Culture medium composition for in vitro maturation of oocytes, comprising piperine, and in vitro embryo production method using same

PIP in the culture medium addresses inefficiencies in in vitro oocyte maturation by reducing ROS levels and improving cytoskeletal and nuclear maturation, thereby enhancing embryonic development efficiency.

WO2026089404A1PCT designated stage Publication Date: 2026-04-30IND ACADEMIC COOPERATION FOUND JEJU NAT UNIVERSTIY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2025/016584
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-10-25
Filing Date
2025-10-20
Publication Date
2026-04-30

AI Technical Summary

Technical Problem

In vitro maturation of oocytes is less efficient than in vivo maturation, leading to decreased oocyte and embryo development due to factors like increased intracellular oxygen concentration, energy source imbalances, and hormonal influences, which affect mitochondrial function, cytoskeletal development, and gene transcription, resulting in lower embryonic development efficiency.

Method used

Incorporation of piperine (PIP) into the culture medium at concentrations of 150 to 300 μM to improve intracellular conditions, reducing reactive oxygen species (ROS) levels and enhancing cytoskeletal and nuclear maturation, thereby improving embryonic development.

Benefits of technology

PIP treatment increases oocyte maturation and embryonic development rates by reducing ROS levels, promoting normal spindle organization, and altering gene expression to enhance blastocyst formation and reduce apoptosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2025016584_30042026_PF_FP_ABST
    Figure KR2025016584_30042026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a culture medium composition for in vitro maturation of oocytes, comprising piperine as an active ingredient, and an in vitro embryo production method using same. The culture medium composition for in vitro maturation of oocytes, comprising piperine as an active ingredient, of the present invention, can qualitatively improve oocytes by inhibiting reactive oxygen species, and in vitro embryo production efficiency can be increased using in vitro matured oocytes obtained from the medium of the present invention.
Need to check novelty before this filing date? Find Prior Art

Description

Composition of a culture medium for in vitro maturation of oocytes containing piperine and a method for producing in vitro embryos using the same

[0001] The present invention relates to a culture medium composition for in vitro maturation of oocytes containing piperine and a method for producing in vitro embryos using the same.

[0002]

[0003] In vitro production of oocytes is the most fundamental step in all experiments dealing with embryonic development, where specific experiments are conducted by creating an environment in the laboratory that mimics in vivo conditions. Therefore, the ability to replicate the in vivo environment in a laboratory setting is crucial when handling oocytes.

[0004] Generally, in vitro production of oocytes can be divided into the oocyte maturation stage and the embryonic development stage. Once maturation is complete, the oocyte acquires a ploidy in the 2n state, which signifies reaching the metaphase of the second meiotic division. During the cytoplasmic maturation stage, the rearrangement of cellular organelles, cytoskeletal movement, and molecular maturation occur. Since cytoplasmic maturation is a critical process that determines late embryonic development, in vitro maturation (IVM) can be considered a fundamental and core stage that has a significant impact on subsequent experimental stages.

[0005] Because in vitro culture is significantly less efficient than in vivo culture, many researchers are continuously conducting studies to improve the conditions for the in vitro maturation of porcine oocytes. Maturating immature oocytes in vitro has a significant impact on the subsequent development of the oocyte and embryo. External conditions, such as temperature, atmosphere, and culture medium composition, affect mitochondrial function, cytoskeletal development, and the function of other organelles, which can lead to significant differences in the maturation and developmental stages of the oocyte and embryo. For this reason, experiments are being conducted across a wide range of subjects, including cells, oocytes, and embryos, to elucidate the relationship between reactive oxygen species and development.

[0006] Increased intracellular oxygen concentration from external sources significantly affects in vitro maturation of oocytes, leading to a decrease in oocyte developmental efficiency. Additionally, energy source imbalances occurring during in vitro maturation cause methylation of genes transcribed from oocytes. Transcription plays a crucial role in regulating placental function and fetal growth, and the initiation and maintenance of transcription during oocyte development can influence early embryonic damage. Furthermore, changes in in vitro or in vivo maturation conditions, the presence or absence of hormones, and the frequency of exposure to various hormones significantly affect the morphogenesis of metafilaments during the second meiotic division.

[0007] Therefore, the development of technology capable of improving the intracellular environment and the in vivo developmental capabilities of cells, eggs, and embryos is required.

[0008] Piperine (PIP) has various physiological effects, including antioxidant, anti-inflammatory, anticancer, and anti-obesity effects. It contributes to obesity control by improving insulin and leptin sensitivity, and also exhibits cytotoxicity by inhibiting cancer cells during the G2 / M phase of the cell cycle.

[0009] No research papers have been reported stating that such PIPs contribute to embryonic developmental capacity.

[0010] [Prior Art Literature]

[0011] [Patent Literature]

[0012] (Patent Document 1) Korean Patent Publication No. 10-2624886

[0013] (Patent Document 2) Korean Registration No. 10-1858844

[0014]

[0015] Accordingly, the inventors completed the present invention by confirming that PIP increases the efficiency of in vitro maturation of oocytes, which directly affects the production rate of embryos.

[0016] Accordingly, the present invention aims to provide a culture medium for the in vitro maturation of oocytes containing piperine and a method for producing in vitro embryos using the same, as a method for increasing the in vitro maturation efficiency of oocytes that directly affects the production rate of embryos.

[0017] However, the problems that the present invention aims to solve are not limited to those mentioned above, and other unmentioned problems will be clearly understood by those skilled in the art from the description below.

[0018]

[0019] According to one embodiment, the present invention provides a culture medium for in vitro maturation of oocytes comprising piperine.

[0020] According to one embodiment, the piperine may be included at a concentration of 150 to 300 μM.

[0021] According to one embodiment, the present invention

[0022] Steps to prepare the egg;

[0023] A step of maturing the oocyte in vitro in an in vitro maturation medium supplemented with piperine;

[0024] A step of inducing parthenogenesis of the above-mentioned in vitro matured oocyte;

[0025] A step of activating the oocyte in which the above-mentioned unitogenesis has been induced;

[0026] A step of performing somatic cell nuclear transfer on the activated oocyte; and

[0027] A step of culturing the above somatic cell nuclear-transplanted egg;

[0028] A method for producing an in vitro embryo, comprising

[0029] According to one embodiment, the mammal may be a mammal other than a human.

