Salmonidae cell derivation and maintenance
A novel method for deriving and maintaining mesodermal progenitor and embryonic stem cells from salmonid embryos using FGF and specific substrates addresses the limitations of existing cell lines, enabling faster growth and superior muscle cell differentiation for sustainable aquaculture and cultivated meat production.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- ROSLIN TECH LTD
- Filing Date
- 2025-11-10
- Publication Date
- 2026-05-21
AI Technical Summary
Current methods for deriving and maintaining mesodermal progenitor cells and embryonic stem cells from salmonid or salmonoid embryos are lacking, particularly for commercially relevant species like Atlantic salmon, hindering the development of sustainable cellular aquaculture and cultivated meat products.
A method for deriving and maintaining mesodermal progenitor cells from eyed-stage salmonid embryos by isolating and culturing them in the presence of fibroblast growth factor (FGF), without the use of inhibitors like GSK-3, TGFB-R, or BMP, and using vitronectin as a substrate, and deriving embryonic stem cells from blastula-stage embryos by seeding on laminin substrates.
The method enables the successful isolation and long-term maintenance of mesodermal progenitor cells with faster growth and increased muscle progenitor marker expression, and the derivation of embryonic stem cells capable of differentiating into muscle cells with superior characteristics for cultivated meat production, addressing the limitations of existing cell lines.
Smart Images

Figure EP2025082511_21052026_PF_FP_ABST
Abstract
Description
[0001] Salmonidae Cell Derivation and Maintenance
[0002] Introduction
[0003] The present invention relates to the derivation and maintenance of specific stem cells from fertilised salmonid or salmonoid ova.
[0004] Background
[0005] Methods for deriving and maintaining progenitor cells of mesodermal lineage from human and mouse embryos are established in the art. The progenitor cells of the mesodermal lineage, also referred to as “mesodermal progenitor cells” or “progenitor cells” herein are from one of the three known somatic cell lineages i.e. mesoderm, ectoderm and endoderm. A progenitor cell of mesodermal lineage may give rise to a range of cell types e.g. skeletal I smooth muscle, bone, cartilage and connective tissue.
[0006] Unfortunately, knowledge from the human and murine fields is not directly transferable to other organisms, without complications arising. Additionally, studies that have been carried out in fish are largely performed in species commonly used only in laboratories e.g. in zebrafish. There is an absence of studies performed in commercially relevant fish species.
[0007] It is well established that the key stages of salmonid or salmonoid embryo development include 1) cleavage, 2) gastrulation and 3) organogenesis. In particular, the organogenesis stage is when the core structures and organs of the developing fish embryo become visible. It was previously unknown that mesodermal progenitor cells with self-renewal capabilities were derivable from late-stage salmonid or salmonoid embryos, especially from embryos in the organogenesis stage.
[0008] The increasing global demand for seafood, coupled with the environmental challenges posed by traditional aquaculture and wild-capture fisheries, necessitates innovative solutions for sustainable seafood production. Cellular aquaculture, which involves cultivating marine cells to produce seafood, offers one such possible solution. Robust and traceable salmonid or salmonoid cell lines from commercially relevant species, e.g. Atlantic salmon, are a prerequisite for the success of this technology. However, currently available salmonid or salmonoid cell lines, e.g. the Atlantic salmon kidney cell line, are lacking in their suitability for commercial production of cellular aquaculture products.
[0009] As such, an objective of the invention is to provide a method for deriving progenitor cells of the mesodermal lineage from salmonid or salmonoid embryos. Use of the resulting mesodermal progenitor cells may be aimed at reducing the environmental impact of traditional aquaculture and wild-capture fisheries, through the preparation of cultivated meat products.
[0010] In addition, the derivation and maintenance of embryonic stem cells (ESCs) from salmonid or salmonoid embryos is poorly understood in the art.
[0011] There is very limited research performed in salmonid or salmonoid, with previous studies having failed to successfully derive and maintain ESCs from salmonid or salmonoid embryos.
[0012] As such, another objective of the invention is to provide a method for deriving ESCs from salmonid or salmonoid embryos. Use of the resulting ESCs may be aimed at reducing the environmental impact of traditional aquaculture and wild-capture fisheries, through the preparation of cultivated meat products.
[0013] This invention thus provides a foundation for developing high-quality cellular aquaculture products and paves the way for progress towards offering a possible solution to environmental and ethical issues associated with traditional aquaculture and wild-capture fisheries.
[0014] Summary of the Invention
[0015] In a first aspect of the present invention there is provided a method of deriving and maintaining a stable progenitor cell line of mesodermal lineage from an eyed-stage salmonid or salmonoid embryo. Surprisingly, it has been shown that a progenitor cell line of mesodermal lineage can be successfully derived from a salmonid or salmonoid eyed-stage embryo and maintained in culture. Advantageously, the mesodermal progenitor cells were shown to have significantly faster growth in comparison to a known, commercially available salmonid or salmonoid cell line. Additionally, it has been shown that the mesodermal progenitor cells derived and maintained according to the methods of the present invention advantageously express increased levels of muscle progenitor markers and reduced levels of muscle markers in long-term culture.
[0016] According to a second aspect of the present invention, there is provided a method of deriving and maintaining an embryo-derived salmonid or salmonoid ESC from a blastula stage embryo.
[0017] Previous attempts at deriving and maintaining salmonid or salmonoid ESCs have all failed, whereas the present inventors have surprisingly found that salmonid or salmonoid ESCs derived from the blastula stage can be successfully maintained according to a method of the invention.
[0018] Detailed Description of the Invention
[0019] The invention provides a method of deriving and maintaining one or more progenitor cells of the mesodermal lineage from a fertilised salmonid or salmonoid ovum, the method comprising isolating the progenitor cells from the salmonid or salmonoid ovum during eyed-stage embryonic development.
[0020] The eyed-stage is known to be one of the later stages of the organogenesis phase of salmonid or salmonoid embryonic development and it is characterised by the eyecup surrounded by a higher density of pigmentation. The time it takes for a fish embryo to reach eyed-stage development is heavily dependent on the incubation temperature. By way of example, salmonid or salmonoid embryos were shown to reach the eyed-stage after approximately 128 days at 2°C incubation temperature, 52 days at 5°C incubation temperature, 32 days at 8°C incubation temperature, or 25 days at 10°C incubation temperature. It is known that organogenesis is the final phase of embryonic development and various structures e.g. tail, optic cup, intestines and analge of the pectoral fins become visible.
[0021] The progenitor cells of mesodermal lineage may be isolated from eyed-stage salmonid or salmonoid embryos at approximately 85-156 days post fertilisation when incubated at approximately 2°C. The progenitor cells of mesodermal lineage may be isolated from eyed-stage salmonid or salmonoid embryos at approximately 40-63 days post fertilisation when incubated at approximately 5°C. The progenitor cells of mesodermal lineage may be isolated from eyed-stage salmonid or salmonoid embryos at approximately 15-35 days post fertilisation when incubated at approximately 10°C. Preferably, the progenitor cells of mesodermal lineage are isolated from eyed-stage salmonid or salmonoid embryos at approximately 85 days post fertilisation when incubated at approximately 2-3°C.
[0022] It was unexpected that progenitor cells could be successfully isolated during the eyed-stage of embryonic development. The eyed-stage represents a late developmental timepoint during organogenesis when cellular differentiation is already well advanced and most cells have committed to specific lineages. Conventional wisdom in the field would suggest that by this stage, the window for isolating multipotent progenitor cells with self-renewal capabilities would have closed. Furthermore, the established protocols for deriving progenitor cells from other species typically target much earlier developmental stages when cells retain greater plasticity. It is noted that the harsh conditions required for embryo processing at this late stage, including the need to break through the increasingly tough chorion and navigate around well-developed organ structures, was expected to compromise cell viability and preclude successful isolation of functional progenitor cells. Finally, prior failures in salmonid stem cell derivation had discouraged attempts at such late developmental stages, leading technical experts to focus their efforts on earlier, seemingly more promising timepoints.
