Rnai construct for inhibiting ASGR1 gene expression and use thereof
By designing and modifying RNAi constructs to target the ASGR1 gene, the targeting and stability issues in existing technologies have been resolved, achieving effective inhibition of the ASGR1 gene and providing a new treatment option for cardiovascular diseases.
Patent Information
- Application Number
- PCT/CN2025/133861
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-11-11
- Filing Date
- 2025-11-10
- Publication Date
- 2026-05-15
AI Technical Summary
There is a lack of therapeutic agents targeting the ASGR1 gene in the current technology, and siRNA or miRNA constructs are easily digested by nucleases in plasma and have difficulty entering intracellular compartments, which limits their application in the treatment of cardiovascular diseases.
We designed and screened naked sequence RNAi constructs with excellent RNA interference effects, and enhanced their delivery in the liver and ability to inhibit ASGR1 gene expression by nucleic acid modification and coupling with GalNac derivative targeting groups.
This study achieved specific inhibition of the ASGR1 gene, improved the stability and expression inhibition effect of the RNAi construct in the liver, and provided a new approach for the treatment of cardiovascular diseases.
Smart Images

Figure PCTCN2025133861-FTAPPB-I100001 
Figure PCTCN2025133861-FTAPPB-I100002 
Figure PCTCN2025133861-FTAPPB-I100003
Abstract
Description
RNAi constructs for inhibiting ASGR1 gene expression and their applications Technical Field
[0001] This invention relates to an RNAi construct for inhibiting the expression of the desialyl glycoprotein receptor 1 (ASGR1) gene, pharmaceutical compositions comprising the present invention, and uses thereof. Background Technology
[0002] Cardiovascular disease (CVD) seriously endangers human health. Atherosclerosis (AS), as the main pathophysiological basis of CVD, is the result of the interaction of multiple risk factors, among which dyslipidemia plays a crucial role. Numerous clinical studies have shown that correcting dyslipidemia has significant benefits in alleviating atherosclerosis.
[0003] Asialoglycoprotein receptor 1 (ASGR1, also known as ASGPR, ASGPR1, HL-1, and CLEC4H1) is also called the Ashwell-Morell receptor. ASGR1 is a transmembrane protein that plays a key physiological role in binding to, internalizing, and clearing Asialoglycoprotein from circulation. ASGR1 is primarily expressed in the liver via the Asialoglycoprotein receptor 1 gene (ASGR1 gene). Evidence suggests a link between ASGR1 and other risk factors for atherosclerosis, such as inflammatory activation and platelet abnormalities. Therefore, therapeutics that target the ASGR1 gene and reduce ASGR1 protein expression represent a novel approach to treating cardiovascular diseases, including coronary artery disease. Currently, no products targeting ASGR1 have been approved for marketing.
[0004] RNAi has extremely wide therapeutic applications because siRNA and miRNA constructs can be synthesized using any nucleotide sequence targeting the protein. To date, siRNA constructs have shown the ability to specifically downregulate target proteins in in vitro and in vivo models. Currently, two problems face siRNA or miRNA constructs: first, their susceptibility to digestion by nucleases in plasma; and second, their limited ability to enter intracellular compartments where RISCs can bind when administered systemically as free siRNA or miRNA. These double-stranded constructs can be stabilized by incorporating chemically modified nucleotide linkers into the molecule. Furthermore, existing technologies using GalNac conjugated delivery technology overcome the off-target problem of siRNA and have become a major technique for delivering oligonucleotides to the liver.
[0005] The present invention aims to provide an RNAi construct for inhibiting the expression of the desialyl glycoprotein receptor 1 (ASGR1) gene, a pharmaceutical composition comprising the RNAi construct, and its use, wherein the RNAi construct can inhibit the expression of the ASGR1 gene in the liver, thereby achieving the purpose of disease treatment. Summary of the Invention
[0006] The present invention provides an RNAi construct for inhibiting the expression of the desialyl glycoprotein receptor 1 (ASGR1) gene, a pharmaceutical composition comprising the present invention, and uses thereof.
[0007] On one hand, this invention provides an RNAi construct for inhibiting ASGR1 gene expression. This RNAi construct utilizes an RNA interference mechanism to degrade or inhibit the translation of target ASGR1 mRNA transcripts in a sequence-specific manner, thereby suppressing ASGR1 gene expression. This invention screens naked sequence RNAi constructs with excellent RNA interference effects. These naked sequence RNAi constructs exhibit good RNA interference effects after being coupled with nucleic acid modifications and / or GalNAc derivative targeting groups.
[0008] In some embodiments, the RNAi construct (also known as a duplex, siRNA, or RNAi reagent) comprises an antisense strand and a sense strand, wherein the antisense strand comprises 17-23 consecutive nucleotides differing by 0, 1, 2, 3, or 4 nucleotides from any of the antisense strand sequences provided in Table 1 or Table 2 or in the claims; and the sense strand comprises a nucleotide sequence at least partially complementary to the antisense strand. In some embodiments, the antisense strand in the RNAi construct is 17-23 consecutive nucleotides differing by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences provided in Table 1, Table 2, or in the claims.
[0009] In some embodiments, the sense strand and antisense strand are each independently 17-21 nucleotides in length. In some embodiments, the sense strand and antisense strand are each 21-26 nucleotides in length. In some embodiments, the sense strand is about 19 nucleotides long, and the antisense strand is about 21 nucleotides long. In some embodiments, the sense strand is about 21 nucleotides long, and the antisense strand is about 23 nucleotides long. In some embodiments, the sense strand is 23 nucleotides long, and the antisense strand is 21 nucleotides long. In some embodiments, both the sense strand and antisense strand are 21 nucleotides long. In some embodiments, the sense strand is 22 nucleotides long, and the antisense strand is 21 nucleotides long. In some embodiments, the sense strand is 19 nucleotides long, and the antisense strand is 21 nucleotides long. In some embodiments, the sense strand and antisense strand of the RNAi construct are each independently 17, 18, 19, 20, 21, 22, or 23 nucleotides long.
[0010] In some embodiments, the sense strand of the RNAi construct comprises a nucleotide sequence that is at least partially complementary to the antisense strand. The RNAi construct is formed by annealing the antisense strand with the sense strand. The length of the region that is completely or substantially complementary between the sense and antisense strands is typically 15-23 nucleotides, for example, 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides, and is located at or near the 5' end of the antisense strand. The core extension sequence of the sense strand is completely (100%) complementary or substantially (e.g., at least about 65%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) complementary to the core extension sequence in the antisense strand.
[0011] In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of the RNAi construct are flush ends. In some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of the RNAi construct are flush ends. In some embodiments, both ends of the RNAi construct are flush ends. In some embodiments, neither end of the RNAi construct is flush ends. As used herein, a flush end refers to the end of a double-stranded RNAi construct in which the terminal nucleotides of the two annealed strands are complementary (forming complementary base pairs).
[0012] In some implementations, the antisense strand of the RNAi construct contains a complementary region substantially complementary to at least a portion of the ASGR1 mRNA encoding the ASGR1 mRNA. The ASGR1 mRNA sequence is selected from the NCBI reference sequence NM_001671.5.In some embodiments, the antisense strand of the RNAi construct of the present invention (including naked sequence RNAi constructs, modified RNAi constructs, and RNAi constructs conjugated with target ligands) contains ASGR1. The following regions of the mRNA sequence NM_001671.5 are substantially or completely complementary to the following sequences: 127-149, 133-153, 138-158, 139-159, 163-183, 199-221, 202-222, 203-223, 206-226, 207-227, 208-228, 209-229, 210-230, 211-231, 212-232, 213-233, 216-236, 223-243, 236-256, 237-259, 239-259, 243-263, 357-377, 422-442, 4 24-444, 483-503, 486-506, 488-508, 489-509, 490-510, 491-511, 492-512, 494-514, 496-516, 500-520, 502-522, 503-525, 521-541, 527-547, 530-550, 532-552, 533-553, 537-557, 538-558, 539-559, 540-562, 543-565, 546-566, 569-589, 582-602, 583-603, 584-604, 585-6 07, 585-605, 588-608, 633-653, 639-659, 645-665, 656-676, 668-688, 671-691, 728-748, 785-805, 795-815, 797-817, 802-822, 884-904, 1025-1045, 1034-1054, 1037-1057, 1063-1085, 1065-1087, 1072-1092, 1074-1094, 1075-1095, 1152-1172, 1153-1173, 1154-1174, 116 3-1183, 1182-1202, 1192-1212, 1202-1222, 1211-1231, 1212-1232, 1213-1233, 1222-1242, 1223-1243, 1224-1244, 1225-1245, 1226-1246, 1227-1247, 1228-1248, 1247-1267, 1254-1276, 1257-1277, 1258-1278, 1263-1283, 1267-1287, 1269-1289, 1272-1292, 1288-1308.In some embodiments, the antisense strand of the RNAi construct of the present invention (including naked sequence RNAi constructs, modified RNAi constructs, and RNAi constructs conjugated with targeting ligands) comprises a sequence substantially or completely complementary to the following regions of the ASGR1 mRNA sequence NM_001671.5: 207-227, 208-228, 209-229, 210-230, 211-231, 212-232, 213-233, 1224-1244, 1225-1245, 1226-1246, 1247-1267; preferably 210-230, 213-233, or 1225-1245. In some embodiments, the antisense strand of the RNAi construct of the present invention comprises a sequence substantially or completely complementary to region 210-230 of the ASGR1 mRNA sequence NM_001671.5. In some embodiments, the antisense strand of the RNAi construct of the present invention comprises a sequence substantially or completely complementary to region 213-233 of the ASGR1 mRNA sequence NM_001671.5. In some embodiments, the antisense strand of the RNAi construct of the present invention comprises a sequence substantially or completely complementary to region 1225-1245 of the ASGR1 mRNA sequence NM_001671.5. In some embodiments, the RNAi construct targets the aforementioned regions in the ASGR1 mRNA sequence NM_001671.5 to inhibit the expression of the ASGR1 gene.