[0030] According to one embodiment, the mammal may be a pig.

[0031] According to one embodiment, the piperine may be included at a concentration of 150 to 300 μM.

[0032]

[0033] This invention confirmed the effects of PIP treatment on subsequent embryonic development following PA and SCNT in porcine oocytes. PIP treatment of porcine oocytes improved the subsequent development of embryos induced by PA and regulated intracellular ROS and GSH levels. Furthermore, it was confirmed that PIP treatment enhanced subsequent embryonic development by promoting nuclear and cytoplasmic maturation of porcine oocytes.

[0034] These results show that PIP can improve the outcomes of assisted reproductive technology (ART) by reducing intracellular ROS levels.

[0035]

[0036] Figure 1 shows the effects of treating porcine oocytes with various concentrations of PIP on subsequent in vitro embryonic development [(Figure 1a) PB extrusion, cleavage, and BL morphology. Scale bar, 100 μm. (Figure 1b) PB extrusion, cleavage, and BL formation rates. (Figure 1c) Blastocyst staining. Scale bar, 160 μm. (Figure 1d) Total number of cells per BL. (Figure 1e) Percentage of apoptotic cells in the BL was analyzed on day 7. Data are mean ± SEM obtained from 4 replicate experiments (*p < 0.05)].

[0037] Figure 2 confirms the antioxidant effect of PIP on porcine oocytes during IVM [(A) Representative image of oocytes stained with DCFHDA (green, ab, ROS staining) and CMF2HC (blue, cd, GSH staining). Scale bar, 100 μm. (B) Quantification of fluorescence intensity of DCFHDA and CMF2HC. Oocytes were analyzed at the MII stage. The experiment was repeated 6 times using 10 oocytes per experiment. (C) Relative expression of antioxidant genes (Nr / 2, CAT, HO-I, SODI, and SOD2)]. Data are the mean ± SEM obtained from 6 repeated experiments (*p < 0.05)].

[0038] Figure 3 shows the effects of PIP on chromosomal alignment and spindle tissue in porcine oocytes in vitro [(A) Representative images of oocytes with normal and abnormal morphology. Scale bar, 50 μm. (B) Proportion of oocytes with normal chromosomal alignment and spindle morphology. Oocytes were analyzed at the MII stage. Data are the mean ± SEM obtained from 6 replicate experiments (**p < 0.01).]

[0039] Figure 4 shows the effect of PIP on cytoplasmic maturation of porcine oocytes in vitro [(A) Western blot analysis of total and phosphorylated p44 / 42 MAPK. (B) Ratio of phospho-p44 / 42 MAPK to p44 / 42 MAPK. Oocytes were analyzed at the MII stage. Data are mean ± SEM obtained from 6 replicate experiments (***p < 0.001)].

[0040] Figure 5 shows the effect of PIP treatment on the gene expression of embryos derived from porcine oocytes during IVM [relative expression of pluripotency-related (CDX2, NANOG, POU5Fl, and SOX2), anti-apoptosis (BCL2Ll, and BIRC5), and pro-apoptosis (BAK, FAS, and CASP3) genes. Data are mean ± SEM obtained from 6 replicate experiments (*p < 0.05, **p < 0.01, and ***p < 0.001)].

[0041] Figure 6 shows the effect of PIP treatment during IVM of porcine oocytes on BLs derived from these oocytes via SCNT [(Figure 6a) Representative image of oocytes via SCNT. Scale bar, 100 μm. (Figure 6b) Rates of fusion, division, and BL formation. (Figure 6c) Blastocyst staining. Scale bar, 160 μm. (Figure 6d) Total number of cells per BL. (Figure 6e) Percentage of apoptotic cells in BL. BLs were analyzed on day 7. Data are the mean ± SEM obtained from four replicate experiments (*p < 0.05).]

[0042]

[0043] Hereinafter, embodiments will be described in detail with reference to the attached drawings. Identical reference numerals in each drawing indicate identical components.

[0044] Various modifications may be made to the embodiments described below. The embodiments described below are not intended to limit the forms of practice and should be understood to include all modifications, equivalents, and substitutions thereof.

[0045] The terms used in the embodiments are used merely to describe specific embodiments and are not intended to limit the embodiments. Singular expressions include plural expressions unless the context clearly indicates otherwise. In this specification, terms such as “comprising” or “having” are intended to indicate the presence of the features, numbers, steps, actions, components, parts, or combinations thereof described in the specification, and should be understood as not precluding the existence or addition of one or more other features, numbers, steps, actions, components, parts, or combinations thereof.

[0046] Unless otherwise defined, all terms used herein, including technical or scientific terms, have the same meaning as generally understood by those skilled in the art to which the embodiments pertain. Terms such as those defined in commonly used dictionaries should be interpreted as having a meaning consistent with their meaning in the context of the relevant technology, and should not be interpreted in an ideal or overly formal sense unless explicitly defined in this application.

[0047] In addition, when describing with reference to the attached drawings, identical components are assigned the same reference numeral regardless of drawing symbols, and redundant descriptions thereof are omitted. When describing the embodiments, if it is determined that a detailed description of related prior art could unnecessarily obscure the essence of the embodiments, such detailed description is omitted.

[0048] In the present invention, “egg” refers to an egg of a mammal, and said mammal may be, but is not limited to, humans, livestock such as pigs, cattle, goats, sheep, and horses, pets, or experimental animals such as mice and guinea pigs.

[0049] In the present invention, "in vitro fertilization (IVF)" refers to a series of laboratory processes in which an egg and sperm are fertilized and cultured in a laboratory incubator under conditions similar to the environment of the uterus, as a method distinct from fertilization within the body. The culture medium composition of the present invention is a culture medium composition optimized for such in vitro fertilization, specifically for the in vitro fertilization of aged eggs and sperm.

[0050] As used herein, the term "in vitro culture" refers to a series of laboratory processes in which a fertilized egg is cultured in a laboratory incubator under conditions similar to the environment of the uterus, in a manner distinct from the state in which the egg grows inside the body. The culture medium composition of the present invention is a culture medium composition optimized for such in vitro culture.