[0023] Surprisingly, the present inventors have developed a successful method of deriving and maintaining progenitor cells from an eyed-stage salmonid or salmonoid embryo. Advantageously, the cells were shown to maintain outstanding self-renewal abilities in comparison to a commercially available salmonid or salmonoid cell line and exhibit key characteristics associated with progenitor cells of the mesodermal lineage. Advantageously, the progenitor cells of mesodermal lineage isolated and maintained according to the present invention were shown to have faster doubling time and better self-renewal abilities in comparison to commercially available salmonid I salmonoid cell lines. Additionally, these progenitor cells were shown to be successfully maintained in long-term culture expansion. The unique characteristics demonstrated by these progenitor cells make the cells ideal candidates for use in downstream cultivation of meat products and / or as a starting material for reprogramming and generation of salmonid I salmonoid induced pluripotent stem cells (iPSCs).
[0024] Preferably, the invention provides a method of deriving and maintaining one or more progenitor cells of the mesodermal lineage from a fertilised salmonid or salmonoid ovum, the method comprising:
[0025] i) disrupting or dissociating the fertilised ovum at the eyed-stage of embryonic development to isolate one or more progenitor cells; and
[0026] ii) culturing the one or more isolated progenitor cells in a culture vessel.
[0027] It is preferred that the fertilised salmonid or salmonoid ovum is derived from a fish of the Salmonidae family. More preferably, the fertilised salmonid or salmonoid ovum is derived from a fish of the Salmo genus within the Salmonidae family. Even more preferably, the fertilised salmonid or salmonoid ovum is derived from Atlantic salmon (Salmo salar).
[0028] The progenitor cells of mesodermal lineage derived from a fertilised salmonid or salmonoid ovum may be cultured in the presence of fibroblast growth factor (FGF). Preferably, the FGF is human FGF or salmon FGF. More preferably, the FGF is salmon FGF.
[0029] Surprisingly, it has been found that the progenitor cell maintenance medium does not require inhibitors that are commonly used to maintain pluripotency in other species. Passages of over 30 have been successfully reached, whilst maintaining true progenitor properties. For this reason, an optional feature of the invention is that the mesodermal progenitor cells derived according to the methods of the invention are not cultured in the presence of inhibitors during the maintenance phase, e.g., the maintenance medium lacks one or more or all of a GSK-3 inhibitor, a TGFB-R inhibitor and a BMP inhibitor.
[0030] Preferably, the progenitor cell maintenance medium lacks a leukaemia inhibitory factor (LIF). As used herein, the term “LIF” is intended to encompass not only naturally occurring LIF polypeptides, but also functional analogues, derivatives, mimetics, variants, fusion proteins, receptor agonists and other agents capable of activating LIF receptor-mediated signalling. Accordingly, references to “LIF” should be understood to include use of any substitute that elicits an equivalent biological response to that of a LIF ligand through activation of the LIF signalling pathway.
[0031] Accordingly, in a preferred embodiment of the invention, there is provided a method of deriving and maintaining one or more progenitor cells (as above), wherein the maintaining is achieved in a maintenance medium lacking a LIF, a GSK-3 inhibitor, a TGFB-R inhibitor and a BMP inhibitor.
[0032] When culturing the derived progenitor cells of mesodermal lineage, the progenitor cells may be incubated at temperatures between approximately 18-25°C. More preferably, the isolated progenitor cells of mesodermal lineage are incubated at temperatures between approximately 19-21 °C. Even more preferably, the isolated I derived progenitor cells of mesodermal lineage are incubated at approximately 20°C.
[0033] It is preferred that the progenitor cells of mesodermal lineage may be incubated in the presence of approximately 2-8% CO2. More preferably, the progenitor cells of mesodermal lineage are incubated in approximately 4-6% CO2. Even more preferably, the progenitor cells of mesodermal lineage are incubated in approximately 5% CO2.
[0034] The progenitor cells of mesodermal lineage may therefore be incubated at temperatures between approximately 18-25°C with approximately 2-8% CO2. More preferably, the progenitor cells of mesodermal lineage are incubated at temperatures between approximately 19-21 °C with approximately 4-6% CO2. Even more preferably, the progenitor cells of mesodermal lineage are incubated at approximately 20°C with approximately 5% CO2. Most preferably, the progenitor cells of mesodermal lineage are incubated at 20°C with 5% CO2. When seeding the isolated progenitor cells in the culture vessel, the cells may be in contact with a vitronectin, vitronectin-XF, poly-L-lysine, poly-L-ornithine, fibronectin substrate, or a synthetic hydrogel modified with ECM peptides. Preferably, the progenitor cells of mesodermal lineage are in contact with a vitronectin substrate. The term “substrate” used herein may include a gel matrix, a pre-coated tissue culture vessel, a microcarrier or a solution. More preferably, the progenitor cells of mesodermal lineage are seeded on a vitronectin, vitronectin-XF, or fibronectin precoated tissue culture vessel. Even more preferably, the progenitor cells of mesodermal lineage are seeded on a vitronectin pre-coated culture plate.
[0035] Preferably, the vitronectin substrate is present at a concentration of 0.1-1.Opg / cm2More preferably, the vitronectin substrate is present at a concentration of 0.25-0.75pg / cm2. Even more preferably, the vitronectin substrate is present at a concentration of 0.4-0.6pg / cm2. Most preferably, the vitronectin substrate is present at a concentration of 0.5pg / cm2.
[0036] Surprisingly, the present inventors have discovered that vitronectin is uniquely effective as a substrate for maintaining salmonid or salmonoid progenitor cells of mesodermal lineage, whereas other commonly used substrates fail to support cell attachment and colony formation.
[0037] The invention hence provides a progenitor cell of the mesodermal lineage obtained according to the methods of the invention. The progenitor cells preferably express increased levels of muscle progenitor marker Myf5 compared to commercially available salmonid cell lines. It is preferred that the progenitor cells have at least a 1000-fold increase in Myf5 expression compared to the ASK cell line. It is preferred that, after 30 passages, the progenitor cells have at least a 1000-fold increase in Myf5 expression compared to the ASK cell line.
[0038] The progenitor cells of mesodermal lineage isolated according to the methods of the present invention may be used for the generation of cultivated I cultured meat. By way of example, the primary cell types for cultivated meat are generally myoblasts, myocytes, myotubes, and myofibers, however use of an undifferentiated cell biomass is also possible, or a combination of several cell types.
[0039] As such, the invention provides methods of producing (cultivated) meat from or comprising the progenitor cells of mesodermal lineage (and cells derived from these progenitor cells through differentiation), e.g., comprising the steps of providing progenitor cells of the invention and differentiating them to produce cultivated meat components or ingredients.
[0040] An embodiment of the invention comprises:
[0041] deriving and maintaining one or more progenitor cells of mesodermal lineage from eyed-stage salmonid or salmonoid ovum;
[0042] optionally differentiating the progenitor cells of mesodermal lineage into one or more cell types;
[0043] using either the progenitor cell biomass or cells differentiated from these progenitor cells as ingredients to generate a cultivated meat product.
[0044] A further embodiment of the invention comprises:
[0045] deriving and maintaining one or more progenitor cells of mesodermal lineage from eyed-stage salmonid or salmonoid ovum;
[0046] differentiating the progenitor cells into one or more cell types; and optionally, using the differentiated cells as ingredients to generate a cultivated meat product.
[0047] A still further embodiment of the invention comprises:
[0048] differentiating salmonid or salmonoid progenitor cells of mesodermal lineage into one or more cell types; and
[0049] using the differentiated cells as ingredients to generate a cultivated meat product.
[0050] The progenitor cells of mesodermal lineage derived according to the methods of the present invention offer advantages in generating phenotypically preferable muscle cells and myocytes for cultivated meat applications. The differentiation of these progenitor cells is able to yield muscle cells with enhanced characteristics such as improved texture, flavour development and nutritional profiles compared to muscle cells derived from other cell sources. The progenitor cells hence retain the capacity to differentiate into muscle cells that more closely resemble the native muscle tissue architecture and cellular organisation found in traditional fish meat.
[0051] In some cases, resulting myocytes exhibit superior contractile properties and protein expression patterns that contribute to the desired sensory attributes of the final cultivated meat product.
[0052] Additionally, the ability to control and direct the differentiation process allows for the generation of muscle cells with specific phenotypic traits that can be tailored to meet particular product specifications or consumer preferences.
