different concentrations of CMC, depicting a viscoelastic behavior of hydrogel construct. It can be seen that increasing the concentration of alginate increases the stiffness of the resulting base material hydrogel construct (Figure 12) while increasing the concentration of CMC decreases its stiffness (Figure 13). As shown in Figure 14, the decreasing stiffness with increasing CMC concentration is due to the swelling capacity of the base material as a higher concentration of CMC can hold higher water content.
[0156] In light of the data above, a polymeric solution comprising 0.5% alginate and 1.5% CMC was used for fabricating the microspheres used in subsequent experiments. The polymeric solution was sprayed through a 25 G needle tip at a flow rate of 2.5 mL / hr and at an applied voltage of 1 IkV to obtain the cell-laden microsphere for subsequent experiments.Example 3: Viability of lipid-precursor cells confined in cell-laden microspheres
[0157] As shown in Figure 15, it was found that the alginate - CMC microspheres could support high cell viability of pADSCs over 21 days of culture, with 85.3% viability on day 21 (n=3 biological triplicates). To corroborate the quantitative cell viability study, the viability of pADSCs encapsulated in the microspheres were qualitatively studied using a confocal microscope. The pADSCs-laden microspheres were stained with live-dead dye (calcein-AM / ethidium homodimer-1) and z-stack images (z=l 5pm) of the stained cells-laden microspheres were then acquired and presented using maximum intensity projection as shown in Figure 16Example 4: Differentiating lipid-precursor cells confined in cell-laden microspheres into lipid-producing cells
[0158] To evaluate the effectiveness of the microspheres in inducing differentiation of encapsulated pADSCs into adipocytes (fats), the amount of lipid production from cells encapsulated in microspheres were then compared against that of cells cultured on conventional 2D tissue culture plates, both of which were cultured without the use of adipogenic differentiation medium The amount of lipid produced was then studied across 21 days as shown in Figure 17. The presence of lipid production in cells cultured on conventional 2D tissue culture plates shows that pADSCs has a propensity towards adipogenesis even withoutaddition of chemical inducers of adipogenesis to induce them, though at a very limited rate. When the pADSCs are confined in the 3D environment of a microsphere, a 2 7-fold increase in lipid production within the encapsulated cells was detected by day 21 of culture as compared to cells cultured in the 2D tissue culture plates. Accordingly, the amount of lipid produced as measured by LipidTOX staining is 2.6 ±0.63pm2of lipid per cell for cells cultured 2D tissue culture plates and 7.0 ± 1 ,58pm2of lipid per cell for cells confined in the microsphere.Example 5: Differentiating fish adipose-derived stem cells confined in cell-laden microspheres into adipocytes
[0159] In this example, the differentiation of fish adipose-derived stem cells (fADSCs) encapsulated in the microsphere is described. Based on data shown in Figures 18 and 19, the confinement of fADSCs in microspheres supports and maintains high viability of fADSCs over 21 days (of more than 80%). Further, the differentiation efficacy of the fADCSs was then compared against 2D control; wherein fADSCs were cultured in a growth media to confluency before differentiating in a growth media or differentiation media respectively. fADSCs differentiated in 2D and those encapsulated in 3D platform were then stained for the adipocyte marker (LipidTOX-red) at each time point over 21 days and imaged under confocal fluorescence microscopy.
[0160] As shown in Figure 20, cells differentiated using a growth medium on 2D culture plates did not produce any observable lipids, similar to cells confined within the 3D microsphere, as shown by the absence of lipids stained with LipidTOX. However, quantification of the lipid produced using triglyceride assay as showed that differentiating the cells confined within the 3D microspheres resulted in a significantly higher amount of lipids produced post 21-days of differentiation as compared to 2D system, from 0.08 ± 0.03 mg in 2D system to 0.19 ± 0.01 mg in the 3D system (Figure 21). Culturing the fADSCs confined in 3D microspheres using the specialized adipogenic culture medium comprising small molecule adipogenic inducers showed that the confined fADSCs could effectively differentiate into adipocytes as shown by the increasing number of LipidT ox-positive cells across 21 day of culture.Example 6: Differentiation of pADSCs-laden microspheres in an edible (food-grade) medium
[0161] A quantification of the gene expression of transcription factor, PPARg, and its regulation on adipokine (adiponectin) was performed to evaluate the efficacy of the pADSCs confined in the 3D microspheres in inducing adipogenesis. The data for this experiment is shown in Figure 23. Three sample groups were studied, namely (a) control group (pADSCscultured on 2D culture dish with edible differentiation media); (b) specialized adipogenic medium cocktail group (pADSCs cultured on 2D culture dish with adipogenic differentiating medium consisting of DMEM +10% FBS supplemented with IBMX, insulin and dexamethasone); and (c) 3D encapsulated cells (pADSCs confined in 3D microspheres cultured with edible differentiation media). The expression of PPARg was significantly higher in pADSCs cultured in specialized adipogenic medium cocktail (7-fold) and those encapsulated in microspheres (5-fold) as compared to control group. The efficacy of the 3D microspheres in inducing adipogenesis was similar to that of specialized adipogenic medium cocktail group, with no significant difference between the two. With the upregulation of PPARg, there was a corresponding increase in the expression of adiponectin, with the expression significantly higher in pADSCs cultured in specialized adipogenic medium cocktail (~186 fold) and those encapsulated in microspheres (~28 fold) as compared to control.Example 7: Synergistic effect of medium-chain fatty acid and confinement of cells in 3D environment on adipogenesis
[0162] In order to determine if fatty acids could indeed induce adipogenesis in pADSCs and accumulate lipid, pADSCs was differentiated in 3D systems (alginate-CMC microspheres) and compared with pADSCs grown on 2D tissue culture plates. Both groups were cultured in the edible differentiation media supplemented with either decanoate or the specialized adipogenic medium cocktail. The supplementation of 1 mM decanoate in the edible differentiation media could induce adipogenesis of pADSCs and had similar lipid production as that of specialized adipogenic medium cocktail for both 2D and 3D systems (Figure 24C- 25F). Decanoate could also significantly increase the amount of lipid production to the extend similar to that of specialized adipogenic medium cocktail, as compared to the negative controls where no toxic soluble factors were added (Figure 24A and 24B).