[0013] In some embodiments, the antisense strand of the RNAi construct comprises, from the 5' end to the 3' end, a continuous nucleotide selected from, or composed of, the nucleotides shown in SEQ ID NO:137 to SEQ ID NO:219, SEQ ID NO:221 to SEQ ID NO:272, SEQ ID NO:432, or SEQ ID NO:504-510. In some embodiments, the antisense strand of the RNAi construct comprises, from the 5' end to the 3' end, a continuous nucleotide selected from, or the nucleotides shown in SEQ ID NO:221 to SEQ ID NO:272, or SEQ ID NO:432, or SEQ ID NO:504-510.
[0014] In some embodiments, the antisense strand of the RNAi construct from the 5' end to the 3' end is selected from: consecutive nucleotides comprising SEQ ID NO: 137, 138, 142, 145, 147, 164, 165, 166, 178, 210, 212, 229, 239, 241, 242, 244, 249, 250, 252, 257, 258, 267, 269, 270, 271, 504-510, or SEQ ID NO: 504-510. The continuous nucleotide compositions shown in NO:137, 138, 142, 145, 147, 164, 165, 166, 178, 210, 212, 229, 239, 241, 242, 244, 249, 250, 252, 257, 258, 267, 269, 270, 271, 504-510 are as follows. In some embodiments, the antisense strand of the RNAi construct from the 5' end to the 3' end is selected from: continuous nucleotides comprising SEQ ID NO:137,138,142,145,147,164,165,166,178,210,212,229,239,242,244,249,250,252,257,258,267,269,270,271, or composed of continuous nucleotides comprising SEQ ID NO:137,138,142,145,147,164,165,166,178,210,212,229,239,242,244,249,250,252,257,258,267,269,270,271.
[0015] In some implementations, the RNAi construct is selected from any of the constructs provided in Table 1.
[0016] In some implementations, the RNAi construct is selected from the following constructs listed in Table 1: D-1001 (SEQ ID NO: 1 and 137), D-1002 (SEQ ID NO: 2 and 138), D-1006 (SEQ ID NO: 6 and 142), D-1009 (SEQ ID NO: 9 and 145), D-1011 (SEQ ID NO: 11 and 147), D-1028 (SEQ ID NO: 28 and 164), D-1029 (SEQ ID NO: 29 and 165), D-1030 (SEQ ID NO: 30 and 166), D-1042 (SEQ ID NO: 42 and 178), D-1074 (SEQ ID NO: 74 and 210), D-1076 (SEQ ID NO: 76 and 212), D-1095 (SEQ ID NO: 137 ...48), D-1002 (SEQ ID NO: 137 and 148), D-1006 (SEQ ID NO: 6 and 142), D-1009 (SEQ ID NO: 1 D-1105 (SEQ ID NO: 103 and 239), D-1107 (SEQ ID NO: 105 and 241), D-1108 (SEQ ID NO: 106 and 242), D-1110 (SEQ ID NO: 108 and 244), D-1115 (SEQ ID NO: 113 and 249), D-1116 (SEQ ID NO: 114 and 250), D-1118 (SEQ ID NO: 116 and 252), D-1123 (SEQ ID NO: 121 and 257), D-1124 (SEQ ID NO: 122 and 258), D-1133 (SEQ ID NO: 131 and 267), D-1135 (SEQ ID NO: 133 and 269), D-1136 (SEQ ID NO: 93 and 229), ... Any one of the following: NO:134 and 270), D-1137 (SEQ ID NO:135 and 271), D-1154 (SEQ ID NO:491 and 504), D-1155 (SEQ ID NO:492 and 505), D-1156 (SEQ ID NO:493 and 506), D-1157 (SEQ ID NO:494 and 507), D-1158 (SEQ ID NO:495 and 508), D-1159 (SEQ ID NO:496 and 509), and D-1160 (SEQ ID NO:497 and 510).In some implementations, the RNAi construct is selected from the following constructs listed in Table 1: D-1001 (SEQ ID NO: 1 and 137), D-1002 (SEQ ID NO: 2 and 138), D-1006 (SEQ ID NO: 6 and 142), D-1009 (SEQ ID NO: 9 and 145), D-1011 (SEQ ID NO: 11 and 147), D-1028 (SEQ ID NO: 28 and 164), D-1029 (SEQ ID NO: 29 and 165), D-1030 (SEQ ID NO: 30 and 166), D-1042 (SEQ ID NO: 42 and 178), D-1074 (SEQ ID NO: 74 and 210), D-1076 (SEQ ID NO: 76 and 212), D-1095 (SEQ ID NO: ...137), D-1006 (SEQ ID NO: 6 and 142), D-1009 (SEQ ID D-1105 (SEQ ID NO: 103 and 239), D-1108 (SEQ ID NO: 106 and 242), D-1110 (SEQ ID NO: 108 and 244), D-1115 (SEQ ID NO: 113 and 249), D-1116 (SEQ ID NO: 114 and 250), D-1118 (SEQ ID NO: 116 and 252), D-1123 (SEQ ID NO: 121 and 257), D-1124 (SEQ ID NO: 122 and 258), D-1133 (SEQ ID NO: 131 and 267), D-1135 (SEQ ID NO: 133 and 269), D-1136 (SEQ ID NO: 134 and 270), D-1137 (SEQ ID NO: 93 and 229), ... Either NO:135 or 271.
[0017] In some embodiments, the preferred RNAi constructs are: D-1074 (SEQ ID NO: 74 and 210), D-1095 (SEQ ID NO: 93 and 229), D-1107 (SEQ ID NO: 105 and 241), D-1108 (SEQ ID NO: 106 and 242), D-1123 (SEQ ID NO: 121 and 257), D-1115 (SEQ ID NO: 113 and 249), D-1116 (SEQ ID NO: 114 and 250), D-1118 (SEQ ID NO: 116 and 252), D-1124 (SEQ ID NO: 122 and 258), D-1154 (SEQ ID NO: 491 and 504), D-1155 (SEQ ID NO: 492 and 505), D-1156 ... (SEQ ID NO:493 and 506), D-1157 (SEQ ID NO:494 and 507), D-1158 (SEQ ID NO:495 and 508), D-1159 (SEQ ID NO:496 and 509), D-1160 (SEQ ID NO:497 and 510).
[0018] In some embodiments, the sense and antisense strands of the RNAi construct are naked sequences (unmodified sequences) and exhibit a repression rate of ≥70%, ≥75%, or ≥80% against ASGR1 gene expression. In some embodiments, these preferred unmodified RNAi constructs are selected from the unmodified RNAi constructs in Table 1 that exhibit a repression rate of ≥70%, ≥75%, or ≥80%. Preferably, D-1074 (SEQ ID NO: 74 and 210), D-1095 (SEQ ID NO: 93 and 229), D-1108 (SEQ ID NO: 106 and 242), D-1118 (SEQ ID NO: 116 and 252), D-1154 (SEQ ID NO: 491 and 504), D-1155 (SEQ ID NO: 492 and 505), D-1156 (SEQ ID NO: 493 and 506), D-1157 (SEQ ID NO: 494 and 507), D-1158 (SEQ ID NO: 495 and 508), D-1159 (SEQ ID NO: 496 and 509), and D-1160 (SEQ ID NO: 497 and 510).
[0019] In some embodiments, at least one nucleotide of the sense strand and / or the antisense strand of the RNAi construct is a modified nucleotide or includes a modified nucleoside inter-bond; preferably all nucleotides are modified nucleotides.
[0020] In some implementations, at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%) of the nucleotides in the RNAi construct are modified nucleotides.
[0021] In some implementations, the modifying nucleotides in the RNAi construct are deoxyribonucleotides, baseless nucleotides, 2'-modified nucleotides, reverse nucleotides, 2',3'-open-ring nucleotide mimics, locked nucleotides, 2'-F-arabinonucleotides, 5'-Me, 2'-fluoronucleotides, inosine-containing nucleotides, or combinations thereof.
[0022] In some embodiments, the modifying group in the modified nucleotide in the RNAi construct is selected from 2'-methoxy, 2'-methoxyalkyl, 2'-O-alkyl, 2'-O-allyl, 2'-C-allyl, 2'-fluorine, 2'-deoxy, 2'-ON-methylacetamido (2-O-NMA), 2'-O-dimethylaminoethoxyethyl (2'-O-DMAEOE), 2'-O-aminopropyl (2'-O-AP), 2'-ara-F, L-nucleoside modification, LNA, ENA, HNA, cET BNA, UNA, and ethylene glycol nucleotide (GNA) or combinations thereof.
[0023] In some embodiments, the modified nucleoside inter-bond is a thiophosphate bond.
[0024] In some implementations, the sense strand of the RNAi construct may contain 1, 2, 3, 4, 5 or 6 phosphate thioester bonds, and the antisense strand of the RNAi construct may contain 1, 2, 3, 4, 5 or 6 phosphate thioester bonds, or both the sense strand and the antisense strand may independently contain 1, 2, 3, 4, 5 or 6 phosphate thioester bonds.