[0051] The mammalian fertilized egg to which the culture medium composition of the present invention can be applied is preferably a fertilized egg of a human, livestock such as pigs, cattle, goats, sheep, and horses, a pet animal, or an experimental animal such as a mouse or guinea pig, and more preferably a fertilized egg of a pig. In addition, any fertilized egg capable of being cultured in vitro is not particularly limited, but may be a fertilized egg that exhibits embryonic arrest during in vitro culture. It is applicable to both in vitro fertilized eggs and cloned fertilized eggs, and preferably may be an in vitro fertilized egg produced by fertilizing an early-maturing egg. Here, "in vitro fertilized egg" refers to an egg obtained by collecting an egg and sperm and fertilizing them in vitro, and "cloned fertilized egg" refers to an egg obtained by injecting a somatic cell donor nucleus into an enucleated egg from which genetic material has been removed, and then fusing them by physical or chemical methods.

[0052] In the present invention, the culture medium composition may contain 150 to 300 μM of piperine, specifically 160 to 290 μM of piperine, and more specifically 170 to 280 μM of piperine, but is not limited thereto.

[0053] The culture medium composition of the present invention may be used by adding piperine to a basic medium used for the culture of conventional mammalian fertilized eggs. In the present invention, the "basic medium" is a medium for culturing early mammalian embryonic cells that basically includes inorganic salts, carbon sources, amino acids, serum, and cofactors, although it varies depending on the species of mammal; it may include all general media well known to those skilled in the art. Particularly preferably, the medium may include NaCl, KCl, and NaHCO3 as inorganic salts, glucose, sodium pyruvate, and calcium lactate as carbon sources, essential and non-essential amino acids including glutamine as amino acids, and other trace elements and buffers as cofactors. More preferably, the medium may also include antibiotics.

[0054] As used herein, the term "parthenogenetic egg" refers to an egg that has been activated independently through drug treatment without the supply of sperm, unlike normal fertilization in which foreign genes are introduced and activated by sperm.

[0055] As used herein, the term "activation" refers to changes within an egg cell that occur after stimulation by the fertilization of a normal egg cell and sperm.

[0056] The term "Glutathione (GSH)" as used in this specification is a major non-protein sulfhydryl compound known to play a role in protecting cells from the effects of reactive oxygen species, and it has been reported that the synthesis of GSH during the egg maturation period is necessary for the formation of the male pronucleus after sperm penetration.

[0057] As used herein, the term "reactive oxygen species (ROS)" refers to all types of modified oxygen that cause cell damage, and O2 - , -OH, RO2, HO2 - Reactive oxygen species include H2O2, etc. Since reactive oxygen species possess free radicals, they exhibit strong activity in an unstable state and have adverse effects on cells, such as apoptosis, oxidative stress, lipid peroxidation, and enzyme inactivation, and reduce the efficiency of in vitro culture, such as decreased sperm motility, inhibition of fertilization, and reduced embryonic development.

[0058] In this invention, the term "blastocyst" refers to a fertilized egg that has developed to the point where, following the process of repeated cleavage and growth, it forms a blastocyst cavity and is distinguishable into an inner cell mass that will differentiate into a fetus and trophectoderm that will differentiate into a placenta.

[0059] In order for an in vitro fertilized egg to implant in the uterus, implantation-related protein enzymes present in the trophoblast cells, which are the cell membranes of the blastocyst, are required. Since conventional in vitro fertilized eggs stop dividing prematurely, making implantation difficult, inhibiting the apoptosis of the fertilized egg's blastocyst cells to enhance development and securing trophoblast cells within the cell can more easily induce uterine implantation.

[0060] In addition, the present invention provides a method for in vitro culture of a fertilized egg comprising the step of culturing a mammalian fertilized egg in the above-mentioned culture medium composition.

[0061] The in vitro culture method of the present invention allows for the cultivation of mammalian fertilized eggs in an in vitro culture medium for mammalian fertilized eggs containing piperine to increase the blastocyst development rate of the fertilized eggs, thereby improving the ease of fertilized egg transplantation. The mammalian fertilized eggs that can be cultured through the in vitro culture method of the present invention are not particularly limited as long as they are fertilized eggs capable of being cultured in vitro; however, fertilized eggs exhibiting embryonic arrest during in vitro culture may be used, and both in vitro fertilized eggs and cloned fertilized eggs are possible.

[0062] As one embodiment, the present invention

[0063] Steps to prepare the egg;

[0064] A step of maturing the oocyte in vitro in an in vitro maturation medium supplemented with piperine;

[0065] A step of inducing parthenogenesis of the above-mentioned in vitro matured oocyte;

[0066] A step of activating the oocyte in which the above-mentioned unitogenesis has been induced;

[0067] A step of performing somatic cell nuclear transfer on the activated oocyte; and

[0068] A step of culturing the above somatic cell nuclear-transplanted egg;

[0069] It includes a method for producing in vitro embryos, comprising...

[0070] The description of the culture medium composition for in vitro maturation containing piperine as an active ingredient, used in the method for producing in vitro embryos of the present invention, is as described above, and a detailed description is omitted to avoid duplication.

[0071] Meanwhile, general media used for the in vitro maturation of immature oocytes may include media containing epidermal growth factor (EGF), follicle-stimulating hormone (FSH), luteinizing hormone (LH), follicular fluid, etc., and appropriately known media may be used as general media depending on the type of oocyte.

[0072]

[0073] In a specific embodiment of the present invention, the inventors prepared a medium for in vitro fertilization and / or in vitro culture containing piperine.

[0074] Oxidative stress caused by light and high temperatures occurs during the in vitro maturation (IVM) process, resulting in embryos of lower quality compared to those obtained in vivo. To overcome this problem, the effects of piperine (PIP) treatment during porcine oocyte maturation on subsequent in vitro embryonic development were investigated.

