Methods and materials for overexpressing and using bone morphogenic proteins
Engineering mesenchymal stem cells to produce BMP2 and BMP7-containing EVs and using recombinant mcDNAs addresses the limitations of rhBMP2, enhancing bone healing by improving calcium deposition and osteoblast differentiation, thus promoting effective bone regeneration.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- MAYO FOUNDATION FOR MEDICAL EDUCATION & RESEARCH
- Filing Date
- 2025-11-11
- Publication Date
- 2026-05-21
AI Technical Summary
Existing bone healing therapies, such as rhBMP2, face challenges with low quality bone formation and adverse effects like inflammation and brittleness, limiting their effectiveness in treating bone defects.
Engineering mesenchymal stem cells to produce extracellular vesicles (EVs) containing BMP2 and/or BMP7, which are used to stimulate bone formation, and using recombinant minicircle DNAs to overexpress BMP2 or BMP7, enhancing bone defect treatment efficacy.
The engineered EVs and mcDNAs effectively increase calcium deposition and osteoblast differentiation, promoting bone regeneration comparable to rhBMP2, while reducing adverse effects, as demonstrated in rat calvarial defect models.
Smart Images

Figure IMGF000029_0001_TABLE 
Figure IMGF000031_0001_TABLE 
Figure IMGF000032_0001_TABLE
Abstract
Description
[0001] Attorney Docket No. 07039-2346WO1
[0002] 2024-506
[0003] METHODS AND MATERIALS FOR OVEREXPRESSING AND USING BONE MORPHOGENIC PROTEINS
[0004] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority from U.S. Provisional Application Serial No. 63 / 720.501, filed November 14, 2024. The disclosure of the prior application is considered part of (and is incorporated by reference in) the disclosure of this application.
[0005] TECHNICAL FIELD
[0006] This document relates to methods and materials for making and using extracellular vesicles (EVs) engineered to include BMP2 or BMP2 in combination with BMP7, and also to methods and materials for making and using minicircle DNAs (also referred to as mcDNAs) to overexpress BMP2 or BMP2 in combination with BMP7. For example, this document relates to methods and materials for generating EVs that include BMP2 or BMP2 and BMP7, methods and materials for generating mcDNAs that encode BMP2 or BMP2 and BMP7, and methods and materials for using such EVs and / or such mcDNAs to induce bone formation.
[0007] SEQUENCE LISTING
[0008] This application contains a Sequence Listing that has been submitted electronically as an XML file named “07039-2346WO1.XML.” The XML file, created on November 10, 2025, is 42,552 bytes in size. The material in the XML file is hereby incorporated by reference in its entirety.
[0009] BACKGROUND
[0010] Impaired bone healing (e.g., after a traumatic break or a surgical procedure in which bone is broken) impacts hundreds of thousands of patients w orldwide on an annual basis. Bone morphogenetic protein 2 (rhBMP2) therapy has been used in attempts to improve healing by promoting the formation of new bone tissue, but rhBMP2 therapy is impeded by low quality of the resulting bone and by adverse effects of the therapy, such as inflammation, swelling, and brittle bone formation. Attorney Docket No. 07039-2346WO1
[0011] 2024-506
[0012] SUMMARY
[0013] This document provides methods and materials that can be used to treat mammals having bone defects. For example, this document provides cells (e.g., mesenchymal stem cells) engineered to express one or more bone morphogenic proteins (e.g., BMP2 and / or BMP7). This document also provides EVs obtained from cells (e.g., mesenchymal stem cells) engineered to express one or more BMPs (e.g., BMP2 or BMP2 and BMP7), such that the EVs include the one or more BMPs. In addition, this document provides compositions containing EVs obtained from mesenchymal cells engineered to express one or more BMPs (e.g., BMP2 or BMP2 and BMP7), such that the EVs include the one or more BMPs. This document also provides recombinant mcDNAs encoding one or more BMPs (e.g., BMP2 or BMP2 and BMP7). Further, this document provides methods for using compositions containing EVs that include one or more BMPs (e.g., BMP2 or BMP2 and BMP7) and / or compositions containing recombinant mcDNAs that encode one or more BMPs (e.g., BMP2 or BMP2 and BMP7) to treat mammals having bone defects.
[0014] As demonstrated herein, mesenchymal stem cells (MSCs) can be engineered to produce EVs that include BMP2 or BMP2 and BMP7 (referred to herein as BMP2-EV and BMP2n-EV), which can provide an alternative means of stimulating bone formation. BMP2-EVs and BMP2n-EVs can be used to increase calcium deposition and alkaline phosphatase activity in mouse pre-osteoblast cells (MC3T3-E1) cells and can be used to increase osterix, RUNX2, osteocalcin, and osteopontin indicated osteoblast differentiation. BMP2n-EVs also can be used to induce SMAD phosphorylation and calcium deposition, which can be inhibited by DMH1 (a BMP I receptor inhibitor), thereby demonstrating BMP receptor dependence. BMP2 and BMP7 EV encapsulation can be confirmed with preserved potency following treatment w ith a BMP antagonist (e.g., Noggin). Further, application of BMP2 / 7-EVs in a rat calvarial defect model can demonstrate enhanced bone formation on micro-computed tomography and histopathologic analysis, comparable to rhBMP2. The BMP2n-EV mediated bone formation described herein demonstrated the ability of EVs to deliver BMPs into the body. mcDNAs that encoding one or more BMPs can be transfected into mesenchymal stem cells (MSCs) to induce MSCs differentiation (e.g., via calcium deposition and mineralization).
[0015] In a first aspect, this document provides a mammalian mesenchymal stem cell including exogenous nucleic acid, where the exogenous nucleic acid includes: (a) a Attorney Docket No. 07039-2346WO1
[0016] 2024-506
[0017] nucleotide sequence encoding a mammalian bone morphogenic protein 2 (BMP2) polypeptide, or (b) a nucleotide sequence encoding a mammalian BMP2 polypeptide, a bone morphogenic protein 7 (BMP7) polypeptide, and a cleavable linker located between the BMP2 polypeptide and the BMP7 polypeptide, where the nucleotide sequence of (a) or (b) is operably linked to a promoter sequence. The nucleotide sequence encoding the BMP2 polypeptide can include the nucleotide sequence set forth in SEQ ID NO: 1. The nucleotide sequence encoding the BMP2 polypeptide can include a nucleotide sequence having at least 95% sequence identity to SEQ ID NO: 1. The nucleotide sequence encoding the BMP7 polypeptide can include the nucleotide sequence set forth in SEQ ID NO:2. The nucleotide sequence encoding the BMP7 polypeptide can include a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:2. The BMP2 polypeptide can include the amino acid sequence set forth in SEQ ID NO:30. The BMP2 polypeptide can include an amino acid sequence having at least 95% sequence identity to SEQ ID NO:30. The BMP7 polypeptide can include the amino acid sequence set forth in SEQ ID NO:31. The BMP7 polypeptide can include an amino acid sequence having at least 95% sequence identity to SEQ ID NO:31. The cleavable linker can be a T2A linker. The exogenous nucleic acid can include the nucleotide sequence of (a). The exogenous nucleic acid can include the nucleotide sequence of (b). The exogenous nucleic acid can form part of a lentivirus construct.
[0018] In another aspect, this document features an EV from a mammalian mesenchymal stem cell, where the mammalian mesenchymal stem cell includes exogenous nucleic acid, and where the exogenous nucleic acid includes: (a) a nucleotide sequence encoding a mammalian BMP2 polypeptide, or (b) a nucleotide sequence encoding a mammalian BMP2 polypeptide, a BMP7 polypeptide, and a cleavable linker, where the nucleotide sequence of (a) or (b) is operably linked to a promoter sequence, and where the EV includes (i) the BMP2 polypeptide or (ii) the BMP2 polypeptide and the BMP7 polypeptide. The nucleotide sequence encoding the BMP2 polypeptide can include the nucleotide sequence set forth in SEQ ID NO: 1. The nucleotide sequence encoding the BMP2 polypeptide can include a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:1. The nucleotide sequence encoding the BMP7 polypeptide can include the nucleotide sequence set forth in SEQ ID NO:2. The nucleotide sequence encoding the BMP7 polypeptide can include a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:2. The BMP2 polypeptide can include the amino acid Attorney Docket No. 07039-2346WO1
[0019] 2024-506
[0020] sequence set forth in SEQ ID NO:30. The BMP2 polypeptide can include an amino acid sequence having at least 95% sequence identity to SEQ ID NO:30. The BMP7 polypeptide can include the amino acid sequence set forth in SEQ ID NO:31. The BMP7 polypeptide can include an amino acid sequence having at least 95% sequence identity to SEQ ID NO:31. The cleavable linker can be a T2A linker. The exogenous nucleic acid can include the nucleotide sequence of (a). The exogenous nucleic acid can include the nucleotide sequence of (b). The exogenous nucleic acid can form part of a lentivirus construct.
[0021] In another aspect, this document features an EV from a mammalian mesenchymal stem cell, where the EV includes: (a) an exogenous BMP2 polypeptide, or (b) an exogenous BMP2 polypeptide and an exogenous BMP7 polypeptide. The BMP2 polypeptide can include the amino acid sequence set forth in SEQ ID NQ:30. The BMP2 polypeptide can include an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 30. The BMP7 polypeptide can include the amino acid sequence set forth in SEQ ID NO:31. The BMP7 polypeptide can include an amino acid sequence having at least 95% sequence identity to SEQ ID NO:31. The EV can include the BMP2 polypeptide but does not contain the BMP7 polypeptide. The EV can include both the BMP2 polypeptide and the BMP7 polypeptide.
[0022] In another aspect, this document features a composition containing a pharmaceutically acceptable carrier and extracellular vesicles (EVs) from a mammalian mesenchymal stem cell, where the EVs include: (a) an exogenous BMP2 polypeptide, or (b) an exogenous BMP2 polypeptide and an exogenous BMP7 polypeptide. The BMP2 polypeptide can include the amino acid sequence set forth in SEQ ID NO:30. The BMP2 polypeptide can include an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 30. The BMP7 polypeptide can include the amino acid sequence set forth in SEQ ID NO:31. The BMP7 polypeptide can include an amino acid sequence having at least 95% sequence identity to SEQ ID NO:31. The composition can further include collagen. The EVs include the BMP2 polypeptide but do not contain the BMP7 polypeptide. The EVs can include both the BMP2 polypeptide and the BMP7 polypeptide.
[0023] In another aspect, this document features a method for treating a bone defect in a mammal, where the method include, or consists essentially of, contacting the bone defect with a composition including a pharmaceutically acceptable carrier and EVs from a Attorney Docket No. 07039-2346WO1
[0024] 2024-506
[0025] mammalian mesenchymal stem cell, where the EVs include: (a) an exogenous BMP2 polypeptide, or (b) an exogenous BMP2 polypeptide and an exogenous BMP7 polypeptide. The mammal can be a human. The mammal can be a rat, a mouse, a rabbit, a dog, a cat, a horse, a cow, a goat, a sheep, a pig, or a non-human primate. The bone defect can be selected from the group consisting of traumatic breaks, non-union fractures, loose joints or bone prostheses, spinal fusion, vertebral compression fractures, and radiation osteonecrosis. The BMP2 polypeptide can include the amino acid sequence set forth in SEQ ID NO: 30. The BMP2 polypeptide can include an amino acid sequence having at least 95% sequence identity to SEQ ID NO:30. The BMP7 polypeptide can include the amino acid sequence set forth in SEQ ID NO:31. The BMP7 polypeptide can include an amino acid sequence having at least 95% sequence identity to SEQ ID NO:31. The EVs can include the BMP2 polypeptide but do not contain the BMP7 polypeptide. The EVs can include both the BMP2 polypeptide and the BMP7 polypeptide. The composition can further include collagen. The contacting can include applying, to the bone defect, the composition in an amount that contains about 1 x IO10to about 1 x 1011of the EVs per mL.
[0026] This document also features a recombinant minicircle DNA containing a nucleotide sequence encoding a BMP polypeptide. The BMP polypeptide can be a BMP2 polypeptide. The nucleotide sequence encoding the BMP2 polypeptide can include the nucleotide sequence set forth in SEQ ID NO: 1. The nucleotide sequence encoding the BMP2 polypeptide can include a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:1. The BMP polypeptide can be a BMP7 polypeptide. The nucleotide sequence encoding the BMP7 polypeptide can include the nucleotide sequence set forth in SEQ ID NO:2. The nucleotide sequence encoding the BMP7 polypeptide can include a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:2.
[0027] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although methods and materials similar or equivalent to those described herein can be used to practice the invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. Attorney Docket No. 07039-2346WO1
[0028] 2024-506
[0029] The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims.
[0030] DESCRIPTION OF DRAWINGS FIGS. 1A-1G. Production and characterization of engineered BMP2- and BMP7-EV. FIG. 1A) Schematic of lentiviral vector with BMP2 (top) or BMP2 and BMP7 (bottom) joined with a T2A linker. Acronyms are as follows: LTR (Long Terminal Repeat), (viral packaging), RRE (Rev response element). cPPT (central polypurine tract), WPRE (post-regulatory element), AU3 (U3 deletion in 3’ LTR). FIG. IB) Realtime quantitative reverse-transcription PCR showed the ACT ratios of BMP2 or BMP7 mRNAto GAPDH mRNA in MSCs transfected with either LV-BMP2 or LV-BMP2 / 7 plasmids. Statistical significance was determined by one-way ANOVA with Tukey post hoc analysis (n = 3). FIG. 1C) Western blot analysis of MSCs that were untransfected or transfected with LV-BMP2 or LV-BMP2 / 7. Actin was used as a loading control. FIG. ID) NanoSight analysis demonstrating mean size profile (± SD) of extracellular vesicles isolated from LV-BMP2 or LV-BMP2 / 7 transfected MSCs. FIG. IE) Transmission electron microscopy (TEM) demonstrating the size profile of BMP2-EV or BMP2 / 7-EV. Scale bar 200 nm. FIG. IF) Western blot analysis of small EVs collected from MSCs that were untransfected or transfected with LV-BMP2 or LV-BMP2 / 7. Samples w ere probed for small extracellular vesicle markers CD63, flotillin, and CD9. FIG. 1G) Western blot analysis of small extracellular vesicles collected from MSCs that were untransfected or transfected with LV-BMP2 or LV-BMP2 / 7. Samples were probed for BMP2 and BMP7 with actin as a loading control.
[0031] FIGS. 2A-2D. In vitro characterization of BMP2 and BMP2 / 7-EV and their effects on calcification and alkaline phosphatase activity. FIG. 2A: Alizarin red assay- performed on MC3T3-E1 cells treated with MSC-EV. BMP2-EV. or BMP2 / 7-EV for 16 days versus the untreated control. Zoomed in images of each well are shown. Scale bar 100 pm. FIG. 2B: Alkaline phosphatase activity- assay w as performed on MC3T3-E1 cells treated with MSC-EV, BMP2-EV, or BMP2 / 7-EV for 10 days versus untreated control. FIG. 2C: Quantification (mean ± SD at optical density 405 nm) of alizarin red assay (FIG. 2A) on day 16. Statistical significance was determined by one-way ANOVA Attorney Docket No. 07039-2346WO1
[0032] 2024-506
[0033] with Tukey post hoc analysis (n = 6). FIG. 2D: Quantification (mean normalized to mg protein ± SD) of alkaline phosphatase activity (FIG. 2B) at 3. 6, 10, or 14 days posttreatment. Statistical significance was determined by two-way ANOVA with Tukey post hoc analysis. Asterisks indicating statistical significance are shown at each time point, with the top asterisks indicating BMP2 / 7, the middle asterisks indicating BMP2-EV, and the bottom asterisks indicating MSC-EV (n = 5).
[0034] FIGS. 3A-3E. BMP2 and BMP2 / 7-EV induction of osteogenic gene expression in MC3T3-E1 cells. FIG. 3A: Schematic demonstrating the differentiation of a mesenchymal stem cell to osteoprogenitor, immature osteoblast, and ending in mature osteoblast. Factors implicated in differentiation events are labeled as: ALP, alkaline phosphatase; BMP. bone morphogenetic protein; FGF, fibroblast growth factor: PTH, parathyroid hormone; OCN, osteocalcin; OPN, osteopontin; SP7, osterix; VEGF, vascular endothelial grow th factor. FIGS. 3B-3E: RT-qPCR quantification of (mean fold change ± SD) RUNX2 (FIG. 3B), SP7 (FIG. 3C), OCN (FIG. 3D), and OPN (FIG. 3E) for MC3T3-E1 cells treated with MSC-EV, BMP2-EV, or BMP2 / 7-EV. and compared to the untreated control. Statistical significance compared to the control was determined by two-way ANOVA with Dunnett post hoc analysis. Statistical significance for each group matches the color of the line (n = 4).
