Gene zmko1 for regulating flowering and pollen shedding of maize tassel and use thereof in maize male sterile hybrid seed production

By regulating the ZmKO1 gene that controls pollen shedding from male spikelets in maize, and utilizing CRISPR-Cas9 gene editing and backcrossing, a male-sterile line in maize was created. This solved the problem of emasculation in maize hybrid seed production, achieving efficient and stable propagation of sterile lines and preparation of hybrid seeds, and is applicable to the two-line method of maize seed production.

WO2026108486A1PCT designated stage Publication Date: 2026-05-28SICHUAN MAOFENG AGRICULTURAL TECHNOLOGY CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
SICHUAN MAOFENG AGRICULTURAL TECHNOLOGY CO LTD
Filing Date
2025-10-17
Publication Date
2026-05-28

AI Technical Summary

Technical Problem

In the current process of maize hybrid seed production, manual and mechanical demasing is time-consuming, labor-intensive, costly, and causes significant mechanical damage. Furthermore, the existing male-sterile lines are unstable in reproduction and cannot meet commercial needs. In particular, there is a shortage of materials for maize two-line seed production technology, and fertility conversion is incomplete and unstable.

Method used

By using genetic engineering techniques, especially CRISPR-Cas9 gene editing and gene backcrossing, the ZmKO1 gene, which controls the flowering and pollen shedding of maize male spikelets, was regulated. By altering its DNA sequence or regulating transcriptional expression, the male spikelets of maize were prevented from flowering and shedding pollen, thus achieving male sterility. Under specific conditions, gibberellin was sprayed to restore fertility, creating a male-sterile maize line.

Benefits of technology

It achieves efficient propagation and stability of male-sterile maize lines, reduces seed production costs, ensures the purity and yield of hybrids, and has the characteristic of dual use. It can be used as a sterile line under specific conditions, and its fertility can be restored by exogenous application of gibberellin. It is suitable for maize two-line hybrid seed production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2025128569_28052026_PF_FP_ABST
    Figure CN2025128569_28052026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention belongs to the field of plant genetic engineering. Provided is a gene ZmKO1 for regulating flowering and pollen shedding of a maize tassel. Mutating the gene ZmKO1 can lead to a genic male sterility phenomenon. The breeding of a maize genic male sterile line can be achieved on the basis of the gene ZmKO1 site using the CRISPR-Cas9 technology or mutant gene backcross breeding technology. In the silking stage of the sterile line, spraying exogenous gibberellin on the tassel can restore fertility in male flowers of the sterile line, enabling normal self-pollination and reproduction, thereby achieving an economical and efficient maintenance of the sterile line as a maintainer line. The genic male sterile line created on the basis of the ZmKO1 gene site has the characteristic of one line for two uses, and can be used for maize male sterile hybrid seed production. Further provided is a technical system for achieving maize two-line sterile hybrid seed production using ZmKO1 gene mutations.
Need to check novelty before this filing date? Find Prior Art

Description

ZmKO1, a gene that regulates flowering and pollen shedding of maize male spikelets, and its application in male-sterile hybrid seed production in maize.

[0001] This application claims priority to Chinese patent application filed on November 19, 2024, application number 202411650856.3, entitled "A gene ZmKO1 regulating flowering and pollen shedding of maize male spikelets and its application in maize male-sterile hybrid seed production", the contents of which shall be understood to be incorporated herein by reference. Technical Field

[0002] This application relates to the field of plant genetic engineering, and in particular to a gene ZmKO1 that regulates the flowering and pollen shedding of maize male spikelets and its application in maize male-sterile hybrid seed production. Background Technology

[0003] Maize is one of the world's most important food crops. In the 1930s, the application of heterosis in maize led to a rapid increase in yield. Heterosis is a common genetic phenomenon in the biological world, referring to the phenomenon where a heterozygote is superior to both parents in one or more traits. As a monoecious, cross-pollinating crop, maize has seen very successful applications of heterosis in production. Currently, hybrid varieties are the main type of maize seed used in production. To ensure the purity of hybrid varieties, emasculation of the female parent is necessary during maize hybrid seed production to prevent self-pollination and ensure that the female parent only accepts pollen from the male parent for hybrid seed production. The quality of emasculation largely determines the yield and purity of the hybrid variety and is a crucial step in seed production.