[0163] Tn Figure 25, the data for pADSCs-laden microspheres cultured in DMEM culture media supplemented with increasing concentration of sodium decanoate from 0.25 mM to 1 mM over 21 days is shown. As can be seen from the photomicrographs, the increasing the concentration of sodium decanoate was not toxic to the cells as exhibited by the presence of largely viable cells as compared to dead cells with increasing concentration of sodium decanoate over 21 days of culture. The quantification of the viability of pADSC laden in microspheres when cultured in DMEM media supplemented with the highest concentration of 1 mM sodium decanoate across 21 days is shown in Figure 26. Culturing pADSCs-laden microspheres in DMEM media supplemented with 1 mM sodium decanote supports high cellviability of 95.2% (n=3 biological triplicates) over 21 days of culture, similar to that of cells cultured in normal DMEM media.
[0164] The efficacy of sodium decanoate in inducing adipogenesis of pADSCs confined in microspheres is shown in Figure 27. It was found that the adipogenesis of pADSCs increases at a dose-dependent manner with sodium decanoate across 21 days of culture. The quantified amount of lipids indicated that increasing the concentration of sodium decanoate increases the mass of lipids produced per 10 million cells, with the highest amount of lipids produced when supplemented with 1 mM of sodium decanoate post 21 days of differentiation with a mass of 15.17 ± 2.14 mg of lipids obtained. Increasing the concentration of sodium decanoate stimulates the rate of adipogenic differentiation, with the mass of lipids produced on day 7 significantly higher in cells treated with 1 mM of sodium decanoate as compared to that of cells cultured in DMEM media supplemented with 0.5 mM sodium decanoate. Photomicrographs in Figure 28 show LipidTOX staining of the cells confined in microspheres cultured in increasing concentration of sodium decanoate. It can be seen that the number of cells stained with the adipocyte marker LipidTOX increases with the concentration of sodium decanoate. The earlier onset of adipogenesis with increasing concentration of sodium decanoate was also observed as shown by a higher number of cells stained with LipidTOX post-7 days of differentiation for cells treated with ImM sodium decanoate as compared to the other study groups.
[0165] The concentration of 1 mM sodium decanoate was supplemented to DMEM media to evaluate the synergistic effect of medium-chain fatty and mechanotransduction induced by the confinement of pADSCs in the 3D microspheres (referred to as 3D culture system). pADSCs cultured in DMEM media with and without ImM sodium decanoate were performed for both 2D and 3D culture system and were cultured across 21 days. The amount of lipids produced for each group were quantified using triglyceride assay and presented in Figure 29. In growth medium without the sodium decanoate, pADSCs encapsulated in 3D microspheres were able to produce 2.7 times more lipids than 2D culture (2.6 ± 0.63 pm2in 2D vs 7.0 ± 1.58 pm2in 3D). However, when the growth medium was supplemented with 1 mM sodium decanoate, this difference was enlarged to 10.8 times (33.5 ±7.1 pm2in 2D vs 364.4 ± 37.4 pm2in 3D) as compared to 2D systems.Example 9: Effect of long-chain fatty acid and confinement of cells in 3D environment on adipogenesis
[0166] Representative phase contrast image showing the morphology of pADSCs cultured in DMEM culture media supplemented with increasing concentration of sodium oleateover 24 hours is shown in Figure 30. After 24 hours of treatment in increasing concentration of sodium oleate, pADSCs cultured in DMEM media supplemented with up to 250 pM of sodium oleate maintained a healthy morphology as compared to pre-treated cells. Shrinkage of cells were observed for pADSCs treated with sodium oleate of 500 pM and 1 mM, and a visible loss of cells for that of ImM sodium oleate treatment group.
[0167] Using the LIVE / DEAD assay, it is shown that high cell viability was maintained across 7 days of culture for cells treated with a sodium oleate concentration of up to 250 pM, with viability similar to negative control (growth media) and that of cells treated with ImM sodium decanoate as indicated by the presence of live cells (LIVE, Figure 31 and 32). Upon treating the cells with a much higher concentration of sodium oleate at 500 pM and 1 mM, it was found that a majority of the cells were washed off as observed by the absence of cells stained with either green or red dye, possible due to the cytotoxicity of the high concentration of sodium oleate that cause the cells to undergo apoptosis and lift off during the analysis.
[0168] The LIVE / DEAD assay were then corroborated with the quantitation of the viable cells using CCK-8 assay. Cells were treated at an increasing concentration of sodium oleate over 7 days of culture and the quantified cell viability is presented as optical density under the absorbance of 450nm as shown in Figure 33. The quantification of viable cells displayed a significant drop in cell count post-24 hours of treatment at concentration 500 pM sodium oleate and above, as compared to day 0 (pre-treatment), while cells treated with sodium oleate ranging from a concentration of 10 pM to 250 pM were viable 7 days post-treatment, similar to the that of cells treated with sodium decanoate and those cultured in just DMEM media alone (Figure 33). Based on the data above, the range of concentration of sodium oleate that can be used for eventual adipogenesis would be lOpM to 250pM.