[0075] Porcine oocytes were cultured in IVM medium supplemented with 0, 50, 100, 200, or 400 μM PIP. After pathenogenetic activation, blastocyst (BL) formation was significantly higher and apoptosis rates were significantly lower when 200 μM PIP-treated oocytes (200 PIP) were used. In the 200 PIP group, levels of reactive oxygen species decreased during the metaphase II phase, glutathione levels increased, and the expression of antioxidant pathways (Nrj2, CAT, H0-1, SODI, and SOD2) increased. Consistently, chromosomal misalignment and abnormal spindle organization were alleviated, and phosphorylated p44 / 42 mitogen-activated protein kinase activity increased in the 200 PIP group. In the 200 PIP group, the expression of development-related (CDX2, NANOG, POUSFI, and SOX2), anti-apoptotic (BCL2LI and BIR.CS), and apoptotic-promoting (BAK, FAS, and CASP3) pathways was altered. Ultimately, embryonic development was improved in the 200 PIP group after somatic cell nuclear transfer. These results suggest that PIP improves the quality of porcine oocytes by reducing the oxidative stress that inevitably occurs during the somatic cell nuclear transfer process. Further in-depth mechanistic studies on porcine oocytes will enhance the efficiency of assisted reproductive technology.

[0076] In conclusion, when oocytes are matured in vitro using the culture medium composition for in vitro maturation of oocytes containing piperine as an active ingredient according to the present invention, it has the effect of increasing the maturation rate of the oocytes and the embryonic development rate.

[0077]

[0078] The present invention will be explained in detail below through examples. The following examples are merely illustrative of the present invention and do not limit the scope of the present invention to the following examples.

[0079]

[0080] Reference Example: Abbreviation

[0081] ART assisted reproductive technology

[0082] BAK Bcl-2 antagonist / killer

[0083] BCL2L1 BCI.2-like 1 BCI.2 similar 1

[0084] BIRCS baculoviral IAP repeat-containing 5 baculoviral IAP repeat containing 5

[0085] BL blastocyst

[0086] BSA bovine serum albumin

[0087] CASP3 cysteine-aspartic acid protease 3

[0088] CAT catalase

[0089] CDX2 caudal type homeobox protein 2

[0090] CMF2HC: 4-chloromethyl~,S-difluoro-7-hydroxycum.arin

[0091] COC cumulus-oocyte complex

[0092] DCFHDA dichlorohydrofluorescein diacetate

[0093] DPBS Dulbecco's phosphate-buffered saline

[0094] FAS cell surface death receptor

[0095] GSH glutathione

[0096] H0-1 heme o.xygenase 1 heme osygenase 1

[0097] IVM in vitro maturation

[0098] MAPK mitogen-activated protein kinase

[0099] MII metaphase II

[0100] NANOG Nanog homeobox Nanog Homeobox

[0101] Nrf2 nuclear factor erythroid 2-related factor 2

[0102] PB polar body

[0103] POUSF1 POU domain, class 5, transcription factor 1 POU domain, class 5, transcription factor 1

[0104] PZM porcine zygote medium

[0105] ROS reactive oxygen species

[0106] SCNT (Somatic Cell Nuclear Transfer)

[0107] SDS sodium dodecyl sulfate

[0108] SOD1 superoxide dismutase 1

[0109] SOD2 superoxide dismutase 2

[0110] SOX2 sex-determining region Y-box transcription factor 2

[0111] TCM tissue culture medium

[0112]

[0113] Examples

[0114] [Materials and Methods]

[0115] 1. Chemicals and Reagents

[0116] All chemicals and reagents were purchased from Sigma (St. Louis, Missouri) unless otherwise specified.

[0117] 2. Oocyte Collection and IVM

[0118] Pre-pubescent pig ovaries were collected from a local slaughterhouse and transported to a laboratory within 2 hours, and during transport, they were kept at 30–33°C in a saline solution containing 75 μg / mL penicillin G and 50 μg / mL streptomycin sulfate.

[0119] COCs were aspirated from follicles with a diameter of 2–8 mm. The COCs were washed three times in tissue culture medium (TCM)-199-HEPES containing 0.1% (w / v) BSA. Subsequently, 50 COCs per group were treated with Earle's disalt, 0.57 mM cysteine, 10 ng / mL epidermal growth factor, 0.5 μg / mL follicle-stimulating hormone, 0.5 μg / mL luteinizing hormone, and 10% (v / v) porcine follicle fluid. Maturation was performed using mineral oil at 38.8°C for 44 hours in an atmosphere of 5% CO2 and 95% air. During IVM, the medium was supplemented with O, 50, 100, 200, or 400 μM PIP. For each group, PIP was dissolved in 1% dimethyl sulfoxide (DMSO) as a 100 x stock solution and frozen until use. The 0 PIP group was treated only with the solvent DMSO.

[0120] 3. PA and Embryo Culture

[0121] After 44 hours of IVM, porcine oocytes were pipetted 40 times in TCM-199-HEPES containing 0.1% hyaluronidase to remove cumulus cells. Oocytes with the first polar body (PB) at the Mil stage were treated with PA solution (5 μM Ca 2+The cells were immersed in ionomycin [Sigma] for 5 minutes and cultured for 3.5 hours in porcine conjugation medium (PZM)-5 containing 7.5 μg / mL cytocalcin B (Sigma). Decapsulated oocytes were washed three times with PZM-5 containing 0.4% (w / v) BSA and cultured for 7 days at 38.8°C in a humidified atmosphere of 5% CO2 and 95% air. The BL formation ratio was calculated on day 2 as the ratio of BL formation to cleavage. Blastocyst formation was determined by blastocyst formation, size increase, and thinning of the blastocyst. Decapsulated oocytes and PA embryos were washed with a wash solution (DPBS containing 0.1% BSA) and, depending on the experiment, fixed in a fixative (4.0% [w / v] paraformaldehyde) and stored at 4°C or snap-frozen in liquid nitrogen and stored at -80°C.

[0122] 4. TUNEL Analysis and Hoechst Staining

[0123] The fixed BUI was washed at least four times with a washing solution and incubated with 0.1% Triton X-100 at 38.8°C for 30 minutes. The BU was incubated with fluorescein-bound dUTP and terminal deoxynucleotidyl transferase (In Situ Apoptosis Detection Kit; Roche, Mannheim, Germany) in a dark room at 38.8°C for 1 hour. The nuclei were stained with Hoechst 33342 for 30 minutes. The stained BL was washed with a washing solution. The washed BUI was mounted on a glass slide and examined using an inverted Olympus IX-71 fluorescence microscope.