[0025] In some embodiments, the modified antisense strand in the RNAi construct comprises, from the 5' end to the 3' end, a continuous nucleotide selected from: SEQ ID NO:352 to SEQ ID NO:383 or SEQ ID NO:385 to SEQ ID NO:416 or SEQ ID NO:418 to SEQ ID NO:430 or SEQ ID NO:455 to SEQ ID NO:476, or composed of the continuous nucleotides shown in SEQ ID NO:352 to SEQ ID NO:383 or SEQ ID NO:385 to SEQ ID NO:416 or SEQ ID NO:418 to SEQ ID NO:430 or SEQ ID NO:455 to SEQ ID NO:476. In some embodiments, the modified antisense strand in the RNAi construct comprises, from the 5' end to the 3' end, a continuous nucleotide selected from: SEQ ID NO:352 to SEQ ID NO:383 or SEQ ID NO:385 to SEQ ID NO:416 or SEQ ID NO:418 to SEQ ID NO:430, or is composed of the continuous nucleotides shown in SEQ ID NO:352 to SEQ ID NO:383 or SEQ ID NO:385 to SEQ ID NO:416 or SEQ ID NO:418 to SEQ ID NO:430.
[0026] In some implementations, the RNAi construct in the RNAi construct is selected from any of the constructs provided in Table 2.
[0027] In some embodiments, the RNAi construct in the RNAi construct is selected from the following constructs in Table 2: D-3001 (SEQ ID NO: 273 and 352), D-3002 (SEQ ID NO: 274 and 353), D-3003 (SEQ ID NO: 275 and 354), D-3005 (SEQ ID NO: 277 and 356), D-3006 (SEQ ID NO: 278 and 357), D-3007 (SEQ ID NO: 279 and 358), D-3012 (SEQ ID NO: 284 and 363), D-3015 (SEQ ID NO: 287 and 366), D-3016 (SEQ ID NO: 288 and 367), D-3017 (SEQ ID NO: 289 and 368), D-3021 (SEQ ID NO: 274 ...5 and 354), D-3005 (SEQ ID NO: 277 and 356), D-3 D-3027 (SEQ ID NO: 293 and 372), D-3032 (SEQ ID NO: 304 and 383), D-3037 (SEQ ID NO: 307 and 386), D-3046 (SEQ ID NO: 312 and 391), D-3047 (SEQ ID NO: 313 and 392), D-3048 (SEQ ID NO: 314 and 393), D-3049 (SEQ ID NO: 315 and 394), D-3054 (SEQ ID NO: 320 and 399), D-3055 (SEQ ID NO: 321 and 400), D-3066 (SEQ ID NO: 332 and 411), D-3067 (SEQ ID NO: 333 and 412), D-3068 (SEQ ID NO: 293 and 372), D-3027 (SEQ ID NO: 299 and 378), D-3032 (SEQ ID NO: 304 and 383), D-3037 (SEQ ID NO: 307 and 386), D-3046 (SEQ ID NO: 312 and 391), D-3047 (SEQ ID NO: 313 and 392), D-3048 (SEQ ID NO: 314 and 393), D-3049 (SEQ ID NO: 315 and 394), D-3054 (SEQ ID NO: 320 and 399), D-3055 (SEQ ID NO: 321 and 400), D-3066 (SEQ ID NO: 332 and 411), D-3067 (SEQ ID NO: 333 and 412), D-3068 (SEQ ID NO: 293 and 372), D-3027 ( NO:334 and 413), D-3069 (SEQ ID NO:335 and 414), D-3070 (SEQ ID NO:336 and 415),Any one of D-3071 (SEQ ID NO: 337 and 416), D-3072 (SEQ ID NO: 433 and 455), D-3073 (SEQ ID NO: 434 and 456), D-3074 (SEQ ID NO: 435 and 457), D-3075 (SEQ ID NO: 436 and 458), D-3076 (SEQ ID NO: 437 and 459), D-3077 (SEQ ID NO: 438 and 460), D-3078 (SEQ ID NO: 439 and 461), D-3079 (SEQ ID NO: 440 and 462), D-3080 (SEQ ID NO: 441 and 463), D-3081 (SEQ ID NO: 442 and 464), and D-3082 (SEQ ID NO: 443 and 465). In some embodiments, the RNAi construct in the RNAi construct is selected from the following constructs in Table 2: D-3001 (SEQ ID NO: 273 and 352), D-3002 (SEQ ID NO: 274 and 353), D-3003 (SEQ ID NO: 275 and 354), D-3005 (SEQ ID NO: 277 and 356), D-3006 (SEQ ID NO: 278 and 357), D-3007 (SEQ ID NO: 279 and 358), D-3012 (SEQ ID NO: 284 and 363), D-3015 (SEQ ID NO: 287 and 366), D-3016 (SEQ ID NO: 288 and 367), D-3017 (SEQ ID NO: 289 and 368), D-3021 (SEQ ID NO: 274 ...5 and 354), D-3005 (SEQ ID NO: 277 and 356), D-3 D-3027 (SEQ ID NO: 293 and 372), D-3032 (SEQ ID NO: 304 and 383), D-3037 (SEQ ID NO: 307 and 386), D-3046 (SEQ ID NO: 312 and 391), D-3047 (SEQ ID NO: 313 and 392), D-3048 (SEQ ID NO: 314 and 393), D-3049 (SEQ ID NO: 315 and 394), D-3054 (SEQ ID NO: 320 and 399), D-3055 (SEQ ID NO: 321 and 400), D-3066 (SEQ ID NO: 332 and 411), D-3067 (SEQ ID NO: 333 and 412), D-3068 (SEQ ID NO: 293 and 372), D-3027 (SEQ ID NO: 299 and 378), D-3032 (SEQ ID NO: 304 and 383), D-3037 (SEQ ID NO: 307 and 386), D-3046 (SEQ ID NO: 312 and 391), D-3047 (SEQ ID NO: 313 and 392), D-3048 (SEQ ID NO: 314 and 393), D-3049 (SEQ ID NO: 315 and 394), D-3054 (SEQ ID NO: 320 and 399), D-3055 (SEQ ID NO: 321 and 400), D-3066 (SEQ ID NO: 332 and 411), D-3067 (SEQ ID NO: 333 and 412), D-3068 (SEQ ID NO: 293 and 372), D-3027 ( NO:334 and 413), D-3069 (SEQ ID NO:335 and 414),Either of D-3070 (SEQ ID NO: 336 and 415).
[0028] In some embodiments, both the sense and antisense strands of the RNAi construct contain modified nucleotides and modified nucleotide inter-bonds. In some embodiments, the antisense strand of these preferred modified RNAi constructs contains a sequence that is substantially or completely complementary to the 210-230 position region of the ASGR1 mRNA sequence NM_001671.5. Specifically, the preferred RNAi constructs are selected from: D-3012 (SEQ ID NO: 284 and 363), D-3046 (SEQ ID NO: 312 and 391), D-3047 (SEQ ID NO: 313 and 392), D-3049 (SEQ ID NO: 315 and 394), D-3072 (SEQ ID NO: 433 and 455), D-3074 (SEQ ID NO: 437 and 457), D-3075 (SEQ ID NO: 436 and 458), D-3077 (SEQ ID NO: 438 and 460), and the corresponding D-5002 (SEQ ID NO: 339 and 418), D-5007 (SEQ ID NO: 344 and 423), D-5008 (SEQ ID NO: 345 and 424), and D-5009 (SEQ ID NO: 363 and 391), which are conjugated with the targeting ligand. D-5015 (SEQ ID NO: 444 and 466), D-5017 (SEQ ID NO: 446 and 468), D-5018 (SEQ ID NO: 447 and 469), and D-5020 (SEQ ID NO: 449 and 471); more preferably D-3012 (SEQ ID NO: 284 and 363), D-3049 (SEQ ID NO: 315 and 394), D-3074 (SEQ ID NO: 437 and 457), and their corresponding D-5002 (SEQ ID NO: 339 and 418), D-5009 (SEQ ID NO: 346 and 425), and D-5017 (SEQ ID NO: 446 and 468). In some implementations, these nucleotide and nucleoside inter-conjugate modifications result in a decrease in ASGR1 gene expression inhibition rate of less than or equal to 20%, less than or equal to 10%, or less than or equal to 5% relative to their respective unmodified RNAi constructs in in vitro Huh 7 cell screening assays.
[0029] In some embodiments, both the sense and antisense strands of the RNAi construct contain modified nucleotides and modified nucleotide inter-bonds. Preferred modified RNAi constructs have an antisense strand containing a sequence substantially or completely complementary to the 213-233 region of the ASGR1 mRNA sequence NM_001671.5. Specifically, preferred RNAi constructs are selected from: D-3054 (SEQ ID NO: 320 and 399), D-3055 (SEQ ID NO: 321 and 400), D-3080 (SEQ ID NO: 441 and 463), D-3081 (SEQ ID NO: 442 and 464), and corresponding D-5010 (SEQ ID NO: 347 and 426), D-5011 (SEQ ID NO: 348 and 427), D-5023 (SEQ ID NO: 452 and 474), and D-5024 (SEQ ID NO: 453 and 475) coupled with targeting ligands. In some implementations, these nucleotide and internucleotide modifications lead to increased ASGR1 gene expression inhibition rates in in vitro Huh 7 cell screening assays, relative to their respective unmodified RNAi constructs.