[0169] The cell viability of pADSCs encapsulated in the 3D microsphere is also evaluated. The cell viability was established via qualitative and quantitative means through LIVE / DEAD assay across 7 days of culture and presented Figures 34-36. Based on Figure 34, the LIVE / DEAD assay showed high viability of cells after 24 hours of treatment across all the concentration of sodium oleate, as observed by the large number of cells stained for live dye in green for all groups. While 2D data showed that 500 pM and 1000 pM sodium oleate were cytotoxic to pADSCs in Figure 31, the presence of viable cells in both the groups for 3D system after 1 day of treatment with the same concentration of sodium oleate indicated that the presence of scaffolds could limit the diffusion oleate to the cells. However, after 7 days of treatment with increasing concentration of sodium oleate, the LIVE / DEAD assay showed that the high viability of cells was only maintained up to a concentration of 250 pM of sodiumoleate, while at higher concentration of sodium oleate many encapsulated cells were dead (Figure 35). Quantification of the live and dead cells using fluorescence cell counter further corroborate the above finding and showed a significant drop in viable cells 7 days posttreatment at a sodium oleate concentration of 500 pM and above, as compared to day 1 (Figure 36).
[0170] Based on the above data, a concentration of 250 pVl of sodium oleate was chosen for differentiation of pADSCs confined in the 3D microspheres. While there is no significant staining of cells for lipid marker, LipidTOX, after 1 day of culture in all groups as shown in Figure 37, a significant number of cells were observed to be stained with LipidTOX for 250 pM sodium oleate and 1 mM sodium decanoate after 7 days of culture as shown in Figure 38. The opacity of the cells in 250 pM sodium oleate and 1000 pM sodium decanoate were visually higher than that of control (DMEM) and 250 pM sodium decanoate is indicative of differentiation of cells. No significant staining of cells with LipidTOX was observed for the control group (DMEM) and those treated with 250 pM sodium decanoate was seen in Figure 38. From Figure 39, it can be seen that after 14 days of culture, there is no significant staining of cells with LipidTOX for the control (DMEM) group while a few cells were stained with LipidTOX when treated with 250 pM sodium decanoate. Based on LipidTOX staining images, more lipids were produced per cell for pADSCs-laden microspheres treated with 250 pM sodium oleate and that of 1000 pM sodium decanote as compared to day 7. Larger globular lipids were also observed in each cell for both groups. By day 21, the opacity between cells treated with 250 pM sodium oleate and 1000 pM sodium decanoate were significantly higher than cells in the control (DMEM) and 250 pM sodium decanoate groups due to the agglomeration and / or differentiation of cells into adipocytes. A few cells were observed to have produced lipids for control (DMEM) group due to the effect of mechanotransduction in the 3D system. Cells treated with 250 pM sodium oleate or 1000 pM sodium decanoate continued to produce more and larger lipids by day 21 (Figure 40).
[0171] In the data shown in Figure 41, the effect of supplementing sodium oleate in a growth medium is compared with the specialized adipogenic medium comprising small molecule adipogenic inducers. fADSCs were first cultured in 2D culture plates and left to grow until confluency before changing the media to various differentiation media for differentiation of fADSCs over 21 days. The treatment groups include a negative control group, labeled as ‘GM’, which is a growth medium without sodium oleate or any adipogenic factors, 50 pM to 500 pM of sodium oleate added to the control growth medium, as well as the positive control group ‘DM’ which is the specialized adipogenic differentiation medium comprising smallmolecule inducers. Based on the immunostaining images in Figure 41, supplementing growth medium with 500 pM of sodium oleate could produce a significant amount of lipids after differentiating the fADSCs for 6 days, as compared to groups supplemented with 50 pM, 100 pM and 250 pM of sodium oleate The number of LipidTOX-stained cells in the 500 pM sodium oleate group is similar to that of “DM” group, indicating that supplementing 500 pM of sodium oleate to growth medium could induce the adipogenesis of fADSCs to the same level as the specialized adipogenic differentiation medium comprising small molecule inducers.
[0172] In data shown in Figure 42, the effect of supplementing sodium oleate and sodium decanoate in a growth medium under reduced fetal bovine serum (FBS) condition is investigated. Under reduced-serum conditions of about 3% FBS, fish adipose-derived stem cells (fADSCs) cultured within the confinement of the microspheres exhibited a marked enhancement in adipogenic differentiation relative to standard high-serum control of 6% FBS and growth medium containing 15% FBS (GM) and differentiation medium containing a basal cell growth medium, supplemented with dexamethasone, IBMX, and linoleic-oleic acid in bovine serum albumin (DM). Fluorescent staining with LipidTOX revealed a higher proportion of lipid-positive cells, together with increased lipid droplet number and size, indicative of more advanced adipocyte maturation (Figure 42(i)). In parallel, DAPI staining suggested that overall cell density was comparable or slightly reduced under low-serum conditions (Figure 42 (ii)), consistent with the well -documented shift from proliferative to differentiative programs when serum-derived mitogenic factors are diminished. When combined with sodium oleate supplementation, the reduced-serum condition further potentiated lipid accumulation, underscoring a synergistic effect between exogenous fatty acids and serum restriction in driving fADSCs adipogenesis.Example 10: Fatty acid profile of cultivated fats in microspheres with or without mediumchain fatty acid
[0173] In this example, the fatty acid profde of lipids produced by pADSCs-laden microspheres cultured in the edible media with and without sodium decanoate was analyzed using gas chromatography -mass spectrometry (GC-MS) after 21 days of differentiation and compared with the fatty acid profiles of lipids obtained from 2D culture of pADSCs differentiated in specialized adipogenic medium and the fatty acid profiles of pork lard, a source of fat that is consumed. The percentage of the different fatty acid content found in the different groups is presented in Figure 43. Based on the data, pork lard is made up of four major fatty acids as highlighted in Figure 43, namely palmitate, stearate, oleate and linoleate. pADSCs differentiated in microspheres with and without sodium decanoate could producelipids with similar fatty acid composition as pork lard. pADSCs-laden microspheres differentiated in growth media with 1 mM sodium decanoate produced lipids with EPA and DHA that were not present in commercial pork lard.Example 11: Appearance of fat construct obtained from lipid-producing cell-laden microspheres manufactured using methods disclosed herein