[0035] FIGS. 4A-4G. Effects of BMP2 / 7-EV on the recipient cells is mediated by auto / paracrine release of EV supplemented BMP2 / 7. FIG. 4A: Immunocytochemistry of MC3T3-E1 cells following overnight serum deprivation and 6 hours treatment with the control (serum free medium), rhBMP2 (100 ng / ml), BMP2 / 7-EV (6.67 e9 particles / mL), noggin (500 ng / mL) treated BMP2 / 7-EV (6.67e9 particles / mL). or BMP2 / 7-EV (6.67e9 particles / mL) with DMH1 (1 pM). Cells were stained with DAPI (which fluoresced blue) to indicate nuclei and with anti-pSMAD (which fluoresced red); scale bar 20 pm. FIG.
[0036] 4B: Quantification (mean ± SD) of pSMAD signal (integrated density' per nuclei) for FIG. 4A. Statistical significance w as determined by one-way ANOVA with Tukey post hoc analysis (n = 4). FIG. 4C: Alizarin red assay was performed on MC3T3-E1 cells treated with BMP2 / 7-EV and 0-10 pM DHM1 on day 16. Entire plates (top row) and representative microscopy images of each w ell (bottom row ) are shown with scale bar 100 pm. FIG. 4D: Quantification (mean ± SD at optical density' 405 nm) of alizarin red assay is shown for FIG. 4C. Statistical significance was determined by one-way ANOVA with Dunnett post hoc analysis (n = 4). FIG. 4E: Alizarin red assay was performed on Attorney Docket No. 07039-2346WO1
[0037] 2024-506
[0038] MC3T3-E1 cells treated with BMP2 / 7-EV and 0-500 ng / mL noggin (NOG) on day 16. Entire plate (top row) and representative microscopy images of each well (bottom row) are shown with scale bar 100 pm. FIG. 4F: Quantification (mean ± SD at optical density 405 nm) of alizarin red assay is shown for FIG. 4E. Statistical significance was determined by one-way ANOVA with Dunnett post hoc analysis (n = 4). FIG. 4G:
[0039] Schematic illustrating a mechanism of BMP2 / 7-EV induced SMAD phosphorylation and downstream effects.
[0040] FIGS. 5A-5E. BMP2 / 7-EV increased bone regrowth in rat calvarial defects. FIG.
[0041] 5A: Scanning electron microscopy demonstrating collagen fibers and BMP2 / 7-EV coated collagen fibers. Scale bar 1 pm (top) or 100 nm (bottom). FIG. 5B: Schematic depicting a rat calvarial skull defect and the placement of a collagen gel disk with respective treatments within the defect. FIG. 5C: Representative micro-CT rendering images showing skull defects at 30, 45, or 75 days post-treatment with collagen (vehicle), rhBMP2 / collagen, or BMP2 / 7-EV / collagen. Circles depict approximate locations of the 5 mm surgical defects. FIG. 5D: Micro-CT depiction of bone thickness at 30, 45, or 75 days post-treatment with collagen (vehicle), rhBMP2 / collagen, or BMP2 / 7-EV / collagen.
[0042] FIG. 5E: Mean ± SEM of micro-CT measurements of bone volume / total volume (BV / TV%) or bone area (%) at 30, 45, or 75 days post-treatment with collagen (vehicle), rhBMP2 / collagen, or BMP2 / 7-EV / collagen. Bone area quantification graphs show breaks in the y-axis at 75%. Statistical significance was determined by one-way ANOVA with Tukey post hoc analysis. (Collagen and BMP2 / 7-EV groups n = 6, rhBMP2 n = 5.)
[0043] FIGS. 6A-6F. H&E staining for histologic analysis of rodent calvarial defects at 30 and 75 days. FIG. 6A: Representative images of a healthy bone and bone treated with collagen, rhBMP2 / collagen, or BMP2 / 7-EV / collagen at 30 or 75 days post-treatment. Scale bar 100 pm. FIGS. 6B-6C: Variation in bone thickness (mean ± SEM) at 30 days (FIG. 6B) or 75 days (FIG. 6C) post-treatment w ith collagen, rhBMP2 / collagen, or BMP2 / 7-EV / collagen. The contralateral healthy bone on each calvarium was used as a control. At 30 days, healthy control n = 10, for collagen and BMP2 / 7-EV n = 3, for rhBMP2 n = 4. At 75 days, healthy control n = 17, for collagen and BMP2 / 7-EV n = 6, for rhBMP2 n = 5. FIG. 6D: Marrow area relative to total bone area (mean ± SEM) in lesion at 75 days post-treatment with collagen, rhBMP2 / collagen, or BMP2 / 7-EV / collagen. For healthy control n = 17. for collagen and BMP2 / 7-EV n = 6, for rhBMP2 n = 5. FIGS. 6E-6F: Bone thickness (mean ± SEM) at 30 days (FIG. 6E) or 75 days Attorney Docket No. 07039-2346WO1
[0044] 2024-506
[0045] (FIG. 6F) post-treatment with collagen, rhBMP2 / collagen, or BMP2 / 7 -EV / collagen. At 30 days, healthy control n = 10, for collagen and BMP2 / 7-EV n = 3, for rhBMP2 n = 4. At 75 days, healthy control n = 17, for collagen and BMP2 / 7-EV n = 6, for rhBMP2 n = 5. Statistical significance was determined by one-way ANOVA with Tukey post hoc analysis (FIGS. 6B-6F).
[0046] FIGS. 7A-7E. Sequences of codon-optimized BMP2, BMP7, TGFbl. BMP4. and Activin A, and encoded polypeptides. DNA sequences as determined by Sanger sequencing for codon-optimized BMP2 (SEQ ID NO: 1; FIG. 7A) and BMP7 (SEQ ID NO:2; FIG. 7B) were cloned into lentiviral vectors. BMP2 polypeptide, SEQ ID NO:30 (FIG. 7A); BMP7 polypeptide, SEQ ID NO: 31 (FIG. 7B). FIG. 7C provides representative nucleic acid and amino acid sequences for TGFbl (SEQ ID NOS:32 and 33). FIG. 7D provides representative nucleic acid and amino acid sequences for BMP4 (SEQ ID NOS:34 and 35). FIG. 7E provides representative nucleic acid and amino acid sequences for Activin A (SEQ ID NOS:36 and 37).
[0047] FIGS. 8A-8B. Uptake of BMP2 / 7-EV by MC3T3-E1 cells. FIG. 8A: Dil labeled BMP2 / 7-EV at a concentration of 2.2ell particles / mL were applied to MC3T3-E1 cells for 0, 1, 3, 6, 12, or 24 hours. Scale bar 20 pm. FIG. 8B: Mean ± SD of Dil intensity / cell for FIG. 8A. Statistical significance compared to 0 hour was determined by one-way ANOVA with Dunnett post hoc analysis (n = 6).
[0048] FIGS. 9A-9B. Effects of MSC-, BMP2-. and BMP2 / 7-EV on proliferation of MC3T3 cells. FIG. 9A: Representative images of MC3T3 cells at 72 hours post-treatment with media only (control), MSC-EV, BMP2-EV, and BMP2 / 7-EV. Scale bar 400 pm. FIG. 9B: Mean ± SD of MC3T3 proliferation over 72 hours following treatment with media only (control). MSC-EV, BMP2-EV, and BMP2 / 7-EV. Statistical significance was determined by two-way ANOVA with Tukey post hoc analysis (n=3).
[0049] FIGS. 10A-10D. Effects of MSC-EV, BMP2-EV, and BMP2 / 7-EV on MSC calcium deposition and alkaline phosphatase activity; FIG. 10A: Alizarin red assay- performed on MSC treated with MSC-EV, BMP2-EV, or BMP2 / 7-EV for 21 days versus the untreated control. Zoomed in images of each well are shown. Scale bar 100 pm. FIG.
[0050] 10B: Alkaline phosphatase activity- assays were performed on MSC treated with MSC-EV, BMP2-EV, or BMP2 / 7-EV for 10 days versus the untreated control. FIG. 10C:
[0051] Quantification (mean ± SD at optical density- 405 nm) of alizarin red assay (FIG. 9A) at day 21. Statistical significance was determined by one-way ANOVA with Tukey post hoc Attorney Docket No. 07039-2346WO1
[0052] 2024-506
[0053] analysis (n = 3). FIG. 10D: Quantification (mean normalized to mg protein ± SD) of alkaline phosphatase activity (FIG. 9B) at 10 days post-treatment. Statistical significance was determined by two-way ANOVA with Tukey post hoc analysis.
[0054] FIG. 11. Effects of MSC-EV, BMP2-EV, and BMP2 / 7-EV on macrophage polarization. Mouse macrophages (MO phenotype) were treated with LPS (Ml phenotype), IL-4 (M2 phenotype), MSC-EV, BMP2-EV, or BMP2 / 7-EV, and were evaluated by RT-qPCR for Ml marker CD86 or M2 marker Arg-1. Fold change (mean ± SD) is relative to untreated macrophages (MO). Statistical significance was determined by one-way ANOVA w ith Dunnett post hoc analysis compared to either LPS or IL-4 control (n=3).
[0055] FIGS. 12A-12B. show the effects of MSC-EV, BMP2-EV, or BMP2 / 7-EV on HUVEC proliferation. FIG. 12A: Representative images of HUVEC at 48 hour posttreatment with basal growth medium supplemented with PBS (control), MSC-EV, BMP2-EV, or BMP2 / 7-EV. Scale bar 400 pm. FIG. 12B: Quantification (mean ± SD) of HUVEC proliferation over 48 hours following treatment with the control (PBS), MSC-EV, BMP2-EV, and BMP2 / 7-EV. Statistical analysis was determined by two-way ANOVA with Tukey post hoc analysis (n=3).
[0056] FIGS. 13A-13C. Immunohistochemical staining of nuclear pSMAD expression in MC3T3-E1 cells following treatment with MSC-EV, BMP2-EV, and BMP2 / 7-EV FIG.
[0057] 13A: Representative immunocytochemistry images of MC3T3-E1 cells 6 hour posttreatment with the control (serum free medium), MSC-EV (6.67e9 particles / mL), BMP2-EV (6.67e9 particles / mL), or BMP2 / 7-EV (6.67e9 parti cles / mL). Cells were stained with DAPI (which fluoresced blue) to indicate nuclei and with anti-pSMAD (which fluoresced red), and scale bar 20 pm. FIG. 13B: Quantification (mean ± SD) of pSMAD signal (integrated density per nuclei) for FIG. 13A. Statistical significance was determined by Brown-Forsythe and Welch ANOVA with Dunnett T3 post-hoc analysis (n = 10). FIG.
[0058] 13C: Western blot probing of pSMAD in MC3T3-E1 cells that were serum-starved for 24 hours followed by a 6-hour treatment with a serum free medium only (control), MSC-EV, BMP2-EV, and BMP2 / 7-EV. Total SMAD and GAPDH are shown as loading controls.
[0059] FIGS. 14A-14B. Immunohistochemical staining of nuclear pSMAD expression in MC3T3-E1 cells following BMP2 / 7-EV treatment. FIG. 14A: hnmunocytochemistry staining of MC3T3-E1 cells 6 hour post-treatment with control (serum free medium), rhBMP2 (100 ng / mL), BMP2 / 7-EV (6.67e9 particles / mL), or BMP2 / 7-EVs (6.67e9 Attorney Docket No. 07039-2346WO1
[0060] 2024-506
[0061] parti cl es / mL) with noggin (500 ng / mL). Cells were stained with DAPI (which fluoresced blue) to indicate nuclei and with anti-pSMAD (which fluoresced red), scale bar 20 pm.
[0062] FIG. 14B: Quantification (mean ± SD) of pSMAD signal (integrated density per nuclei) for FIG. 14A. Statistical significance was determined by one-way ANOVA with Tukey post hoc analysis, (n > 3)
[0063] FIG. 15. H&E staining of calvarial defects for all rats on day 30. Representative H&E images of bone lesions for each rat at 30 days are shown for collagen, rhBMP2 / collagen, and BMP2 / 7-EV / collagen groups. Scale bar is 500 pm.
[0064] FIG. 16. H&E staining of calvarial defects for all rats on day 75. Representative H&E images of bone lesions for each rat at 75 days are shown for collagen, rhBMP2 / collagen, and BMP2 / 7-EV / collagen groups. Scale bar is 500 pm.
[0065] FIGS. 17A-17B. Toluidine blue staining for histologic analysis of mast cells in rat calvarial skull defects at 30 and 75 days. FIG. 17A: Representative images of healthy bone and bone defects treated with collagen, rhBMP2 / collagen, or BMP2 / 7-EV / collagen at 30 or 75 days post-treatment. Arrow heads indicate mast cells. Scale bar 50 pm. FIG.
[0066] 17B: Number of mast cells (mean per area tissue ± SEM) per 106pm2area at 30 and 75 days post-treatment with either collagen, rhBPM2 / collagen, or BMP2 / 7-EV / collagen. The contralateral healthy bone on each calvarium was used as a control. Statistical significance was determined by one-way ANOVA with Tukey post hoc analysis. At 30 days, healthy control n = 10. for collagen and BMP2 / 7-EV n = 3, for rhBMP2 n = 4. At 75 days, healthy control n = 17, for collagen and BMP2 / 7-EV n = 6, for rhBMP2 n = 5.
[0067] FIGS. 18A-18C. Immunohistochemical staining of mast cell marker CD117 (c-kit) in rat calvarial skull defects at 30 and 75 days. FIG. 18A: Representative images of healthy bone and bone defects treated with collagen, rhBMP2 / collagen. or BMP2 / 7-EV / collagen at 30 or 75 days post-treatment. Arrow heads indicate mast cells. Scale bar 50 pm. FIG. 18B: Number of mast cells (mean per area tissue + / - SEM) per 106pm2area at 30 and 75 days post-treatment with either collagen, rhBPM2 / collagen, or BMP2 / 7-EV / collagen. The contralateral healthy bone on each calvarium was used as a control. Statistical significance was determined by one-way ANOVA with Tukey post hoc analysis. At 30 days, healthy control n = 10, for collagen and BMP2 / 7-EV n = 3, for rhBMP2 n = 4. At 75 days, healthy control n = 17, for collagen and BMP2 / 7-EV n = 6, for rhBMP2 n = 5. Attorney Docket No. 07039-2346WO1
[0068] 2024-506
[0069] FIGS. 19A-19D. Blood vessel formation at 30 days post-treatment. FIG. 19A:
[0070] Representative images of a healthy bone and bone defect treated with collagen. rhBMP2 / collagen, or BMP2 / 7-EV / collagen at 30 post-treatment. Arrow heads indicate blood vessels. Slides were stained with anti-a-smooth muscle actin primary antibody and counter stained with hematoxylin, scale bar 100 pm. FIG. 19B: Quantification (mean ± SEM) of number of blood vessels per bone area (pm2) at 30 days post-treatment. FIG.
[0071] 19C: Quantification (mean ± SEM) of average blood vessels per bone area (pm2) at 30 days post-treatment. FIG. 19D: Quantification (mean ± SEM) of total blood vessels per bone area (pm2) at 30 days post-treatment. For all quantifications, the contralateral healthy bone on each calvarium was used as a control. Statistical significance was determined by one-way ANOVA with Tukey post hoc analysis. Healthy control n = 10. for collagen and BMP2 / 7-EV n = 3, for rhBMP2 n = 4.
[0072] FIGS. 20A-20D. Blood vessel formation at 75 days post-treatment. FIG. 20A:
[0073] Representative images of a healthy bone and bone defect treated with collagen, rhBMP2 / collagen, or BMP2 / 7-EV / collagen at 75 days post-treatment. Arrowheads indicate blood vessels. Scale bar 100 pm. Slides were stained with anti-a-smooth muscle actin primary' antibody and counter stained with hematoxylin; scale bar 100 pm. FIG. 20B: Quantification (mean ± SEM) of number of blood vessels per bone area (pm2) at 75 days post-treatment. FIG. 20C: Quantification (mean ± SEM) of average blood vessels per bone area (pm2) at 75 days post-treatment. FIG. 20D: Quantification (mean ± SEM) of total blood vessels per bone area (pm2) at 75 days post-treatment. For all quantifications, the contralateral healthy bone on each calvarium was used as a control. Statistical significance was determined by one-way ANOVA with Tukey post hoc analysis. Healthy control n = 17. for collagen and BMP2 / 7-EV n = 6, for rhBMP2 n = 5.