[0004] Methods for detasseling maize include manual detasseling, mechanical detasseling, chemical detasseling, and the use of male-sterile lines. Due to the potential risks of chemical detasseling agents, including incomplete pollen death, reduced female fertility, and environmental pollution, their large-scale application is limited. Currently, manual and mechanical detasseling remain the main methods used in commercial maize hybrid seed production. Manual detasseling is highly controllable, widely applicable, and simple to operate, making it the primary method used in maize hybrid seed production in my country. However, manual detasseling is time-consuming and labor-intensive, and its cost is increasing year by year. Furthermore, manual detasseling often results in untimely or incomplete detasseling, affecting seed quality. With the acceleration of urbanization and the continuous flow of rural labor to urban areas and non-agricultural industries, the problem of manual detasseling will persist and become increasingly severe. In recent years, many seed companies have also attempted mechanical detasseling, but the large investment in equipment, unstable detasseling quality, and significant plant damage from mechanical detasseling reduce seed yield, limiting its large-scale application. Therefore, detasseling remains a major challenge in maize hybrid seed production in my country.

[0005] Using male-sterile lines as the female parent for hybrid seed production eliminates the need for emasculation, saving labor costs, reducing production costs, and ensuring hybrid purity. Plant male sterility is classified into cytoplasmic male sterility (CMS) and nuclear male sterility (GMS). However, the CMS sterilization system for maize faces several unresolved issues, including low genetic diversity in sterile and restorer lines, susceptibility of sterile cytoplasmic materials to specialized pathogen infection, and the influence of environmental and genetic background on abortion stability and fertility recovery stability, limiting its widespread application. In contrast, GMS, with its stable and complete abortion, boasts abundant genetic resources, with most exhibiting recessive single-gene control and simple fertility recovery, making it an ideal type of sterility for hybrid seed production. However, due to its nuclear genetic characteristics, GMS cannot be efficiently propagated, failing to meet seed production demands and hindering its application in commercial maize hybrid seed production.

[0006] To address the challenge of efficient propagation of maize GMS, Pioneer developed a seed production technology (SPT) based on recessive male sterility (Wu et al., 2016, Development of a novel recessive genetic male sterility system for hybrid seed production in maize and other cross-pollinating crops. Plant Biotechnol J.14(3):1046-54). This technology enabled efficient propagation of non-transgenic male sterile lines through transgenic technology. Although SPT technology achieved efficient propagation of GMS, it still had a transgenic drift frequency of 0.002%-0.518%. The subsequently developed "multicontrol sterility system" can reduce the transgenic drift frequency to 1 / 8-1 / 7 of that of SPT, but it still cannot completely eliminate it (Zhang et al., 2018, Construction of a multicontrol sterility system for a maize male-sterile line and hybrid seed production based on the ZmMs7 gene encoding a PHD-finger transcription factor. Plant Biotechnol J.16(2):459-471). Developing sterile seed production technology that is free of genetically modified components, easy to operate, and has better universality is an urgent need for maize hybrid seed production in my country.

[0007] Environment-sensitive genic male sterility (EGMS) is characterized by fertility conversion primarily controlled by environmental conditions such as temperature and photoperiod. Under specific environmental conditions, it can function as a sterile line; under other environmental conditions, it can serve as a maintainer line for self-pollination to maintain the sterility. By combining a single line with a restorer line, two-line hybrid seed production can be achieved. Currently, two-line seed production technology has seen some successful application in rice hybrid seed production, mainly due to the discovery and utilization of a series of environment-sensitive genic male sterile materials in rice, particularly temperature-sensitive genic male sterile materials. However, maize two-line seed production technology is currently only in the exploratory stage. Its limiting factors include the limited number of discovered environment-sensitive genic male sterile materials in maize and incomplete and unstable fertility conversion. Therefore, collecting, creating, and screening new materials or genes suitable for maize two-line seed production technology can accelerate innovation in maize hybrid seed production technology. Summary of the Invention