[0030] In some embodiments, both the sense and antisense strands of the RNAi construct contain modified nucleotides and modified nucleotide inter-bonds. Preferred modified RNAi constructs contain antisense strands that are substantially or completely complementary to the 1222-1242, 1223-1243, 1224-1244, 1225-1245, 1226-1246, 1227-1247, or 1228-1248 regions of the ASGR1 mRNA sequence NM_001671.5. In some embodiments, the modified RNAi construct is selected from: D-1108 (SEQ ID NO: 106 and 242), D-1154 (SEQ ID NO: 491 and 504), D-1155 (SEQ ID NO: 492 and 505), D-1156 (SEQ ID NO: 493 and 506), D-1157 (SEQ ID NO: 494 and 507), D-1158 (SEQ ID NO: 495 and 508), D-1159 (SEQ ID NO: 496 and 509) or D-1160 (SEQ ID NO: 497 and 510) or the aforementioned constructs thereof with optional nucleotide modifications and / or optional internucleotide bond modifications to the sense strand and / or antisense strand and / or conjugation of optional targeting ligands. Specifically, preferred RNAi constructs are selected from D-3032 (SEQ ID NO: 304 and 383) and the corresponding D-5004 (SEQ ID NO: 341 and 420) coupled with a targeting ligand. In some embodiments, these nucleotide and internucleotide modifications result in a decrease in ASGR1 gene expression inhibition rate of less than or equal to 20%, less than or equal to 10%, or less than or equal to 5% relative to their respective unmodified RNAi constructs in in vitro Huh 7 cell screening assays.
[0031] In some embodiments, the RNAi construct in any of the foregoing embodiments is further conjugated with a targeting ligand (targeting group), preferably an N-acetyl-galactosamine derivative (GalNAc derivative).
[0032] In some implementations, the targeting ligand of the RNAi construct is conjugated to the 5' or 3' end of the sense strand.
[0033] In some implementations, the targeting ligand in the RNAi construct is selected from L96, LICA-1, LICA-2, LICA-3, (NAG25), (NAG25)s, (NAG37) or (NAG37)s, and their chemical structures are shown below.
[0034] In some embodiments, the sense strand of the RNAi construct conjugated with the targeting ligand comprises, from the 5' end to the 3' end, a continuous nucleotide selected from, or composed of, the continuous nucleotides shown in SEQ ID NO:339 to SEQ ID NO:351, SEQ ID NO:444 to SEQ ID NO:454. In some embodiments, the sense strand of the RNAi construct conjugated with the targeting ligand comprises, from the 5' end to the 3' end, a continuous nucleotide selected from, SEQ ID NO:339 to SEQ ID NO:351, or composed of the continuous nucleotides shown in SEQ ID NO:339 to SEQ ID NO:351. In some embodiments, the RNAi construct is selected from the constructs conjugated with the targeting ligand in Table 2. In some embodiments, the targeting ligand is conjugated at the 5' end or the 3' end of the sense strand of the modified RNAi construct.In some implementations, the RNAi construct is selected from: D-5002 (SEQ ID NO: 339 and 418), D-5003 (SEQ ID NO: 340 and 419), D-5004 (SEQ ID NO: 341 and 420), D-5005 (SEQ ID NO: 342 and 421), D-5006 (SEQ ID NO: 343 and 422), D-5007 (SEQ ID NO: 344 and 423), D-5008 (SEQ ID NO: 345 and 424), D-5009 (SEQ ID NO: 346 and 425), D-5010 (SEQ ID NO: 347 and 426), D-5011 (SEQ ID NO: 348 and 427), D-5012 (SEQ ID NO: 349 and 428), D-5013 (SEQ ID NO: 349 and 428), D-5013 (SEQ ID NO: 349 and 428), D-5002 (SEQ ID NO: 339 and 418), D-5003 (SEQ ID NO: 340 and 419), D-5004 (SEQ ID NO: 341 and 420), D-5005 (SEQ ID NO: 342 and 421), D-5006 (SEQ ID NO: 343 and 422), D-5007 (SEQ ID NO: 344 and 423), D-5008 (SEQ ID NO: 345 and 424), D-5009 (SEQ ID NO: 346 and 425), D-5010 (SEQ ID NO: 347 and 426), D-5011 (SEQ ID NO: 348 and 427), D-5012 (SEQ ID NO: 349 D-5014 (SEQ ID NO: 350 and 429), D-5015 (SEQ ID NO: 444 and 466), D-5016 (SEQ ID NO: 430 and 467), D-5017 (SEQ ID NO: 446 and 468), D-5018 (SEQ ID NO: 447 and 469), D-5019 (SEQ ID NO: 448 and 470), D-5020 (SEQ ID NO: 449 and 471), D-5021 (SEQ ID NO: 450 and 472), D-5022 (SEQ ID NO: 451 and 473), D-5023 (SEQ ID NO: 452 and 474), D-5024 (SEQ ID NO: 453 and 475), or D-5025 (SEQ ID NO: 454 and 476).In some implementations, the RNAi construct is selected from: D-5002 (SEQ ID NO: 339 and 418), D-5003 (SEQ ID NO: 340 and 419), D-5004 (SEQ ID NO: 341 and 420), D-5005 (SEQ ID NO: 342 and 421), D-5006 (SEQ ID NO: 343 and 422), D-5007 (SEQ ID NO: 344 and 423), D-5008 (SEQ ID NO: 345 and 424), D-5009 (SEQ ID NO: 346 and 425), D-5010 (SEQ ID NO: 347 and 426), D-5011 (SEQ ID NO: 348 and 427), D-5012 (SEQ ID NO: 349 and 428), D-5013 (SEQ ID NO: 349 and 428), D-5013 (SEQ ID NO: 349 and 428), D-5002 (SEQ ID NO: 339 and 418), D-5003 (SEQ ID NO: 340 and 419), D-5004 (SEQ ID NO: 341 and 420), D-5005 (SEQ ID NO: 342 and 421), D-5006 (SEQ ID NO: 343 and 422), D-5007 (SEQ ID NO: 344 and 423), D-5008 (SEQ ID NO: 345 and 424), D-5009 (SEQ ID NO: 346 and 425), D-5010 (SEQ ID NO: 347 and 426), D-5011 (SEQ ID NO: 348 and 427), D-5012 (SEQ ID NO: 349 Either NO:350 and 429, or D-5014 (SEQ ID NO:351 and 430).
[0035] In some embodiments, the modified RNAi constructs conjugated with the targeting ligand are selected from the following constructs: D-5002 (SEQ ID NO: 339 and 418), D-5004 (SEQ ID NO: 341 and 420), D-5009 (SEQ ID NO: 346 and 425), D-5011 (SEQ ID NO: 348 and 427), D-5015 (SEQ ID NO: 444 and 466), D-5017 (SEQ ID NO: 446 and 468), and D-5018 (SEQ ID NO: 447 and 469). In some embodiments, relative to their respective corresponding modified RNAi constructs, in in vitro Huh 7 cell screening assays, the modified RNAi constructs conjugated with the targeting ligand showed no decrease in ASGR1 gene expression inhibition, a decrease of less than or equal to 5%, or a decrease of less than or equal to 10%.
[0036] In some embodiments, preferred modified RNAi constructs conjugated with the target ligand are selected from the following constructs: D-5003 (SEQ ID NO: 340 and 419), D-5008 (SEQ ID NO: 345 and 424), D-5010 (SEQ ID NO: 347 and 426), and D-5024 (SEQ ID NO: 453 and 475). In some embodiments, compared to their respective corresponding modified RNAi constructs, the modified RNAi constructs conjugated with the target ligand showed increased inhibition of ASGR1 gene expression in in vitro Huh 7 cell screening assays.
[0037] In some implementations, the RNAi construct, conjugated with a targeting ligand and modified, targets the following regions in the ASGR1 mRNA sequence NM_001671.5 to suppress ASGR1 gene expression: 207-227, 208-228, 209-229, 210-230, 211-231, 212-232, 213-233, 1224-1244, 1225-1245, 1226-1246, and 1247-1267.
[0038] In some embodiments, the targeting group is attached to the RNAi construct via a linker. The reactive group used to attach the targeting group is, for example, an amino group (also referred to herein as an amine), a phosphate ester group, or a thiophosphate ester group. The reactive group can be used to subsequently attach the targeting group using methods typical in the art.
[0039] In some embodiments, the targeting ligand is attached to the sense chain. In some embodiments, the targeting ligand is attached to the 3' end of the sense chain. In some embodiments, the targeting ligand is attached to the sense chain via a thiophosphate bond. In some embodiments, the targeting ligand is attached to the 3' end of the sense chain via a thiophosphate bond.
[0040] In some embodiments, the RNAi constructs of the present invention are prepared or provided as salts, mixed salts, or free acids.
[0041] On the other hand, the present invention provides a pharmaceutical composition comprising an RNAi construct of any of the foregoing embodiments and a pharmaceutically acceptable excipient.
[0042] In some embodiments, a delivery medium can be used to deliver the RNAi construct to cells or tissues. The delivery medium is a compound that improves the delivery of the RNAi construct to cells or tissues. Delivery mediators may include, but are not limited to: polymers (such as amphiphilic polymers), membrane-active polymers, peptides, melittin peptides, melittin-like peptides (MLPs), lipids, reversibly modified polymers or peptides or reversibly modified membrane-active polyamines, or combinations thereof. In some embodiments, the RNAi construct may be combined with lipids, nanoparticles, polymers, liposomes, micelles, DPCs, or other delivery systems available in the art.
[0043] In some embodiments, the pharmaceutical composition of the present invention further comprises a second ASGR1 RNAi construct or one or more other therapeutic agents. The RNAi construct in any of the foregoing embodiments is a first ASGR1 RNAi construct. The second ASGR1 RNAi construct is selected from any of the foregoing embodiments that differs from the first ASGR1 RNAi construct.
[0044] On the other hand, the present invention provides a method for treating and / or preventing ASGR1-related diseases or conditions, the method comprising administering to a subject in need an effective amount of an RNAi construct of any of the foregoing embodiments or a composition of any of the foregoing embodiments.