[0074] FIGS. 21A-21D. Immunohistochemical staining of endothelial cell marker CD34 in rat calvarial skull defects at 30 days. FIG. 21A: Representative images of healthy bone and bone defects treated with collagen, rhBMP2 / collagen, or BMP2 / 7-EV / collagen at 30 days post-treatment. Arrow heads indicate blood vessels. Scale bar 100 pm. Slides were stained with anti-CD34 primary antibody and counter stained with hematoxylin; scale bar 100 pm. FIG. 21B: Quantification (mean ± SEM) of number of blood vessels per bone area (pm2) at 30 days post-treatment. FIG. 21C: Quantification (mean ± SEM) of average blood vessels per bone area (pm2) at 30 days post-treatment. FIG. 21D: Quantification (mean ± SEM) of total blood vessels per bone area (pm2) at 30 days post-treatment. For Attorney Docket No. 07039-2346WO1
[0075] 2024-506
[0076] all quantifications, the contralateral healthy bone on each calvarium was used as a control. Statistical significance was determined by one-way ANOVA with Tukey post hoc analysis. Healthy control n = 10, for collagen and BMP2 / 7-EV n = 3, for rhBMP2 n = 4.
[0077] FIGS. 22A-22D. Immunohistochemical staining of endothelial cell marker CD34 in rat calvarial skull defects at 75 days. FIG. 22A: Representative images of healthy bone and bone defects treated with collagen, rhBMP2 / collagen. or BMP2 / 7-EV / collagen at 75 days post-treatment. Arrow heads indicate blood vessels. Scale bar 100 pm. Slides were stained with anti-CD34 primary antibody and counter stained with hematoxylin, scale bar 100 pm. FIG. 22B: Quantification (mean ± SEM) of number of blood vessels per bone area (pm2) at 75 days post-treatment. FIG. 22C: Quantification (mean ± SEM) of average blood vessels per bone area (pm2) at 75 days post-treatment. FIG. 22D: Quantification (mean ± SEM) of total blood vessels per bone area (pm2) at 75 days post-treatment. For all quantifications, the contralateral healthy bone on each calvarium was used as a control. Statistical significance was determined by one-way ANOVA with Tukey post hoc analysis. Healthy control n = 17. for collagen and BMP2 / 7-EV n = 6, for rhBMP2 n = 5.
[0078] FIGS. 23A-23D. Expression of BMP2 from mini circle DNA-transfected human mesenchymal stem cells (hMSCs). FIG. 23A: Schematic of a minicircle expression cassette encoding BMP2 (MC-BMP2). FIG. 23B: Real-time quantitative reversetranscriptase PCR (RT-qPCR) results showing expression of BMP2 mRNA in hMSCs transfected with MC-BMP2. FIG. 23C: Calcium deposition evaluated using an alizarin red assay in transfected hMSCs (lower panel) compared with control (upper panel). FIG.
[0079] 23D: Calcium deposition assessed using the alizarin red assay in hMSCs cultured with EVs derived from MC-BMP2 transfected hMSCs (low er panel) compared with whole medium controls (upper panel) or flow-through controls (middle panel).
[0080] DETAILED DESCRIPTION
[0081] This document provides methods and materials for treating mammals having one or more bone defects. For example, this document provides cells (e.g., mesenchymal stem cells, such as human adipose-derived mesenchymal stem cells) engineered to express one or more bone morphogenic proteins (e.g., BMP2 and / or BMP7). This document also provides EVs obtained from cells (e.g., mesenchymal stem cells) engineered to express one or more BMPs (e.g., BMP2 or BMP2 and BMP7), such that the EVs include the one or more BMPs. In some embodiments, this document provides compositions containing Attorney Docket No. 07039-2346WO1
[0082] 2024-506
[0083] EVs obtained from mesenchymal cells engineered to express one or more BMPs (e.g., BMP2 or BMP2 and BMP7), such that the EVs include the one or more BMPs. This document also provides recombinant mcDNAs encoding one or more BMP polypeptides (e.g., BMP2 or BMP2 and BMP7). Further, this document provides methods for using compositions containing EVs that include one or more BMPs (e.g., BMP2 or BMP2 and BMP7) to treat mammals having one or more bone defects, as well as methods for using compositions containing recombinant mcDNAs that encode one or more BMP polypeptides (e.g., BMP2 or BMP2 and BMP7) to treat mammals having one or more bone defects.
[0084] In some cases, this document provides cells (e g., mammalian stem cells such as human adipose-derived mesenchymal stem cells, 293 cells, Chinese hamster ovary (CHO) cells, platelets, or any other cytotype with EV-producing capability that can be engineered to express an exogenous coding sequence) containing exogenous nucleic acid that encodes one or more BMPs.
[0085] The term “nucleic acid” as used herein encompasses both RNA and DNA, including cDNA, genomic DNA, and synthetic (e.g., chemically synthesized) DNA. The nucleic acid can be double-stranded or single-stranded. Where single-stranded, the nucleic acid can be the sense strand or the antisense strand. In addition, nucleic acid can be circular or linear.
[0086] The term “isolated” as used herein with reference to nucleic acid refers to a naturally -occurring nucleic acid that is not immediately contiguous wi th both of the sequences with which it is immediately contiguous (one on the 5’ end and one on the 3’ end) in the naturally -occurring genome of the organism from which it is derived. For example, an isolated nucleic acid can be, without limitation, a recombinant DNA molecule of any length, provided that one of the nucleic acid sequences normally found immediately flanking that recombinant DNA molecule in a naturally-occurring genome is removed or absent. Thus, an isolated nucleic acid includes, without limitation, a recombinant DNA that exists as a separate molecule (e.g.. a cDNA or a genomic DNA fragment produced by PCR or restriction endonuclease treatment) independent of other sequences as well as recombinant DNA that is incorporated into a vector, an autonomously replicating plasmid, a virus (e.g., a retrovirus, adenovirus, or herpes virus), or into the genomic DNA of a prokaryote or eukaryote. In addition, an isolated nucleic Attorney Docket No. 07039-2346WO1
[0087] 2024-506
[0088] acid can include a recombinant DNA molecule that is part of a hybrid or fusion nucleic acid sequence.
[0089] The term '‘isolated’’ as used herein with reference to nucleic acid also includes any non-naturally-occurring nucleic acid since non-naturally-occurring nucleic acid sequences are not found in nature and do not have immediately contiguous sequences in a naturally-occurring genome. For example, non-naturally-occurring nucleic acid such as an engineered nucleic acid is considered to be isolated nucleic acid. Engineered nucleic acid can be made using common molecular cloning or chemical nucleic acid synthesis techniques. Isolated non-naturally-occurring nucleic acid can be independent of other sequences, or incorporated into a vector, an autonomously replicating plasmid, a virus (e.g., a retrovirus, adenovirus, or herpes virus), or the genomic DNA of a prokaryote or eukaryote. In addition, anon-naturally-occurring nucleic acid can include a nucleic acid molecule that is part of a hybrid or fusion nucleic acid sequence. It will be apparent to those of skill in the art that a nucleic acid existing among hundreds to millions of other nucleic acid molecules within, for example, cDNA or genomic libraries, or gel slices containing a genomic DNA restriction digest is not to be considered an isolated nucleic acid.
[0090] Isolated nucleic acid molecules can be produced using standard techniques, including, without limitation, common molecular cloning and chemical nucleic acid synthesis techniques. For example, polymerase chain reaction (PCR) techniques can be used to obtain an isolated nucleic acid containing nucleotide sequence that encodes a BMP polypeptide provided herein. PCR refers to a procedure or technique in which target nucleic acids are enzy matically amplified. Sequence information from the ends of the region of interest or beyond typically is employed to design oligonucleotide primers that are identical in sequence to opposite strands of the template to be amplified. PCR can be used to amplify specific sequences from DNA as well as RNA, including sequences from total genomic DNA or total cellular RNA. Primers ty pically are 14 to 40 nucleotides in length, but can range from 10 nucleotides to hundreds of nucleotides in length. General PCR techniques are descnbed, for example in PCR Primer: A Laboratory Manual, ed. by Dieffenbach and Dveksler, Cold Spring Harbor Laboratory Press, 1995. When using RNA as a source of template, reverse transcriptase can be used to synthesize complementary DNA (cDNA) strands. Ligase chain reaction, strand displacement amplification, self-sustained sequence replication, or nucleic acid sequence-based Attorney Docket No. 07039-2346WO1
[0091] 2024-506
[0092] amplification also can be used to obtain isolated nucleic acids. See, for example, Lewis (1992) Genetic Engineering News 12:1; Guatelli et al. (1990) Proc. Natl. Acad. Sci. USA 87: 1874-1878; and Weiss (1991) Science 254:1292.
[0093] In some cases, a nucleic acid can be contained in a vector. A “vector” is a replicon, such as a plasmid, phage, or cosmid, into which another DNA segment may be inserted so as to bring about the replication of the inserted segment. An “expression vector” is a vector that includes one or more expression control sequences, and an “expression control sequence” (e.g., a promoter) is a DNA or RNA sequence that controls and regulates the transcription and / or translation of another DNA sequence.
[0094] In some cases, vector containing a nucleotide sequence encoding a BMP polypeptide can be a mcDNA vector. mcDNA vectors are non-viral DNA vectors that generally are smaller than traditional expression plasmids. In some cases, given their smaller size, mcDNA vectors can be safer and more efficient to use than traditional plasmids. mcDNA vectors can be produced using any appropriate methods. In some cases, a mcDNA vector can be generated by excising the bacterial backbone from a parental plasmid. For example, a mcDNA vector can be created from a parental plasmid through a process that includes in vivo recombination within E. coli, using a site-specific recombinase to excise the expression cassette containing the gene or coding sequence of interest, such that the bacterial backbone is degraded. In some cases, a mcDNA vector can be commercially obtained (e.g., from System Biosciences (Palo Alto. CA). After delivery’ into a cell of interest, an mcDNA can express a transgene for a longer period of time compared to a standard plasmid, as it can avoid issues such as immune responses and silencing that otherwise would be caused by bacterial DNA. In some cases, a vector containing a nucleotide sequence encoding a BMP polypeptide can be a Nanoplasmid™ (Aldevron; Fargo, ND), which includes a small (less than 500 bp) backbone.
[0095] In an expression vector (e.g., a mcDNA vector), a nucleic acid (e.g., a nucleic acid encoding a BMP polypeptide) can be operably linked to one or more expression control sequences. As used herein, “operably linked” means incorporated into a genetic construct so that expression control sequences effectively control expression of a coding sequence of interest. Examples of expression control sequences include, without limitation, promoters, enhancers, and transcription terminating regions. A promoter is an expression control sequence composed of a region of a DNA molecule, ty pically within 100 to 500 nucleotides upstream of the point at which transcription starts (generally near the Attorney Docket No. 07039-2346WO1
[0096] 2024-506
[0097] initiation site for RNA polymerase II). To bring a coding sequence under the control of a promoter, the translation initiation site of the translational reading frame of the polypeptide can be positioned between one and about fifty' nucleotides downstream of the promoter. Enhancers provide expression specificity in terms of time, location, and / or level. Unlike promoters, enhancers can function when located at various distances from the transcription site. An enhancer also can be located downstream from the transcription initiation site. A coding sequence is ‘'operably linked” and “under the control” of expression control sequences in a cell when RNA polymerase is able to transcribe the coding sequence into mRNA, which then can be translated into the protein encoded by the coding sequence.
[0098] Suitable expression vectors include, without limitation, plasmids, mcDNAs, and viral vectors derived from, for example, bacteriophage, baculovi ruses, tobacco mosaic virus, herpes viruses, cytomegalovirus, retroviruses, vaccinia viruses, adenoviruses, and adeno-associated viruses. Numerous vectors and expression systems are commercially available from such corporations as Thermo Fisher Scientific (Waltham, MA).
[0099] The cells provided herein can contain nucleic acid (e.g., a vector) encoding one or more BMP polypeptides as described herein. As used herein, “transformed” and “transfected” encompass the introduction of nucleic acid (e.g., a vector) into a cell by one of a number of techniques. Suitable methods for transforming and transfecting host cells can be found, for example, in Sambrook et al.. Molecular Cloning: A Laboratory Manual (2ndedition), Cold Spring Harbor Laboratory, New York (1989). For example, calcium phosphate precipitation, electroporation, heat shock, lipofection, microinjection, and viral-mediated nucleic acid transfer can be used introduce nucleic acid into cells. In addition, naked DNA can be delivered directly to cells in vivo as described elsewhere (U.S. Patent Nos. 5,580,859 and 5,589,466). The host cells can express the encoded polypeptide, but it is noted that cells containing an isolated nucleic acid provided herein are not required to express a polypeptide. The isolated nucleic acid transformed into a host cell can be integrated into the genome of the cell or maintained in an episomal state. Thus, host cells can be stably or transiently transfected with a construct containing an isolated nucleic acid provided herein.
[0100] Any suitable method can be used to identify cells containing nucleic acid encoding one or more BMP polypeptides described herein. Such methods include, without limitation, PCR, and nucleic acid hybridization techniques such as Northern and Attorney Docket No. 07039-2346WO1
[0101] 2024-506
[0102] Southern analyses. In some cases, immunohistochemistry and biochemical techniques can be used to determine if a cell contains a particular nucleic acid described herein by detecting the expression of a polypeptide (e.g., a BMP polypeptide) encoded by that nucleic acid.
[0103] As used herein, “polypeptide” refers to an amino acid chain, regardless of length or post-translational modification. The term “isolated” with reference to a polypeptide means that the polypeptide (1) is not associated with proteins found in nature, (2) is free of other proteins from the same source (e.g., free of human proteins), (3) is expressed by a cell from a different species, or (4) does not occur in nature. An isolated polypeptide can be, for example, encoded by DNA or RNA, including synthetic DNA or RNA, or some combination thereof.
[0104] The cells provided herein can contain an exogenous nucleic acid that encodes one or more (e.g., one, two, or three) BMP polypeptides. For example, the cells provided herein can contain exogenous nucleic acid that includes a nucleotide sequence encoding a mammalian BMP2 polypeptide. In some cases, the cells provided herein can contain exogenous nucleic acid that includes a nucleotide sequence encoding both a mammalian BMP2 polypeptide and a mammalian BMP7 polypeptide. In some cases, the BMP2 and BMP7 coding sequences can be separated by a nucleotide sequence encoding a cleavable linker (e.g.. a T2A sequence, a P2A sequence, an E2A sequence, an F2A sequence, or any other oligopeptide sequence that can create a ribosome skipping effect and induce cleavage of polypeptides), which can be cleaved during or after translation of the coding sequences to separate the expressed BMP2 polypeptide from the expressed BMP7 polypeptide. Further, the nucleotide sequence(s) encoding the one or more BMP polypeptides can be operably linked to a promoter sequence, such that the one or more BMP polypeptides can be expressed in the cells. As such, the cells provided herein can contain the one or more BMP polypeptides.
[0105] In some cases, the cells provided herein can contain an exogenous nucleic acid that contains a nucleotide sequence encoding a BMP2 polypeptide and optionally a nucleotide sequence encoding a BMP7 polypeptide, as well as a nucleotide sequence encoding an additional polypeptide that can activate mammalian mothers against decapentapl egic homolog 4 (SMAD4) or another SMAD polypeptide (e.g., SMAD1, SMAD5, or SMAD9). Non-limiting examples of SMAD-activating polypeptides include transforming growth factor beta-1 (TGFbl). BMP4. and Activin A. Representative Attorney Docket No. 07039-2346WO1
[0106] 2024-506
[0107] nucleic acid and amino acid sequences for TGFbl, BMP4, and Activin A are provided in FIGS. 7C, 7D, and 7E, respectively. Other examples of SMAD activating polypeptides include, without limitation, TGFb2, TGFb3, BMP1, BMP3, BMP5, BMP6, BMP8, BMP9, BMP10, BMP11, BMP12, BMP13, BMP14, BMP15, BMP16, BMP17, BMP18, BMP 19, BMP20, Activin B, myostatin, and nodal. In some cases, a cell provided herein can contain exogenous nucleic acid that includes a first nucleotide sequence encoding a BMP2 polypeptide, a second nucleotide sequence encoding a BMP7 polypeptide, and a third nucleotide encoding a SMAD activating polypeptide (e.g., TGFbl, BMP4, or Activin A), where the first, second, and third nucleotide sequences are each separated from one another by a nucleotide sequence encoding a cleavable linker (e.g., a T2A sequence), which can be cleaved during or after translation of the coding sequences to separate the expressed BMP2 polypeptide, the expressed BMP7 polypeptide, and the expressed SMAD activating polypeptide. Further, the nucleotide sequence(s) encoding the mammalian BMP2 polypeptide, the mammalian BMP7 polypeptide, and the SMAD activating polypeptide can be operably linked to a promoter sequence, such that the mammalian BMP2 polypeptide, the mammalian BMP7 polypeptide, and the SMAD activating polypeptide can be expressed in the cells. As such, the cells provided herein can contain the mammalian BMP2 polypeptide, the mammalian BMP7 polypeptide, and the SMAD activating polypeptide.