[0008] Previously, the inventors screened a mutant in a maize mutagenesis population. During the silking and pollination stage, the male spikelet filaments elongated abnormally, the glumes of the male spikelets did not open, the anthers were not exposed, and the plant could not flower and release pollen, exhibiting male sterility. Genetic analysis showed that this male sterility was controlled by a single recessive nuclear gene, and the mutant was named the stamen filament defective mutant 1 (def1). The mature pollen grains of mutant def1 showed normal I2-IK staining and morphology, and the female ear fertility and other plant traits were normal. During the silking stage, spraying gibberellin could cause the male spikelet filaments of mutant def1 to elongate normally, the glumes to open normally, and the anthers to be exposed and release pollen normally, enabling self-pollination of the mutant, and the seed setting rate was not significantly different from that of the wild type. The DEF1 gene was cloned through map-based cloning and transgenic functional verification. The DEF1 gene locus is Zm00001eb385100 (reference genome: Zm-B73-REFERENCE-NAM-5.0), annotated as the endoroot-kaurene oxidase 1 gene ZmKO1. Currently, there are no reports on the function of the ZmKO1 gene in regulating flowering and pollen shedding of maize male spikelets, nor on its application in the creation of male-sterile lines and sterile hybridization for seed production.

[0009] The purpose of this application is to provide a gene, ZmKO1, that regulates the flowering and pollen shedding of maize male spikelets and its application in maize male-sterile hybrid seed production. Based on the ZmKO1 gene, novel maize lines with both nuclear male sterility and dual male sterility can be developed using genetic engineering or breeding techniques. This dual-purpose sterility line can then be used to construct a two-line hybrid seed production technology for maize, solving the problem of emasculation in existing maize hybrid seed production processes.

[0010] To achieve the above objectives, this application provides the following solution:

[0011] This application provides for the use of the ZmKO1 gene in any of the following:

[0012] (1) Application in regulating the development of silks in maize male spikelets;

[0013] (2) Application in regulating the opening of the glumes of maize male spikelets;

[0014] (3) Application in regulating the fertility of maize male flowers;

[0015] (4) Application in male-sterile hybrid seed production of maize;

[0016] The ZmKO1 gene is the Zm00001eb385100 gene in the reference genome Zm-B73-REFERENCE-NAM-5.0 in the EnsemblPlants database, and its gene number in the NCBI (National Center of Biotechnology Information) database is 100274015.

[0017] On the other hand, this application provides for the use of the ZmKO1 gene in any of the following:

[0018] (1) Application in regulating pollen shedding from male spikelets of maize;

[0019] (2) Application in regulating the fertility of maize male flowers;

[0020] (3) Application in male-sterile hybrid seed production of maize.

[0021] On the other hand, this application provides for the use of the ZmKO1 gene in any of the following:

[0022] (1) Application in inhibiting pollen shedding from male spikelets of maize;

[0023] (2) Application in producing male sterility in maize;

[0024] (3) Application in male-sterile hybrid seed production of maize.

[0025] The nucleotide sequence of the ZmKO1 gene described in the embodiments of this application is shown in any one of SEQ ID NO:1-3. The nucleotide sequence of the ZmKO1 gene may also be a DNA sequence that has more than 90% identity with the sequence shown in any one of SEQ ID NO:1-3 and has the same function as the sequence shown in any one of SEQ ID NO:1-3.

[0026] This application provides for the use of the protein expressed by the ZmKO1 gene in any of the following:

[0027] (1) Application in regulating the development of silks in maize male spikelets;

[0028] (2) Application in regulating the opening of the glumes of maize male spikelets;

[0029] (3) Application in regulating the fertility of maize male flowers;

[0030] (4) Application in male-sterile hybrid seed production of maize.

[0031] On the other hand, this application provides for the use of the protein expressed by the ZmKO1 gene in any of the following:

[0032] (1) Application in inhibiting pollen shedding from male spikelets of maize;

[0033] (2) Application in producing male sterility in maize;

[0034] (3) Application in male-sterile hybrid seed production of maize.

[0035] More preferably, the amino acid sequence of the protein described in the embodiments of this application is as shown in SEQ ID NO:4. The protein sequence may also be a derived protein sequence having the same function as the amino acid sequence shown in SEQ ID NO:4, by substituting and / or deleting and / or adding one or more amino acid residues.

[0036] This application provides for the use of recombinant vectors containing the ZmKO1 gene in any of the following:

[0037] (1) Application in regulating the development of silks in maize male spikelets;

[0038] (2) Application in regulating the opening of the glumes of maize male spikelets;

[0039] (3) Application in regulating the fertility of maize male flowers;

[0040] (4) Application in male-sterile hybrid seed production of maize.