[0124] 5. Measurement of intracellular ROS and GSH levels

[0125] Intracellular levels of ROS and glutathione (GSH) were measured using dichlorohydrofluorescein diacetate (DCFHDA) and Cell Tracker Blue 4-chloromethyl-6,8-difluoro-7-hydroxycoumarin (CMF2HC), respectively.

[0126] Exfoliated oocytes were cultured in DPBS containing 50 μm DCFHDA or 100 μm CellTracker™ effue CMF:z IC at 38.8 °C for 20 minutes in a dark room. Subsequently, the oocytes were washed with a washing solution at least five times to completely remove excess dye, and then immediately analyzed using an epifluorescence microscope (Olympus, Japan). ROS levels were measured using excitation and emission wavelengths of 450–490 nm and 515–565 nm, respectively. GSH levels were measured using excitation and emission wavelengths of 371 nm and 464 nm, respectively. Grayscale images were acquired using a digital camera (Nikon) attached to the microscope. The average grayscale value was calculated using imageJ software. Background fluorescence values ​​were subtracted from the final values ​​prior to statistical analysis.

[0127] 6. Immunofluorescence

[0128] The meiotic axis and nucleus of the oocyte were visualized after maturation.

[0129] Exfoliated oocytes were fixed in fixation solution at 4°C overnight. The fixed oocytes were cultured with 0.5% (v / v) Triton X-100 at 38.8°C for 30 minutes. The permeated oocytes were blocked for 1 hour with 1% BSA (w / v) prepared in PBS (blocking solution I) and cultured overnight at 4°C with Alexa Fluor 488-conjugated anti-11-tubulin antibody (Sigma, diluted 1:200 in blocking solution I). The nuclei were stained with Hoechst 33342 for 30 minutes. The stained oocytes were washed three times with washing solution. The washed oocytes were mounted on glass slides and examined under an inverted Olympus IX-71 microscope.

[0130] Grayscale images were acquired using a microscope equipped with a digital camera. The average grayscale value was calculated using ImageJ software (NIH). At least 15 oocytes were examined per group.

[0131] 7. mRNA Extraction and Synthesis of Complement DNA

[0132] mRNA was isolated from three biological replicates using the Dynabeads mRNA Direct Kit (Invitrogen, Carlsbad, California) according to the manufacturer's instructions. The isolated mRNA was collected in the 10 μL of elution buffer provided with the kit. Subsequently, the eluted RNA was reverse transcribed into cDNA using oligo(dT) 20 primers and SuperScript II reverse transcriptase (Invitrogen). At least 30 oocytes or 15 BLs were examined per group.

[0133] 8. Real-time reverse transcriptase chain reaction

[0134] The protocol used is as described in SE Lee, SC Sun, HY Chol, SJ Uhm, NH Kim, mTOR Is required for asymmetric division through small GTPases in mouse oocyres, Mol. Reprod. Dev. 79 (5) (2012) 356-366. Real-time RT-PCR was performed using the SYBR Green PCR Master Mix (Applied Biosystems) with a StepOnePlus Real-time PCR system (Applied Biosystems, USA) with a final reaction volume of 20 μL and the primer set listed in Table 1. The PCR conditions were as follows: 10 min at 95°C, 39 cycles at 95°C, and 60 sec at 54°C. The samples were then cooled to 12°C. Relative gene expression was analyzed using the 2-44Ct method [KJ Llvak, TD Schmittgen, Analysis of relative gene expression data using realtime quantitative PCR and the 2-44Ct method, Methods 25 (4) (2001) 402-408.] after normalization of the expression of the housekeeping gene (ACTB).

[0135] Gene GenBank accession no. Primer sequence Annealing temperature (°C) Product size (bp) ACTBAY550069.1F: AGATCATGTTCGAGACCTTC (Sequence No. 1) R: GTCAGGATCTTCATGAGGTAGT (Sequence No. 2) 54220CATNM_214301.2F: AGGGAGAGGCGGTTTATTGC (Sequence No. 3) R: GGACTCGTTGGTGAAGCTCA (Sequence No. 4) 59117HO-1NM_214127.2F: ACCCAGGACACTAAGGACCA (Sequence No. 5) R: CGGTTGCATTCACAGGGTTG (Sequence No. 6) 52227NFE2L2XM_005671981.2F: ACAACTCAGCACCTTGTACC (Sequence No. 7) R: CCTTACTCTCCAAGTGAGTACTC (Sequence No. 8)5481SOD1GU9444822.1F: GCCACTGTGTACATCGAAGAT (Sequence No. 9)R: GTGATCCCAATTACACCACAG (Sequence No. 10)54173SOD2NM_214127.2F: AGACCTGATTACCTGAAAGC (Sequence No. 11)R: CTTGATGTACTCGGTGTGAG (Sequence No. 12)54110CDX2AM778830F: AGCCAAGTGAAAACCAGGAC (Sequence No. 13)R: TGCGGTTCTGAAACCAGATT (Sequence No. 14)60178NANOGDQ447201F: TTCCTTCCTCCATGGATCTG (Sequence No. 15)R: ATCTGCTGGAGGCTGAGGTA (Sequence No 16)60214POU5F1NM_001113060F: AGTGAGAGGCAACCTGGAGA (Sequence No. 17)R: TCGTTGCGAATAGTCACTGC (Sequence No. 18)60166SOX2EU503117F: GCCCTGCAGTACAACTCCAT (Sequence No. 19)R: GCTGATCATGTCCCGTAGGT (Sequence No. 20)60216BCL2L1NM_214285.1F: GGTTGACTTTCTCTCCTACA (Sequence No. 21)R: CTCAGTTCTGTTCTTCCA (Sequence No. 22)54118BIRC5NM_214141.1F: CTTCTGCTTCAAAGAGCTG (Sequence No. 23)R: GGCTCTTTCTTTGTCCAGT (Sequence No. 24)54154BAKAJ001204F: CTAGAACCTAGCAGCACCAT (Sequence No. 25)R: CGATCTTGGTGAAGTACTC (Sequence No. 26)60151FASAJ001202.1F: GAGAGACAGAGGAAGACGAG (Sequence No. 27)R: CTGTTCAGCTGTATCTTTGG (Sequence No. 28)54194CASP3NM_214131F: GAGGCAGACTTCTTGTATGC (Sequence No. 29)R: CATGGACACAATACATGGAA (Sequence No. 30)55236.