[0045] On the other hand, the present invention provides the use of RNAi constructs or compositions of any of the foregoing embodiments in the treatment and / or prevention of ASGR1-related diseases or conditions.
[0046] On the other hand, the present invention provides the use of the RNAi construct of any of the foregoing embodiments or the composition of any of the foregoing embodiments in the preparation of a medicament for treating and / or preventing ASGR1-related diseases or conditions.
[0047] In some embodiments, the RNAi constructs, pharmaceutical compositions, and methods of the present invention reduce target mRNA levels in cells, cell populations, tissues, or subjects, including by administering a therapeutically effective amount of the RNAi construct described herein to the subject, thereby inhibiting the expression of ASGR1 mRNA in the subject. In some embodiments, the subject has previously been identified as having upregulated pathogenicity of a target gene in cells or tissues targeted.
[0048] In some implementations, the ASGR1-related diseases or conditions are obesity, metabolic syndrome, abnormal lipid metabolism, atherosclerosis, cardiovascular disease, peripheral vascular disease, cerebrovascular disease, or diabetes; preferably, the abnormal lipid metabolism is hyperlipidemia, hypertriglyceridemia, hypercholesterolemia, abnormal cholesterol metabolism, or non-alcoholic steatohepatitis; the cardiovascular disease is coronary artery disease or myocardial infarction; the cerebrovascular disease is stroke; and the diabetes is type II diabetes.
[0049] In some embodiments, the ASGR1-related disease or condition is atherosclerosis or cardiovascular disease. In some embodiments, the ASGR1-related disease or condition is atherosclerosis. In some embodiments, the ASGR1-related disease or condition is cardiovascular disease. In some embodiments, the ASGR1-related disease or condition is hyperlipidemia. Attached Figure Description
[0050] Figure 1 illustrates the solid-phase synthesis principle of siRNA.
[0051] Figure 2 shows the synthesis process of RNAi constructs. Detailed Implementation
[0052] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are one module embodiment of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0053] Example 1: siRNA design and synthesis
[0054] 1.1 Bioinformatics
[0055] A siRNA targeting the human desialyl glycoprotein receptor (ASGR1: human NCBI refseq NM_001671.5; NCBI Gene ID: 432) was designed. The unmodified siRNA was a perfect or near-perfect match to the human ASGR1 transcript. The human ASGR1 NM_001671.5 refseq mRNA is 1310 bp in length. The nucleotide sequences of the unmodified sense and antisense strands of ASGR1 are shown in Table 1, and the nucleotide sequences of the modified sense and antisense strands of ASGR1 are shown in Table 2.
[0056] 1.2 Synthesis of ASGR1 siRNA sequence
[0057] siRNA was synthesized and annealed using conventional methods known in the art, and all oligonucleotides were synthesized using an AKTA OP100 nucleic acid synthesizer.
[0058] The siRNA sequence is a chemically synthesized oligonucleotide double strand. Using a solid-phase synthesizer, siRNA containing a solid-phase carrier and protecting groups is synthesized through multiple steps, followed by ammonia deprotection and purification. The principle of solid-phase synthesis is shown in Figure 1.
[0059] A vector containing a protecting oligonucleotide sequence was obtained through solid-phase synthesis. The protected oligonucleotide was then cleaved from the solid-phase vector to obtain crude oligonucleotides. These crude oligonucleotides were subsequently purified by HPLC, annealed, concentrated, and dried or lyophilized to obtain pure siRNA. HPLC and MS analyses were performed simultaneously. The process flow diagram is shown in Figure 2.
[0060] Synthesis was performed on a solid support (PS support) made of glass with controllable porosity. All modified phosphoramide monomers were commercially available. All phosphoramide monomers were removable under alkaline conditions. All phosphoramide monomers were dissolved in anhydrous acetonitrile (100 mM) and dried over a molecular sieve (3A). An acetonitrile solution of 0.6 M ethmetatotetrazole was used as the activating agent. Coupling times were 200 seconds (2′OMe and 2′F). A pyridine solution of 0.2 M hydroflavin was used to introduce thiophosphate bonds. For unreacted active groups, a mixture of acetic anhydride, N-methylimidazolium, pyridine, and acetonitrile (N-methylimidazolium / acetonitrile ratio 1:4; acetic anhydride / pyridine / acetonitrile ratio 2:3:5) was used as a capping agent. After solid-phase synthesis, the dried solid support was treated with an ammonia solution at 55 °C for 16 hours, the solution was evaporated, and the solid residue was redissolved in water. Crude siRNA was purified by IEX-HPLC using an Autotide 100 system. UV traces were recorded at 260 nm, and appropriate fractions were collected. The complementary strands were mixed to form siRNA by combining equimolar solutions (sense and antisense strands) in enzyme-free water. The solution was placed in a 70°C hot mixer, heated to 90°C, held at 90°C for 5 minutes, and then slowly cooled to room temperature. The siRNA was lyophilized and stored at -15 to -25°C.
[0061] Table 1. Nucleotide sequences of the sense and antisense strands of unmodified ASGR1 siRNA Note: G, C, A, and U represent nucleotides with guanine, cytosine, adenine, and uracil as bases, respectively. All sequences in the table above are RNA sequences. In the ST.26 sequence table, T in RNA is equivalent to U.
[0062] Table 2. Sense and antisense nucleotide sequences of modified ASGR1 siRNA Note: m indicates that the nucleotide adjacent to the left is a 2'-methoxy modified nucleotide; f indicates that the nucleotide adjacent to the left is a 2'-fluorine modified nucleotide; s indicates that the two adjacent nucleotides on both sides are connected by a thiophosphate bond; GNA indicates that the nucleotide adjacent to the left is an ethylene glycol nucleotide; L96 indicates N-[tris(GalNAc-alkyl)amidodecanoyl]-4-hydroxyprolylHyp-(GalNAc-alkyl)3.
[0063] Example 2: In vitro activity assay of naked ASGR1 siRNA sequence in Huh 7 cells
[0064] 10 nM siRNA was transfected into Huh 7 cells.
[0065] (1) Digest and centrifuge Huh 7, count the cells, and inoculate them into 24-well plates using antibiotic-free culture medium; Huh 7: 60000 / well, 500μL / well, incubate overnight at 37℃;
[0066] (2) Perform siRNA transfection at a cell density of approximately 30-80%. The preparation process of the siRNA transfection reagent is as follows:
[0067] siRNA solution preparation: Dilute siRNA to a final concentration of 10 nM with Opti-MEM and prepare a 50 μL system.
[0068] RNAiMAX solution preparation: Dilute RNAiMAX with opti-MEM medium at a ratio of 1.5 μL + 50 μL, mix well, and let stand at room temperature for about 5 min;
[0069] Preparation of transfection mixture: Mix siRNA working solution and transfection solution at a 1:1 ratio, and let stand at room temperature for about 10 minutes;
[0070] (3) Cells can be lysed directly 24 hours after transfection, washed once with PBS, and then RNA extracted using a Sangon Biotech kit (Sangon, B518651-0100).
[0071] (4) Store the obtained RNA solution at -70℃ or use it for subsequent experiments;
[0072] (5) Reverse transcription: Reverse transcription was performed using the EZBioscience B0003 kit.
[0073] (6) Use the ABIQuantStudio 3 system for qPCR detection. qPCR reaction system: 20 μL per sample per well.
[0074] qPCR reaction system preparation: 10μL 2X SYBR Green Qpcr master mix + 1μL cDNA + 0.4μL 10μM Forward primer + 0.4μL 10μM Reverse primer + 8.2μL dd H2O; ASGR1 forward primer sequence: GGGAAGAAAGATGAAGTCGCTAGA (SEQ ID NO.477); reverse primer sequence: GCAGGCTGGAGTGATCTTCAC (SEQ ID NO.478).
[0075] The forward primer sequence for the internal reference GAPDH is: GTCTCCTCTGACTTCAACAGCG (SEQ ID NO.479); the reverse primer sequence is: ACCACCCTGTTGCTGTAGCCAA (SEQ ID NO.480).
[0076] Data analysis of qRT-PCR was performed using the common 2^ -△△Ct The Livak method is a relative quantification method. The ASGR1 mRNA inhibition rate is calculated using samples transfected with blank control as the control group. The formula is: Inhibition rate (%) = (Quantitative value of blank control group - Quantitative value of siRNA treatment group) / Quantitative value of blank control group * 100%.
[0077] The results of the Huh 7 cell transfection experiment are shown in Table 3.
[0078] Table 3. In vitro activity assay results of Huh 7 cells transfected with naked siRNA of 10 nM ASGR1.
[0079] Example 3: Activity assay of ASGR1 siRNA modified sequence in Huh 7 cells in vitro
[0080] The modified sequences in Table 2 were transfected into Huh 7 cells according to the procedure in Example 2, with a final concentration of 10 nM, and mRNA was detected. The results are shown in Table 4.
[0081] Table 4. In vitro activity assay results of siRNA-modified sequences of 10 nM ASGR1 transfected into Huh 7 cells.
[0082] Example 4: Activity assay of ASGR1 siRNA in the psi-CHECK target system
[0083] The siRNA-AS chain-targeted mRNA sequence was inserted into the 3'UTR region of the psi-CHECK 2 plasmid between XhoI and NotI, and the recombinant plasmid was prepared by a CRO company.
[0084] (1) Dissolve the plasmid powder in RNase-free water, detect the concentration, and adjust the concentration to 200 ng / μL;
[0085] (2) Digest 293A cells, count them, plate them in 96-well plates at 16,000 cells / well and 100 μL / well, and incubate overnight in an incubator.