[0041] On the other hand, this application provides the use of recombinant vectors containing the ZmKO1 gene in any of the following:

[0042] (1) Application in inhibiting pollen shedding from male spikelets of maize;

[0043] (2) Application in producing male sterility in maize;

[0044] (3) Application in male-sterile hybrid seed production of maize.

[0045] Preferably, genetic engineering or gene editing techniques are used to alter the DNA or protein sequence of the ZmKO1 gene or to regulate the transcriptional expression or protein abundance of the ZmKO1 gene, so as to reduce the length of the filaments of the male spikelet of maize and / or close the glumes and / or sterilize the male flower.

[0046] In this application, genetic engineering techniques (including but not limited to gene editing techniques) are used to alter the DNA sequence or protein sequence of the ZmKO1 gene or to regulate the transcriptional expression or protein abundance of the ZmKO1 gene, so that the male spikelets of maize cannot flower and shed pollen, thus making the maize plant male-sterile for use in maize male-sterile hybrid seed production.

[0047] More preferably, the gene editing method in this application embodiment is as follows: inserting or deleting bases in the target sequence of the second exon of the ZmKO1 gene, and the sgRNA sequence for gene editing is 5'-GTCTCTGGTTTACCCCTGAT-3' (SEQ ID NO:7). For example: deleting the 17th base of the target sequence (i.e., the sequence complementary to the sgRNA), or deleting 16 bp consecutively starting from the 6th base of the target sequence, or inserting a T base between the 16th and 17th bases of the target sequence. However, this application is not limited to the above target sites; gene editing at other target sites of the maize ZmKO1 gene to produce male sterility in maize is also within the scope of this application.

[0048] This application provides a method for cultivating male-sterile maize lines, the method comprising (1) using genetic engineering methods to change the transcript sequence or protein sequence of the ZmKO1 gene in the recipient plant or the expression level of the ZmKO1 gene transcription or protein level, and screening out male-sterile lines from the offspring of the recipient plant; or (2) using gene editing technology (including but not limited to CRISPR-Cas9 technology) to edit the ZmKO1 gene of the maize recipient plant and screening out male-sterile maize lines from the offspring of the recipient plant; or (3) using backcrossing to introduce the ZmKO1 gene that can cause male sterility into maize materials with different genetic backgrounds, and creating male-sterile maize lines with different genetic backgrounds.

[0049] This application provides a method for producing maize male-sterile hybrid seeds using a maize male-sterile line cultivated by the method described above, comprising: using a maize male-sterile line as the female parent and a fertile maize inbred line as the male parent, and planting according to the hybrid seed production method, thereby realizing maize male-sterile hybrid seed production.

[0050] This application provides a method for cultivating male-sterile maize lines based on the ZmKO1 gene. The method includes (1) using genetic engineering methods (including but not limited to gene editing technology) to change the transcript sequence or protein sequence of the ZmKO1 gene or the expression level of the ZmKO1 gene transcription or protein level in the recipient plant, and screening out male-sterile maize lines from the offspring of the recipient plant; or (2) using breeding technology (including but not limited to backcrossing) to introduce the ZmKO1 allele, which can cause the male spikelets of maize to fail to flower and shed pollen, thus making the maize plant exhibit male sterility, into maize materials with different genetic backgrounds, and creating male-sterile maize lines with different genetic backgrounds.

[0051] This application provides a method for two-line hybridization of maize using maize male-sterile lines bred based on the ZmKO1 gene, comprising: (1) when propagating maize male-sterile lines bred based on the ZmKO1 gene, the flowering and pollination ability of the maize male-sterile lines is restored by spraying exogenous gibberellin or agricultural growth regulators containing gibberellin during the silking stage, thereby achieving self-pollination of the sterile lines; (2) the maize male-sterile lines bred based on the ZmKO1 gene are used as the female parent and fertile maize inbred lines are used as the male parent, and the maize is planted according to the hybridization method, thereby achieving maize male-sterile hybridization using the ZmKO1 gene.