[0174] In the data shown in Figure 44, the macroscopic formation and visual appearance of an exemplary cultivated fat construct obtained from the method as disclosed herein is provided. The fat construct was obtained by assembling lipid-producing cell-laden microspheres produced using electrosprayed microspheres fabricated from a polymeric mixture comprising 0.5% (w / v) alginate and 1.5% (w / v) carboxymethyl cellulose (CMC). In this example, porcine adipose-derived stem cells (pADSCs) were encapsulated within the microspheres at a cell density of 10 x 106cells / mL prior to crosslinking. The cell-laden microspheres were subsequently cultured in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1 mM sodium decanoate for 21 days. After which, the cell-laden microspheres obtained were assembled together using a food binder, such as calcium alginate. As shown in Figure 44A, a representative acellular construct fabricated from the same 0.5% alginate-1.5% CMC composition remained translucent and hydrogel-like after culture, serving as the control. A representative fat construct obtained from assembling the lipid-producing cell-laden microspheres, as shown in Figure 44B, is opaque, cohesive, and white after culturing in the food-grade medium for 21 days, indicating lipid accumulation and adipogenic differentiation of the encapsulated pADSCs. For comparison, Figure 44C shows the appearance of commercially available or natural pork lard, which displays a similar degree of opacity and tissue-like consistency as the fat construct obtained from the method disclosed herein. The representative cultivated fat construct obtained from assembling the cell-laden microspheres (Figure 44B) exhibits a comparable macroscopic appearance to that of natural pork lard, confirming that the developed 3D culture platform can reproduce the visual and textural features of animal fat through cell-driven lipid deposition within the microsphere matrix.EXPERIMENTAL SECTIONFabrication of cell-laden microfibers using wet-spinning method
[0175] Porcine adipose-derived stem cells (pADSCs) were first dissociated from the culture flasks and subsequently resuspended with alginate-gelatin pre-gel solution consistingof a range from 3% alginate-3% gelatin (A3G3), 3% alginate-4% gelatin (A3G4) and 4% alginate-4% gelatin ( A4G4) The encapsulation cell density used was 10 million cells / ml. Microbial transglutaminase (mTgase), an enzymatic crosslinker for gelatin was added to the pre-gel cell solution and homogenized using a vortex for 5 s. The pre-gel cell solution was transferred to a syringe and tube system before injected into a 150 mM calcium chloride coagulation bath using a syringe pump at the rate of 0.1 ml / min, via a 25 G blunt tip dispensing needle. The cell-laden microfibers were then collected with rotating drum sleeves of 30 mm outer diameter, at 80 rounds per minute (rpm). After wet-spinning, the drum sleeves with cellladen microfibers were then removed from the drum and placed into a 50 U / ml mTgase bath and incubated at 37°C for 15 min before they were transferred into petri dish with comprising a cell culture medium for culture at 37°C in air with 5% CO2. The drum sleeves with the cellladen microfibers were then placed in petri dishes and submerged in the culture media for eventual cell differentiation. The cell culture media was changed every 2-3 days. The cell culture media used in this context comprises DMEM,10% FBS and 1% Penicillin- Streptomycin.Fabrication of microspheres using electrospraying method
[0176] A solution of 0.5% (w / v) sodium alginate was first prepared by dissolving sodium alginate in phosphate-buffered saline (PBS) The solution was left to dissolve overnight at 4°C. Sodium carboxymethyl cellulose (CMC) with 0.7 degree of substitution and Mw of 250,000. CMC and alginate powder were first weighed and combined before dissolving in PBS to make up solutions consisting of 0.5% alginate with 0.5%, 1%, 1.5% and 2% of CMC (w / v). The solution was then left to dissolve overnight at 4°C.
[0177] The prepared alginate-CMC solutions were first electrosprayed to fabricate microspheres with a uniform size distribution. The alginate or alginate-CMC solutions were loaded into a syringe and infused through a 25G needle tip at a constant flow rate of 2 5mL / hr to 100 mL / hr. At an applied voltage of 5 kV to 25 kV, the solutions were sprayed into microspheres and collected in 100 mM calcium chloride (CaCh) collector bath. The size, circularity and stiffness of the microspheres obtained were quantified.Rheological analysis
[0178] The mechanical properties of the microfibers and microspheres were evaluated to determine whether the soft characteristic of native adipose tissue could be replicated. The mechanical properties of the hydrogel were assessed using rheological analysis Hydrogel discs of 25 mm diameter were fabricated and subjected to oscillatory measurements on a plate-plate rheometer in order to determine the gel strength of the different alginate-gelatin compositematerials. When hydrogels were subjected to an amplitude sweep of 0.1-100% strain rate, at an angular frequency of 10 rad / s and at 37°C, the storage and loss modulus of hydrogels were recorded. At low strain rates, the mechanical response of the hydrogel is linear and this is known as the linear viscoelastic region (LVR), where the modulus of the hydrogels is independent of the applied deformation. This region can be determined by subjecting hydrogels to an amplitude sweep as shown in Figure 2, with the linear viscoelastic region (LVR) indicated in the line with double arrow heads. After identifying the linear viscoelastic region (LVR), hydrogels were subjected to a frequency sweep of 0.1-100 rad / s, at a strain of 1%, which lies within the linear viscoelastic region (LVR) and at 37°C. The storage and loss modulus recorded during the experiment is presented in Figure 4. Based on these parameters, the gel strength or stiffness, can be determined. For the storage modulus presented in Figure 4 the method is as follows: alginate-gelatin hydrogel composites were prepared in 10 cm petri dishes and was punched into 25 mm discs, with a thickness of 5 mm. A rheometer (Anton Paar Rheometer MCR 501) was used to measure the storage modulus of the hydrogel disc samples. The hydrogels were first subjected to an amplitude sweep of 0-100% strain, at an angular frequency of 10 rad / s The linear viscoelastic region (LVR) was identified, and at the strain of 0.1%, within the LVR, a frequency sweep of 0.1-100 rad / s. The tests were conducted at 37°C, with a 25 mm diameter parallel plate.