[0108] Any appropriate promoter sequence can be used. Examples of suitable promoters include, without limitation, cytomegalovirus (CMV) promoter, cytomegalovirus immediate early enhancer / chicken P-actin (CAG) promoter, human elongation factor- 1 alpha (EFlalpha) promoter, heat shock protein 70 (HSP70) promoter, beta-Kin promoter, phosphoglycerate kinase 1 (PGK-1) promoter, reverse orientation splice acceptor (ROSA) promoter, ubiquitin B promoter, and TATA-binding promoter (TBP).
[0109] The nucleic acid contained within the cells provided herein can be any appropriate nucleic acid vector. For example, the nucleic acid can be a mcDNA or a lentivirus construct. Other appropriate vectors include, without limitation. pcDNA™3.1 (Thermo Fisher Scientific), pEFGP (NovoPro Bioscience Inc.), pMC.CMV / EFla-MCS-SV40PolyA (System Biosciences), pMax (e.g., pMAX-BMP7), AAV9, and pBabe (e.g., pBabe-puro).
[0110] The cells provided herein can contain exogenous nucleic acid containing any appropriate BMP coding sequence. A representative example of a nucleotide sequence Attorney Docket No. 07039-2346WO1
[0111] 2024-506
[0112] encoding a BMP2 polypeptide is set forth in SEQ ID NO: 1 (FIG. 7A). A representative example of a nucleotide sequence encoding a BMP7 polypeptide is set forth in SEQ ID NO: 2 (FIG. 7B). Thus, in some cases, the cells provided herein can contain exogenous nucleic acid that includes the nucleotide sequence set forth in SEQ ID NO: 1, optionally in combination with the nucleotide sequence set forth in SEQ ID NO:2. In some cases, the cells provided herein can contain exogenous nucleic acid that includes a nucleotide sequence having at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) sequence identity to SEQ ID NO: 1, optionally in combination with a nucleotide sequence having at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) sequence identity to SEQ ID NO:2.
[0113] The percent sequence identity between a particular amino acid or nucleic acid sequence and an amino acid or nucleic acid sequence referenced by a particular sequence identification number is determined as follows. First, an amino acid or nucleic acid sequence is compared to the sequence set forth in a particular sequence identification number using the BLAST 2 Sequences (B12seq) program from the stand-alone version of BLASTZ containing BLASTN version 2.0.14 and BLASTP version 2.0.14. This standalone version of BLASTZ can be obtained from Fish & Richardson’s web site (e.g., www.fr.com / blast / ) or the U.S. government's National Center for Biotechnology Information web site (www.ncbi.nlm.nih.gov). Instructions explaining how to use the B12seq program can be found in the readme file accompanying BLASTZ. B12seq performs a comparison between two sequences using either the BLASTN or BLASTP algorithm. BLASTN is used to compare nucleic acid sequences, while BLASTP is used to compare amino acid sequences. To compare two nucleic acid sequences, the options are set as follows: -i is set to a file containing the first nucleic acid sequence to be compared (e.g., C:\seql .txt); -j is set to a file containing the second nucleic acid sequence to be compared (e.g., C:\seq2.txt); -p is set to blastn; -o is set to any desired file name (e.g., C:\output.txt); -q is set to -1; -r is set to 2; and all other options are left at their default setting. For example, the following command can be used to generate an output file containing a comparison between two sequences: C:\B12seq -i c:\seql.txt -j c:\seq2.txt -p blastn -o c:\output.txt -q -1 -r 2. To compare two amino acid sequences, the options of B12seq are set as follows: -i is set to a file containing the first amino acid sequence to be compared (e.g., C:\seql.txt); -j is set to a file containing the second amino acid sequence Attorney Docket No. 07039-2346WO1
[0114] 2024-506
[0115] to be compared (e.g., C:\seq2.txt); -p is set to blastp; -o is set to any desired file name (e.g., C:\output. txt); and all other options are left at their default setting. For example, the following command can be used to generate an output file containing a comparison between two amino acid sequences: C:\B12seq -i c:\seql.txt -j c:\seq2.txt -p blastp -o c:\output.txt. If the two compared sequences share homology, then the designated output file will present those regions of homology as aligned sequences. If the two compared sequences do not share homology, then the designated output file will not present aligned sequences.
[0116] Once aligned, the number of matches is determined by counting the number of positions where an identical nucleotide or amino acid residue is presented in both sequences. A matched position refers to a position in which an identical nucleotide or amino acid residue occurs at the same position in aligned sequences. The percent sequence identity is determined by dividing the number of matches by the length of the sequence set forth in the identified sequence (e.g., SEQ ID NO: 1), followed by multiplying the resulting value by 100. For example, an amino acid sequence that has 1150 matches when aligned with the sequence set forth in SEQ ID NO: 1 is 96.6 percent identical to the sequence set forth in SEQ ID NO: 1 (i.e., 1150 1191 x 100 = 96.6). It is noted that the percent sequence identity7value is rounded to the nearest tenth. For example, 75.11, 75.12, 75.13, and 75.14 are rounded down to 75.1, while 75.15, 75.16, 75.17, 75.18. and 75.19 are rounded up to 75.2. It also is noted that the length value will always be an integer.
[0117] This document also provides EVs from an engineered mammalian cell (e.g., an engineered mesenchymal stem cell) provided herein. The EVs can include one or more BMP polypeptides that were expressed in the engineered cells. For example, EVs provided herein can contain a BMP2 polypeptide. In some cases, EVs provided herein can contain a BMP2 polypeptide and a BMP7 polypeptide.
[0118] EVs provided herein can contain any appropriate BMP2 polypeptide. A representative example of an amino acid sequence for a BMP2 polypeptide is set forth in SEQ ID NO:30 (FIG. 7A). Thus, in some cases, EVs provided herein can include an BMP2 polypeptide that comprises, consists essentially of, or consists of the amino acid sequence set forth in SEQ ID NO:30. In some cases, EVs provided herein can include a BMP2 polypeptide having an amino acid sequence with at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least Attorney Docket No. 07039-2346WO1
[0119] 2024-506
[0120] 98%, or at least 99%) sequence identity to SEQ ID NO:30. In addition to a BMP2 polypeptide, EVs provided herein can. in some cases, include a BMP7 polypeptide that comprises, consists essentially of, or consists of the amino acid sequence set forth in SEQ ID NO:31, or a BMP7 polypeptide having an amino acid sequence with at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) sequence identity to SEQ ID NO:31.
[0121] Any appropriate method can be used to obtain EVs provided herein. For example, engineered mammalian cells provided herein (e.g., human adipose-derived mesenchymal stem cells containing nucleic acid that encodes a BMP2 polypeptide and, optionally, nucleic acid encoding a BMP7 polypeptide) can be cultured for any appropriate period of time (e.g., 12 hours to 5 days, 12 to 24 hours, 1 to 2 days. 2 to 3 days. 3 to 4 days, 4 to 5 days, 1 to 5 days, 2 to 4 days, or 3 to 5 days) under conditions such that the BMP2 polypeptide or the BMP2 and BMP7 polypeptides are expressed by the cells. The culture medium can be removed from the cells and centrifuged (e.g., at a speed of about 1000 rpm to about 100,000 rpm. about 1000 to about 3000 rpm, about 3000 to about 5000 rpm, about 5000 to about 10,000 rpm, about 10,000 to about 20,000 rpm, about 20,000 to about 50,000 rpm, about 50,000 to about 75,000 rpm, or about 75,000 to about 100,000 rpm) to remove cell debris. The resulting supernatant can be collected and can contain EVs from the cells. In some cases, EVs can be concentrated (e.g., using a centrifugal filter with a size cutoff of about 50 kDa to about 1000 kDa. about 50 kDa to about 100 kDa, about 100 kDa to about 200 kDa, about 200 kDa to about 400 kDa, about 400 kDa to about 600 kDa, about 600 kDa to about 800 kDa, about 800 to about 1000 kDa, about 50 kDa, about 100 kDa, about 200 kDa, or about 300 kDa).
[0122] This document also provides compositions that contain EVs described herein. For example, this document provides compositions containing EVs from engineered cells described herein, where the EVs include a BMP2 polypeptide. In some cases, this document provides compositions containing EVs from engineered cells described herein, where the EVs include a BMP2 polypeptide and a BMP7 polypeptide.
[0123] In some cases, compositions provided herein can contain a pharmaceutically acceptable carrier in addition to EVs. Pharmaceutically acceptable carriers include, for example, pharmaceutically acceptable solvents, suspending agents, or any other pharmacologically inert vehicles for delivering EVs to a mammal. Pharmaceutically acceptable carriers can be liquid or solid, and can be selected with the planned manner of Attorney Docket No. 07039-2346WO1
[0124] 2024-506
[0125] administration in mind so as to provide for the desired bulk, consistency, and other pertinent transport and chemical properties, when combined with one or more therapeutic compounds and any other components of a given pharmaceutical composition. Examples of pharmaceutically acceptable carriers include, without limitation, water, saline solution (e.g., normal saline), lactated ringer's solution, albumin solution (e.g., about 5% albumin or about 25% albumin solution), any crystalloid or colloid that can be administered intravenously, binding agents (e.g., polyvinylpyrrolidone or hydroxypropyl methylcellulose), fillers (e.g., lactose, dextrose, and other sugars, gelatin, or calcium sulfate), lubricants (e.g., starch, polyethylene glycol, or sodium acetate), disintegrates (e.g., starch or sodium starch glycolate), and wetting agents (e.g., sodium lauryl sulfate).
[0126] The compositions provided herein can contain any other appropriate ingredients in addition to EVs described herein. For example, a composition provided herein can contain collagen or another appropriate scaffold (e.g., hyaluronic acid, fibrin gel, thrombin gel, alginate, or a self-polymerizing polymer). When a composition provided herein contains collagen, the collagen can be included at any appropriate concentration. For example, a composition provided herein can contain from about 10 pg / mL to about 100 mg / mL collagen (e.g., from about 10 pg / mL to about 100 pg / mL, from about 100 pg / mL to about 500 pg / mL, from about 500 pg / mL to about 1 mg / mL, from about 1 mg / mL to about 5 mg / mL, from about 2 mg / mL to about 4 mg / mL, from about 5 mg / mL to about 10 mg / mL, from about 10 mg / mL to about 50 mg / mL, from about 50 mg / mL to about 100 mg / mL, about 1 mg / mL, about 2 mg / mL, about 3 mg / mL, about 4 mg / mL, about 5 mg / mL, or about 10 mg / mL).
[0127] This document also provides methods for treating mammals having a bone defect. Any appropriate mammal can be treated using the methods provided herein. For example, the methods provided herein can be used to treat humans, non-human primates, rats, mice, rabbits, dogs, cats, horses, cows, goats, sheep, and pigs. Bone defects that can be treated using the methods provided herein include, without limitation, traumatic breaks, non-union fractures, loose joint / bone prosthesis, spinal fusion, vertebral compression fractures, and radiation osteonecrosis.
[0128] The methods provided herein for treating a bone defect in a mammal can include contacting a bone defect in a mammal with a composition provided herein (e.g., a composition containing a pharmaceutically acceptable carrier and EVs from an engineered mammalian mesenchymal stem cell described herein). In some cases, a Attorney Docket No. 07039-2346WO1
[0129] 2024-506
[0130] method provided herein can include contacting a bone defect in a mammal with a composition that includes EVs including a BMP2 polypeptide (e.g.. aBMP2 polypeptide having the amino acid sequence set forth in SEQ ID NO:30, or a BMP2 polypeptide having an amino acid sequence with at least 90% sequence identity to the sequence set forth in SEQ ID NO:30). In some cases, a method provided herein can include contacting a bone defect in a mammal with a composition that includes EVs including a BMP2 polypeptide (e.g., a BMP2 polypeptide having the amino acid sequence set forth in SEQ ID NO:30, or a BMP2 polypeptide having an amino acid sequence with at least 90% sequence identity' to the sequence set forth in SEQ ID NO:30) and a BMP7 polypeptide (e.g., a BMP7 polypeptide having the amino acid sequence set forth in SEQ ID NO:31. or a BMP7 polypeptide having an amino acid sequence with at least 90% sequence identity to the sequence set forth in SEQ ID NO:31).
[0131] A composition containing EVs provided herein can be delivered to a bone defect in a mammal by any appropriate route. For example, a composition containing EVs provided herein can be injected into a mammal at the site of a bone defect. In some cases, a composition containing EVs provided herein can be implanted into a mammal at the site of a bone defect.
[0132] The methods provided herein include applying, to a bone defect in a mammal, a composition containing any appropriate number of EVs described herein. For example, a method provided herein can include contacting a bone defect in a mammal with a composition containing from about IxlO7to about IxlO12EVs (e.g., from about IxlO7to about 5x107, from about 5xl07to about IxlO8, from about IxlO8to about 5xl08, from about 5x108to about IxlO9, from about IxlO9to about 5xl09, from about 5xl09to about IxlO10. from about IxlO10to about 5xl010, from about 5xl010to about IxlO11EVs, from about IxlO11to about 5xl0n, from about 5xl0nto about IxlO12EVs). In some cases, a composition containing EVs as described herein can be applied to a bone defect in an amount effective to promote healing of the bone defect and / or growth of the bone. In some cases, a composition containing from about IxlO7to about IxlO12EVs (e.g., from about IxlO7to about 5xl07, from about 5xl07to about IxlO8, from about IxlO8to about 5xl08, from about 5xl08to about IxlO9, from about IxlO9to about 5xl09, from about 5xl09to about IxlO10, from about IxlO10to about 5xl010, from about 5xl010to about IxlO11EVs, from about IxlO11to about 5xlOn, from about 5xl0nto about IxlO12EVs) can be administered to a bone defect in an amount of about 0.1 mL to about 10 mL (e.g., Attorney Docket No. 07039-2346WO1
[0133] 2024-506
[0134] about 0.1 mL to about 0.5 mL, about 0.5 mL to about 1 mL, about 1 mL to about 2 mL, about 1 mL to about 3 mL. about 1 mL to about 5 mL. or about 5 mL to about 10 mL) per cm2of the bone defect (e.g., about 1 mL / cm2of the bone defect).
[0135] Effective doses can vary depending on the severity of the bone defect, the route of administration, the age and general health condition of the mammal, excipient usage, the possibility of co-usage with other therapeutic treatments, and the judgment of the treating clinician. An effective amount of a composition containing EVs described herein can be any amount that increases bone growth (e.g., by at least 5, 10, 25, 35, 45, 50, 55, 65, 75, 80, 90, or 100 percent) at the site of a bone defect within a mammal (e.g., a human), without producing severe toxicity in the mammal. In some cases, an effective amount of a composition containing EVs described herein can be any amount that increases bone thickness, bone area healed, or bone volume / total volume (e.g., by at least 5, 10, 25, 35, 45, 50, 55, 65, 75, 80, 90, or 100 percent) at the site of a bone defect within a mammal (e.g., a human), without producing severe toxicity to the mammal. If a composition is administered more than once (e.g.. twice, three times, or four times), the effective amount can remain constant or can be adjusted as a sliding scale or variable dose depending on the mammal’s response to treatment. Various factors can influence the actual effective amount used for a particular application. For example, the frequency of administration, duration of treatment, use of multiple treatment agents, route of administration, or the severity of the bone defect in the mammal being treated may require an increase or decrease in the actual effective amount administered.
[0136] If a particular mammal fails to respond to a particular amount of a composition containing EVs described herein, then the amount of the composition (and / or the number of EVs in the administered dose) can be increased by, for example, two fold. After receiving the higher amount of the composition (and / or the higher number of EVs), the mammal can be monitored for both responsiveness to the treatment and toxicity symptoms, and adjustments made accordingly. The effective amount can remain constant or can be adjusted as a sliding scale or variable dose depending on the mammal’s response to treatment.