[0052] This application provides a gene, ZmKO1, that regulates the flowering and pollen shedding of maize male spikelets. The nucleotide sequence of the protein-coding region of this gene transcript is shown in SEQ ID NO:1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO:4. This application confirms that mutations in the ZmKO1 gene can lead to inhibited filament elongation, inability of the glumes to open, and inability of the anthers to release pollen, exhibiting nuclear male sterility, but with normal pollen grain morphology and activity, representing a novel form of maize nuclear male sterility. This application also clarifies that, based on the ZmKO1 gene locus, nuclear male sterility lines in maize can be cultivated using CRISPR-Cas9 gene editing technology or mutant gene backcrossing technology. This application further discovers that spraying exogenous gibberellin or agricultural growth regulators containing gibberellin onto the male spikes during the silking stage of the sterile line can restore the male flowering and pollen shedding ability of the sterile line, achieving economical and efficient maintenance of the sterile line. Therefore, the nuclear male sterile line created based on the ZmKO1 gene locus has the characteristic of being a dual-purpose line. This application also provides a technical system for achieving two-line sterile hybridization of maize using ZmKO1 gene mutation.

[0053] Overview of the attached figures

[0054] To more clearly illustrate the technical solutions in the embodiments of this application or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0055] Figure 1 shows the phenotypic identification results of the maize male-sterile mutant def1 and the wild-type WT. A represents the plant architecture of wild-type WT and mutant def1; B represents the fertility of wild-type WT and mutant def1 at the pollen shedding stage; C represents the spikelet characteristics of wild-type WT and mutant def1 at the pollen shedding stage; D represents the difference in filament elongation of spikelets of wild-type WT and mutant def1 at the pollen shedding stage; E represents the I2-KI staining results of the anthers of wild-type WT; F represents the I2-KI staining results of the anthers of mutant def1; G represents the ear-filling characteristics of wild-type WT; and H represents the ear-filling characteristics of mutant def1.

[0056] Figure 2 shows the phenotypic identification results of the maize male-sterile mutant def1 and the wild-type WT. A represents the plant type of wild-type WT and mutant def1; B represents the fertility of wild-type WT and mutant def1 at the pollen shedding stage; C represents the ear-filling performance of wild-type WT and mutant def1; D represents the spikelet performance of wild-type WT at the pollen shedding stage; E represents the spikelet performance of mutant def1; F represents the image of the spikelet of mutant def1 after it has been peeled open; and G represents the pollen grain I2-KI staining, Alexander staining, and in vitro germination results of wild-type WT and mutant def1.

[0057] Figure 3 shows the gene localization of the def1 mutant; where A is the fine localization of the def1 mutant; and B is the sequence variation characteristics of the key candidate gene Zm00001eb385100.

[0058] Figure 4 shows the promoting effect of gibberellin GA3 on the flowering and pollen shedding of male spikelets in mutant def1; where A represents the flowering and pollen shedding of wild-type WT male spikelets and the self-pollination and seed setting of female spikelets; B represents the flowering and pollen shedding of male spikelets and the self-pollination and seed setting of female spikelets after spraying def1 with 50 mg / L gibberellin GA3.

[0059] Figure 5 shows the transgenic complementation experiment to verify the function of the Zm00001eb385100 gene; where A is a schematic diagram of the expression vector and the results of genomic PCR identification of the transgenic T0 generation; B is the expression of the coding regions of the mutant allele ZmKO1-82 and the wild-type allele ZmKO1 at the transcriptional level of the transgenic T1 generation; C is the fertility performance of the mutant def1 and the transgenic plant.

[0060] Figure 6 shows the verification of the function of the Zm00001eb385100 gene using CRISPR-Cas9 gene editing technology; where A represents the sgRNA site and sequence information; B represents the genomic sequence variation information of the target site in the three gene-edited lines; C represents the protein sequence variation characteristics of the Zm00001eb385100 gene in the gene-edited line; D represents the male sterility of the gene-edited line and the fertility restoration of the edited line by GA3; E is a magnified view of D; and F represents the allelic determination results.

[0061] Figure 7 shows the backcrossing and conversion of male sterility in inbred lines using the mutant def1; where A is the backcrossing and conversion flowchart; B is the male flower fertility phenotype of the maize inbred line Jing92; C is the abortion phenotype of the Jing92A male sterile line bred using backcrossing and conversion; and D is the male flower flowering and pollen shedding phenotype of Jing92A after spraying with 50 mg / L gibberellic acid.

[0062] Figure 8 shows the breeding of male-sterile inbred lines based on the ZmKO1 gene. A is a flowchart of backcrossing and conversion using the def1 mutant to obtain the ZmKO1-82 mutant allele; B shows the fertility of inbred line Jing92, male-sterile line Jing92A, and male-sterile line after GA3 spraying; C shows the fertility of inbred line DH351, male-sterile line DH351A, and male-sterile line after GA3 spraying; D shows the fertility of inbred line Zheng58, male-sterile line Zheng58A, and male-sterile line after GA3 spraying; E shows the fertility of inbred line SCML0849, male-sterile line SCML0849A, and male-sterile line after GA3 spraying.