[0179] For the storage modulus presented in Figure 13C the method is as follows: To fabricate the CMC and / or alginate-CMC hydrogel, 1 mL of solution consisting of 0.5% CMC, or 0.5% alginate-0.5%CMC, 0.5% alginate- 1%CMC, 0.5% alginate- 1.5%CMC, or 0.5%- 2%CMC) was first made and frozen at -80°C overnight in a circular mould with 14.5 mm inner diameter. The mould was a 10 mL syringe cut in half with the bottom sealed using parafilm. After the solution was completely frozen, 4 mL of lOOmM calcium chloride solution was added to the mould containing frozen CMC or alginate - CMC solutions for crosslinking for 24h in a 37°C oven. The top opening of the mould was sealed using parafilm to prevent evaporation of the calcium chloride solution. After 24h of crosslinking, the calcium chloride solution was poured away. The fabricated hydrogel was removed from the mould using a laboratory spatula, directly onto the rheometer stage (Anton Paar Rheometer MCR 501). An amplitude sweep was first performed from 0.01% to 100% strain at lOrad / s angular frequency to determine the limit of the linear viscoelastic region (LVER). Subsequently, frequency sweep was carried out at 0. 1 to 10 Hz, at a strain within the linear viscoelastic region The storage modulus (G’) and loss modulus (G”) were measured to investigate the influence of CMC concentration on the stiffness of the hydrogel. For both amplitude sweep and frequency sweep, a 12 mm diameter parallelplate was used. The measurement height was 2 mm and the characterization was carried out at room temperature.
[0180] For the compressive modulus presented in Figure 12, the method is as follows: Crosslinked gels of different compositions were subjected to uniaxial compression testing using a DMA TA Instruments Q800 system. The compression rate was set at 1% strain per minute at 37 °C. The Young’s modulus was determined from the elastic region of the stressstrain curve obtained.Oil-red-O staining protocol
[0181] pADSCs-laden microfibers were cultured in a culture medium comprising DMEM and 10% FBS and antibiotics over 21 days and washed with phosphate buffer saline (PBS) before staining with Oil-Red-O The stained pADSCs-laden microfibers or microscpheres were then imaged under an inverted brightfield microscope.Fabricating pADSCs-laden alginate-CMC microspheres
[0182] Cell-laden microspheres comprising lipid-producing precursor cells encapsulated in 0.5% alginate -1.5% CMC were fabricated to investigate the capability of the lipid-producing pre-cursor cells to differentiate into mature lipid-cells for cultivated meat application.
[0183] Porcine adipose-derived stem cells (pADSCs) were first harvested from porcine adipose tissue according to methods known in the art. The harvested pADSCs were then maintained in Dulbecco's modified Eagle's medium (DMEM, Life Technologies) supplemented with 10% fetal bovine serum (FBS, Life Technologies) and 1% of penicillin (100 units / mL) and streptomycin (100 pg / mL) (Life Technologies). The cells were cultured in T150 tissue culture flasks (Coming®, New York, USA) in a 37°C incubator with 5% CO2, with subsequent change in media every 2 days until approximately 80% confluent. The cells that were passaged 5-9 times were used for all cell studies.
[0184] pADSCs-laden alginate-CMC microspheres were then fabricated using an electrospray. The method of fabrication was the same as described above. Briefly, 0.5% alginate-1.5% CMC pre-polymeric solution and 10 million cells / mL of pADSCs were mixed together to obtain the spraying liquid. The pADSCs-laden microspheres cells were then cultured in the edible or food-grade differentiation media and the viability of cells in confined in the alginate-CMC microspheres was studied post 21 days of culture.Assessment of viability of cells
[0185] The viability of pADSCs encapsulated in the 0.5% alginate - 1.5% CMC microspheres was assessed using Live / Dead® Viability Assay Kit (Life Technologies)consisting of 4 mM Calcein AM and 2 mM Ethidium homodimer-1 (EthD-1). A live-dead solution was then prepared by diluting the Calcein AM and EthD-1 to a final concentration of 2pM and 4 pM respectively in a serum-free DMEM culture media before staining the cellladen microspheres. To quantify the viability of cells in alginate-CMC microspheres, the microspheres-containing cell strainers were first removed from the well plate at each time point and placed into a new 6-well plate. The strainers were inverted over, and a fixed volume of the live-dead staining solution was pipetted over the strainers to transfer the cell-laden microspheres into the new well plate. The microspheres were then incubated in the live-dead solution for 30 minutes at 37°C. Thereafter, the stained cell-laden microspheres were filtered and collected using a new cell strainer. The cell strainer now containing stained cell-laden microspheres were thoroughly washed with pre-warmed PBS three times and subsequently placed into a well plate containing 0.25% Trypsin-EDTA with enough volume (~5 mL) to fully cover the microspheres. The well plate with strainers was then incubated at 37°C for 5 minutes for the digestion of microspheres to take place. Thereafter, the digestion was stopped by adding a complete medium to the well plate and collecting the digested cell suspension into a 15 mL centrifuge tube. A cell pellet was obtained after centrifuging at 254g for 5 minutes. The supernatant was aspirated, and the cell pellet was gently washed with PBS before centrifuging the cell suspension. Finally, the cell pellet was homogenously resuspended in PBS and analyzed under a 3-channel fluorescence cell counter (NanoEnTek Arthur™, Seoul, Korea). Live and dead cells were counted based on expressing cells in the green channel (Lex = 458 ± 20nm) and red channel (Lex = 530 ± 20 nm) respectively. To remove any background signal, unstained single-cell suspension was analyzed