[0053] The advantageous phenotypic characteristics of muscle cells and myocytes derived from the progenitor cells of the invention may be obtained by culturing the progenitor cells in a growth medium comprising specific components that support the generation of desired properties. For example, the growth medium may comprise one or more or all of DMEM / F-12 (Dulbecco's Modified Eagle Medium / Nutrient Mixture F-12), foetal bovine serum (FBS), 2-mercaptoethanol, non-essential amino acids (NEAA), sodium pyruvate, insulin-like growth factor (IGF), hepatocyte growth factor (HGF) and fibroblast growth factor (FGF). Preferably, the FGF is salmon FGF. This combination of medium components may contribute to differentiation into muscle lineages that exhibit advantageous phenotypic characteristics. In some cases, the inclusion of these specific growth factors and supplements may enhance the expression of key muscle markers, enabling the generation of muscle cells and myocytes with superior characteristics for cultivated meat applications.
[0054] Optionally, the differentiation is preceded by culturing the progenitor cells in a transition medium. The transition medium replaces the progenitor cell maintenance medium and comprises specific inhibitors to guide the cells toward a presomitic mesoderm (PSM) fate. This works by selectively inhibiting alternative differentiation routes. In this way, the inhibitors help to narrow the developmental potential of the cells toward a mesodermal lineage, preferably the paraxial mesoderm that gives rise to skeletal muscle. Preferably, the inhibitors comprise a GSK-3 inhibitor, a TGFB-R inhibitor and / or a BMP inhibitor.
[0055] Preferably, the cells produced from differentiating the progenitor cells (differentiated progenitor cells) are myocytes.
[0056] The invention hence also provides a (cultivated) meat product or prototype comprising progenitor cells of the invention and / or derivatives thereof, suitably obtainable according to the methods outlined above.
[0057] Specific embodiments comprise cultivated salmonid or salmonoid meat generated from cells derived (via differentiation) from the progenitor cells of mesodermal lineage, of the invention.
[0058] Preferably, the progenitor cells themselves and the culture media used to grow them meet the requirements of the US Food and Drug Administration (FDA) concerning safety and good manufacturing practices (GMP) for cultured cells in the context of cultured meat.
[0059] Preferably, the progenitor cells themselves and the culture media used to grow them meet the requirements of the European Food Safety Authority (EFSA) for cultured cells in the context of cultured meat, including the Regulations (EC) No. 852 / 2004 and (EC) No. 450 / 2009.
[0060] As such, it is preferred that the progenitor cells of the invention and the growth medium used to generate them are food-safe. Accordingly, it is preferred that the progenitor cells are cultured in a food-grade growth medium suitable for use in meat cultivation. More preferably, the food-grade growth medium comprises DMEM (Dulbecco’s Modified Eagle Medium).
[0061] The first aspect of the present invention thus provides methods for isolating salmonid or salmonoid derived progenitor cells of mesodermal lineage, the resulting progenitor cells per se and uses of these progenitor cells in the food industry. The invention also provides a method of producing an iPSC starting from the isolated progenitor cell of the mesodermal lineage.
[0062] Progenitor cells of the mesodermal lineage are typically regarded as multipotent stem cells.
[0063] Optionally, the invention provides a method of deriving and maintaining one or more progenitor cells of the mesodermal lineage from a fertilised salmonid or salmonoid ovum, the method comprising:
[0064] a) isolating the one or more progenitor cells from the salmonid or salmonoid ovum during eyed-stage embryonic development by processing the ovum to release cells;
[0065] b) seeding the isolated progenitor cells in a culture vessel; and
[0066] c) culturing the progenitor cells in appropriate environmental conditions for cell growth.
[0067] Optionally, the invention provides a method of deriving and maintaining one or more progenitor cells of the mesodermal lineage from a fertilised salmonid or salmonoid ovum, the method comprising:
[0068] a) isolating the one or more progenitor cells from the salmonid or salmonoid ovum during eyed-stage embryonic development by homogenising the ovum;
[0069] b) seeding the isolated progenitor cells in a culture vessel; and
[0070] c) culturing the progenitor cells in a growth medium suitable to maintain the progenitor cells.
[0071] According to a second aspect of the invention, there is provided a method of deriving and maintaining embryonic stem cells (ESCs) from a fertilised salmonid or salmonoid ovum of the Salmonidae family, the method comprising:
[0072] i) isolating one or more ESCs from an inner cell mass of the fertilised salmonid or salmonoid ovum during the blastula stage of development;
[0073] ii) seeding the ESCs on a laminin substrate; and
[0074] iii) culturing the ESCs in a suitable growth medium. It is preferred that the fertilised salmonid or salmonoid ovum is derived from a fish of the Salmonidae family. More preferably, the fertilised salmonid or salmonoid ovum is derived from a fish of the Salmo genus within the Salmonidae family. Even more preferably, the fertilised salmonid or salmonoid ovum is from Atlantic salmon (Salmo salar).
[0075] The ESC is derived from the inner cell mass of a fertilised salmonid or salmonoid ovum during the blastula stage. The blastula stage is known to be one of the earlier stages of the cleavage stage during embryonic development. At the blastula stage, the embryo is characterised by a hollow sphere of cells forming an epithelial covering layer enclosing a fluid-filled cavity. The time it takes for a fish embryo to reach the blastula stage is heavily dependent on the incubation temperature. By way of example, salmonid or salmonoid embryos were observed to reach early blastula stage at approximately 120-168 hours post-fertilisation and mid-blastula stage at approximately 150-192 hours post-fertilisation, when incubated at 6-8°C.
[0076] During derivation and maintenance, the isolated ESCs are seeded in culture vessels to be in contact with a laminin substrate. The term “substrate” used herein may include a gel matrix, a pre-coated tissue culture vessel or a solution containing laminin. More preferably, the ESCs are seeded on a laminin pre-coated tissue culture vessel.
[0077] Accordingly, the laminin substrate may be selected from laminin-521, laminin-511 , laminin-511 E8, laminin-411, laminin-332, laminin-221, laminin-211, laminin-111 or a mimetic of laminin e.g. decellularized ECM or Biosilk 521. Preferably, the laminin substrate is laminin 511. Surprisingly, the inventors have found that ESCs derived from mid-blastula stage embryos can only be maintained on laminin coated plates.
[0078] Preferably, the laminin substrate is present at a concentration of 0.1-1.Opg / cm2More preferably, the laminin substrate is present at a concentration of 0.25-0.75pg / cm2. Even more preferably, the laminin substrate is present at a concentration of 0.4-0.6pg / cm2. Most preferably, the laminin substrate is present at a concentration of 0.5pg / cm2. Surprisingly, the present inventors have discovered that laminin is uniquely effective as a substrate for maintaining salmonid or salmonoid ESCs, whereas other commonly used substrates fail to support ESC attachment and colony formation. This finding was unexpected, as laminin is not typically the preferred substrate for ESC culture in other species.
[0079] An embodiment of the invention comprises deriving and maintaining ESCs from a fertilised salmonid or salmonoid ovum, the method comprising:
[0080] i) isolating one or more ESCs from an inner cell mass of the fertilised salmonid or salmonoid ovum during the early blastula stage; and
[0081] ii) seeding the ESCs on a laminin substrate; and
[0082] iii) culturing the ESCs in a suitable growth medium.
[0083] The ESCs may be isolated from the early blastula stage salmonid or salmonoid embryos at approximately 90-480 hours post fertilisation when incubated at approximately 2-10°C. Preferably, the ESCs are isolated from early blastula stage salmonid or salmonoid embryos at approximately 120-240 hours post fertilisation when incubated at approximately 4-8°C. More preferably, the ESCs are isolated from early blastula stage salmonid or salmonoid embryos at approximately 135-192 hours post fertilisation when incubated at approximately 5-7°C. Even more preferably, the ESCs are isolated from early blastula stage salmonid or salmonoid embryos at approximately 160-175 hours post fertilisation when incubated at approximately 6°C. Most preferably, the ESCs are isolated from early blastula stage salmonid or salmonoid embryos at 166 hours post fertilisation when incubated at 6°C.
[0084] In another embodiment, the invention comprises deriving and maintaining ESCs from a fertilised salmonid or salmonoid ovum, the method comprising:
[0085] i) isolating one or more ESCs from an inner cell mass of the fertilised salmonid or salmonoid ovum during the mid-blastula stage; and
[0086] ii) seeding the ESCs on a laminin substrate; and
[0087] iii) culturing the ESCs in a suitable growth medium.