[0063] Figure 9 shows the two-line sterile hybridization seed production using a male-sterile dual-purpose maize line created with the ZmKO1 gene. def1 / def1 represents the genotype of the sterile line, and DEF1 / DEF1 represents the genotype of the male parent inbred line. A is the reproductive pattern diagram of the sterile line; B is the sterile hybridization seed production pattern diagram.

[0064] Detailed Explanation

[0065] Various exemplary embodiments of this application are now described in detail. This detailed description should not be considered as a limitation of this application, but rather as a more detailed description of certain aspects, features, and implementations of this application.

[0066] It should be understood that the terminology used in this application is merely for describing particular implementations and is not intended to limit the application. Furthermore, for numerical ranges in this application, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this application. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0067] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art described herein. While only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this application. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0068] Various modifications and variations can be made to the specific embodiments described in this application without departing from the scope or spirit of this application, as will be apparent to those skilled in the art. Other embodiments derived from this application will be obvious to those skilled in the art. This application specification and embodiments are merely exemplary.

[0069] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0070] This application provides a nuclear gene, ZmKO1, that regulates the flowering and pollen shedding of maize male spikelets. Mutating the ZmKO1 gene can inhibit the elongation of maize male spikelet silks and prevent the male spikelets from flowering and shedding pollen, exhibiting nuclear male sterility. It also clarifies that, based on the ZmKO1 gene, nuclear male sterile lines in maize can be cultivated using CRISPR-Cas9 technology or backcrossing technology with mutant genes. Furthermore, this application finds that during the silking stage of the sterile lines cultivated based on the ZmKO1 gene, exogenous spraying of gibberellin GA3 (or gibberellic acid) onto the male spikes of the sterile lines can restore the male flowering and pollen shedding ability of the sterile lines. The sterile lines can then self-pollinate normally, thus serving as maintainer lines for economical and efficient maintenance of sterility. In summary, the nuclear male-sterile line created based on the ZmKO1 gene locus has the characteristic of "one line, two uses," meaning it can be used as a male-sterile line for maize sterile hybridization seed production, and its fertility can be restored by exogenous spraying of gibberellin GA3 (or gibberellic acid), achieving efficient maintenance of the sterile line. This application also provides a technical method for achieving maize two-line sterile hybridization seed production using the male-sterile line created based on the ZmKO1 gene.

[0071] Maize inbred lines B73, Mo17, and Huangzaosi all originated from the Maize Research Institute of Sichuan Agricultural University.

[0072] The maize male spikelet silk elongation defect mutant def1 is a mutant material collected on July 23, 2015, from a maize mutagenesis progeny population at the Modern Agricultural Research and Development Base of Sichuan Agricultural University in Chongzhou City, Sichuan Province. Because its male spikelet silk elongation is inhibited during the silking and pollen shedding stage, the glumes of the male spikelet do not split open, and the anthers cannot be exposed to shed pollen, exhibiting male sterility characteristics, it was identified as a male nuclear sterile mutant. Its seeds are deposited at the Maize Research Institute of Sichuan Agricultural University, and the applicant has committed to making this seed resource publicly available for 20 years from the date of application.

[0073] Example 1

[0074] 1. Cloning of the def1 gene, a mutant of maize silk elongation development.

[0075] In July 2015, the inventors identified a maize spikelet silk elongation defect mutant, def1. The overall agronomic traits of mutant def1 were not significantly different from those of wild-type WT (Figure 1, A). During the silking and pollen shedding stage, the glumes of WT spikelets opened normally, and the anthers were exposed and shedding pollen normally, while the glumes of def1 spikelets did not open, and the anthers could not be exposed and shedding pollen naturally, exhibiting male sterility (Figure 1, B and C). Further examination of the spikelet glumes revealed that the silks of WT spikelets elongated normally, while those of def1 spikelets did not (Figure 1, D). During the silking stage, pollen grains from both WT and def1 plants were stained with I2-KI, indicating normal pollen viability (Figure 1, E and F). Pollination of the female ears of mutant def1 with wild-type WT pollen showed no significant difference in seed setting rate compared to self-pollinated ears of wild-type WT (Figure 1, G and H).