using the fluorescence cell counter. Threshold and gating parameters were set using unstained cells suspension and samples from different time points were gated according to the same set of parameters. The cell viability was then quantified by normalizing the number of live cells by the total number of cells and expressed as a cell viability percentage based on Equation 1.Number of live cellsCell viability (%) = x 100% [Equation 1]Total number of cellsA qualitative study on the viability of pADSCs cells in alginate-CMC microspheres was also conducted to corroborate the viability quantification. At each time point, the 100pm cell strainers were removed from the well plate and placed into a new well plate. The strainers were inverted over, and a fixed volume of the live-dead staining solution was pipetted over the strainers to collect the cell-laden microspheres into the new well plate. The microspheres werethen incubated in the live-dead solution for 30 minutes at 37°C. Thereafter, the stained cellladen microspheres were imaged under LSM710 confocal microscope with a 10X dry objective. Z-stack images of the encapsulated live-dead cells were acquired (z=15 pm) and presented as a maximum projection image.Differentiating lipid-producing pre-cursor cells confined in cell-laden microspliere into lipid-producing cells
[0186] As described above, 0.5% alginate-1.5% CMC polymeric solution and 10 million cells / mL of pADSCs were first electrosprayed using the optimized parameters. The pADSCs-laden microspheres were then cultured in an edible differentiation media. The edible differentiation medium comprises DMEM, 3-10% FBS and optionally a fatty acid such as decanoic acid (decanoate) and oleic acid (oleate). The fatty acid is present in the culture medium at a concentration of 0.25 mM to 1 mM. The cell -laden microspheres were cultured in tissue cultures plates across 21 days (Corning®, New York, USA) in a 37°C incubator with 5% CO2, with subsequent change in media every 3 days. In some examples, the pADSCs-laden microspheres are cultured in a reduced-serum condition are then switched to a serum-free foodgrade differentiation medium containing 100-1000 pM sodium oleate or 100-1000 pM sodium decanoate, or any other fatty acids. Medium is refreshed every 72 h for 0-21 days.Assessing differentiation of lipid-producing precursor cells into lipid-producing cells
[0187] To assess the adipogenic differentiation of pADSCs confined in the alginate- CMC microspheres, cells were stained with HCS LipidTOX™ Red Neutral Lipid Stain (#H34476, Invitrogen), a marker for lipid production in adipocytes, and 4',6-Diamidino-2- Phenylindole, Dihydrochloride (DAPI), a nuclei stain ( D1306, Invitrogen) at 1 :20 and 1 : 1000 concentration respectively. For quantitative study of the lipid production, cells were harvested from the microspheres and stained with LipidTOX and phalloidin (CF®488 Phalloidin, Atlantis Bioscience) markers. The stained cell suspension was then analyzed under a fluorescence cell counter (NanoEnTek Arthur™, Seoul, Korea) through the green (hex = 458 ± 20nm) and red (Zex = 530 ± 20 nm) channels. To remove any background signal, unstained single-cell suspension was analyzed using the fluorescence cell counter. Threshold and gating parameters were set using unstained cells suspension and samples from different time points were gated according to the same set of parameters. The number of lipid-producing cells was then quantified by normalizing the number of cells expressing both LipidTOX and phalloidin by the total number of cells and expressed as a percentage based on Equation 2 below.T. . „ .. .. Number of cells expressing LipidTOX , ^ ^^ zrT-, .LipidTOX-positive cells (%) = - ; - ; - - — - - x 100% [Equation 2]Analysing the expression of PPARg and adiponection using real-time quantitative Polymerase Chain Reaction[00188| Total RNA was isolated using the PureLink® RNA Mini Kit (Invitrogen, Cat. 12183018A) following the manufacturer’s protocol, including on-ice lysis, ethanol addition, column purification, and RNase-free water elution. RNA quantity and purity were assessed using NanoDrop Microvolume Spectrophotometers (A260 / 280 = 2.0); integrity was verified and residual genomic DNA minimized per kit guidance (DNase step recommended). First- strand cDNA was synthesized from 0.5-1 .0 pg RNA using iScript™ Reverse Transcription Supermix for RT-qPCR (Bio-Rad, Cat. 1708840) with the standard program (25 °C 5 min, 46 °C 20 min, 95 °C 1 min). qPCR was performed with KAPA SYBR® FAST qPCR Master Mix (2x) (Sigma-Aldrich, Cat. KK4600) in 10-20 pL reactions containing l x master mix, 0.2 pM primers, and 1-2 pL cDNA. Porcine PPARv primers were: pPPARG-F TGACCCAGAAAGCGATGCCT and pPPARG-R GTCGTCCATCACCGACAGGT Porcine adiponectin primers were: pAdiponectin (F) TCTCCTTCCACGTCACGGTC and pAdiponectin (R) GCCAGACTTGGTCCCCCTTC. Porcine GAPDH primers with sequence pGAPDH (F) TCGGAGTGAACGGATTTG and pGAPDH (R) CCTGGAAGATGGTGATGG were used as housekeeping genes. Cycling used initial denaturation 95 °C for 2-3 min, then 40 cycles of 95 °C for 3-10 s and 60 °C for 20-30 s with single-point acquisition; a high-resolution melt curve (60-95 °C) confirmed a single specific amplicon Relative expression was calculated by the 2A-AACt method normalized to validated reference genes. Primer specificity was verified in silico (BLAST) and empirically by meltcurve and single-band amplicon sizing.Quantification of lipids in cells using triglyceride quantification assay
[0189] Quantification of lipid in cells using triglyceride quantification assay: Free fatty acid and triglyceride level were measured by colorimetric method using Abeam quantification kit (#ab65336). In brief, lipids were extracted through 5% NP-40 from cell solution and collection of supernatants by centrifuge. The free fatty acid / triglycerides of the supernatant collected at each time point is then quantified using Abeam quantification kit and measured at Ex / Em 535 / 587 nm via fluorometric plate reader.Immunostaining with LipidTOX and confocal microscopy