[0086] (3) The next day, when the cell density reaches 70-80%, the original culture medium is discarded and replaced with 80 μL of Opti-MEM culture medium per well, and starved for about 1.5 h.
[0087] (4) Preparation of plasmid mixture: 10 ng / well of plasmid was diluted with 9 μL / well of opti-MEM medium; after preparation, the plasmid mixture was dispensed into 8-tube strips, 31.5 μL / sample;
[0088] (5) Dilution of siRNA: Dilute with opti-MEM to a maximum final concentration of 10 nM, and dilute 3-fold down to a total of 11 dilutions with 3 replicates; dispense into 8-tube strips containing pre-allocated plasmids, 3.5 μL / sample;
[0089] (7) Prepare Lipo mixture: Dilute 0.2 μL of Lipo per well with 10 μL of Opti-MEM medium per well; incubate at room temperature for 5 minutes;
[0090] (8) Aliquot the Lipo mixture into 8-tube strips containing plasmids and siRNA, 35 μL / sample, and incubate at room temperature for 20 minutes; aliquot the mixture into 96-well plates, 20 μL / well;
[0091] (9) After culturing in the incubator for 4-6 hours, add 100 μL of DMEM medium containing 20% FBS to each well;
[0092] (10) Approximately 24 hours after transfection, the Dual-Luciferase Assay (Promega, E2940) can be performed. The relative fluorescence reading for each well is calculated based on the test values, with the blank control group's relative fluorescence reading as a reference. The remaining activity percentage (%) of the siRNA-treated group is calculated as: Remaining activity (%) = (Ratio of siRNA / Ratio of control) × 100%. The IC50 value is calculated based on the remaining activity percentage at different concentration points. The IC50 is calculated using the following model and formula: log(inhibitor) vs. response -- Variable slope (four parameters) and Y = Bottom + (Top - Bottom) / (1 + 10^((LogIC50 - X) * HillSlope)).
[0093] The inhibitory activity of ASGR1 siRNA against psi-CHECK in the target system is shown in Table 5.
[0094] Table 5. In vitro screening of ASGR1 siRNA in the psi-CHECK on target system
[0095] Example 5: Screening of ASGR1 siRNA-coupled ligand sequences in Huh 7 cells in vitro
[0096] 10 nM conjugated siRNA was transfected into Huh 7 cells, following the same procedure as in Example 2. The results are shown in Table 6.
[0097] Table 6. In vitro screening of siRNA modification sequences of Huh 7 cells transfected with 10 nM ASGR1-coupled ligand.
[0098] Example 6: In vivo efficacy experiment of GalNAc-siRNA sequence in C57BL / 6J-AAV-hASGR1-Flag mice
[0099] Using PBS as a negative control, the in vivo efficacy of conjugated ligand siRNA (GalNAc-siRNA) was evaluated in AAV mice via subcutaneous injection.
[0100] A fusion gene fragment containing the full-length human ASGR1 gene (coding region, CDS, and untranlational region, UTR) and the Flag tag protein was inserted into a liver-specific AAV8 vector and packaged into an AAV-hASGR1-Flag virus. This virus can normally express the full-length human ASGR1 gene and express the human ASGR1-Flag fusion protein.
[0101] Three weeks after injecting AAV-hASGR1-Flag virus into C57BL / 6J mice, the human ASGR1-Flag gene and fusion protein were stably expressed. At this point, GalNAc-siRNA was injected subcutaneously into C57BL / 6J-AAV-hASGR1-Flag mice. One week after injection, the knockdown efficiency of hASGR1 mRNA and protein in the mouse liver was measured. The specific steps are as follows:
[0102] (1) C57BL / 6J mice, 8 weeks old, male, were grouped in a circular pattern according to their body weight, with 8 mice in each group;
[0103] (2) AAV injection: Wipe the amplified blood vessels of the mouse tail vein with an alcohol swab, and inject the mouse tail vein with AAV-hASGR1-Flag virus at a titer of 1*10^11 / mouse. Wait three weeks after injection.
[0104] (3) Preparation of GalNAc-siRNA solution: Dissolve siRNA in PBS, measure and correct the concentration using an ELISA reader, and adjust the stock solution concentration to 1.2±10% mg / mL. The prepared siRNA solution can be stored at -80℃ or used directly in subsequent experiments.
[0105] (4) After the virus has been expressed for three weeks, the mice were weighed and siRNA was administered according to their body weight. The left or right groin of the mice was located, and the corresponding volume of siRNA was injected subcutaneously into each mouse according to the dosage.
[0106] (5) One week after siRNA injection, mice were sacrificed, dissected, and liver tissue was collected; one copy was used for mRNA extraction and stored in RNAlater; one copy was used for protein extraction and stored in Ripa+cocktail lysis buffer; stored at -80℃.
[0107] (6) Add two stainless steel beads to the two tissue samples, and use a grinder (SCIENTZ, SCIENTZ-48) to homogenize the liver tissue samples at 60HZ, 30s, 3 cycles, and let them stand at room temperature for 5min.
[0108] (7) mRNA was extracted from liver tissue according to the kit (Qiagen RNeasy mini kit, 74106); the obtained RNA solution was stored at -80℃ or used for subsequent experiments.
[0109] (8) Reverse transcription: Reverse transcription was performed using the EZBioscience B0003 kit.
[0110] (9) Use the ABIQuantStudio 3 system for qPCR detection. qPCR reaction system: 10 μL per sample per well.
[0111] qPCR reaction system preparation: 5μL 2X SYBR Green Qpcr master mix + 1μL cDNA + 0.2μL Forward primer (10μM) + 0.2μL Reverse primer (10μM) + 3.6μL dd H2O; The qPCR results were sorted and analyzed, the expression level of human ASGR1 gene mRNA in different treatment groups was calculated, and the knockdown effect of siRNA conjugate on human ASGR1 gene mRNA in vivo was calculated.
[0112] ASGR1 forward primer sequence: CGAGACGGGCTTCAAGAACTG (SEQ ID NO.481); reverse primer sequence: TAAAGGAGAGGTGGCTCCTG (SEQ ID NO.482).
[0113] The forward primer sequence for the internal reference GAPDH is: TGTGTCCGTCGTGGATCTGA (SEQ ID NO.483); the reverse primer sequence is: CCTGCTTCACCACCTTCTTGAT (SEQ ID NO.484).
[0114] (10) Homogenize the RIPA lysis buffer containing pre-added protein inhibitors for liver tissue and use it to extract proteins from the liver tissue. Centrifuge at 4°C, 12000 rpm for 20 min and transfer the supernatant to a new 1.5 ml EP tube.
[0115] (11) Protein concentration was determined using the BCA protein assay kit (Thermo Scientific, 23227);
[0116] (12) Perform gel electrophoresis and membrane transfer at a loading rate of 25 μg total protein / well. Incubate overnight at 4°C with primary antibody against Flag-tagged protein (Cell Signaling Technology, #2368) and primary antibody against GAPDH (Cell).
[0117] Signaling Technology, #2118S) was then incubated with a secondary antibody (Goat anti-Rabbit IgG (H+L) Secondary Antibody, HRP, Thermo Scientific). TM ,31460), chemical exposure and imaging were performed using e-BLOT (Touch imager); based on the imaging data and the gray-scale quantification of protein bands, the expression level of human ASGR1-Flag protein in different treatment groups was calculated, and the knockdown effect of GalNAc-siRNA conjugate on human ASGR1-Flag protein in vivo was calculated.
[0118] Table 7. Efficacy of GalNAc-siRNA sequence in C57BL / 6J-AAV-hASGR1-Flag mice Note: - indicates not measured
[0119] Example 7: Pharmacological effects of ASGR1 siRNA-coupled ligand sequence in cynomolgus monkeys
[0120] Using cynomolgus monkeys as the research subjects, the animals were roughly grouped according to body weight, with 5 animals in each group, and further subdivided according to blood parameters taken two days prior to drug administration (Day-12 and Day-7). On the day of drug administration (D0), the dosage and volume of the drug were calculated based on the animals' latest body weight. PBS was used as a negative control. GalNAc-siRNA (injection dose 4.5 mpk) was subcutaneously injected into the back of the animals to evaluate the in vivo efficacy of the conjugated siRNA in cynomolgus monkeys.
[0121] Venous blood samples were collected from the cephalic vein of the upper limb or the saphenous vein of the lower limb of each group of animals before administration (Day-7) and at different time points after administration. Serum or anticoagulated blood samples were collected for various index tests.
[0122] Animals in each group were anesthetized before drug administration (Day 7) and at different time points after drug administration. The puncture area was disinfected with iodine and alcohol, respectively. After locating the liver and puncture needle using ultrasound, a biopsy needle was inserted to collect liver tissue. One copy of the obtained liver tissue was preserved in RNA later (when processing RNA later samples, the tissue was completely immersed in the RNA later solution in the tube, soaked at 4°C for approximately 24 hours, and then transferred to -80°C for storage) for mRNA analysis; another copy was rapidly frozen in liquid nitrogen and stored at -80°C for protein detection and pharmacokinetic analysis. Data from ASGR1 mRNA and ASGR1 protein tests on the liver puncture samples showed that the tested conjugated ligands (siRNAs) exhibited good inhibitory activity against ASGR1 mRNA and ASGR1 protein in cynomolgus monkeys, with most tested molecules showing inhibition rates of >50% or higher against ASGR1 mRNA or ASGR1 protein.
Claims
1. An RNAi construct that inhibits ASGR1 gene expression, comprising an antisense strand and a sense strand, wherein... The antisense strand comprises 17-23 consecutive nucleotides that differ from any of the antisense strand sequences provided in Table 1 or Table 2 by 0, 1 or 2 nucleotides. The sense strand comprises a nucleotide sequence that is at least partially complementary to the antisense strand.