[0137] The frequency of administration of a composition containing EVs as described herein can be any frequency that increases bone growth at the site of a bone defect within a mammal (e g., a human), without producing severe toxicity in the mammal. In some cases, an effective frequency of administration of a composition containing EVs Attorney Docket No. 07039-2346WO1
[0138] 2024-506
[0139] described herein can be any frequency that increases bone thickness, bone area healed, or bone volume / total volume at the site of a bone defect within a mammal (e.g.. a human), without producing severe toxicity to the mammal. For example, the frequency of administration of a composition containing EVs described herein can be from about once a day to about once a w eek, or from about once a week to about once a month (e.g., from about once a week to about once every other week). The frequency of administration of a composition containing EVs described herein can remain constant or can be variable during the duration of treatment. As with the effective amount, various factors can influence the actual frequency of administration used for a particular application. For example, the effective amount, duration of treatment, route of administration, and severity of the bone defect may require an increase or decrease in administration frequency. An effective duration for administering a composition containing EVs described herein can be any duration that increases bone growth, increases bone thickness, increases bone area healed, or increases bone volume / total volume at the site of a bone defect within a mammal (e.g., a human), without producing severe toxicity to the mammal. In some cases, the effective duration can vary from several days to several weeks to several months. Multiple factors can influence the actual effective duration used for a particular treatment. For example, an effective duration can vary with the effective amount, frequency of administration, route of administration, and severity of the bone defect being treated.
[0140] In some cases, the effectiveness of a composition provided herein on the healing of a bone defect in a mammal can be monitored. Any appropriate method can be used to determine whether or not a mammal having a bone defect is effectively being treated. For example, clinical scanning techniques (e.g., X-ray, computed tomography (CT), positron emission tomography (PET) / CT, bone scan, and / or magnetic resonance imaging (MR1)) can be used to determine the healing status of a bone defect within a mammal (e.g., a human) being treated. Increased bone growth, increased bone thickness, increased bone area healed, and / or increased bone volume / total volume at the site of the defect (e.g., as compared to the same characteristic prior to treatment or at an earlier time point after the onset of treatment) can indicate effective treatment.
[0141] The invention will be further described in the following examples, which do not limit the scope of the invention described in the claims. Attorney Docket No. 07039-2346WO1
[0142] 2024-506
[0143] EXAMPLES
[0144] Example 1: Engineered BMP2 / BMP7 extracellular vesicles promoted bone formation METHODS
[0145] Study design: Studies were conducted to engineer small EVs derived from mesenchymal stem cells (MSCs) such that the EVs would contain BMP2 or BMP2 / 7, to validate their efficacy and mechanism of action in vitro, and to evaluate their treatment efficacy in a rodent calvarial defect model in comparison to rhBMP2 therapy. In vitro experiments were performed using mouse pre-osteoblast (MC3T3-E1) cells to determine the ability7of BMP2-EV and BMP2 / 7 -EV to induce calcium deposition, alkaline phosphatase activity, and osteoblast differentiation. EV uptake and SMAD phosphorylation following EV treatment were also tested. All in vitro experiments consisted of n > 3 unless otherwise stated. In vivo experiments used male Sprague-Dawley rats to create a calvarial defect model. Animals were randomized across treatment groups: collagen, collagen with rhBMP2, and collagen with BMP2 / 7-EV. Analyses included serial micro-CT evaluation at 30. 45. and 75 days, with histologic analysis at 75 days. A separate cohort of animals was evaluated with histologic analysis at 30 days. Histologic analyses were conducted in blinded fashion, and evaluated the entirety of a cross-sectional area of the lesion. For the 75-day cohort, the sample sizes per group were: collagen (n = 6), rhBMP2 / collagen (n = 5), and BMP2 / 7-EV / collagen (n = 6). For the 30-day cohort, the sample sizes per group were: collagen (n = 3), rhBMP2 / collagen (n = 4), and BMP2 / 7-EV / collagen (n = 3). One animal was excluded from the micro-CT and histologic analyses from the rhBMP2 / collagen 75-day group due to surgical failure with injury7to dura, which compromised bone healing. Otherwise, no animals were excluded from the analyses.
[0146] Plasmid generation and optimization: Nucleotide sequences for human BMP2 and human BMP7 were retrieved from Ensembl and coding sequences were noted. Codonoptimization was obtained through GeneWiz (Azenta). Codon-optimized BMP2 and BMP7 were synthesized (GenScript), with BMP7 containing a (GSG)-T2A linker at its 5’ end. The T2A linker sequence was GGCAGTGGAGAGGGCAGAGGAAGTCTGCTAACATGCG GTGACGTCGAGGAGAATCCTGGCCCA (SEQ ID NO:3). BMP2 was cloned into the lentiviral expression vector pLenti6.3 / V5 (Invitrogen, # K5310-00) and w as designated Attorney Docket No. 07039-2346WO1
[0147] 2024-506
[0148] pLV-BMP2. To clone pLV-BMP2 / 7, the DNA fragment with (GSG)-T2A-BMP7 was inserted at the 3’ end of BMP2 in pLV-BMP2.
[0149] Lentiviral production: The ViraPower HiPerform Lentiviral Expression System (Invitrogen, # K5310-00) was used according to the manufacturer’s instructions to produce lentivirus. Briefly, HEK293FT cells were cultured in DMEM containing 0.1 mM non-essential amino acids, 2 mM L-glutamine, 1 mM sodium pyruvate, and 10% fetal bovine serum. At 48 and 72 hours post-transfection, virus-containing supernatants were harvested and fdtered through a 0.45 pm filter.
[0150] MSC andMC3T3 cell culture: Human adipose-derived mesenchymal stem cells (Lonza. #PT-5006), MC3T3-E1 cells (ATCC, #CRL-2593), the mouse macrophage cell line RAW 264.7 (ATCC), and HUVEC (Lonza) were cultured in a humidified incubator at 37°C with 5% CO2. The MSC medium was high glucose DMEM (Gibco, #10569010) containing 2.5% PLTMax, 100 units / mL penicillin, and 100 mg / mL streptomycin.
[0151] MC3T3-E1 murine calvarial preosteoblast cells were cultured in a-minimal essential medium without ascorbic acid (Gibco. #A1049001) containing 10% fetal bovine serum, 100 units / mL penicillin, and 100 mg / mL streptomycin. For osteogenic differentiation of MC3T3-E1 cells, the osteogenic medium consisted of MC3T3-E1 medium supplemented with 50 pg / mL ascorbic acid (Sigma), 10 mM P-glycerol phosphate (Sigma), and 40 ng / mL dexamethasone (VetOne, #501012). Mouse macrophages were cultured in DMEM (Gibco. #10569010) containing 10% FBS and 100 units / mL penicillin, and 100 mg / mL streptomycin. HUVEC were cultured in EBMIMbasal medium (Lonza, #CC-3156) supplemented with EGM™-2 SINGLEQUOTS™ Supplements (Lonza, #CC-4176).
[0152] Small EV isolation: MSCs were transduced with LV-BMP2 or LV-BMP2 / 7 at a multiplicity of infection of 400. Prior to small EV isolation. MSCs were washed with lx PBS and cultured in DMEM without PLTMax for 3 days. To isolate small extracellular vesicles, the culture medium was removed and spun at 3000 rpm to remove cell debris. The resulting supernatant was then concentrated using an AMICON® Ultra-15 centrifugal fdter unit with a 100 kDa size cutoff.
[0153] Real-time-quantitative reverse-transcriptase PCR (RT-qPCR): RNA was isolated using RNEASY® Plus kit according to the manufacturer’s instructions (Qiagen, #74034). RT-qPCR was subsequently performed according to the manufacturer’s instructions using QUANTITECT® SYBR® Green RT-PCR kit (Qiagen. #204243). Primer sequences are listed in TABLE 1. Attorney Docket No. 07039-2346WO1
[0154] 2024-506
[0155] TABLE 1: RT-qPCR primer sequences
[0156]
[0157] Western blotting: Samples were lysed in a detergent-based buffer (10 mM HEPES pH 7.4, containing 1% Triton X-100, 50 mM sodium pyrophosphate, 50 mM sodium fluoride, 50 mM sodium chloride, 5 mM EDTA, 5 mM EGTA, 100 pM sodium orthovanadate, and 1: 100 protease inhibitor cocktail [Sigma P8340]). Protein lysates were quantified by BCA Protein Assay (Pierce, #23227), and then loaded into polyacrylamide gels (Invitrogen), and were semi -dry transferred using Trans-Blot Turbo (Bio-Rad) onto nitrocellulose membranes. Membranes were incubated for 1 hour in Intercept (TBS) blocking buffer (Li-Cor), followed by overnight incubation at 4°C with primary antibodies with 0.1% Tween. Primary antibodies included CD63 (1:1000, R&D Systems, #MAB50482), flotillin (1:1000, Abeam. #abl33497), CD9 (1:1000, Cell Signaling Technology, #134038), BMP2 (1:1000, Thermo Fisher, #PA578874), BMP7 (1:1000, GeneTex, #GTX53692), phospho-SMAD 1 / 5 / 9 (1:500, Cell Signaling Technology7, #13820S), total SMAD 1 / 9 (1:1000, Abeam, #abl08965), GAPDH (1:1000, Cell Signaling Technology, #2118S), and actin (1 : 1000, Li-Cor, #926-42212). After a subsequent 1 hour incubation with IRDye anti-rabbit and anti-mouse secondary7antibodies (Li-Cor), membranes were imaged using Li-Cor CLx Imager. Attorney Docket No. 07039-2346WO1
[0158] 2024-506
[0159] NanoSight Tracking Analysis: Small EV samples were diluted in IX PBS.
[0160] Quantification of particle numbers and distribution of particle sizes were performed using the NanoSight NS300 System (Malvern Instruments).
[0161] Transmission / scanning electron microscopy: For transmission electron microscopy (TEM), small extracellular vesicles were fixed in Trump's fixative and then applied onto a carbon-coated nickel grid. The nickel grid was stained with 2% uranyl acetate, air-dried, and visualized using a JEOL 1400 plus TEM transmission electron microscopy.
[0162] For scanning electron microscopy, collagen or collagen with BMP2 / 7-EV were fixed in Trump’s fixative, washed in IX PBS, rinsed in deionized H2O, dehydrated, and critical point dried. Imaging was performed on a Hitachi S-4700 cold field emission scanning electron microscope.
[0163] Immunocytochemistry: Following overnight serum deprivation and respective treatments, MC3T3-E1 cells were fixed in 100% methanol for 15 minutes at -20°C. Cells were permeabilized using 0.1% Triton in IX PBS followed by blocking (5% bovine serum albumin, 2% normal donkey serum, 0.02% Triton in IX PBS) for 10 minutes. Primary antibody pSMADl / 5 / 9 (1:100, Cell Signaling Technologies, #13820) was added for 1 hour at 37°C. Secondary7antibody (1:200, Thermo Fisher, #A-31572) was added for 45 minutes at 37°C. PROLONG™ Gold Antifade Mountant with DAPI (ThermoFisher, #P36935) was used to apply the coverslips. Slides were imaged on Zeiss LSM780 confocal microscope system. Quantification was performed using ImageJ to calculate integrated density', and values w ere normalized to the number of nuclei.
[0164] Alizarin red assay: MC3T3-E1 cells were cultured in osteogenic differentiation medium for 16 days. EV treatments were added to the medium on days 0 and 3. Cells were fixed in 4% formaldehyde and stained with 4 mM Alizarin Red S from Ared-Q kit (ScienCell). Images were scanned and alizarin red was quantified by measuring absorption at 405 nm (Microplate reader, BMG Labtech).
[0165] Alkaline phosphatase activity assay: MC3T3-E1 cells were cultured in osteogenic differentiation medium for 14 days, with EV added to the medium on day 0. Alkaline phosphatase activity 'as measured on days 3, 6, 10, and 14. Briefly, cells were washed in lx PBS and lysed with 0.2% Triton X-100 in distilled water by shaking for 20 minutes at room temperature. Protein concentration of lysates was measured by BCA Protein Assay Kit (Thermo Scientific) according to the manufacturer's instructions. Samples were Attorney Docket No. 07039-2346WO1
[0166] 2024-506
[0167] assayed for alkaline phosphatase activity using QuantiChrom Alkaline Phosphatase Assay Kit (BioAssay Systems) in a 96-well plate format according to the kit instructions. A microplate reader (BMG Labtech) was used to measure absorbance at 405 nm. Alkaline phosphatase activity was calculated as absorbance units / mg polypeptide.
[0168] Representative microscopy images were acquired on day 10 of osteogenic differentiation. Cells in monolayer were covered with Saccomanno fixation solution for 90 seconds, followed by washing (lx PBS with 0.05% Tween-20). Cells were then stained with BCIP / NBT substrate solution (SigmaFast BCIP-NBT) at room temperature for 5-10 minutes, protected from light. Cells were washed once more prior to imaging.
[0169] MC3T3 and HUVEC proliferation assays: Cells were plated in a 96-well plate in either a-MEM (MC3T3) or EBM™ complete supplemented medium (HUVEC). MC3T3 were treated with medium only (control), MSC-EV (lelO particles), BMP2-EV (lelO particles), or BMP2 / 7-EV (lelO particles). Cells were imaged by the IncuCyte live-cell imaging system for either 48 or 72 hours, with confluency analysis performed using the IncuCyte software.
[0170] Macrophage Polarization Assay: For macrophage polarization controls, cells were treated with 50 ng / mL of LPS for 24 hours to obtain an Ml phenoty pe, 20 ng / mL of IL-4 for 48 hours to obtain an M2 phenoty pe, or untreated to obtain an M0 phenoty pe.
[0171] Macrophages were treated with BMP2-EV, BMP2 / 7-EV, or MSC-EV at a concentration of IxlO11EV / mL for 24 hours.
[0172] RNA was isolated using RNEASY® Plus kit according to the manufacturer’s instructions (Qiagen, #74034). RNA w as converted to cDNA using a High-Capacity7cDNA Reverse Transcription Kit according to the manufacturer’s instruction (ABI, #4374966). Real time-quantitative PCR was subsequently performed according to the manufacturer’s instructions using PowerTrack SYBR Green Master Mix for qPCR (Thermo Fisher, # A46012). Primer sequences used are listed in TABLE 2.
[0173] TABLE 2: RT-qPCR primer sequences
[0174]
[0175] Attorney Docket No. 07039-2346WO1
[0176] 2024-506
[0177]
[0178] Rodent calvarial defect model
[0179] Male rats were selected due to their increased periosteal thickness. Male Sprague-Dawley rats weighing 290-325 grams were placed under general anesthesia using 1-2% isoflurane followed by an anesthetic cocktail (Ketamine / Xylazine / Acepromazine) administered intraperitoneally. The skull region was clipped prior to sterile preparation and draping. A midline incision was made, extending through the periosteum. A dental filling instrument (HuFriedy, PFITR1 / 2) was used to bilaterally elevate the periosteum and to provide access to the right side of the calvarium. A high-speed rotary' drill (Foredom K.1070) and a 5 mm trephine drill (Fine Science Tools, Trephine for Micro Drill 18004-50) were used to create a defect in the right parietal bone while under irrigation. The bone disk was elevated to preserve the dura. The area was thoroughly lavaged and the treatments were applied. Groups consisted of collagen (Advanced BioMatrix, Collagen Type 1. #5133) with DMEM, collagen with rhBMP2 (2.5 pg per rodent), or collagen with BMP2 / 7-EVs (4e9 particles per rodent). To produce a gel disc, 10 mg / mL collagen was diluted to 3 mg / mL using the respective treatments; the final volume applied to the rat was 50 pL. The periosteal layer was closed in a simple continuous pattern with 6-0 Monocr l and the skin was closed in interrupted fashion using a 5-0 Vicryl.
[0180] Micro-CT: Rats were followed sequentially using an in vivo micro-CT to evaluate bone healing. Scans were performed in the animals at 30, 45, and 75 days, using a Bruker Skyscan 1276 micro-CT scanner with a source voltage of 100 kV, a current of 200 mA, and a 2 x 2 detector binning to achieve a 20 pm isometric voxel size. Scans were performed over a 180-degree arc using 2 frames on average for every 0.4-degree increment, with a 352 ms exposure time. Reconstructions and analyses were performed using the Skyscan NRcon and Ctan software, respectively. A region of interest (ROI) w as set at 4.5 mm to cover the defect area. Attorney Docket No. 07039-2346WO1
[0181] 2024-506
[0182] Histological analysis: Animals were sacrificed at either day 30 or day 75 for histologic analysis. Calvaria were explanted using a fine circular saw (Fine Science Tools, Mandrel #1800-18 with Circular Saw for Micro Drill #1800-18) and fixed in 10% buffered formalin. The bone was transferred into a decalcification solution (LEICA, Decalcifier II) for 48 hours. Samples were then rinsed in saline and placed into formalin prior to processing and embedding. Sections were cut at 4 pm thickness, melted onto the slide, deparaffinized, and stained with hematoxylin & eosin (H&E) or toluidine blue. Tissue was deparaffinized and antigen retrieval was performed overnight at 50°C in sodium citrate buffer (pH 6.0) for a-smooth muscle actin, at 37°C for 30 minutes in 0.1% trypsin for CD34, or at room temperature for 5 minutes with HistoReveal (Abeam, #ab!03720) for CD117. IHC staining was performed with IMMPRESS® HRP horse antirabbit IgG polymer detection kit (Vector Laboratories, #MP-7401) and IMMPACT® DAB substrate kit (Vector Laboratories, #SK-4105) according to the manufacturer's instructions using either a-smooth muscle actin primary antibody (1:1000, Abeam, #ab7817), CD117 (l:50, Novus, #AF1356), and CD34 (1:100, R&D, #AF4117) with hematoxylin counter stain. All slides were scanned, and images were tiled together using Axio Scan Z1 microscope. H&E sections were analyzed for average bone thickness, percentage marrow space (marrow area / total bone area), and difference in bone thickness (thickest area - thinnest area). Toluidine blue and CD117 were used to quantify the number of mast cells in bony tissue per area (pm2). Quantification of a-smooth muscle actin was used to analyze the number of blood vessels in bone, the average area of blood vessels in bone, and the total area of blood vessels in bone, and were normalized to total bone area per image. All quantifications were performed in ImageJ.