[0088] The ESCs may be isolated from the mid-blastula stage salmonid or salmonoid embryos at approximately 110-580 hours post fertilisation when incubated at approximately 2-10°C. Preferably, the ESCs are isolated from mid-blastula stage salmonid or salmonoid embryos at approximately 140-290 hours post fertilisation when incubated at approximately 4-8°C. More preferably, the ESCs are isolated from mid-blastula stage salmonid or salmonoid embryos at approximately 160-230 hours post fertilisation when incubated at approximately 5-7°C. Even more preferably, the ESCs are isolated from mid-blastula stage salmonid or salmonoid embryos at approximately 190-200 hours post fertilisation when incubated at approximately 6°C. Most preferably, the ESCs are isolated from mid-blastula stage salmonid or salmonoid embryos at 193 hours post fertilisation when incubated at 6°C.
[0089] The salmonid or salmonoid derived ESCs may be incubated at temperatures between approximately 18-25°C. More preferably, the ESCs are incubated at temperatures between approximately 19-21 °C. Even more preferably, the ESCs are incubated at 20°C.
[0090] It is preferred that the ESCs are incubated in approximately 2-8% CO2. More preferably, the ESCs are incubated in approximately 4-6% CO2. Even more preferably, the ESCs are incubated in 5% CO2.
[0091] The salmonid or salmonoid derived ESCs may therefore be incubated at temperatures between approximately 18-25°C with approximately 2-8% CO2. More preferably, the ESCs are incubated at temperatures between approximately 19-21 °C with approximately 4-6% CO2. Even more preferably, the ESCs are incubated at approximately 20°C with approximately 5% CO2. Most preferably, the ESCs are incubated at 20°C with 5% CO2.
[0092] The ESCs derived from a fertilised blastula stage salmonid or salmonoid ovum may be maintained in a growth medium. Preferably, the growth medium is salmon ED media orTeSR-E8 media. More preferably, the growth medium is salmon ED media.
[0093] It is preferred that the growth media comprises FGF. More preferably, the FGF comprises human derived FGF or salmon derived FGF. Even more preferably, the growth media comprises salmon derived FGF. Preferably, the growth medium lacks fish embryo extract. More preferably, the growth medium lacks fish embryo extract derived from blastula stage embryos. Even more preferably, the growth medium lacks fish embryo extract derived from mid-blastula stage embryos.
[0094] It is also preferred that the growth medium lacks fish serum.
[0095] Preferably, the growth medium lacks sodium selenite.
[0096] Furthermore, it is preferred that the growth medium lacks leukaemia inhibitory factor (LIF).
[0097] An embodiment of the invention comprises:
[0098] isolating and maintaining one or more ESCs derived from blastula stage salmonid or salmonoid ovum;
[0099] optionally differentiating the ESCs into one or more cell types;
[0100] using either the ESCs or cells differentiated from these ESCs as ingredients to generate a cultivated meat product.
[0101] Preferably, the cells produced from differentiating the ESCs (differentiated ESCs) are myocytes and / or adipocytes.
[0102] The invention hence also provides a (cultivated) meat product or prototype comprising ESCs of the invention or derivatives thereof, suitably obtainable according to the method outlined above.
[0103] Specific embodiments comprise cultivated salmonid or salmonoid meat generated from cells derived (via differentiation) from the ESCs of the invention.
[0104] Preferably, the ESCs themselves and the culture media used to grow them meet the requirements of the US Food and Drug Administration (FDA) concerning safety and good manufacturing practices (GMP) for cultured cells in the context of cultured meat. Preferably, the ESCs themselves and the culture media used to grow them meet the requirements of the European Food Safety Authority (EFSA) for cultured cells in the context of cultured meat, including the Regulations (EC) No. 852 / 2004 and (EC) No.
[0105] 450 / 2009.
[0106] As such, it is preferred that the ESCs of the invention and the growth medium used to generate them are food-safe. Accordingly, it is preferred that the ESCs are cultured in a food-grade growth medium suitable for use in meat cultivation. Even more preferably, the food-grade growth medium comprises DMEM / F-12 (Dulbecco’s Modified Eagle Medium / Nutrient Mixture F-12).
[0107] The second aspect of the present invention thus provides methods for producing salmonid or salmonoid derived ESCs, the resulting ESCs per se and uses of these ESCs in the food industry.
[0108] Examples
[0109] The invention is now illustrated by way of the following examples, with reference to the accompanying drawings, in which:
[0110] Fig. 1 illustrates a method of deriving and maintaining progenitor cells of mesodermal lineage from eyed-stage salmonid or salmonoid ova;
[0111] Fig. 2 demonstrates that progenitor cells of mesodermal lineage derived from eyed-stage salmonid or salmonoid ova were successfully maintained on vitronectin coated plates;
[0112] Fig. 3A-3B show that progenitor cells of mesodermal lineage derived from eyed-stage salmonid or salmonoid ova exhibit the correct morphology and have a faster doubling time in comparison to the commercially available adult Atlantic salmon kidney (ASK) cell line.
[0113] Fig. 4A-4D show that progenitor cells of the mesodermal lineage derived from eyed-stage salmonid or salmonoid ova exhibit a distinct gene expression profile in comparison to a commercially available ASK cell line;
[0114] Fig. 5A-5C demonstrate an upregulation of genes associated with muscle progenitors and decreased gene expression associated with differentiated muscle markers in progenitor cells of the mesodermal lineage derived from eyed-stage salmonid or salmonoid ova;
[0115] Fig. 6 illustrates a method of deriving and maintaining ESCs from mid-blastula stage salmonid or salmonoid ova;
[0116] Fig. 7 shows that ESCs derived from mid-blastula stage salmonid or salmonoid ova were successfully maintained on laminin coated plates;
[0117] Fig. 8 shows that ESCs derived from mid-blastula stage salmonid or salmonoid ova exhibited stem cell-like morphologies and formed tight colonies;
[0118] Fig. 9A-9C demonstrate that differentiated progenitor cells of mesodermal lineage positively express muscle gene markers;
[0119] Fig. 10 shows that a high level of myosin heavy chain (MHC) protein expression was detected in muscle cells differentiated from the progenitor cells of the invention; and
[0120] Fig. 11 shows that a high level of sarcomeric a-actinin (SAA) protein expression was detected in muscle cells differentiated from the progenitor cells of the invention.
[0121] Example 1 - Derivation of mesodermal progenitor cells from eyed-stage salmon ova.
[0122] Salmon Embryo Derivation (ED) Media
[0123] 1) DMEM / F-12 (Thermo Fisher Scientific, Cat. No: 31330-038)
[0124] 2) FBS (Merck, Cat. no: F2442)
[0125] 3) Human bFGF (Peprotech, Cat. No: 100-18B)
[0126] 4) Non-essential amino acid (NEAA) (Thermo Fisher Scientific, Cat. No:
[0127] 11140050)
[0128] 5) Sodium Pyruvate (Thermo Fisher Scientific, Cat. No: 11360070)
[0129] 6) 2-mercaptoethanol (Thermo Fisher Scientific, Cat. No: 31350010)
[0130] Protocol
[0131] Approximately 1,000 StofnFiskur Salmoselect diploid mixed-sex ova were obtained from Benchmark Genetics. The ova were washed once in 70% ice-cold ethanol and rinsed three times in ice-cold Dulbecco’s Phosphate Buffered Saline (DPBS) supplemented with antibiotics. The salmon ova were incubated in DPBS supplemented with antibiotics for 5 minutes during the final rinse. The salmon ova were subsequently homogenised using a stick blender and a small volume of DPBS supplemented with antibiotics was added to aid the homogenisation process. The homogenate was filtered using 200pm and 100pm filters to remove larger debris and the chorion. The homogenate was then collected in a 50ml centrifuge tube and centrifuged at 300g for 4 minutes. The cell pellet was collected, and the supernatant was discarded. The cells were resuspended in 5m I of Salmon ED media and the wash process was carried out 2-3 times to remove excess oil and blood. The cleaned cells were resuspended in 5ml of Salmon ED media supplemented with 20ng / pl of human bFGF and the cell suspension was subsequently seeded onto a 6-well plate precoated with 0.5pg / cm2vitronectin. The cells were then incubated at 20°C with 5% CO2 to allow cell attachment and growth.
[0132] The salmon ED media was refreshed every two days and adherent cells became visible within 2-7 days. The cultured cells were observed to reach confluency by day 14.
[0133] Example 2 - Progenitor cells of mesodermal lineage derived from eyed-stage Atlantic salmon embryos successfully established on vitronectin coated plates.
[0134] The following experimental setup was used to evaluate the optimal maintenance protocol for progenitor cells of mesodermal lineage derived from eyed-stage Atlantic salmon embryos.