2. The RNAi construct of claim 1, wherein the antisense strand is any of the antisense strand sequences provided in Table 1 or Table 2 that differ by 0 or 1 nucleotide.
3. The RNAi construct of claim 1, wherein the antisense strand comprises, from the 5' end to the 3' end, a continuous nucleotide selected from: SEQ ID NO:137 to SEQ ID NO:219, SEQ ID NO:221 to SEQ ID NO:272, SEQ ID NO:432 or SEQ ID NO:504-510, or is composed of a continuous nucleotide selected from: SEQ ID NO:137 to SEQ ID NO:219, SEQ ID NO:221 to SEQ ID NO:272, SEQ ID NO:432 or SEQ ID NO:504-510.
4. The RNAi construct of claim 1, wherein the antisense strand from the 5' end to the 3' end is selected from: a series of nucleotides comprising SEQ ID NO: 137, 138, 142, 145, 147, 164, 165, 166, 178, 210, 212, 229, 239, 241, 242, 244, 249, 250, 252, 257, 258, 267, 269, 270, 271, 504-510, or SEQ ID NO: 504-510. The continuous nucleotide compositions shown in NO:137, 138, 142, 145, 147, 164, 165, 166, 178, 210, 212, 229, 239, 241, 242, 244, 249, 250, 252, 257, 258, 267, 269, 270, 271, 504-510 are as follows.
5. The RNAi construct of claim 1, wherein the RNAi construct is selected from any of the constructs provided in Table 1.
6. The RNAi construct of claim 1, wherein the RNAi construct is selected from the following constructs in Table 1: D-1001 (SEQ ID NO: 1 and 137), D-1002 (SEQ ID NO: 2 and 138), D-1006 (SEQ ID NO: 6 and 142), D-1009 (SEQ ID NO: 9 and 145), D-1011 (SEQ ID NO: 11 and 147), D-1028 (SEQ ID NO: 28 and 164), D-1029 (SEQ ID NO: 29 and 165), D-1030 (SEQ ID NO: 30 and 166), D-1042 (SEQ ID NO: 42 and 178), D-1074 (SEQ ID NO: 74 and 210), D-1076 (SEQ ID NO: 76 and 212), D-1095 (SEQ ID NO: 137 ...48), D-1002 (SEQ ID NO: 137 and 148), D-1006 (SEQ ID NO: 6 and 142), D-1009 D-1105 (SEQ ID NO: 103 and 239), D-1107 (SEQ ID NO: 105 and 241), D-1108 (SEQ ID NO: 106 and 242), D-1110 (SEQ ID NO: 108 and 244), D-1115 (SEQ ID NO: 113 and 249), D-1116 (SEQ ID NO: 114 and 250), D-1118 (SEQ ID NO: 116 and 252), D-1123 (SEQ ID NO: 121 and 257), D-1124 (SEQ ID NO: 122 and 258), D-1133 (SEQ ID NO: 131 and 267), D-1135 (SEQ ID NO: 133 and 269), D-1136 (SEQ ID NO: 93 and 229), ... D-1137 (SEQ ID NO: 135 and 271), D-1154 (SEQ ID NO: 491 and 504), D-1155 (SEQ ID NO: 492 and 505), D-1156 (SEQ ID NO: 493 and 506), D-1157 (SEQ ID NO: 494 and 507), D-1158 (SEQ ID NO: 495 and 508), D-1159 (SEQ ID NO: 496 and 509), D-1160 (SEQ ID NO: 497 and 510);Preferred D-1074 (SEQ ID NO: 74 and 210), D-1095 (SEQ ID NO: 93 and 229), D-1107 (SEQ ID NO: 105 and 241), D-1108 (SEQ ID NO: 106 and 242), D-1123 (SEQ ID NO: 121 and 257), D-1115 (SEQ ID NO: 113 and 249), D-1116 (SEQ ID NO: 114 and 250), D-1118 (SEQ ID NO: 116 and 252), D-1124 (SEQ ID NO: 122 and 258), D-1154 (SEQ ID NO: 491 and 504), D-1155 (SEQ ID NO: 492 and 505), D-1156 (SEQ ID NO: 493 and 506), D-1157 (SEQ ID NO: 74 and 210). SEQ ID NO:494 and 507), D-1158 (SEQ ID NO:495 and 508), D-1159 (SEQ ID NO:496 and 509), D-1160 (SEQ ID NO:497 and 510).
7. The RNAi construct according to any one of claims 1 to 6, wherein at least one nucleotide of the sense strand and / or the antisense strand is a modified nucleotide or includes a modified nucleoside inter-bond; preferably all nucleotides are modified nucleotides.
8. The RNAi construct of claim 7, wherein the modified nucleotide is a deoxyribonucleotide, a base-free nucleotide, a 2'-modified nucleotide, a reverse nucleotide, a 2',3'-open-ring nucleotide mimic, a locked nucleotide, a 2'-F-arabinonucleotide, a 5'-Me, a 2'-fluoronucleotide, an inosine-containing nucleotide, or a combination thereof.
9. The RNAi construct of claim 7, wherein the modifying group in the modified nucleotide is selected from 2'-methoxy, 2'-methoxyalkyl, 2'-O-alkyl, 2'-O-allyl, 2'-C-allyl, 2'-fluorine, 2'-deoxy, 2'-ON-methylacetamido (2-O-NMA), 2'-O-dimethylaminoethoxyethyl (2'-O-DMAEOE), 2'-O-aminopropyl (2'-O-AP), 2'-ara-F, L-nucleoside modification, LNA, ENA, HNA, cET BNA, UNA, and ethylene glycol nucleotide (GNA) or combinations thereof; wherein the internucleotide bond is a phosphate thioester bond.
10. The RNAi construct of claim 7, wherein the modified antisense strand comprises, from the 5' end to the 3' end, a continuous nucleotide selected from: SEQ ID NO:352 to SEQ ID NO:383, SEQ ID NO:385 to SEQ ID NO:416, SEQ ID NO:418 to SEQ ID NO:430, or SEQ ID NO:455 to SEQ ID NO:476, or is composed of a continuous nucleotide selected from: SEQ ID NO:352 to SEQ ID NO:383, SEQ ID NO:385 to SEQ ID NO:416, SEQ ID NO:418 to SEQ ID NO:430, or SEQ ID NO:455 to SEQ ID NO:
476.
11. The RNAi construct of claim 10, wherein the RNAi construct is selected from any of the constructs provided in Table 2.
12. The RNAi construct of claim 11, wherein the RNAi construct is selected from the following constructs in Table 2: D-3001 (SEQ ID NO: 273 and 352), D-3002 (SEQ ID NO: 274 and 353), D-3003 (SEQ ID NO: 275 and 354), D-3005 (SEQ ID NO: 277 and 356), D-3006 (SEQ ID NO: 278 and 357), D-3007 (SEQ ID NO: 279 and 358), D-3012 (SEQ ID NO: 284 and 363), D-3015 (SEQ ID NO: 287 and 366), D-3016 (SEQ ID NO: 288 and 367), D-3017 (SEQ ID NO: 289 and 368), D-3021 (SEQ ID NO: 274 ...5 and 354), D-3005 (SEQ ID NO: 277 and 3 D-3027 (SEQ ID NO: 293 and 372), D-3032 (SEQ ID NO: 304 and 383), D-3037 (SEQ ID NO: 307 and 386), D-3046 (SEQ ID NO: 312 and 391), D-3047 (SEQ ID NO: 313 and 392), D-3048 (SEQ ID NO: 314 and 393), D-3049 (SEQ ID NO: 315 and 394), D-3054 (SEQ ID NO: 320 and 399), D-3055 (SEQ ID NO: 321 and 400), D-3066 (SEQ ID NO: 332 and 411), D-3067 (SEQ ID NO: 333 and 412), D-3068 (SEQ ID NO: 293 and 372), D-3027 (SEQ ID NO: 299 and 378), D-3032 (SEQ ID NO: 304 and 383), D-3037 (SEQ ID NO: 307 and 386), D-3046 (SEQ ID NO: 312 and 391), D-3047 (SEQ ID NO: 313 and 392), D-3048 (SEQ ID NO: 314 and 393), D-3049 (SEQ ID NO: 315 and 394), D-3054 (SEQ ID NO: 320 and 399), D-3055 (SEQ ID NO: 321 and 400), D-3066 (SEQ ID NO: 332 and 411), D-3067 (SEQ ID NO: 333 and 412), D-3068 (SEQ ID NO: 293 and 372), D-3027 ( NO:334 and 413), D-3069 (SEQ ID NO:335 and 414), D-3070 (SEQ ID NO:336 and 415),Any one of D-3071 (SEQ ID NO: 337 and 416), D-3072 (SEQ ID NO: 433 and 455), D-3073 (SEQ ID NO: 434 and 456), D-3074 (SEQ ID NO: 435 and 457), D-3075 (SEQ ID NO: 436 and 458), D-3076 (SEQ ID NO: 437 and 459), D-3077 (SEQ ID NO: 438 and 460), D-3078 (SEQ ID NO: 439 and 461), D-3079 (SEQ ID NO: 440 and 462), D-3080 (SEQ ID NO: 441 and 463), D-3081 (SEQ ID NO: 442 and 464), and D-3082 (SEQ ID NO: 443 and 465).
13. The RNAi construct according to any one of claims 1-12, wherein the RNAi construct is further conjugated with a targeting ligand, preferably the targeting ligand being an N-acetyl-galactosamine derivative (GalNAc derivative).