[0136]

[0137] 9. Western Blot Analysis

[0138] The protocol is basically as described in SE Lee, SC Sun, HY Chol, SJ Uhm, NH Kim, mTOR Is required for asymmetric division through small GTPases in mouse oocyres, Mol. Reprod. Dev. 79 (5) (2012) 356-366.

[0139] Exfoliated oocytes were dissolved in 20 μL of 1 x sodium dodecyl sulfate (SDS) sample buffer (containing 62.5 mM Tris-HCl, pH 6.8, 2% [w / V] SDS, 10% [v / v] glycerol, 50 μM dithiothreitol, and 0.01% [w / v] bromophenol blue or phenol red) and heated at 95°C for 5 minutes. Proteins were lysed on a 10% Tris-SDS-polyacrylamide electrophoresis gel at BO₀V for 20 minutes and at 120 V for 1 hour, then the samples were transferred to a HybondECL nitrocellulose membrane at 400 mA for 1 hour and transferred in transfer buffer (25 mM Tris, pH 8.5 containing 200 mM glycine and 20% [v / v] methanol) for 1 hour. After blocking the membrane with 5% (w / v) non-fat milk in PBS for 2 hours, the membrane was incubated overnight at 4°C with a blocking solution (PBS containing 5% [w / v] non-fat milk) containing anti-p44 / 42 mitogen-activated protein kinase (MAPK) or anti-phospho-p44 / 42 MAPK antibody diluted 1:300. Subsequently, the membrane was washed four times for 10 minutes with TBST (PBS containing 0.1% [v / v] Tween-20) and incubated for 1 hour with anti-rabbit IgG-horseradish peroxidase diluted 1:2000 in the blocking solution. After washing three times with TBST, non-luminescent protein bands were visualized using a chemiluminescent reagent (Invitrogen).

[0140] 10. SCNT and In Vitro Culture

[0141] After 36–38 hours of IVM, porcine oocytes were pipetted approximately 40 times in TCM-199-HEPES containing 0.1% hyaluronidase to remove cumulus cells. Primary PB and nucleosomes were removed from enucleated oocytes using a 20 μm glass pipette in TCM-199-HEPES containing 0.4% (w / v) BSA and 7.5 μg / mL cytocalcin B on an Oosight imaging system (Cambridge Research & Instrumentation, Inc., USA). Cells were cultured in Dulbecco’s Modified Eagle Medium containing 10% fetal bovine serum, 0.1 mM p-mercaptoethanol, and 1% penicillin / streptomycin until the cells reached confusion and expanded via passage. Donor cells were injected into the periplasmic space surrounding the cytoplasm. The nucleoplasm-cytoplasm complex was fused in fusion medium (0.3 M D-mannitol, 0.5 mM HEPES, 0.05% [w / v] fatty acid-free BSA, 0.05 mM CaCh, and 0.1 mM MgSO4) and exposed to a direct current of 101 V / cm for 60 μ seconds. After fusion, the activated embryos in the presence of 7.5 μg / mL cytocalcin B were transferred to PZM-5 supplemented with 0.4% (w / v) fatty acid-free BSA and cultured for 3.5 hours.

[0142] These oocytes were washed three times with PZM-5 containing 0.4% (w / v) BSA and cultured for 7 days at 38.8°C in a humidified atmosphere of 5% CO2 and 95% air. The BL formation ratio was calculated on day 2 as the ratio of BL formation to cleavage. Blastocyst formation was determined by the formation of blastocysts, increase in size, and thinning of the pelucidal region. A minimum of 70 oocytes were examined per group.

[0143] 11. Statistical Analysis

[0144] All experimental data were analyzed using the general linear model procedure provided by the statistical analysis system (Statistical Analysis System User Guide, 1985, Statistical Analysis System Inc.). Tukey's multiple range test was used to evaluate significant differences, and significance was defined as a p-value < 0.05. Values ​​are expressed as mean ± standard error (SEM).

[0145]

[0146] [result]

[0147] 1. PIP treatment of porcine oocytes in IVM improves subsequent embryonic development.

[0148] To determine the optimal PIP concentration, 0, 50, 100, 200, or 400 μM PIP was added to the IVM medium. The efficiency of oocyte maturation was determined by calculating the proportion of oocytes that exhibited PB extrusion after 44 hours of IVM. Oocytes treated with 200 μM PIP tended to have a higher developmental rate and a significantly increased BL formation rate. On day 7, BL formation was 14% higher in the 200 PIP group (34.1±4.0%) than in the control group (20.1±2.4%) (p < 0.05) (Fig. 1b). Although there was no significant difference in the total number of cells per BL between the two groups (Fig. 1d), the apoptosis rate was 0.6% lower in the 200 PIP group (0.8 ± 0.1%) than in the control group (1.4 ± 0.2%) (p < 0.05) (Fig. 1e). Therefore, 200 μM was selected as the optimal PIP concentration, and experiments were subsequently conducted with a control group and a 200 PIP group.

[0149] 2. Induction of antioxidant effects in porcine oocytes via PIP treatment in IVMs

[0150] The antioxidant effects of PIP treatment on porcine oocytes were investigated. Levels of ROS and GSH were measured at the MII stage using DCFHDA and CMF2HC (Fig. 2(A)). Intracellular ROS levels, measured by DCFHDA staining intensity, were lower in the 200 PIP group (54.6 ± 1.3 pixels / oocyte) than in the control group (58.4 ± 1.4 pixels / oocyte) (p < 0.05) (Fig. 2(B)). Intracellular GSH levels, measured by CMF2HC staining intensity, were higher in the 200 PIP group (106.0 ± 2.0 pixels / oocyte) than in the control group (99.7 ± 2.5 pixels / oocyte) (p < 0.05) (Fig. 2(B)). Next, the expression of antioxidant processes (nuclear factor erythrocyte-associated factor 2 [Nif.2], catalase [CA11, H0-1, superoxide dismutase 1 [SOD1], superoxide dismutase 2 [SOD2]) was investigated by real-time RT-PCR at the MII stage. The expression of these processes was higher in the 200 PIP group compared to the control group (p < 0.05) (Figure 2 (C)).