[0190] Cells were harvested from their culture and deposited into a cell strainer of 8.0pm pore size. The excess solution with cells were carefully drained using an absorbentmaterial from under the strainer. This process is repeated until a desirous density of cells is achieved. The cells were then fixed with 10% formalin in PBS for 30 minutes and rinsed with PBS by draining the PBS solution from under the strainer carefully. The fixed cells were then stained with HCS LipidTOX™Red Neutral Lipid Stain (#H34476, Invitrogen) and 4', 6- Diamidino-2-Phenylindole, Dihydrochloride (DAP I) (# D1306, Invitrogen) at 1 : 10 and 1 :2000 concentration respectively in PBS for 30 minutes. The stained cells were then imaged with Zeiss LSM980 with Airyscan2 at Ex582 / Em616 for LipidTOX and Ex353 / Em465 for DAPI. Images were then post-processed and analysed with ImageJ for quantification of lipid area and number of cells.Swelling behavior of alginate and CMC hydrogel composition
[0191] The effect of CMC concentration on the swelling behavior of alginate - CMC hydrogels was evaluated using two methods. Hydrogels of three selected compositions containing 0.5% w / v alginate and 1.0 % w / v carboxymethyl cellulose (CMC), 0.5% w / v alginate and 1.5 CMC, 0.5% w / v alginate and 2 % w / v CMC were prepared as previously described. After 24 h of crosslinking, excess calcium chloride solution was removed, and the wet weight of each hydrogel was recorded. The samples were then dried in a vacuum oven at room temperature until all water was removed, after which the dry weight was measured. The swelling capacity and water content were calculated according to Equations (3) and (4), respectively. Each condition was assessed with six replicates.~ ... . Wet weight-dry weightr_ . >_Swelling capacity = - driTweiqht - [Equation 3JWater content = Wet weight - dry weight [Equation 4]Lipid extraction for mass spectrometry
[0192] The total fatty acid content of the sample provided was detected based on Gas Chromatography-Mass Spectrometry (GC-MS) methods known in the art. Firstly, the metabolites in the samples were extracted, and then the processed samples were analyzed by liquid mass spectrometry, the massHunter quantitative software was used to calculate the peak area of the targeted data, and the identification results were obtained by the single-point internal standard method.
[0193] For lipid extraction from a liquid sample, the following steps were performed: 1. Obtain 50LLL of the sample, add 0.5 mL n-hexane, shake at 50°C for 30 min.2. Add 0.5mL KOH methanol solution (0.4moL / L), shake at 50°C for 30min for derivatization.3. Stand still, after the temperature drops to room temperature, add 0.5mL water and mix well.4. Static and stratified, take 90 pL of the supernatant, add 10 L of internal standard (methyl nonadecanoate 125 pg / mL), gas sampling detection.
[0194] For lipid extraction from solid cell sample, the following steps were performed:1. Accurately weigh the required mass (8.3mg) of the sample, add 0.5 mL of n-hexane, and shake at 50°C for 30 minutes.2. Add 0.5mL KOH methanol solution (0.4moL / L), shake at 50°C for 30min for derivatization.3. Stand still, after the temperature drops to room temperature, add 0.5mL water and mix well.4. Static and stratified, take 90 pL of the supernatant, add 10 L of internal standard (methyl nonadecanoate 125 pg / mL), gas sampling detection.
[0195] For lipid extraction from solid lard, the following steps were performed:1. Accurately weigh the required mass of sample, homogenize it, add 3 mL of n-hexane, and shake at 50°C for 30 minutes. .2. Add 3mL KOH methanol solution (0.4moL / L), shake at 50°C for 30min for derivatization.3. Stand still, after the temperature drops to room temperature, add ImL of water and mix well.4. Static and stratified, take 90 pL of the supernatant, add 10 L of internal standard (methyl nonadecanoate 125 pg / mL,), gas sampling detection.Cell viability assay as evaluated by CCK-8
[0196] At each time point (day 0, day 1 and day 7), the cell culture medium was aspirated and replaced with 200pL of 10% (v / v) CCK-8 in DMEM-10% FBS culture medium. The samples were incubated at 37°C for 2 hours in the dark. Thereafter, lOOpL were withdrawn from the contents and transferred to a new clean 96-well plate. The absorbance of the samples was measured at 450nm using a SpectraMax M2 microplate reader and the cell viability over days were analyzed. A net absorbance value of cells cultured in different concentration of sodium oleate was obtained by deducting the obtained absorbance value of each well sample with that of its blank, wherein the blank consists of just DMEM-10% FBS culture medium and 10% (v / v) CCK-8 solution.
Claims
CLAIMS1. A method of manufacturing a cell-laden scaffold comprising lipid-producing cells, the method comprising:(a) preparing a mixture comprising lipid-producing precursor cells and a foodgrade polymeric solution;(b) forming a three-dimensional (3D) environment from the mixture from (a) such that the lipid-producing precursor cells are confined in the 3D environment, and(c) culturing the lipid-producing precursor cells confined in 3D environment from (b) in a food-grade differentiation medium for differentiating the lipid-precursor cells into lipid-producing cells to obtain the cell-laden scaffold.
2. The method according to claim 1, wherein the food-grade differentiation medium comprises a fatty acid.
3. The method according to claim 1 or 2, wherein the lipid-producing precursor cells are cultured in a reduced serum culture medium prior to being cultured in the food-grade differentiation medium, wherein the reduced serum culture medium comprises 3% or less than 3% of a serum.