14. The RNAi construct of claim 13, wherein the targeting ligand is selected from L96, LICA-1, LICA-2, LICA-3, (NAG25), (NAG25)s, (NAG37) or (NAG37)s; 15. The RNAi construct of claim 13, wherein the sense strand conjugated with the targeting ligand comprises, from the 5' end to the 3' end, a continuous nucleotide selected from, or composed of, the continuous nucleotides shown in SEQ ID NO:339 to SEQ ID NO:351, SEQ ID NO:444 to SEQ ID NO:
454.
16. The RNAi construct of claim 13, wherein the targeting ligand is conjugated to the 5' or 3' end of the sense strand, wherein the RNAi construct is selected from the following constructs in Table 2: D-5002 (SEQ ID NO: 339 and 418), D-5003 (SEQ ID NO: 340 and 419), D-5004 (SEQ ID NO: 341 and 420), D-5005 (SEQ ID NO: 342 and 421), D-5006 (SEQ ID NO: 343 and 422), D5007 (SEQ ID NO: 344 and 423), D5008 (SEQ ID NO: 345 and 424), D-5009 (SEQ ID NO: 346 and 425), D-5010 (SEQ ID NO: 347 and 426), D-5011 (SEQ ID NO: 347 and 426), D-5011 (SEQ ID NO: 348 and 429), D-5002 (SEQ ID NO: 339 and 418), D-5003 (SEQ ID NO: 340 and 419), D-5004 (SEQ ID NO: 341 and 420), D-5005 (SEQ ID NO: 342 and 421), D-5006 (SEQ ID NO: 343 and 422), D5007 (SEQ ID NO: 344 and 423), D5008 (SEQ ID NO: 345 and 424), D-5009 (SEQ ID NO: 346 and 425), D-5010 (SEQ ID NO: 347 and 426), D-5011 (SEQ ID NO: 348 and 429), D-5011 (SEQ ID NO: 349 and D-5012 (SEQ ID NO: 348 and 427), D-5013 (SEQ ID NO: 350 and 429), D-5014 (SEQ ID NO: 351 and 430), D-5015 (SEQ ID NO: 444 and 466), D-5016 (SEQ ID NO: 430 and 467), D-5017 (SEQ ID NO: 446 and 468), D-5018 (SEQ ID NO: 447 and 469), D-5019 (SEQ ID NO: 448 and 470), D-5020 (SEQ ID NO: 449 and 471), D-5021 (SEQ ID NO: 450 and 472), D-5022 (SEQ ID NO: 451 and 473), D-5023 (SEQ ID NO: 348 and 427), D-5012 (SEQ ID NO: 349 and 428), D-5013 (SEQ ID NO: 350 and 429), D-5014 (SEQ ID NO: 351 and 430), D-5015 (SEQ ID NO: 444 and 466), D-5016 (SEQ ID NO: 430 and 467), D-5017 (SEQ ID NO: 446 and 468), D-5018 (SEQ ID NO: 447 and 469), D-5019 (SEQ ID NO: 448 and 470), D-5020 (SEQ ID NO: 449 and 471), D-5021 (SEQ ID NO: 450 and 472), D-5022 (SEQ ID NO: 451 and 473), D-5023 (SEQ ID NO: 348 and 427), D-5012 ( Any one of NO:452 and 474), D-5024 (SEQ ID NO:453 and 475), or D-5025 (SEQ ID NO:454 and 476).
17. The RNAi construct of claim 1, selected from... (1) D-1074 (SEQ ID NO: 74 and 210), D-1095 (SEQ ID NO: 93 and 229), D-1115 (SEQ ID NO: 113 and 249), D-1116 (SEQ ID NO: 114 and 250), D-1107 (SEQ ID NO: 105 and 241), D-1108 (SEQ ID NO: 106 and 242), D-1118 (SEQ ID NO: 116 and 252), D-1123 (SEQ ID NO: 121 and 257) or D-1124 (SEQ ID NO: 122 and 258), D-1154 (SEQ ID NO: 491 and 504), D-1155 (SEQ ID NO: 492 and 505), D-1156 (SEQ ID NO: 493 and 506), D-1157 ... (SEQ ID NO:494 and 507), D-1158 (SEQ ID NO:495 and 508), D-1159 (SEQ ID NO:496 and 509), or D-1160 (SEQ ID NO:497 and 510); (2) Its antisense strand contains a sequence substantially or completely complementary to the 210-230 position region of the ASGR1 mRNA sequence NM_001671.5; preferably D-3012 (SEQ ID NO: 284 and 363), D-3046 (SEQ ID NO: 312 and 391), D-3047 (SEQ ID NO: 313 and 392), D-3049 (SEQ ID NO: 315 and 394), D-3072 (SEQ ID NO: 433 and 455), D-3074 (SEQ ID NO: 437 and 457), D-3075 (SEQ ID NO: 436 and 458), D-3077 (SEQ ID NO: 438 and 460), D-5002 (SEQ ID NO: 339 and 418), D-5007 (SEQ ID NO: 344 and 423), D-5008 ...5008 (SEQ ID NO: 284 and 363), D (SEQ ID NO: 345 and 424), D-5009 (SEQ ID NO: 346 and 425), D-5015 (SEQ ID NO: 444 and 466), D-5017 (SEQ ID NO: 446 and 468), D-5018 (SEQ ID NO: 447 and 469) and D-5020 (SEQ ID NO: 449 and 471); more preferably D-3012 (SEQ ID NO: 284 and 363), D-3049 (SEQ ID NO: 315 and 394), D-3074 (SEQ ID NO: 437 and 457), D-5002 (SEQ ID NO: 339 and 418), D-5009 (SEQ ID NO: 346 and 425), D-5017 (SEQ ID NO: 446 and 468); (3) Its antisense strand contains a sequence that is substantially or completely complementary to the 213-233 region of the ASGR1 mRNA sequence NM_001671.5; preferably D-3054 (SEQ ID NO:320 and 399), D-3055 (SEQ ID NO:321 and 400), D-3080 (SEQ ID NO:441 and 463), D-3081 (SEQ ID NO:442 and 464), D-5010 (SEQ ID NO:347 and 426), D-5011 (SEQ ID NO:348 and 427), D-5023 (SEQ ID NO:452 and 474), and D-5024 (SEQ ID NO:453 and 475); (4) Its antisense strand contains a sequence substantially or completely complementary to the 1222-1242, 1223-1243, 1224-1244, 1225-1245, 1226-1246, 1227-1247 or 1228-1248 position regions of the ASGR1 mRNA sequence NM_001671.5; the preferred RNAi construct is selected from: D-1108 (SEQ ID NO: 106 and 242), D-1154 (SEQ ID NO: 491 and 504), D-1155 (SEQ ID NO: 492 and 505), D-1156 (SEQ ID NO: 493 and 506), D-1157 (SEQ ID NO: 494 and 507), D-1158 (SEQ ID NO: 495 and 508), D-1159 ...7), D-1158 (SEQ ID NO: 495 and 508), D-1159 (SEQ ID NO: 106 and 242), D-1154 (SEQ ID NO: 491 and 507), D-1158 (SEQ ID NO: 495 and 508), D-1159 (SEQ ID NO:496 and 509), D-1160 (SEQ ID NO:497 and 510) or the aforementioned constructs thereof with optional nucleotide modifications and / or optional internucleotide bond modifications and / or optional conjugation targeting ligands, or D-3032 (SEQ ID NO:304 and 383), D-5004 (SEQ ID NO:341 and 420); (5) D-5002 (SEQ ID NO: 339 and 418), D-5004 (SEQ ID NO: 341 and 420), D-5009 (SEQ ID NO: 346 and 425), D-5011 (SEQ ID NO: 348 and 427), D-5015 (SEQ ID NO: 444 and 466), D-5017 (SEQ ID NO: 446 and 468), D-5018 (SEQ ID NO: 447 and 469); or (6) D-5003 (SEQ ID NO: 340 and 419), D-5008 (SEQ ID NO: 345 and 424), D-5010 (SEQ ID NO: 347 and 426), D-5024 (SEQ ID NO: 453 and 475).
18. A pharmaceutical composition comprising the RNAi construct of any one of claims 1-17 and a pharmaceutically acceptable excipient.
19. The pharmaceutical composition of claim 18, further comprising a second ASGR1 RNAi construct or one or more other therapeutic agents; wherein, The RNAi construct of claim 18 is a first ASGR1 RNAi construct, and the second ASGR1 RNAi construct is selected from any one of claims 1-17 that is different from the first ASGR1 RNAi construct.
20. A method for treating and / or preventing ASGR1-related diseases or conditions, said method comprising administering to a subject in need an effective amount of the RNAi construct of any one of claims 1-17 or the composition of any one of claims 18-19; or Use of the RNAi construct of any one of claims 1-17 or the composition of any one of claims 18-19 in the treatment and / or prevention of ASGR1-related diseases or conditions; or Use of the RNAi construct of any one of claims 1-17 or the composition of any one of claims 18-19 in the preparation of a medicament for treating and / or preventing ASGR1-related diseases or conditions.
21. The method or use of claim 20, wherein the ASGR1-related disease or condition is obesity, metabolic syndrome, abnormal lipid metabolism, atherosclerosis, cardiovascular disease, peripheral vascular disease, cerebrovascular disease, or diabetes; preferably, the abnormal lipid metabolism is hyperlipidemia, hypertriglyceridemia, hypercholesterolemia, abnormal cholesterol metabolism, or non-alcoholic steatohepatitis; the cardiovascular disease is coronary artery disease or myocardial infarction; the cerebrovascular disease is stroke; and the diabetes is type II diabetes.