[0135] Salmon ED Media
[0136] 1) DMEM / F12 (Thermo Fisher Scientific, Cat. No: 31330-038)
[0137] 2) FBS (Merck, Cat. no: F2442)
[0138] 3) Human bFGF (Peprotech, Cat. No: 100-18B)
[0139] 4) Non-essential amino acid (NEAA) (Thermo Fisher Scientific, Cat. No:
[0140] 11140050)
[0141] 5) Sodium Pyruvate (Thermo Fisher Scientific, Cat. No: 11360070)
[0142] 6) 2-mercaptoethanol (Thermo Fisher Scientific, Cat. No: 31350010)
[0143] Protocol Approximately 1,000 StofnFiskur Salmoselect diploid mixed-sex ova were obtained from Benchmark Genetics. The ova were washed once in 70% ice-cold ethanol and rinsed three times in ice-cold Dulbecco’s Phosphate Buffered Saline (DPBS) supplemented with antibiotics. The salmon ova were incubated in DPBS supplemented with antibiotics for 5 minutes during the final rinse. The salmon ova were subsequently homogenised using a stick blender and a small volume of DPBS supplemented with antibiotics was added to aid the homogenisation process. The homogenate was filtered using 200pm and 100pm filters to remove larger debris and the chorion. The homogenate was then collected in a 50ml centrifuge tube and centrifuged at 300g for 4 minutes. The cell pellet was collected, and the supernatant was discarded. The cells were resuspended in 5ml of Salmon ED media and the wash process was carried out 2-3 times to remove excess oil and blood. The cleaned cells were resuspended in 5ml of Salmon ED media supplemented with 20ng / pl of human bFGF and the cell suspension was subsequently seeded into 3 wells of a 6-well plate pre-coated with 1) 0.5pg / cm2vitronectin; 2) 0.5pg / cm2laminin; or 3) 0.2% gelatin. The cells were then incubated at 20°C with 5% CO2 to allow cell attachment and growth. This is depicted in Fig. 1.
[0144] The Salmon ED media was refreshed every two days and adherent cells became visible on day 5. As shown on Figure 2, the progenitor cells of mesodermal lineage failed to grow on 0.2% gelatin and all cells were dead by Day 30. While progenitor cells plated on laminin coated plates were shown to be capable of expanding, the cells failed to grow further and could not be passaged following Day 30. Surprisingly, it has been shown that only progenitor cells seeded on vitronectin coated plates were successfully expanded and passaged. It was observed that these progenitor cells are successfully maintained and with continued passaging.
[0145] Example 3 - Superior growth rate of Atlantic salmon-derived mesodermal progenitors observed in comparison to ASK cell line
[0146] The growth rate of eyed-stage embryo derived progenitor cells of mesodermal lineage was evaluated and compared to the commercial ASK cell line. As shown in Figure 3A, advantageously the eyed-stage embryo derived progenitor cells of mesodermal lineage have a significantly faster doubling time in comparison to the ASK cell line, measuring at 54 hours vs 120 hours, respectively.
[0147] Eyed-stage embryo derived progenitor cells of mesodermal lineage was also shown to have a desirable morphology in Figure 3B.
[0148] Example 4 - Distinct gene expression profile observed in Atlantic salmon derived progenitor cells of mesodermal lineage in comparison to ASK cell line
[0149] The gene expression profile of Atlantic salmon derived progenitor cells of mesodermal lineage was characterised and compared to the commercially available ASK cell line using RNA sequencing in the following example.
[0150] The cells were detached enzymatically using accutase as per standard maintenance procedure, counted and transferred to a centrifuge tube. The cells were then centrifuged at 300g for 5 minutes and the supernatant was aspirated. The cell pellet was washed using PBS and centrifuged again at 300g for 5 minutes. The supernatant was, again, aspirated and the cells were centrifuged for the final time to remove last traces of liquid.
[0151] The samples were then sent to GeneWiz (Azenta Life Sciences) for RNA sequencing.
[0152] As shown in Figures 4A-4B, the principal component analysis (PCA) plots reveal that the progenitor cells of mesodermal lineage are unique compared to the commercial ASK cell line. The majority of the variance between the eyed-stage embryo derived progenitor cells of mesodermal lineage and ASK was captured by the first principal component (PC1), accounting for 84.27% of the variation. In contrast, PC2 and PC3 explained only 4.1% and 3.98% of the variation, respectively, suggesting that the differences between these cell types are primarily driven by factors associated with PC1.
[0153] Figures 4C-4D further demonstrate that in comparison to commercially available ASK cell lines, eyed-stage embryo derived progenitor cells of mesodermal lineage were shown to have a distinct gene expression profile. In particular, Figure 4C indicates a significant upregulation of muscle and muscle related progenitor genes was detected in eyed-stage embryo derived progenitor cells of mesodermal lineage, whereas ASK cells had a notable upregulation of endothelial-related genes.
[0154] Example 5 - Genes highly expressed in RNAseq were also detected in qPCR
[0155] The gene expression of muscle progenitor markers or muscle markers of the progenitor cells of mesodermal lineage was verified and compared to the ASK cell line using qPCR at passage 8 and passage 32 in the following example.
[0156] The cells were detached enzymatically using Accutase as per standard maintenance procedure, counted and transferred to a centrifuge tube. The cells were then centrifuged at 300g for 5 minutes and the supernatant was aspirated. The cell pellet was washed using PBS and centrifuged again at 300g for 5 minutes. The supernatant was, again, aspirated and the cells were centrifuged for the final time to remove last traces of liquid.
[0157] The RNA was extracted from the progenitor cells according to the manufacturer’s protocol for the RNeasy Mini Kit (Qiagen, Cat no: 74104). The extracted RNA was quantified, and quality assessment was performed using Nanodrop. RNA samples with a concentration up to 200ng / pl were treated using 1 pl of DNase enzyme. Samples with a concentration greater than 200ng / pl were diluted prior to DNase treatment.
[0158] The RNA samples were subsequently diluted in PCR reaction tubes in preparation for cDNA synthesis. 1 pl of Oligo dT was added to each reaction tube and the tubes were incubated 65°C for 5 minutes and then cooled at room temperature for 10 minutes to allow annealing. 2pl of 10x Affinity Script RT buffer; 0.8pl of dNTP mix; 0.5pl of RNAse Block Ribonuclease inhibitor; 1 pl of Affinity Script Multiple Temperature RT were added per sample. The tubes were incubated at 42°C for 1 hour and then at 70°C for another 15 minutes. Prior to qPCR, the cDNAwas diluted to a final concentration of 10ng / pl.
[0159] qPCR was performed using the Applied Biosystems QuantStudio 3 qPCR machine. The qPCR program and primers used are listed in Tables 1 and 2 below, respectively.
[0160]
[0161] Table 1. qPCR program for detecting UB2L3, Myf5, TMP1, Actal, VWF, Pecam and KDR gene expression.
[0162]
[0163] Table 2. Primers for detecting UB2L3, Myf5, TMP1 , Actal , VWF, Pecam and KDR gene expression using qPCR.
[0164] The AACt method was used to calculate the relative expression of the different genes in the samples, with gene expression normalised to endogenous control ubiquitin-conjugating enzyme E2 L3 (UB2L3) before relative expression to the control was calculated.
[0165] Resu / ts Gene expression of muscle progenitor marker Myf5; muscle markers TMP1 and Actal ; and endothelial markers VWF, Pecam and KDR were measured in eyed-stage embryo derived progenitor cells of the mesodermal lineage and compared to the ASK cell line at passage 8 and passage 32.
[0166] Figure 5A shows that muscle progenitor marker Myf5 was highly expressed in eyed-stage embryo derived progenitor cells of the mesodermal lineage in comparison to the commercially available ASK cell line at both passage timepoints.
[0167] Surprisingly, increased levels of Myf5 were detected in the “SsEC p32” group when compared to the “SsEC p8”. This result indicates the isolated progenitor cells advantageously maintained a muscle progenitor phenotype despite a high number of passages.
[0168] Although TMP1 and Actal muscle markers are shown to be expressed in eyed-stage embryo derived progenitor cells of the mesodermal lineage during earlier passages in Figure 5B, advantageously expression of these markers is shown to have reduced significantly by passage number 32. This further demonstrates eyed-stage embryo derived progenitor cells of the mesodermal lineage exhibit and maintain a desirable muscle progenitor phenotype in long-term culture.