4. The method according to claim 3, wherein the food-grade medium is serum-free.
5. The method according to claim 1-4, wherein the food-grade polymeric solution comprises one or more types of material selected from the group consisting of alginate, pectin, agarose, carrageenan, gellan gum, konjac glucomannan, xanthan gum, guar gum, locust bean gum, gum arabic, starches and derivatives thereof, pullulan; 0- glucans, cellulose and derivatives thereof, gelatin, collagen, whey proteins, casein, caseinates, soy proteins, pea proteins, gluten, glutenin, zein and combinations thereof.
6. The method according to claim 5, wherein the one or more types of material in the polymeric solution is present at an amount of 0.1% to 5.0% weight / volume (w / v) for each material.
7. The method according to any one of claims 1-6, wherein the 3D environment and the cell-laden scaffold is characterized by a stiffness of 0.1-15 kPa.
8. The method according to any one of claims 1-7, wherein the mixture contains about 8- 12 million cells / mL.
9. The method according to any one of claims 1-8, wherein the lipid-producing precursor cells are selected from the group consisting of adipose-derived stem cells, preadipocytes mesenchymal stem cells, embryonic stem cells, induced-pluripotent stem cells and combinations thereof.
10. The method according to any one of claims 1-9, wherein the lipid-producing cells are selected from the group consisting of adipocytes, hepatocytes, sebocytes, mammary epithelia cells, keratinocytes and combinations thereof.1 1 . The method according to any one of claims 1 -10, wherein the lipid-producing cells are obtained from an animal.
12. The method according to any one of claims 1-11, wherein the manufactured cell-laden scaffold is in the form of a three-dimensional shape.
13. The method according to claim 12, wherein the manufactured cell-laden scaffold is in the form of a sphere, fiber, sheet, film, ribbon, cord, flat disc, cylinder or any amorphous shape.
14. The method according to claim 2, wherein the fatty acid is a medium-chain fatty acid or a long chain fatty acid.
15. The method according to claim 14, wherein the medium-chain fatty acid is decanoate (C: 10).
16. The method according to claim 14, wherein the long chain fatty acid is oleate (C18: 1 cis-9), linoleate (C18:2), palmitate (C16:0) or stearate (C18:0).
17. The method according to any one of claims 1-16, wherein the 3D environment and the cell-laden scaffold is formed by a method comprising any one of electrospraying, electrospinning, wet-spinning, 3D printing, microfluidic droplet generation or bulk encapsulation.
18. The method according to any one of claims 1-17, wherein the method is used for cultivating a food product, preferably meat.
19. A cell-laden scaffold comprising lipid-producing cells, obtained or obtainable from the method of any one of claims 1-17.
20. A cell-laden scaffold comprising one or more food-grade scaffold materials and one or more types of cells, wherein the cell-laden scaffold is characterized by a stiffness of 0. 1 - 15 kPa.
21. The cell-laden scaffold of claim 20, wherein the one or more type of cells comprises lipid-producing precursor cells and / or lipid-producing cells.
22. The cell-laden scaffold of claim 20 or 21, wherein the one or more food-grade scaffold materials is / are selected from the group consisting of alginate, pectin, agarose, carrageenan, gellan gum, konjac glucomannan, xanthan gum, guar gum, locust bean gum, gum arabic, starches and derivatives thereof, pullulan; 0-glucans, cellulose and derivatives thereof, gelatin, collagen, whey protein, casein, caseinates, soy protein, pea protein, gluten, glutenin, zein and combinations thereof..
23. The cell-laden scaffold of any claim 22, wherein the one or more food-grade scaffold materials is / are present at an amount of 0.1% to 5.0% weight / volume (w / v) for each material.
24. The cell-laden scaffold according to any one of claims 20-23, wherein the cell-laden scaffold is in the form of a three-dimensional shape.
25. The cell-laden scaffold according to any one of claims 20-24, wherein the cell -laden scaffold is in the form of a sphere, fiber, sheet, film, ribbon, cord, flat disc, cylinder or any amorphous shapes.
26. The cell-laden scaffold according to claim 25, wherein the cell-laden scaffold is in the form of a sphere.
27. The cell-laden scaffold according to claim 26, wherein the sphere has a diameter of 10 pm to 1800 pm.
28. The cell-laden scaffold according to claim 25, wherein the cell-laden scaffold is in the form of a fiber.
29. The cell-laden scaffold according to claim 28, wherein the fiber has a diameter of 50 pm to 200 pm.
30. The cell-laden scaffold according to any one of claims 20-30, wherein the cell-laden scaffold has a cell density of 8, 000 to 12,000 cells / mm331. A kit for obtaining a cell-laden scaffold comprising lipid-producing cells, the kit comprising:(a) one or more food-grade scaffold materials;(b) one or more populations of lipid-producing precursor cells; and(c) a food-grade differentiation medium for differentiating the lipid-producing precursor cells into the lipid-producing cells.
32. The kit of claim 31, wherein the food-grade differentiation medium comprises a fatty acid.
33. A method of differentiating a lipid-producing precursor cell into a lipid-producing cell, wherein the method comprises culturing the lipid-precursor cell in a food-grade differentiation medium consisting essentially of a basal cell growth medium with or without a serum, and optionally an antibiotic.
34. A food-grade differentiation medium comprising one or more fatty acids, wherein the food-grade differentiation medium is serum-free or contains about 1-3% of a serum.
35. The food-grade differentiation medium of claim 34, wherein the one or more fatty acids is selected from the group consisting of oleate, decanoate, linoleate, palmitate, stearate, and combinations thereof.
36. The food-grade differentiation medium of claim 34 or 35 further comprising an edible lipid carrier and / or protein.
Citation Information
Patent Citations
Efficient low-cholesterol fat cell 3D culture material and preparation method and application thereof
CN117757111A
Tissue engineered meat for consumption and a method for producing tissue engineered meat for consumption
EP1789063B1
Ex vivo meat production
US20200140821A1
Methods and compositions for cell culture on heterogeneous scaffolds
US20220195392A1
Hydrogel scaffolds and uses thereof
WO2022225458A1