[0151] 3. PIP treatment prevents abnormal spindle tissue and chromosomal misalignment in porcine oocyte IVMs.

[0152] To investigate the nuclear maturation of porcine oocytes, chromosomal alignment and spindle organization were evaluated. Oocyte morphology was classified as normal or abnormal (Fig. 3 (A)). The proportion of oocytes with normal spindle organization and chromosomal alignment was higher in the 200 PIP group (88.4% ± 0.9%) than in the control group (82.2% ± 1.3%) (p < 0.01) (Fig. 3 (B)).

[0153] 4. PIP treatment increases the expression of cytoplasmic maturation markers during in vitro fertilization of porcine oocytes.

[0154] Cytoplasmic maturation of porcine oocytes, which is important for embryonic development, was investigated. In Western blotting, phospho-p44 / 42 MAPK, the active form of this kinase, migrated to the dimer in the lysates of mature porcine oocytes (Fig. 4 (A)). The ratio of phospho-p44 / 42 to p44 / 42 was higher in the 200 PIP group (1.5 ± 0.08) than in the control group (1.0 ± 0.0) (p < 0.001) (Fig. 4 (B)).

[0155] 5. PIP treatment alters gene expression in embryos during the in vitro fertilization process of porcine oocytes.

[0156] We investigate the molecular mechanism by which the quality of embryos developing in PIP-treated porcine oocytes is improved.

[0157] The expression of development-related (tailed homobox protein 2 [CDX2], nanog homobox [NANOG], POU domain, class 5, transcription factor 1 [POUSFl], sex determination domain Y-box transcription factor 2 [SOX2]) and apoptosis-related (BCL2-like 1 [BCL2Ll]) processes, as well as baculovirus IAP repeat-containing 5 [BIRCS], Bcl-2 antagonist / killer [BAK], Fas cell surface death receptor [FAS], and cysteine-aspartate protease 3 [CASP3]) processes, was analyzed by real-time RT-PCR in BL on day 7. The expression of development-related processes (CDX2, NANOG, POUSFl, SOX2) was higher in the 200 PIP group than in the control group (p < 0.05), and notably, the expression of POUSFl was higher in the former group than in the latter group (p < 0.001). The expression of anti-apoptotic pathways (BCL2L1 and BIRCS) was higher in the 200 PIP group than in the control group (p < 0.05), and in particular, the expression of BCL2L1 was higher in the former group than in the latter group (p < 0.01). The expression of pre-apoptotic pathways (BAK, FAS, CASP3) was lower in the 200 PIP group than in the control group (p < 0.05).

[0158] 6. PIP treatment of porcine oocytes for 1 VM improves subsequent embryonic development after SCNT.

[0159] The effect of PIP treatment on porcine oocytes on the developmental ability and quality of BLs formed after SCNT was evaluated. Oocytes that showed PB extrusion after 36-38 hours of IVM were used.

[0160] The developmental capacity of porcine oocytes was determined by calculating the rates of fusion, division, and BL formation. These rates were higher in the 200 PIP group than in the control group (p < 0.05) (Fig. 6b).

[0161] The quality of the BL was determined by calculating the total number of cells and the apoptosis rate per BL. There was no significant difference in the total number of cells per BL between the two groups, but the apoptosis rate was lower in the 200 PIP group (1.4% ± 0.2%) compared to the control group (2.4% ± 0.3%) (Fig. 6e).

[0162]

[0163] [Discussion]

[0164] Oocyte quality has a significant impact on subsequent embryonic development. IVM is inherently less stable than in vivo maturation, leading to excessive ROS and oxidative stress. Elevated ROS levels can have harmful effects on oocytes, including DNA fragmentation and the induction of apoptosis. To mitigate these harmful effects during IVM, the antioxidant effects of PIP on porcine oocytes were investigated. Developmental rates tended to be higher in the 200 PIP group, and BL formation was significantly increased (Figure 1b).

[0165] In addition, the apoptosis rate was significantly lower in the 200 PIP group (Fig. 1e). BL formation is an important indicator of embryonic developmental capacity. While apoptosis generally occurs during development and aging and can help maintain antioxidant mechanisms, excessive apoptosis can inhibit BL formation and negatively affect embryonic development. Therefore, the regulation of BL formation and apoptosis is a key factor in early embryonic development.

[0166] Based on these results, an additional 200 PIP groups were studied. Intracellular ROS and GSH levels were quantified to evaluate whether PIP improves embryonic development by inducing antioxidant effects. Intracellular redox balance can be maintained through the equilibrium of ROS and GSH. While ROS plays an important role in cell signaling and homeostasis, excessive ROS can lead to mitochondrial dysfunction and apoptosis, ultimately impairing embryonic development.

[0167] Meanwhile, GSH may play a role in protecting oocytes from oxidative stress and may be essential for cytoplasmic maturation. In the 200 PIP group, intracellular ROS levels were significantly decreased, and intracellular GSH levels were significantly increased (Fig. 2 (A) and (B)). Consistently, the expression of antioxidant processes increased in the 200 PIP group (Fig. 2 (C)). Among these genes, Nrf2 encodes proteins that play a crucial role in regulating antioxidant enzymes, including those encoded by CAT, H0-1, and SOD. MAPK and Akt are involved in translocation to the nucleus and activation of Nrf2, and activated Nrf2 binds to antioxidant response elements to regulate the antioxidant response. Increased expression of Nrf2 may imply an enhancement of cellular defense mechanisms against oxidative stress. Furthermore, increased expression of antioxidant enzymes regulated by Nrf2 may enhance cell protection. CAT can protect oocytes by metabolizing hydrogen peroxide and free radicals into non-reactive molecules, while H0-1 regulates immune responses and maintains intracellular homeostasis. Furthermore, SOD converts superoxide radicals into hydrogen peroxide and molecular oxygen. Results regarding antioxidant enzymes show that PIP activates Nrf2, upregulates intracellular antioxidant enzymes (CAT and SOD), and regulates the Nrf2 / H0-1 antioxidant pathway. These results demonstrate that PIP induces antioxidant effects by activating Nrf2-related antioxidant pathways and reducing oxidative stress in porcine oocytes.