[0169] It was also confirmed in Figure 5C that no expression of differentiated endothelial markers i.e. VWF, Pecam and KDR was detected in eyed-stage embryo derived progenitor cells of the mesodermal lineage at both passage stages.
[0170] In summary, the results demonstrate that eyed-stage embryo derived progenitor cells of the mesodermal lineage successfully maintained desirable markers and features associated with mesodermal progenitor cells in culture.
[0171] Example 6 - Derivation of salmon ESCs from early-blastula stage
[0172] Salmon ESCs were derived from Atlantic salmon fertilised eggs according to the method described in the following example. Salmon ED Media
[0173] 1) DMEM / F12 (Thermo Fisher Scientific, Cat. No: 31330-038)
[0174] 2) FBS (Merck, Cat. no: F2442)
[0175] 3) Salmon bFGF (Qkine, Cat. No: Qk103-0100)
[0176] 4) Non-essential amino acid (NEAA) (Thermo Fisher Scientific, Cat. No:
[0177] 11140050)
[0178] 5) Sodium Pyruvate (Thermo Fisher Scientific, Cat. No: 11360070)
[0179] 6) 2-mercaptoethanol (Thermo Fisher Scientific, Cat. No: 31350010)
[0180] Protocol
[0181] Milt was collected from six male donors and approximately 2,000 unfertilised salmon ova in amniotic fluid were gathered and separated into six batches (approximately 300 ova in each batch). The milt straws were prewarmed to approximately 36°C for 10 seconds and mixed thoroughly with each batch of unfertilised ova. The fertilised ova were incubated at 4°C for approximately 2 minutes and the amniotic fluid was then drained. The ova were washed 3 times in approximately 6°C glutathione solution and subsequently transferred into baskets to be incubated at 5-6°C for approximately 6.7 days. The eggs were monitored daily for development and dead eggs were removed.
[0182] Embryos were collected during early blastula stage (approximately 160 hours post fertilisation) of development. The eggs were washed once in ice-cold ethanol and three times in ice-cold PBS supplemented with antibiotics. The eggs were then transferred to a 12-well 0.5pg / cm2laminin pre-coated dish containing salmon ED medium, each well was seeded with 3-5 eggs.
[0183] Using sterile fine-needle tweezers, the position of the eggs was adjusted so as to angle the “inner cell-mass” towards the bottom of the well. A small incision was made on the outer chorion using a scalpel and the contents of the egg was gently ejected into the well. The outer chorion was subsequently removed and disposed of. 1 ml of the salmon ED medium was added per well and the cells were incubated at approximately 20°C with 5% CChfor 48 hours. After 48 hours, the spent media was aspirated, and the cells were washed twice with DPBS supplemented with antibiotics. Fresh media was subsequently added and refreshed daily hereon. Cell growth was monitored via phase-contrast microscopy and tightly formed colonies with ESC-like morphologies were observed at around day 10. The colonies were then picked at day 14 for further passaging.
[0184] Example 7 - Derivation of salmon ESCs cells from mid-blastula stage
[0185] Salmon ESCs were derived from Atlantic salmon fertilised eggs according to the method described in the following example.
[0186] Salmon ED Media
[0187] 1) DMEM / F12 (Thermo Fisher Scientific, Cat. No: 31330-038)
[0188] 2) FBS (Merck, Cat. no: F2442)
[0189] 3) Salmon bFGF (Qkine, Cat. No: Qk103-0100)
[0190] 4) Non-essential amino acid (NEAA) (Thermo Fisher Scientific, Cat. No:
[0191] 11140050)
[0192] 5) Sodium Pyruvate (Thermo Fisher Scientific, Cat. No: 11360070)
[0193] 6) 2-mercaptoethanol (Thermo Fisher Scientific, Cat. No: 31350010)
[0194] Protocol
[0195] Milt was collected from six male donors and approximately 2,000 unfertilised salmon ova in amniotic fluid were gathered and separated into six batches (approximately 300 ova in each batch). The milt straws were prewarmed to approximately 36°C for 10 seconds and mixed thoroughly with each batch of unfertilised ova. The fertilised ova were incubated at 4°C for approximately 2 minutes and the amniotic fluid was then drained. The ova were washed 3 times in approximately 6°C glutathione solution and subsequently transferred into baskets to be incubated at 5-6°C for approximately 8 days. The eggs were monitored daily for development and dead eggs were removed.
[0196] Embryos were collected during mid-blastula stage (approximately 193 hours post fertilisation) of development. The eggs were washed once in ice-cold ethanol and three times in ice-cold PBS supplemented with antibiotics. The eggs were then transferred to a 12-well 0.5pg / cm2laminin pre-coated dish containing salmon ED medium, each well was seeded with 3-5 eggs.
[0197] Using sterile fine-needle tweezers, the position of the eggs was adjusted, so as to angle the “inner cell-mass” towards the bottom of the well. A small incision was made on the outer chorion using a scalpel and the contents of the egg was gently ejected into the well. The outer chorion was subsequently removed and disposed of. 1ml of the Salmon ED medium was added per well and the cells were incubated at approximately 20°C with 5% CChfor 48 hours.
[0198] After 48 hours, the spent media was aspirated, and the cells were washed twice with DPBS supplemented with antibiotics. Fresh media was subsequently added and refreshed daily hereon. Cell growth was monitored via phase-contrast microscopy and tightly formed colonies with ESC-like morphologies were observed at around day 10. The colonies were then picked at day 14 for further passaging.
[0199] Example 8 - Salmon ESCs derived from mid-blastula embryos successfully established on laminin coated plates
[0200] The following experimental setup was performed to evaluate the optimal maintenance protocol for ESCs derived from mid-blastula stage Atlantic salmon embryos.
[0201] Salmon ED Media
[0202] 1) DMEM / F12 (Thermo Fisher Scientific, Cat. No: 31330-038)
[0203] 2) FBS (Merck, Cat. no: F2442)
[0204] 3) Salmon bFGF (Qkine, Cat. No: Qk103-0100)
[0205] 4) Non-essential amino acid (NEAA) (Thermo Fisher Scientific, Cat. No:
[0206] 11140050)
[0207] 5) Sodium Pyruvate (Thermo Fisher Scientific, Cat. No: 11360070)
[0208] 6) 2-mercaptoethanol (Thermo Fisher Scientific, Cat. No: 31350010)
[0209] Protocol
[0210] As shown in Figure 6, milt was collected from six male donors and approximately 2,000 unfertilised salmon ova in amniotic fluid were gathered and separated into six batches (approximately 300 ova in each batch). The milt straws were prewarmed to approximately 36°C for 10 seconds and mixed thoroughly with each batch of unfertilised ova. The fertilised ova were incubated at 4°C for approximately 2 minutes and the amniotic fluid was then drained. The ova were washed 3 times in approximately 6°C glutathione solution and subsequently transferred into baskets to be incubated at 5-6°C for approximately 8 days. The eggs were monitored daily for development and dead eggs were removed.
[0211] Embryos were collected during mid-blastula stage (approximately 193 hours post fertilisation) of development. The eggs were washed once in ice-cold ethanol and three times in ice-cold PBS supplemented with antibiotics. The eggs then transferred to 6-well dishes pre-coated with 1 ) 0.5pg / cm2laminin; 2) 20pg / cm2Geltrex; or 3) 0.5pg / cm2vitronectin. To examine which media can maintain salmon derived ESCs, 1) salmon ED medium or 2) TeSR-E8 medium (Stemcell Technologies, Cat no: 05990) was added and 3-5 eggs were seeded per well.
[0212] Using sterile fine-needle tweezers, the position of the eggs was adjusted so as to angle the “inner cell-mass” towards the bottom of the well. A small incision was made on the outer chorion using a scalpel and the contents of the egg was gently ejected into the well. The outer chorion was subsequently removed and disposed of. 1 ml of the salmon ED or TeSR-E8 media was added per well and the cells were incubated at approximately 20°C with 5% CChfor 48 hours.
[0213] After 48 hours, the spent media was aspirated, and the cells were washed twice with DPBS supplemented with antibiotics. Fresh media was subsequently added and refreshed daily hereon. Cell growth was monitored via phase-contrast microscopy.
[0214] As shown in Figure 7, no cell attachment or formation of ESC-like colonies was observed in conditions where Geltrex or vitronectin coated plates were used. However, the desired cell attachment and the formation of distinct ESC-like colonies was observed in conditions where laminin coated plates were used.