[0183] Statistical analysis: Data are expressed as mean ± SD for in vitro data and mean ± SEM for in vivo data. Statistical significance are shown as * p<0.05, ** p<0.01, *** p<0.001, and **** pO.OOOl. Statistics were performed using GraphPad Prism version 9.2.0.
[0184] RESULTS
[0185] Production and characterization of engineered BMP2-EV and BMP2 / 7-EV: Mesenchymal stem cells (MSCs) were engineered to stably overexpress BMP2 (LV-BMP2), or BMP2 and BMP7 (LV-BMP2 / 7) using lentiviral transduction. Dual expression of BMP2 and BMP7 in LV-BMP2 / 7 was accomplished using a T2A linker. Attorney Docket No. 07039-2346WO1
[0186] 2024-506
[0187] which caused cleavage during translation. This allowed a single plasmid vector to express both polypeptides of interest under the same promoter (Liu et al., Sci Rep., 7( 1):2193 (2017)). Human BMP2 and BMP7 optimized codons were used to improve the expression and translational efficiency of the vectors (FIGS. 7A-7B; SEQ ID NOs:l and 2).
[0188] Schematics of the lentiviral vectors are shown in FIG. 1A. Real-time quantitative reversetranscriptase PCR (RT-qPCR) demonstrated a significant increase in the expression of BMP2 mRNA in MSCs that were transduced with LV-BMP2 (mean ratio to GAPDH 320.8 ± 38.3, p<0.0001) and LV-BMP2 / 7 (mean ratio to GAPDH 227.5 ± 30.5, p-0.0002) compared to the non-transduced MSCs (mean ratio to GAPDH 1.2 ± 0.04) (FIG. IB). LV-BMP2 MSCs showed significantly higher levels of BMP2 mRNA expression compared to LV-BMP2 / 7 MSCs (p=0.016) (FIG. IB). On the other hand. LV- BMP2 / 7 MSCs showed higher levels of BMP7 mRNA expression (mean ratio to GAPDH 64.3 ± 28.1, p = 0.0082 vs non-transduced MSC and LV-BMP2) compared to LV-BMP2 MSCs (2.4 ± 0.3) and non-transduced MSCs (2.3 ± 0.4) (FIG. IB). Western blotting showed no significant BMP2 or BMP7 polypeptide expression in the non-transduced control MSCs at baseline, while LV-BMP2 and LV-BMP2 / 7 transduction increased the expression of either BMP2 alone or dual BMP2 / 7, respectively (FIG. 1C). Extracellular vesicles derived from LV-BMP2 demonstrated a mean diameter of 272.5 nm± 9.9 and a mode diameter of 172.2 nm ± 34.0, while LV-BMP2 / 7 extracellular vesicles (BMP2 / 7- EV) had a mean diameter of 248.9 nm ± 4.8 and a mode diameter of 165.2 nm ± 4.1 (FIG. ID) Transmission electron microscopy of BMP2-EV and BMP2 / 7-EV revealed a similar size distribution for each sample (FIG. IE). Western blot analysis of control MSC-EV, BMP2-EV, and BMP2 / 7-EV showed uniform expression of the small EV markers CD63. flotillin, and CD9 (FIG. IF). Additionally, BMP2-EV demonstrated the expression of BMP2 and BMP2 / 7-EV demonstrated the expression of both BMP2 and BMP7 (FIG. 1G).
[0189] In vitro characterization of the impact of BMP2-EV and BMP2 7-EV on bone formation: To evaluate the effects of BMP2-EV and BMP2 / 7-EV on bone formation in vitro, a mouse preosteoblast cell line (MC3T3-E1) was employed. The timeline of EV uptake in MC3T3-E1 cells was determined by quantifying lipophilic Dil dye-labeled BMP2 / 7-EV at 0, 1, 3, 6, 12, and 24 hours post-treatment. All timepoints showed a significant fluorescent intensity difference when compared to the 0-hour timepoint, with peak uptake intensity (mean 7634 ± 2097, p < 0.0001) at 6 hours (FIG.8). Calcium Attorney Docket No. 07039-2346WO1
[0190] 2024-506
[0191] deposition was evaluated using the alizarin red assay (Puchtler et al., J. Histochem.
[0192] Cytochem.. 17(2): 110-124 (1969)). MC3T3-E1 cells were treated with osteogenic differentiation medium only (control) or differentiation medium supplemented with MSC-EV, BMP2-EV, or BMP2 / -EV. On day 16, calcium deposition was found to be significantly increased, with a mean optical density (OD) of 0.534 ± 0.05 (p < 0.0001) for BMP2-EV and an OD of 0.562 ± 0.04 (pO.OOOl) for BMP2 / 7-EV compared to the control (0.0328 ± 0.01), while MSC-EV (OD 0.0355 ± 0.005, p = 0.9993) showed no difference compared to the control (FIGS. 2A and 2C). BMP2 / 7-EV demonstrated increased calcium deposition compared to BMP2-EV (p < 0.0001) (FIGS. 2A and 2C).
[0193] Bone-specific alkaline phosphatase activity, which reflects mineralization (Vimalraj et al., Gene., 754:144855 (2020)), was evaluated on days 3, 6. 10. and 14 post-treatment with MSC-EV, BMP2-EV, or BMP2 / 7-EV. All EV groups showed a significant increase in bone-specific alkaline phosphatase activity compared to the control at all time points. The alkaline phosphatase activity peaked on day 10, with a mean alkaline phosphatase activity of 933.7 ± 18.3 for the control compared to the mean alkaline phosphatase activity of 5808 ± 345.0 (p < 0.0001) for BMP2-EV and 6606 ± 473.6 (p < 0.0001) for BMP2 / 7-EV (FIGS. 2B and 2D) On day 10, MSC-EV treatment showed a significant increase in bone-specific alkaline phosphatase activity compared to the control at 1530 ± 91.5 (p = 0.0002). However, the increase in MSC-EV was minimal compared to that for BMP2-EV and BMP2 / 7-EV treatment (FIGS. 2B and 2D). To determine whether the changes in proliferation impacted the effects of BMP2-EV and BMP2 / 7-EV on calcium deposition and alkaline phosphatase activity, cells were treated with media only (control), MSC-EV, BMP2-EV, or BMP2 / 7-EV for 72 hours. There was no significant difference between the groups at any time point; at the 72 hour timepoint, cell confluency reached 94.34% ± 5.5% (control), 96.39% ± 1.9% (MSC-EV), 87.03% ± 4.5% (BMP2-EV), and 86.89% ± 3.6% (BMP2 / 7-EV) (FIGS. 9A and 9B). Overall, BMP2 / 7-EV showed a statistically significant increase in both the alizarin red and alkaline phosphatase activity assays compared to BMP2-EV (FIGS. 2C and 2D).
[0194] To further evaluate the effects of BMP2- and BMP2 / 7-EVs, MSCs were employed to determine whether BMP-endowed EVs could induce bone formation in cells that were not yet lineage-specified toward an osteogenic fate. MSCs w ere treated with osteogenic differentiation medium alone (control) or differentiation medium supplemented with MSC-EV, BMP2-EV, or BMP2 / 7-EV. On day 21. calcium deposition had significantly Attorney Docket No. 07039-2346WO1
[0195] 2024-506
[0196] increased, with a mean OD of 0.215 ± 0.008 (p < 0.0001 vs control and MSC-EV) for BMP2-EV and 0.267 ± 0.016 (p < 0.0001 vs control and MSC-EV) for BMP2 / 7-EV compared to the control (0.050 ± 0.010) and MSC-EV (0.062 ± 0.013). MSC-EV showed no significant difference compared to the control (p = 0.6932) (FIGS. 10A and 10C). Additionally, BMP2 / 7 -EV showed a significant increase in calcium deposition compared to BMP2-EV (p = 0.0039) (FIGS. 10A and 10C). Similarly, the alkaline phosphatase activity measurements in BMP2-EV (1729 ± 45.3, p < 0.0001 vs control and MSC-EV) and BMP2 / 7-EV (1936 ± 80.0, p <0.0001 vs control and MSC-EV) were significantly increased compared to both the control (435.5 ± 18.9) and MSC-EV (499.7 ± 29.0) (FIGS. 10B and 10D). However, MSC-EV showed no difference compared to the control (p = 0.1408). while the superiority of BMP2 / 7-EV compared to BMP2-EV continued to be statistically significant (p < 0.0001) (FIGS. 10B and 10D).
[0197] Since MSC-derived extracellular vesicles can induce macrophage polarization toward an M2 phenotype (Pei et al., Int. Immunopharm., 128:111575 (2024)), studies were conducted to evaluate whether the addition of BMP2 or BMP2 / 7 to MSC-EV affected the EV’s ability to induce macrophage polarization. LPS was used to induce polarization to an Ml phenotype, while IL-4 was used to induce an M2 phenotype.
[0198] Expression of CD86 was used to quantify the Ml phenotype, and Arg-1 was used to quantify the M2 phenotype. MSC-EV (1.13 ± 0.4, p = 0.35) and BMP2 / 7-EV (1.26 ± 0.6, p = 0.57) did not show any significant increase in the expression of CD86 (Ml phenotype) compared to the LPS control (1.65 ± 0.2), while BMP2-EV (0.70 ± 0.6, p = 0.043) showed a significant decrease in the expression of CD86 (FIG. 11). MSC-EV (22.83 ± 4.1, p = 0.0001), BMP2-EV (14.68 ± 1.8, p = 0.0057), and BMP2 / 7-EV (15.36 ± 6.2. p = 0.0040) showed a significant increase in the expression of Arg-1 (M2 phenotype) compared to IL-4 (2.62 ± 0.5) (FIG. 11).
[0199] Further, since MSC-derived extracellular vesicles have been implicated in angiogenesis (Labedz et al., J Nanobiotech., 22(1): 60(2024)), human umbilical vein endothelial cells (HUVEC) were used to evaluate cell proliferation in response to the treatment. At 48 hours, cells treated the control were at 68.55% ± 4.0% confluency, and no significant difference was observed when compared to MSC-EV (80.43% ± 5.6%, p = 0.1402) or BMP2 / 7-EV (83.30% ± 7.6%, p = 0.1648) (FIGS. 12A and 12B). However, cells treated with BMP2-EV were at 86.22% ± 3.9% confluency, a significant increase in Attorney Docket No. 07039-2346WO1
[0200] 2024-506
[0201] at 48 hours (p = 0.0190), although that was the only time point that showed significance compared to the control (FIGS. 12A and 12B).
[0202] Given the role of BMP in the induction of osteoblast differentiation, RT-qPCR was employed to evaluate the transcriptional changes in MC3T3-E1 cells following treatment with osteogenic differentiation medium alone (control), MSC-EV, BMP2-EV, and BMP2 / 7-EV treatment on days 0, 1, 3, 6, 10, and 14. Runt-related transcription factor 2 (RUNX2) and osterix (SP7) are transcription factors association with an earlier stage of differentiation (from osteoprogenitor to osteoblast), while osteopontin (OPN) and osteocalcin (OCN) are bone matrix polypeptides associated with mature osteoblasts (Rutkovskiy et al., Med. Sci. Monit. Basic Res., 22:95-106 (2016)). A schematic depicting the timeline of expression of RUNX2. SP7, OCN. and OPN during osteoblast differentiation is shown in FIG. 3A. RUNX2 expression peaked on day 3 in cells treated with BMP2-EV (mean 3.93 ± 1.2, p = 0.0703) and BMP2 / 7-EV (mean 4.50 ± 0.3, p < 0.0001) compared to cells treated with the control (mean 1.61 ± 0.2). Cells treated with MSC-EV (mean 1.96 ± 0.3, p = 0.3417) showed no difference compared to the control (FIG. 3B). Similarly, SP7 transcript levels peaked on day 3 in cells treated with BMP2-EV (mean 19.37 ±7.1, p = 0.0843) and BMP2 / 7-EV (mean 16.30 ± 3.3, p = 0.0244) compared to the control (mean 7.02 ± 0.2), while MSC-EV treated cells (mean 4.60 ± 0.02, p = 0.0006) showed decreased expression of SP7 compared to the control (FIG. 3C). OCN expression was highest on day 14, with BMP2-EV (227.2 ± 11.1, p < 0.0001) and BMP2 / 7-EV (236.4 ± 7.7, p < 0.0001) treated cells showing a significant increase in OCN expression levels compared to the control (46.5 ± 4.2) (FIG. 3D). MSC-EV (32.7 ± 4.2. p = 0.0088) showed a significant decrease in OCN expression levels on day 14 (FIG.
[0203] 3D). OPN expression was also highest on day 14, with BMP2-EV (53.9 ± 4.8, p = 0.0006) and BMP2 / 7-EV (76.0 ± 10.1, p = 0.0019) treated cells showing a significant increase in OPN expression compared to the control (7.3 ± 0.2) (FIG. 3E). On day 14, MSC-EV (8.1 ± 0.2, p = 0.0085) showed a significant decrease in OPN expression (FIG.
[0204] 3E). These results demonstrated that treating cells with BMP2-EV or BMP2 / 7-EV recapitulated the temporal pattern of osteoblast differentiation and maturation, with RUNX2 and SP7 expression peaking on day 3 and the expression levels of OCN and OPN increasing over time (FIG. 3B-3E).
[0205] SMAD phosphorylation by BMP2 / 7-EV was mediated by auto, 'paracrine release ofBMP2 / 7 by the EVs: To probe the biopotency of BMP-containing EVs compared to the Attorney Docket No. 07039-2346WO1
[0206] 2024-506
[0207] biopotency of rhBMP2, the ability of BMP2 / 7-EV to induce SMAD phosphorylation (pSMAD) was evaluated. Treating MC3T3-E1 cells with rhBMP2 (100 ng / mL) or BMP2 / 7-EV (6.67e9 particles / mL) for 6 hours induced pSMAD, and quantification of the pSMAD fluorescent signal showed a significant increase for both groups (rhBMP2 mean 2559 ± 120.9, p<0.0001, BMP2 / 7-EV mean 2256 ± 187.6, p < 0.0001) compared to the untreated control (mean 284.7 ± 48.6) (FIGS. 4A and 4B). To further delineate the potency of BMP2-EV in inducing pSMAD, MC3T3-E1 cells were treated with a serum free medium (control), MSC-EV (6.67e9 particles / mL), BMP2-EV (6.67e9 particles / mL), and BMP2 / 7-EV (6.67e9 particles / mL) for 6 hours. Quantification of pSMAD fluorescence showed that MSC-EV (350.1 ± 751.4, p = 0.6444) did not induce significant SMAD phosphorylation compared to the control (23.30 ± 17.6) (FIGS. 13A and 13B).
[0208] Both BMP2-EV (85025 ± 29535, p <0.0001 vs control and MSC-EV) and BMP2 / 7-EV (139786 ± 27323, p <0.0001 vs control and MSC-EV) significantly increased the pSMAD fluorescent signal compared to the control and MSC-EV (FIGS. 13A and 13B).