[0168] Oxidative stress alleviation by PIP during IVM can promote normal oocyte maturation. Oocyte maturation involves nuclear and cytoplasmic maturation and is essential for subsequent development. Normal chromosomal alignment and spindle formation are critical for oocyte maturation. Oxidative stress caused by IVM reduces the proportion of oocytes reaching MII stage and results in spindle defects and chromosomal misalignment. This suggests that embryonic development may be halted. Nuclear maturation of oocytes was evaluated by analyzing spindle formation and chromosomal alignment. The proportion of oocytes with normal chromosomal alignment and spindle formation was higher in the 200 PIP group than in the control group (Fig. 3). Furthermore, phosphorylated p44 / 42 MAPK activity increased in the 200 PIP group (Fig. 4). MAPKs play a role in regulating meiosis by activating the ERK signaling pathway and participating in the signaling pathway from the extracellular to the nucleus; this pathway activates ERK, and activated ERK1 / 2 increases meiotic maturation in porcine oocytes. The MAPK-ERKl / 2 pathway can regulate cellular activities including differentiation, proliferation, and apoptosis. MAPK activity was increased in the 200 PIP group, and these results indicate that PIP reduces ROS levels at the MII stage, thereby increasing nuclear and cytoplasmic maturation of oocytes.

[0169] Changes in mRNA expression were investigated to explore the molecular mechanisms by which PIP promotes embryonic development. When a mammalian zygote develops into a BL, it consists of two groups of cells: the trophoblast, which differentiates into trophoblast cells to form the placenta, and the inner cell mass, which consists of pluripotent cells and develops into an embryo. CDX2 can serve as a marker to evaluate the formation and maintenance of the trophoblast and has recently been reported to be important for early porcine embryonic development. Meanwhile, POUSFl, SOX2, and NANOG encode pluripotency regulators essential for early embryonic development in the inner cell mass. The expression of developmental processes, including CDX2, POUSFl, NANOG, and SOX2, was significantly upregulated in the 200 PIP group (Fig. 5), implying improved embryonic development (Fig. 1).

[0170] Considering that oxidative stress can cause apoptosis, the expression of apoptosis-related processes was analyzed. Given that excessive apoptosis can impair BL maturation and potentially lead to early embryonic death, it is essential to evaluate apoptosis during embryonic development.

[0171] In the major apoptotic pathway, mitochondria mediate the activation of the caspase cascade. Cytochromes center in the cytoplasm and bind to caspase-9 to activate caspase-3. This process is regulated by BCL2 family proteins. The BCL2 family consists of anti-apoptotic and pro-apoptotic proteins. Anti-apoptotic gene expression is decreased by oxidative stress and increased by antioxidant treatment. BCL2L1 and BIRCS encode mitochondrial anti-apoptotic regulators, while BAK encodes mitochondrial pro-apoptotic regulators. On the other hand, FAS propagates apoptotic signals by encoding a protein that stimulates the initiator caspase-8.

[0172] Caspases induce apoptosis by cleaving various substrates in the cytoplasm and nucleus, ultimately inducing cysteine-aspartate protease 3 (CASP3), a major mediator of mammalian apoptosis.

[0173] PIP treatment reduces cytochrome c release and regulates caspases 3 and 9 activated by 6-0HDA in a mouse model. Additionally, PIP reduces apoptosis by maintaining a balance between pro-apoptotic and anti-apoptotic proteins. In the 200 PIP group, the anti-apoptotic process was upregulated, while the pro-apoptotic process was downregulated (Fig. 5). This supports the fact that PIP maintains a balance between pro-apoptotic and anti-apoptotic proteins. Furthermore, this implies that the rate of apoptosis was reduced in the 200 PIP group (Fig. 1).

[0174] Embryos generated by PA allow for the rapid verification of experimental effects. To determine the optimal concentration, porcine oocytes were treated with various concentrations of PIP (Fig. 1). Subsequently, the effects of PIP on antioxidant activity, oocyte maturation, and molecular mechanisms in embryos derived from these oocytes were investigated (Figs. 2-5). Based on these results, the effects of PIP on embryos generated by SCNT were finally investigated (Fig. 6). SCNT can potentially harm oocytes because it transfers the nucleus of a donor somatic cell into the cytoplasm and subsequently fuses them. Subsequent embryonic development in SCNT was significantly improved in the 200 PIP group (Fig. 6b). Additionally, the quality of the BL was evaluated by quantifying the total number of cells per BL and the apoptosis rate. There was no significant difference in the total number of cells per BL between groups, while the apoptosis rate was lower in the 200 PIP group compared to the control group (Fig. 6e).

[0175] In summary, PIP treatment had a positive effect on SCNT embryos by protecting the cytoplasm and enhancing oocyte maturation. This means that embryonic development after PA was improved in the 200 PIP group (Fig. 1).

Claims

1. A culture medium composition for in vitro maturation of oocytes, comprising piperine as an active ingredient.

2. In Paragraph 1, The above-mentioned oocyte is a culture medium composition in which the oocyte is a mammalian oocyte.

3. In Paragraph 2, The above-mentioned mammal is a pig, and the culture medium composition.

4. In Paragraph 1, A culture medium composition containing the above piperine at a concentration of 150 to 300 μM.

5. Step to prepare the egg; A step of maturing the oocyte in vitro in an in vitro maturation medium supplemented with piperine; A step of inducing parthenogenesis of the above-mentioned in vitro matured oocyte; A step of activating the oocyte in which the above-mentioned unitogenesis has been induced; A step of performing somatic cell nuclear transfer on the activated oocyte; and A step of culturing the above somatic cell nuclear-transplanted egg; A method for producing an in vitro embryo, comprising 6. In Paragraph 5, The above-mentioned egg is a mammalian egg, a method for producing an in vitro embryo.

7. In Paragraph 6, The above mammal is a pig, a method for producing an in vitro embryo.

8. In Paragraph 5, A method for producing an in vitro embryo, wherein the piperine is included at a concentration of 150 to 300 μM.