[0215] Advantageously, ESCs maintained on laminin coated plates exhibited stem-cell like morphologies as shown in Figure 8. Example 9 - Differentiating progenitor cells from eyed-stage Atlantic salmon embryos
[0216] The following media formulations were used to differentiate the Atlantic salmon-derived progenitor cells of Example 1:
[0217] Presomitic Mesoderm Media (PSM)
[0218] 1) Salmon ED media
[0219] 2) CHIR99021 (2435 Axon)
[0220] 3) Salmon bFGF
[0221] 4) SB431542 (72234, StemCell Tech)
[0222] 5) DMH-1 (1206711-16-1 Tocris)
[0223] Muscle Media 1 Salmon Adapted (MS1)
[0224] 1) DMEM / F12
[0225] 2) FBS
[0226] 3) 2-mercaptoethanol
[0227] 4) Non-essential amino acids
[0228] 5) Sodium Pyruvate
[0229] 6) IGF
[0230] 7) HGF
[0231] 8) Salmon bFGF
[0232] Muscle Media 2 Salmon Adapted (MS2)
[0233] 1) DMEM / F12
[0234] 2) FBS
[0235] 3) IGF
[0236] 4) HGF
[0237] Protocol
[0238] Atlantic salmon-derived progenitor cells obtained according to the method of Example 1 were cultured to confluency. The culture medium was subsequently changed from the Salmon ED medium to the PSM medium, and the progenitor cells were cultured for 48 hours to undergo initial induction using CHIR99021 , a glycogen synthase kinase 3 (GSK-3) inhibitor, SB431542, a transforming growth factor-beta receptor (TGF[3-R) inhibitor, DMH1, a bone morphogenetic protein (BMP) inhibitor, and salmon fibroblast growth factor (FGF).
[0239] The cells were cultured in the PSM medium until Day 2, and the culture medium was subsequently changed to the MS1 medium, and the cells were cultured until Day 6. On Day 6, the culture medium was changed to the MS2 culture medium. The cells were kept in culture and fed every other day until Day 15.
[0240] The differentiated muscle cells were then maintained in MS2 or harvested for subsequent characterisation assays or tissue generation.
[0241] Example 10 - Expression of muscle markers in differentiated progenitor cells
[0242] The following media formulations were used to differentiate the Atlantic salmon-derived progenitor cells of Example 1 :
[0243] Presomitic Mesoderm Media (PSM)
[0244] 1) Salmon ED media
[0245] 2) CHIR99021 (2435 Axon)
[0246] 3) Salmon bFGF
[0247] 4) SB431542 (72234, StemCell Tech)
[0248] 5) DMH-1 (1206711-16-1 Tocris)
[0249] Muscle Media 1 Salmon Adapted (MS1)
[0250] 1) DMEM / F12
[0251] 2) FBS
[0252] 3) 2-mercaptoethanol
[0253] 4) Non-essential amino acids
[0254] 5) Sodium Pyruvate
[0255] 6) IGF
[0256] 7) HGF
[0257] 8) Salmon bFGF
[0258]
[0259] 1) DMEM / F12
[0260] 2) Knockout Serum
[0261] 3) 2-mercaptoethanol
[0262] 4) Non-essential amino acids
[0263] 5) Sodium Pyruvate
[0264] 6) IGF
[0265] 7) HGF
[0266] 8) Human bFGF
[0267]
[0268] 1) DMEM / F12
[0269] 2) Knockout serum
[0270] 3) IGF
[0271] 4) HGF
[0272] Protocol
[0273] 1 x 105progenitor cells were seeded into each well of a 6-well plate and subsequently incubated in Salmon ED media for 24 hours post-seeding.
[0274] The culture medium was subsequently changed from the Salmon ED medium to the PSM medium, and the progenitor cells of mesodermal lineage were cultured for 48 hours to undergo initial induction using CHIR99021 (GSK-3) inhibitor, SB431542 (TGF[3-R) inhibitor, DMH1 (BMP) inhibitor, and salmon FGF.
[0275] On Day 2, the culture medium was changed from the PSM medium to 1) MS1 or 2) MN1 medium. The progenitor cells were differentiated into mature muscle cells when cultured for 4 days in the presence of hepatocyte growth factor (HGF), insulin-like growth factor (IGF), and either salmon or human FGF.
[0276] On Day 6, the culture medium was changed from the MS1 or MN1 medium to the MS2 or MN2 medium, respectively. The progenitor cells were subsequently maintained in the MS2 or MN2 medium until Day 15.
[0277] Alternatively, post-seeding, the culture medium was changed from the Salmon ED medium to a serum-reduced medium (Salmon ED medium supplemented only with 2% FBS) or a serum starvation medium (Salmon ED medium with no FBS supplemented, i.e. , feeding was terminated upon reaching confluency). The cells were kept in culture for a further 7-10 days.
[0278] The cells were collected, and total RNA was extracted using the Rneasy Plus kit (74134 Qiagen), and cDNA was synthesised using a DNA Synthesis Kit. The cDNA was subsequently quantified using qPCR. The AACt method was used to calculate the relative expression of the genes in the samples. Gene expression was normalised to an endogenous control, Ubiquitin-conjugating enzyme E2 L3 (UB2L3), and the relative expression of the genes in comparison to the control was calculated.
[0279] Resu / ts
[0280] The gene expression of muscle marker genes MyoD1, MyoG and Tnn3a was measured and compared between the following groups:
[0281] 1) ASK cell line;
[0282] 2) Undifferentiated progenitor cells of mesodermal lineage;
[0283] 3) Condition 1 (cells were cultured in the media sequence of PSM, MS1 and MS2); 4) Condition 2 (cells were cultured in the media sequence of PSM, MN1 and MN2); 5) Condition 3 (cells were cultured in basal medium supplemented with 2% FBS);
[0284] and
[0285] 6) Condition 4 (cells were cultured in basal medium only).
[0286] As shown in Figures 9A - 9C, relative gene expression of muscle marker genes MyoD1 , MyoG and Tnn3a was measured using qPCR. Compared to the ASK cell line and the undifferentiated progenitor cells, MyoD1 expression was significantly upregulated in cells differentiated in Conditions 1 and 2. On the other hand, no significant difference was observed in cells differentiated in Conditions 3 and 4, when compared to either ASK cells or undifferentiated progenitor cells (see Fig. 9A). It was also observed that muscle cells differentiated using Condition 1 expressed the highest levels of MyoD1.
[0287] MyoG expression was significantly upregulated in all muscle differentiation conditions when compared ASK cells and undifferentiated progenitor cells. However, it is clear from Figure 9B that muscle cells differentiated using Condition 1 demonstrated the highest level of MyoG expression.
[0288] As shown in Figure 9C, Tnnt3a expression was significantly upregulated in all muscle differentiated conditions in comparison to ASK cells and undifferentiated progenitor cells. Notably, Tnnt3a expression was significantly higher in muscle cells differentiated using Condition 2 when compared to all other conditions.
[0289] In summary, the muscle marker genes were highly expressed in differentiated cells prepared using Conditions 1 and 2 when compared to other conditions.
[0290] Example 11 - Differentiated muscle cells exhibit a mature muscle phenotype
[0291] The protein expression of muscle differentiation markers myosin heavy chain (MHC) and sarcomeric a-actinin (SAA) in muscle cells differentiated from the progenitor cells of Example 1 was measured and compared between the following groups:
[0292] 1 ) Condition 1 (cells were cultured in the media sequence of PSM, MS1 and MS2); 2) Condition 2 (cells were cultured in the media sequence of PSM, MN1 and MN2);
[0293] and
[0294] 3) Condition 3 (cells were cultured in basal medium supplemented with 2% FBS).
[0295] Figure 10 demonstrates that on Day 15, Atlantic salmon muscle cells differentiated using Condition 1 exhibited strong and uniform MHC immunoreactivity, indicating robust protein expression of this late-stage myogenic marker. Muscle cells differentiated under Condition 3 also displayed positive MHC staining on Day 15. However, it was observed that the staining intensity and cell density in Condition 3 was lower in comparison to Conditions 1 and 2.
[0296] As shown in Figure 11, muscle cells differentiated using Condition 1 exhibited robust sarcomere organisation and strong SAA immunoreactivity by Day 15. Similarly, muscle cells differentiated using Condition 2 exhibited well-defined SAA staining, confirming successful myogenic differentiation. Muscle cells differentiated under Condition 3 exhibited positive SAA immunoreactivity. However, the signal intensity appeared lower when compared to Conditions 1 and 2.