[0209] BMP2 / 7-EV also demonstrated significantly increased the pSMAD fluorescent signal compared to BMP2-EV (p = 0.0025) (FIGS. 13A and 13B). Western blotting was employed as an additional measure to demonstrate pSMAD induction, and demonstrated that both BMP2-EV and BMP2 / 7-EV induced pSMAD while the control and MSC-EV did not. Total expression of SMAD and GAPDEI were used as loading controls (FIG. 13C)
[0210] A BMP2 / 4 / 7 inhibitor (noggin) and a BMPRI inhibitor (DMH1) were employed to further characterize the mechanism of BMP2 / 7 activation of pSMAD. To determine whether the BMP polypeptide was located inside or outside the extracellular vesicle, BMP2 / 7-EV were pre-treated with noggin (500 ng / mL) for 1 hour, followed by three washes with medium to remove any unbound noggin. When noggin-pre-treated BMP2 / 7-EV were applied to MC3T3-E1 cells, pSMAD induction (mean 2415 ± 306.8, p < 0.0001) was preserved, suggesting that the BMP polypeptide was located inside the extracellular vesicle and thereby protected (FIGS. 4A and 4B). However, when a combination of noggin (500 ng / mL) and BMP2 / 7-EV was added to MC3T3-E1 cells, the induction of pSMAD was significantly decreased (mean 470 ± 145.2, p < 0.0001) compared to BMP2 / 7-EV treatment alone (mean 2319 ± 694.6), suggesting that the concentration of noggin was sufficient for inhibition, and that the supplemented BMP was driving SMAD activation through an auto / paracrine mechanism (FIGS. 14A and 14B). With DMH1 (1 Attorney Docket No. 07039-2346WO1
[0211] 2024-506
[0212] pM) addition in combination with BMP2 / 7-EV treatment. pSMAD induction was significantly decreased (mean 240.9 ± 104.2, p = 0.7318) indicating that BMP2 / 7-EV signaling was reliant on BMPRI / II activation (FIGS. 4A and 4B).
[0213] To demonstrate that pSMAD activation was reflective of the dow nstream effects on bone formation, the effects of noggin and DMH1 on MC3T3-E1 cells were tested using the alizarin red assay with BMP2 / 7-EV. MC3T3-E1 cells were pre-treated with DMH1 for 1 hour and then BMP2 / 7-EV w ere added. The alizarin red assay demonstrated that DMH1 treatment with BMP2 / 7-EV resulted in a significant decrease in optical density at 0.1 pM (mean 0.92 ± 0.009, p < 0.0001), 1 pM (mean 0.27 ± 0.007, p < 0.0001), and 10 pM (mean 0.20 ± 0.0009, p < 0.0001) compared to BMP2 / 7-EV treatment alone (mean 1.29 ± 0.02) (FIGS. 4C and 4D). Noggin -pre-treated BMP2 / 7-EV showed no significant difference in optical density in the alizarin red assay at 5 ng / mL (mean 0.84 ± 0.04, p= 0.8803), 50 ng / mL (mean 0.84 ± 0.008, p= 0.9370), or 500 ng / mL (mean 0.82 ± 0.07, p > 0.9999) compared to BMP2 / 7-EV alone (0.81 ± 0.06) (FIGS. 4E and 4F). A summary of the overall mechanism through which BMP2 / 7-EV donate bioactive ligands BMP2 and BMP7 to result in SMAD phosphorylation and bone formation is depicted in FIG. 4G. Since noggin pre-treatment of BMP2 / 7-EV did not impact efficacy, the results suggested that the BMP polypeptides were encapsulated within the extracellular vesicle (FIG. 4G). Further, DMH1 inhibition of SMAD phosphorylation pointed to BMP2 / 7-EV induced BMPRI / II activation of pSMAD and subsequent nuclear translocation to cause the transcriptional changes (FIG.4G).
[0214] In vivo application of BMP 2 / 7 -EV to facilitate bone regrowth in a rat calvarial defect model: Based on their superior performance in vitro, BMP2 / 7-EV were selected for further in vivo testing to evaluate their ability to augment bone formation. For in vivo delivery, BMP2 / 7-EV were combined with collagen to form a gel scaffold, allowing for sustained EV release over time. FIG. 5A shows representative scanning electron microscope images of homogeneously BMP2 / 7 -EV -coated collagen fibril. To evaluate the impact of BMP2 / 7-EV on bone healing, a rat calvarial critical defect model with a 5 mm unilateral lesion was employed. Following the creation of a lesion, one of several treatments was applied: collagen (vehicle control), rhBMP2 (2.5 pg) in collagen, or BMP2 / 7-EV (4e9 particles) in collagen (FIG. 5B). Micro-CT was performed on days 30, 45, and 75 to produce renderings of the defects and demonstrate the areas of bone healing (FIG. 5C) Micro-CT was also used to generate images depicting bone thickness on days Attorney Docket No. 07039-2346WO1
[0215] 2024-506
[0216] 30, 45, and 75 (FIG. 5D). Quantification by micro-CT on day 30 demonstrated that rhBMP2 (58.42% ± 1.7%, p = 0.0006 vs collagen, p = 0.0393 vs BMP2 / 7-EV) significantly increased bone volume per total volume (BV / TV) compared to both collagen (32.32% ± 3.1%) and BMP2 / 7-EV groups (44.00% ± 4.8%) (FIG. 5E). The percentage of bone area healed as determined by micro-CT on day 30 was increased with rhBMP2 treatment (99.68% ± 0.1%, p = 0.0164) compared to collagen treatment (84.44% ± 4.0%), while BMP2 / 7-EV treatment (93.63% ± 3.5%, p = 0.14) showed no significant difference compared to collagen treatment (FIG. 5E). On day 45, both the rhBMP2 (67.45% ± 1.5%, p = 0.0025) and BMP2 / 7-EV (59.37% ± 4.9%, p = 0.0283) groups showed significantly increased BV / TV compared to collagen (43.28% ± 4.0%) (FIG. 5E). On day 45, bone area also was significantly increased in the rhBMP2 group (99.87% ± 0.1%, p = 0.0081) and the BMP2 / 7-EV group (98.51% ± 1.1%, p = 0.0157) as compared to the collagen group (89.91% ± 2.9%) (FIG. 5E). In addition, on day 75 both the rhBMP2 group (70.64% ± 3.5%, p= 0.0374) and the BMP2 / 7-EV group (70.21% ± 3.1%, p = 0.0337) showed significantly increased BV / TV compared to the collagen group (54.81% ± 4.8%) (FIG. 5E). Also on day 75, however, only the BMP2 / 7-EV group (99.76% ± 0.1%, p = 0.0490) showed a significant increase in bone area compared to the collagen group (94.53% ± 2.3%), as the rhBMP2 group (99.48% ± 0.1%, p = 0.0573) did not reach a statistical significance (FIG. 5E).
[0217] Histologic analysis of hematoxylin and eosin (H&E) stained rat calvarium on day 30 showed significantly increased variation in bone thickness in the BMP2 / 7-EV group (575.3 pm ± 205.3 pm, p = 0.0105) compared to the healthy control (163.6 pm ± 18.7 pm). No significant difference was observed in the collagen (194 pm ± 44.5, p = 0.9929 pm) or rhBMP2 (405.1 pm ± 120.5 pm, p = 0.1215) groups compared to the control (FIG. 6B and FIG. 15). However, by day 75, the variation had normalized, and there was no significant difference between any of the groups (FIG.6C and FIG. 16). The ratio of marrow' area to the total bone area was also quantified, revealing a significant increase in the ratio in the rhBMP2 group (0.1283 ± 0.01, p = 0.0020 vs control, p = 0.0040 vs collagen) and the BMP2 / 7-EV group (0.1156 ± 0.03, p = 0.0049 vs control, p = 0.0094 vs collagen) on day 75, as compared to both the healthy control group (0.04050 ±0.007) and the collagen group (0.03059 ± 0.01, p = 0.9620 vs control) (FIG. 6D and FIG. 16). Marrow- area could not be quantified at 30 days due to the amount of fibrous tissue and cartilage that prevented accurate identification of marrow spaces. Bone thickness was Attorney Docket No. 07039-2346WO1
[0218] 2024-506
[0219] quantified on day 30, and both the rhBMP2 group (640.3 pm ± 89.0 pm, p = 0.0315) and the BMP2 / 7-EV group (753.7 pm ± 139.8 pm, p = 0.0041) showed a significant increase compared to the healthy controls (401.8 pm ± 18.5), but no difference was observed when compared to the collagen group (495.3 pm± 67.5 pm, p = 0.4829 versus rhBMP2, p = 0.1107 versus BMP2 / 7-EV, p = 0.6996 versus control) (FIG.6E and FIG. 15). On day 75, bone thickness had significantly increased in only the BMP2 / 7-EV group (729.9 pm ± 73.1 pm, p = 0.0002 vs control, p = 0.0017 vs collagen) compared to both the healthy control group (425.0 pm ± 16.2 pm) and the collagen group (420.6 pm ± 74.6 pm), while the rhBMP2 group (563.8 pm± 78.0 pm, p = 0.1858 vs control, p = 0.2954 vs collagen) did not show a significant difference (FIG. 6F and FIG. 16).
[0220] As mast cells play a role in bone healing, toluidine blue staining was used to quantify the number of cells per area of bone tissue. On day 30, there was a significant increase in the number of mast cells / area in the rhBMP2 group (26.91 ± 12.9, p = 0.0071) compared to the healthy controls (0.6204 ± 0.1), but the collagen group (3.764 ± 1.7, p = 0.9755 vs control, p = 0.0789 vs rhBMP2) and the BMP2 / 7-EV group (6.191 ± 3.9, p = 0.8831 vs control, p = 0.9938 vs collagen) showed no significant difference vs control (FIGS. 17A and 17B) On day 75, there was a significant increase in number of mast cells / area in both the rhBMP2 group (17.41 ± 5.8, p = 0.0129 vs control) and the BMP2 / 7-EV group (19.89 ± 4.1, p = 0.0012 vs control) compared to the healthy control (4.448 ± 1.0). A significant increase in number of mast cells / area was also observed in the BMP2 / 7-EV group compared to the collagen group (6.059 ± 3.0, p = 0.9713 vs control, p = 0.0944 vs rhBMP2, p = 0.0208 vs BMP2 / 7-EV) (FIGS. 17A and 17C). To further corroborate these findings, immunohistochemical staining of mast cell marker CD117 (c-kit) was used. CD117 staining demonstrated a significant increase in the number of mast cells / area in the rhBMP2 group (36.26 ± 20.27, p = 0.0190) at 30 days compared to the healthy control group (0.92 ± 0.28). There was no significant difference observed for the collagen group (3.76 ± 1.02, p = 0.9948) or the BMP2 / 7-EV group (8.82 ± 4.71, p = 0.9056) compared to the control (FIGS. 18A and 18B). At 75 days, there was a significant increase in the number of mast cells / area in the BMP2 / 7-EV group (16.19 ± 5.69, p = 0.0022) compared to the healthy control group (2.29 ± 0.52), with no significant difference observed in either the collagen group (5.35 ± 2.88, p = 0.8162) or the rhBMP2 group (8.52 ± 4.01, p = 0.3589) compared to the controls (FIGS. 18A and 18B). Attorney Docket No. 07039-2346WO1
[0221] 2024-506
[0222] Alpha-smooth muscle actin staining was used to evaluate changes in blood vessel formation throughout the healing process. At 30 days, there was no change in the number of blood vessels per area of bone (pm2) in any of the groups (healthy control 1.2e5 ± 5.4e6, collagen 8.2e6 ± 4.4e6, rhBMP2 1.9e5 ± 8.9e6, BMP2 / 7-EV 6.6e6 ± 1.3e6) (FIGS. 19A and 19B). However, the average blood vessel area (pm2) per pm2of bone was significantly increased in the rhBMP2 group (4.2e4 ± 1.8e4, p = 0.0407) compared to the healthy control group (5.3e5 ± 3.0e5), while the collagen group (1. Ie5 ± 1. Ie5, p = 0.9901) and the BMP2 / 7-EV group (3.0e4 ± 1.9e4, p = 0.3188) showed no significant changes (FIGS. 19A and 19C). The total blood vessel area (pm2) per pm2of bone also was not significantly increased in the rhBMP2 group (0.01 ± 0.007, p = 0.0214) compared to the healthy control group (1.9e4 ± 1.6e4). and the collagen group (1. Ie5 ± 1. Ie5, p > 0.9999) and the BMP2 / 7-EV group (0.002 ± 5.6e4, p = 0.9327) showed no significant changes (FIGS. 19A and 19D).
[0223] At 75 days, there was no change in number of blood vessels per area of bone (pm2) in any of the groups (healthy control 6.6e6 ± 1.0e6. collagen 1.8e6 ± 4.8e7, rhBMP2 9.4e6 ± 7.2e6, BMP2 / 7-EV 5.8e6 ± 2. Ie6) (FIGS. 20A and 20B). Average blood vessel area (pm2) per pm2of bone was also unchanged compared to the healthy control group (healthy control 5.2e5 ± 2.3e5, collagen l.le4 ± 6. Ie5, rhBMP2 1.0e4 ± 3.4e5, BMP2 / 7-EV 2.1e4 ± 8.0e5) (FIGS. 20A and 20C). The total blood vessel area (pm2) per pm2of bone also did not significantly change compared to the healthy control group (healthy control 1.7e4 ± 9.5e5, collagen 2.2e4 ± 1.2e4, rhBMP22.7e4 ± 1.0e4, BMP2 / 7-EV 5.2e4 ± 2.2e4) (FIGS. 20 A and 20D).
[0224] For further evaluation of capillary formation, staining with the endothelial cell marker CD34 was utilized. At 30 days, the number of blood vessels per area of bone (pm2) was significantly increased with the BMP2 / 7-EV treatment (5.0e5 ± 8.3e6 SEM, p < 0.0001 vs healthy control, collagen and rhBMP2) compared to the healthy control (7.5e6 ± 1.0e6 SEM), the collagen (1.3e5 ± 2.4e6 SEM), and the rhBMP2 (1.3e5 ± 1.6e6 SEM) treatments (FIGS. 21A and 21B). There was no significant difference in either the collagen (p = 0.4965) or the rhBMP2 (p = 0.4344) groups compared to the healthy control (FIGS. 21A and 21B) Further, no significant difference was observed in the average blood vessel area (pm2) per pm2of bone in the collagen (1.7e4 ± 6.7e5 SEM, p = 0.4293), rhBMP2 (2.3e4 ± 7.9e5 SEM, p = 0.7184), or BMP2 / 7-EV (1.4e4 ± 4.9e5 SEM, p = 0.3142) groups compared to healthy controls (3.3e4 ± 5.5e5 SEM) at 30 days post- Attorney Docket No. 07039-2346WO1
[0225] 2024-506
[0226] treatment (FIGS. 21A and 21C). The total blood vessel area (pm2) per pm2of bone was significantly increased in the BMP2 / 7-EV group (0.032 ± 0.010 SEM, p < 0.0001 vs healthy control, p = 0.0005 vs collagen, p = 0.0011 vs rhBMP2) compared to the healthy control (0.004 ± 7.9e4 SEM), the collagen (0.004 ± 1.2e3 SEM), and the rhBMP2 (0.007 ± 1.2e3 SEM) groups (FIGS. 21A and 21D). No significant difference was seen in the collagen group (p = 0.9977) or the rhBMP2 group (p = 0.8612) compared to the healthy control group (FIGS. 21A and 21D).
[0227] At 75 days, there was a significant increase in the number of blood vessels per area of bone (pm2) in both the rhBMP2 group (1.0e5 ± 8.6e7 SEM, p = 0.0009) and the BMP2 / 7-EV group (1.4e5 ± 2.1e6, p < 0.0001 vs healthy control and collagen) compared to the healthy control group (5.1e6 ± 3.8e7), while there was no significant difference in the collagen group (6.6e6 ± 6.3e7 SEM, p = 0.6561) (FIGS. 22A and 22B). There was no significant difference in the average blood vessel area (pm2) per pm2of bone in the collagen group (1.9e4 ± 4.8e5 SEM, p = 0.5467), the rhBMP2 group (1.4e4 ± 2.2e5 SEM, p = 0.2853), or the BMP2 / 7-EV group (1.3e4 ± 3.8e5. p = 0.2068) compared to the healthy control (3.0e4 ± 5.2e5 SEM) (FIGS. 22A and 22C). Similarly, there was no significant difference in the total blood vessel area (pm2) per pm2of bone in the collagen group (2.2e3 ± 2.9e4 SEM, p = 0.6774), the rhBMP2 group (4.4e3 ± 5.8e4 SEM, p = 0.6529), or the BMP2 / 7-EV group (5. Ie3 ± 9.7e4 SEM. p = 0.2519) compared to the healthy control (3.2e3 ± 5.5e4 SEM) (FIGS. 22A and 22D).
[0228] Taken together, these studies demonstrated the feasibility of generating MSC-derived EVs containing BMP2 and BMP7 to successfully deliver bioactive proteins. Exosome uptake resulted in activation of recipient cell BMPRI / II and SMAD phosphorylation to cause transcriptional changes and yield enhanced bone healing in vivo. Probing the response to DMH1 and Noggin treatment also provided insight into the autocrine / paracrine mechanism through which EV can activate signaling in recipient cells.