[0297] In summary, cells differentiated in Conditions 1 and 2 advantageously demonstrated high levels of MHC and SAA protein expression when compared to Condition 3, indicating successful differentiation into muscle cells.
[0298] Example 12 - Tissue generation for salmon meat cultivation
[0299] In order to promote tissue development, the salmon myocytes, optionally with a plurality of other cell types, e.g. adipocytes, are co-cultured inside a 3D scaffold that mimics their natural environment.
[0300] The scaffold can be composed of either a hydrogel, a macroporous, sponge-like biomaterial or their combination. While the macroporous biomaterial can provide the macrostructure and mechanical support, the hydrogel can provide cells with an elastic 3D microenvironment. To some extent, scaffolds should recapitulate the different layers of the skeletal muscle connective tissue. The macroporous biomaterial should recapitulate the mechanical properties of the perimysium, the hardened connective tissue that surrounds the fascicles, while the hydrogel inside the pores should mimic the endomysium.
[0301] Polymers that degrade during the tissue culture period can be applied, keeping in mind disposal methods of the degraded molecule or their continued presence. The degradation kinetics of such polymers can be tuned using enzymes or by incorporating weak points inside the polymer structure (Keeney et al., 2012). Traditionally, scaffolds are designed to degrade into safe biomolecules which can be assimilated into the patient's metabolic pathways. For meat cultivation purposes, scaffolds are composed of biopolymers designed to degrade into molecules with favourable organoleptic properties. This can be achieved by judicious polymer selection, monomer chemistry, and chemical modification of the scaffold. There are many edible polymers, including hydrocolloids, polypeptides, lipids, synthetic polymers and composite polymers. Comprehensive reviews of the role of biomaterials in human skeletal muscle tissue engineering have been published, with emphasis on polymers used for scaffold fabrication (Keeney et al., 2012; Qazi et al., 2015). The concepts behind their fabrication and design, with the proper selection of flavourenhancing biomaterials, can be used to generate novel hydrogels and scaffolds for meat cultivation purposes.
[0302] Sequence Listing
[0303] SEQ ID NO:1 (Myf5 Forward Primer)
[0304] CTCCGACAGCATGGTTGACT
[0305] SEQ ID NO:2 (Myf5 Reverse Primer)
[0306] ACTATGTTAGACAGGCGGGC
[0307] SEQ ID NO:3 (TMP1 Forward Primer)
[0308] ATCGACGACTTGGAAGATGAGTT
[0309] SEQ ID NO:4 (TMP1 Reverse Primer)
[0310] AGGCGTCTTTGATGAGGTGTAA
[0311] SEQ ID NO:5 (Actal Forward Primer)
[0312] CCTAATGGTTGTCAGGAGACGAA
[0313] SEQ ID N0:6 (Actal Reverse Primer)
[0314] ACATCTTGGTGGGTTCTGGTTT SEQ ID NO:7 (VWF Forward Primer) CAACCCCAAGAGAGTGCGTT
[0315] SEQ ID NO:8 (VWF Reverse Primer) AACGACAGAACCGCAGGAAG
[0316] SEQ ID NO:9 (Pecam Forward Primer) GTGCTGCGCTACAATTCCAA
[0317] SEQ ID NO: 10 (Pecam Reverse Primer) ATCCACTCCAACTTCGGGC
[0318] SEQ ID NO: 11 (KDR Forward Primer) GAGAGTGAACGTCAGTGCGA
[0319] SEQ ID NO:12 (KDR Reverse Primer) TCAGAATCACACCAGAGCCG
[0320] SEQ ID NO: 13 (UB2L3 Forward Primer) GGAGGCTGCACAAGGAACTC
[0321] SEQ ID NO: 14 (UB2L3 Reverse Primer) CTCGATCCTGAACGCACCTT Citations
[0322] 1. Macqueen DJ, Robb DH, Olsen T, Melstveit L, Paxton CG, Johnston IA.
[0323] Temperature until the 'eyed stage' of embryogenesis programmes the growth trajectory and muscle phenotype of adult Atlantic salmon. Biol Lett. 2008 Jun 23;4(3):294-8. doi: 10.1098 / rsbl.2007.0620. PMID: 18348956; PMCID: PMC2610038.
[0324] 2. Musialak LA, Finstad B, Brathen KE, Kjorsvik W. Embryonic development and sensitive stages of Atlantic salmon (Salmo salar) eggs. Aquaculture 2023 Oct 27;579:740281. https: / / doi.Org / 10.1016 / j.aquaculture.2023.740281.
Claims
Claims1. A method of deriving and maintaining one or more progenitor cells of the mesodermal lineage from a fertilised salmonid or salmonoid ovum, the method comprising:i) disrupting or dissociating the fertilised ovum at the eyed-stage of embryonic development to isolate one or more progenitor cells; andii) culturing the one or more isolated progenitor cells in a culture vessel.
2. A method according to claim 1, wherein the fertilised salmonid or salmonoid ovum is derived from a fish of Salmo genus within the Salmonidae family.
3. A method according to claim 1 or claim 2, wherein the fish is an Atlantic salmon (Salmo salar).
4. A method according to any preceding claim, wherein the one or more progenitor cells are incubated at temperatures between 18-25°C.
5. A method according to any preceding claim, wherein the one or more progenitor cells are incubated at 2-8% CO2.
6. A method according to any preceding claim, wherein the one or more progenitor cells are seeded on a vitronectin or a fibronectin substrate.
7. A method according to claim 6, wherein the vitronectin substrate is present at a concentration of 0.1 -1.Opg / cm28. A method according to any preceding claim, wherein the progenitor cells are cultured in the presence of fibroblast growth factor (FGF).
9. A method according to claim 8, wherein the FGF is salmon FGF.
10. A method according to any preceding claim, wherein the progenitor cells are isolated from eyed-stage salmonid or salmonoid embryos at 85-156 days postfertilisation when incubated at 2°C.
11. A method according to any preceding claim, wherein the progenitor cells exhibit a doubling time of 45-65 hours.
12. A method according to any preceding claim, wherein the progenitor cells express increased levels of muscle progenitor marker Myf5 compared to commercially available salmonid cell lines, preferably at least a 1000-fold increase compared to the ASK cell line (e.g., after 30 passages).
13. A method according to any preceding claim, wherein the progenitor cells maintain self-renewal capabilities through at least 50 passages.
14. A method according to any preceding claim, wherein the progenitor cells do not express endothelial markers VWF, Pecam and KDR.
15. A method according to any preceding claim, wherein the progenitor cells are capable of differentiating into muscle cells that express myosin heavy chain (MHC) and sarcomeric a-actinin (SAA).
16. A method according to any preceding claim, wherein the progenitor cells are cultured in a food-grade growth medium suitable for use in meat cultivation.
17. A method according to any preceding claim, wherein the progenitor cells exhibit reduced expression of muscle markers TMP1 and Actal in long-term culture compared to earlier passages.
18. A method of producing cultivated meat comprising:a) deriving and maintaining progenitor cells of mesodermal lineage according to any of claims 1-17;b) differentiating the progenitor cells into one or more cell types; andc) using the differentiated cells as ingredients to generate a cultivated meat product.
19. A method according to claim 18, wherein the differentiated cells are myocytes.
20. A method according to claim 18 or 19, wherein the differentiation is performed using a growth medium comprising one or more or all of DMEM / F-12, foetal bovine serum, 2-mercaptoethanol, non-essential amino acids, sodium pyruvate, insulin-like growth factor, hepatocyte growth factor and fibroblast growth factor.
21. Progenitor cells of mesodermal lineage derived from eyed-stage salmonid or salmonoid embryos obtainable by the method of any of claims 1 -17.
22. Progenitor cells according to claim 21, wherein the cells express increased levels of muscle progenitor markers and reduced levels of muscle markers in longterm culture.
23. A cultivated meat product comprising progenitor cells according to claim 21 or 22, or derivatives thereof.
24. A cultivated meat product according to claim 23, wherein the product is cultivated salmonid or salmonoid meat.
25. Use of progenitor cells according to claim 21 or 22 for the production of cultivated meat products that meet FDA or EFSA safety requirements for cultured cells in the context of cultured meat.
Citation Information
Patent Citations
Ex VIVO meat production
WO2018227016A1
Synthetic food compositions
WO2020123876A1
Compositions and methods for culturing cells of aquatic species
WO2024134658A1