[0229] Example 2: Minicircle DNA expressing BMP2 promoted osteogenic differentiation of mesenchymal stem cells
[0230] METHODS
[0231] Study design: Studies were conducted to construct recombinant minicircle DN A containing a BMP2 over-expression cassette. To validate its efficacy and mechanism of Attorney Docket No. 07039-2346WO1
[0232] 2024-506
[0233] action in vitro, human mesenchymal stem cells (hMSCs) were used to determine the ability' of minicircle-BMP2 to induce osteogenic differentiation of the hMSCs.
[0234] Plasmid generation and optimization: A nucleotide sequence for human BMP2 was retrieved from Ensembl and coding sequences were noted. Codon optimization was conducted using GeneWiz (Azenta). A codon-optimized BMP2 coding sequence was synthesized (GenScript). with a Kozak sequence (GCCACCATGG; SEQ ID NO:38) in front of the start codon. BMP2 was cloned into the minicircle parental cloning vector pMC.EFla-MCS-SV40polyA (System Biosciences, # MN502A-1), and the resulting mcDNA was designated pMC-EFl-BMP2-pA.
[0235] Minicircle DNA preparation: The ZYCY10P3S2T E. coli Minicircle Producer Strain was used for transformation, and mini circle DNA-BMP2 was produced and extracted using the MC-Easy™ Minicircle Production Kit (System Biosciences, #MN920A-l) and the QIAGEN MAXI kit. Briefly, transformed ZYCY10P3S2T E. coli SNQK cultured in growth medium (TB) for 15 hours at 30°C, and then arabinose induction medium was added (final arabinose 2%) and continuously cultured for 4 more hours. The QIAGEN MAXI kit was used to extract minicircle DNA.
[0236] MSC cell culture and minicircle DNA transfection: Human adipose-derived MSCs (Lonza, #PT-5006) were cultured in a humidified incubator at 37°C with 5% CO2. The MSC culture medium was high glucose DMEM (Gibco, #10569010) containing 2.5% PLTMax, 100 units / mL penicillin, and 100 mg / mL streptomycin. For osteogenic differentiation, the osteogenic medium consisted of MSC medium supplemented with 50 pg / mL ascorbic acid (Sigma), 10 mM P-glycerol phosphate (Sigma), and 40 ng / mL dexamethasone (V etOne, #501012). Minicircle DNA was transfected into MSC using 1.5 pg minicircle DNA with 4 pL LIPOFECTAMINE™ 2000 in a 12-well plate.
[0237] Real-time-quantitative reverse-transcriptase PCR (RT-qPCR): RNA was isolated using the RNEASY® Plus kit (Qiagen, #74034) according to the manufacturer’s instructions. RT-qPCR was subsequently performed using the QUANTITECT* SYBR® Green RT-PCR kit (Qiagen, #204243) according to the manufacturer’s instructions, with the primers listed in TABLE 3. Attorney Docket No. 07039-2346WO1
[0238] 2024-506
[0239] TABLE 3: RT-qPCR primer sequences
[0240]
[0241] Mineralization staining: Cells were cultured in osteogenic differentiation medium for 16-20 days. EVs were added to the medium on days 0 and 3. The culture medium was removed from each well and the cells were gently washed 3 times with PBS. Cells were then fixed in 4% formaldehyde for 15 minutes at room temperature, and washed 3 times with water. Calcium deposition was evaluated using an alizarin red assay (Puchtler et al., J Histochem. Cytochem., 17(2): 110-124 (1969)). For the 12-well plate, 0.5 mL of40 mM alizarin red solution was added per well, and the plate was incubated at room temperature for 20 minutes with gentle shaking. The staining solution was removed and the cells were washed 5 times with water. Scanning images were then obtained.
[0242] RESULTS
[0243] Expression of BMP 2 from minicircle-BMP2 (MC-BMP2) transfected hMSCs: Schematics of the minicircle expression cassette is shown in FIG. 23A. A codon- optimized human BMP2 sequence (SEQ ID NO: 1; FIG. 7A) w as used to improve the expression and translational efficiency from the minicircle vector. hMSCs were transfected with MC-BMP2. Cells were collected at different time points and total RNA was prepared. Real-time quantitative reverse-transcriptase PCR (RT-qPCR) demonstrated a significant increase in the expression of BMP2 mRNA in the MSCs transfected with MC-BMP2 (FIG. 23B), with increased expression lasting for 14 days after transfection.
[0244] In vitro osteogenic induction of hMSCs: hMSCs were used to evaluate the effects of MC-BMP2 on bone formation in vitro. In particular, calcium deposition was evaluated using the alizarin red assay. hMSCs were transfected with MC-BMP2, and differentiation of the cells was induced by adding osteogenic differentiation medium. On day 23, calcium deposition evaluated, and was found to be significantly increased in transfected hMSCs (FIG. 23C, lower panel) as compared with controls (FIG. 23C, upper panel). This result indicated that the BMP2-expressing mcDNA promoted osteogenic differentiation of the hMSCs. Attorney Docket No. 07039-2346WO1
[0245] 2024-506
[0246] To further investigate the osteogenic effects of MC-BMP2, hMSCs were used in studies to determine whether BMP-endowed EVs could induce bone formation in cells that were not yet lineage-specified toward an osteogenic fate. MC-BMP2 transfected hMSCs were cultured in DMEM with 10% EV-depleted FBS for 2 days. The conditioned medium was collected, and debris was removed by centrifuging at 3000 rpm for 20 minutes. EVs were then concentrated using an AMICON Ultra-15 centrifugal filter unit with a 100 kDa size cutoff. The flow-through was used as a negative control. hMSCs were treated with osteogenic differentiation medium supplemented with (1) whole conditioned medium from MC-BMP2 transfected MSCs, (2) EVs from the conditioned medium, or (3) flow-through. After 21 days, alizarin red staining (calcium deposition) was found to be significantly increased in hMSCs cultured with EVs derived from MC-BMP2 transfected hMSCs (FIG. 23D, lower panel), as compared with the whole medium control (FIG. 23D, upper panel) or the flow -through controls (FIG. 23D, middle panel). These results indicated that EVs secreted from MC-BMP2 transfected cells can mediate the osteogenic differentiation of MSCs. Thus, these studies demonstrated the feasibility’ of generating MSC-derived EVs by BMP2 mcDNA (MC-BMP2) transfection to successfully deliver bioactive proteins.
[0247] OTHER EMBODIMENTS
[0248] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.
Claims
Attorney Docket No. 07039-2346P012024-506WHAT IS CLAIMED IS:
1. A mammalian mesenchymal stem cell comprising exogenous nucleic acid, wherein said exogenous nucleic acid comprises:(a) a nucleotide sequence encoding a mammalian bone morphogenic protein 2 (BMP2) polypeptide, or(b) a nucleotide sequence encoding a mammalian BMP2 polypeptide, a bone morphogenic protein 7 (BMP7) polypeptide, and a cleavable linker located between said BMP2 polypeptide and said BMP7 polypeptide,wherein said nucleotide sequence of (a) or (b) is operably linked to a promoter sequence.
2. The mammalian mesenchymal stem cell of claim 1, wherein said nucleotide sequence encoding said BMP2 polypeptide comprises the nucleotide sequence set forth in SEQ ID NOT.
3. The mammalian mesenchymal stem cell of claim 1, wherein said nucleotide sequence encoding said BMP2 polypeptide comprises a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:1.
4. The mammalian mesenchymal stem cell of claim 1, wherein said nucleotide sequence encoding said BMP7 polypeptide comprises the nucleotide sequence set forth in SEQ ID NO:2.
5. The mammalian mesenchymal stem cell of claim 1, wherein said nucleotide sequence encoding said BMP7 polypeptide comprises a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:2.
6. The mammalian mesenchymal stem cell of claim 1, wherein said BMP2 polypeptide comprises the amino acid sequence set forth in SEQ ID NO: 30.
7. The mammalian mesenchymal stem cell of claim 1, wherein said BMP2 polypeptide comprises an amino acid sequence having at least 95% sequence identity to SEQ ID NOTO.
8. The mammalian mesenchymal stem cell of claim 1, wherein said BMP7 polypeptide comprises the amino acid sequence set forth in SEQ ID NO: 31.Attorney Docket No. 07039-2346P012024-5069. The mammalian mesenchymal stem cell of claim 1, wherein said BMP7 polypeptide comprises an amino acid sequence having at least 95% sequence identity to SEQ ID NOTE10. The mammalian mesenchymal stem cell of any one of claims 1-9, wherein said cleavable linker is a T2A linker.
11. The mammalian mesenchymal stem cell of any one of claims 1-3, 6, 7, and 10, wherein said exogenous nucleic acid comprises said nucleotide sequence of (a).
12. The mammalian mesenchymal stem cell of any one of claims 1-10, wherein said exogenous nucleic acid comprises said nucleotide sequence of (b).
13. The mammalian mesenchymal stem cell of any one of claims 1-12, wherein said exogenous nucleic acid forms part of a lentivirus construct.
14. An extracellular vesicle (EV) from a mammalian mesenchymal stem cell, wherein said mammalian mesenchymal stem cell comprises exogenous nucleic acid, wherein said exogenous nucleic acid comprises:(a) a nucleotide sequence encoding a mammalian bone morphogenic protein 2 (BMP2) polypeptide, or(b) a nucleotide sequence encoding a mammalian BMP2 polypeptide, a bone morphogenic protein 7 (BMP7) polypeptide, and a cleavable linker,wherein said nucleotide sequence of (a) or (b) is operably linked to a promoter sequence, and wherein said EV comprises (i) said BMP2 polypeptide or (ii) said BMP2 polypeptide and said BMP7 polypeptide.
15. The EV of claim 14, wherein said nucleotide sequence encoding said BMP2 polypeptide comprises the nucleotide sequence set forth in SEQ ID NO: 1.
16. The EV of claim 14, wherein said nucleotide sequence encoding said BMP2 polypeptide comprises a nucleotide sequence having at least 95% sequence identity to SEQ ID NOT.
17. The EV of claim 14, wherein said nucleotide sequence encoding said BMP7 polypeptide comprises the nucleotide sequence set forth in SEQ ID NO: 2.Attorney Docket No. 07039-2346P012024-50618. The EV of claim 14, wherein said nucleotide sequence encoding said BMP7 polypeptide comprises a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:2.
19. The EV of claim 14, wherein said BMP2 polypeptide comprises the amino acid sequence set forth in SEQ ID NO: 30.
20. The EV of claim 14, wherein said BMP2 polypeptide comprises an amino acid sequence having at least 95% sequence identity7to SEQ ID NO:30.
21. The EV of claim 14, wherein said BMP7 polypeptide comprises the amino acid sequence set forth in SEQ ID NO:31.
22. The EV of claim 14, wherein said BMP7 polypeptide comprises an amino acid sequence having at least 95% sequence identity to SEQ ID NO:31.
23. The EV of any one of claims 14-22, wherein said cleavable linker is a T2A linker.
24. The EV of any one of claims 14-16 and 23, wherein said exogenous nucleic acid comprises said nucleotide sequence of (a).
25. The EV of any one of claims 14-23, wherein said exogenous nucleic acid comprises said nucleotide sequence of (b).
26. The EV of any one of claims 14-25, wherein said exogenous nucleic acid forms part of a lentivirus construct.
27. An extracellular vesicle (EV) from a mammalian mesenchymal stem cell, wherein said EV comprises:(a) an exogenous bone morphogenic protein 2 (BMP2) polypeptide, or(b) an exogenous BMP2 polypeptide and an exogenous bone morphogenic protein 7 (BMP7) polypeptide.
28. The EV of claim 27, wherein said BMP2 polypeptide comprises the amino acid sequence set forth in SEQ ID NO: 30.
29. The EV of claim 27, wherein said BMP2 polypeptide comprises an amino acid sequence having at least 95% sequence identity to SEQ ID NO:30.Attorney Docket No. 07039-2346P012024-50630. The EV of claim 27, wherein said BMP7 polypeptide comprises the amino acid sequence set forth in SEQ ID NO:31.
31. The EV of claim 27, wherein said BMP7 polypeptide comprises an amino acid sequence having at least 95% sequence identity to SEQ ID NO:31.
32. The EV of any one of claims 27-29, wherein said EV comprises said BMP2 polypeptide but does not comprise said BMP7 polypeptide.
33. The EV of any one of claims 27-31, wherein said EV comprises both said BMP2 polypeptide and said BMP7 polypeptide.
34. A composition comprising a pharmaceutically acceptable carrier and extracellular vesicles (EVs) from a mammalian mesenchymal stem cell, wherein said EVs comprise:(a) an exogenous bone morphogenic protein 2 (BMP2) polypeptide, or(b) an exogenous BMP2 polypeptide and an exogenous bone morphogenic protein 7 (BMP7) polypeptide.
35. The composition of claim 34, wherein said BMP2 polypeptide comprises the amino acid sequence set forth in SEQ ID NO: 30.
36. The composition of claim 34, wherein said BMP2 polypeptide comprises an amino acid sequence having at least 95% sequence identity to SEQ ID NO:30.
37. The composition of claim 34, wherein said BMP7 polypeptide comprises the amino acid sequence set forth in SEQ ID NO:31.
38. The composition of claim 34, wherein said BMP7 polypeptide comprises an amino acid sequence having at least 95% sequence identity to SEQ ID NO:31.
39. The composition of any one of claims 34-38, wherein said composition further comprises collagen.
40. The composition of any one of claims 34-36 and 39, wherein said EVs comprise said BMP2 polypeptide but do not comprise said BMP7 polypeptide.
41. The composition of any one of claims 34-39, wherein said EVs comprise both said BMP2 polypeptide and said BMP7 polypeptide.Attorney Docket No. 07039-2346P012024-50642. A method for treating a bone defect in a mammal, wherein said method comprises contacting said bone defect with a composition comprising a pharmaceutically acceptable carrier and extracellular vesicles (EVs) from a mammalian mesenchymal stem cell, wherein said EVs comprise:(a) an exogenous bone morphogenic protein 2 (BMP2) polypeptide, or(b) an exogenous BMP2 polypeptide and an exogenous bone morphogenic protein 7 (BMP7) polypeptide.
43. The method of claim 42, wherein said mammal is a human.
44. The method of claim 42, wherein said mammal is a rat, a mouse, a rabbit, a dog, a cat, a horse, a cow, a goat, a sheep, a pig, or a non-human primate.
45. The method of any one of claims 42-44, wherein said bone defect is selected from the group consisting of traumatic breaks, non-union fractures, loose joints or bone prostheses, spinal fusion, vertebral compression fractures, and radiation osteonecrosis.
46. The method of any one of claims 42-45, wherein said BMP2 polypeptide comprises the amino acid sequence set forth in SEQ ID NO:30.
47. The method of any one of claims 42-45, wherein said BMP2 polypeptide comprises an amino acid sequence having at least 95% sequence identity to SEQ ID NO:30.
48. The method of any one of claims 42-47, wherein said BMP7 polypeptide comprises the amino acid sequence set forth in SEQ ID NO:31.
49. The method of any one of claims 42-47, wherein said BMP7 polypeptide comprises an amino acid sequence having at least 95% sequence identity to SEQ ID NO:31.
50. The method of any one of claims 42-47, wherein said EVs comprise said BMP2 polypeptide but do not comprise said BMP7 polypeptide.
51. The method of any one of claims 42-49, wherein said EVs comprise both said BMP2 polypeptide and said BMP7 polypeptide.Attorney Docket No. 07039-2346P012024-50652. The method of any one of claims 42-51, wherein said composition further comprises collagen.
53. The method of any one of claims 42-52, wherein said contacting comprises applying, to said bone defect, said composition in an amount of about 1 mL per cm2of said bone defect, and wherein said composition comprises about 1 x IO10to about 1 x 1011of said EVs per mL.
54. A recombinant minicircle DNA comprising an exogenous nucleic acid, wherein said exogenous nucleic acid comprises:(a) a nucleotide sequence encoding a mammalian bone morphogemc protein 2 (BMP2) polypeptide, or(b) a nucleotide sequence encoding a mammalian BMP2 polypeptide, a bone morphogenic protein 7 (BMP7) polypeptide, and a cleavable linker,wherein said nucleotide sequence of (a) or (b) is operably linked to a promoter sequence, and wherein said recombinant minicircle DNA, after introduction into a cell, overexpresses (i) said BMP2 polypeptide or (ii) said BMP2 polypeptide and said BMP7 polypeptide in said cell.
Citation Information
Patent Citations
Nucleic acid therapy to enhance cartilage repair
US20050197304A1
Designer osteogenic proteins
US20120046227A1