[0076] Furthermore, referring to Figure 2, the overall agronomic traits of mutant def1 showed no significant difference compared to wild-type WT (Figure 2, A). During the silking and pollination stage, the filaments of WT male spikelets grew and elongated normally, the glumes opened normally, and the anthers were exposed and released pollen normally. In contrast, the glumes of def1 male spikelets did not open, the filaments could not grow and elongate, and the anthers could not be exposed and released pollen naturally, exhibiting male sterility (Figure 2, B, D, E, and F). During the silking stage, the pollen grains of WT and def1 plants showed normal I2-KI staining and Alexander staining, and normal in vitro germination (Figure 2, G), indicating that the pollen viability of the def1 male-sterile mutant was normal, exhibiting functional male sterility. When wild-type WT pollen was used to pollinate the female ears of mutant def1, the seed setting rate was not significantly different from that of self-pollinated ears of wild-type WT (Figure 2, C), indicating that the def1 mutation does not affect female fertility.

[0077] The mutant def1 was used as the female parent and crossbred with four maize inbred lines: B73, Mo17, and Huangzao, to form three F2 populations. The number of flowering and pollen-shedding plants and male-sterile plants in the F2 populations was counted using the χ² method. 2The analysis revealed that the ratio of flowering and pollinating plants to male-sterile plants in all three F2 populations conformed to a segregation ratio of 3:1, indicating that the def1 mutant trait is controlled by a single recessive nuclear gene. Using the F2 phenotypic segregating population formed by crosses between the mutant def1 and the inbred line Mo17, polymorphic molecular marker localization technology was employed to locate the target site between the polymorphic markers idp8 and SNP2 on chromosome 9. This region contains 13 protein-coding genes (Figure 3A). Based on this, expression analysis and sequence comparison identified a key candidate gene, Zm00001eb385100 (reference genome: Zm-B73-REFERENCE-NAM-5.0). This gene is annotated as the endoroot-kaurene oxidase 1 gene ZmKO1 (nucleotide sequence as shown in SEQ ID NO: 1, amino acid sequence as shown in SEQ ID NO: 4; cDNA sequence as shown in SEQ ID NO: 2, genomic DNA sequence as shown in SEQ ID NO: 3), which is involved in gibberellin synthesis. Compared to wild-type WT, the mutant def1 has a large insertion in the first exon of the ZmKO1 gene, resulting in a 19bp sequence replacement of an 82bp sequence in the first exon region at the cDNA level (the mutant allele is named ZmKO1-82), which ultimately leads to frameshift mutations and premature termination of the protein sequence (Figure 3B).

[0078] During the silking and pollination stage, spraying gibberellin GA3 restored the development of male spikelet filaments in the mutant def1, allowing the anthers to emerge and release pollen normally. The mutant could then self-pollinate, and the seed setting rate was not significantly different from the wild type (Figure 4). Furthermore, the inventors found that spraying gibberellin GA1, GA4, and GA7 separately also restored the mutant's fertility. Exogenous spraying of the mutant with gibberellin (75% active ingredient content, manufactured by Shanghai Tongrui Biotechnology Co., Ltd., with a spraying concentration of 25–50 mg / L), a commonly used plant growth regulator in agricultural production, also significantly restored the fertility of def1, enabling it to flower and release pollen.

[0079] Furthermore, an expression vector ProZmKO1::ZmKO1CDS (Figure 5A) was constructed to drive the expression of the coding region (CDS) of the ZmKO1 gene's own promoter and transformed into Agrobacterium EHA105 competent cells. Using Agrobacterium-mediated maize embryo genetic transformation, the def1 mutant was transgenic, and 12 T0 generation transgenic lines were identified by leaf genomic PCR (Figure 5A). Since the T0 generation consisted of callus-induced regeneration plants, four plants exhibited abnormal flower development, while the remaining eight plants had male flowers that could flower and release pollen, thus completing self-pollination. In the T1 generation, three lines, T1-3, T1-6, and T1-10, were randomly selected for genotypic and phenotypic identification. As shown in Figure 5B, at the transcriptional level, expression of the mutant allele ZmKO1-82 and the wild-type allele ZmKO1 was detectable in all three lines. Phenotypic observation showed that the male spikelets of all three transgenic lines exhibited normal filament elongation, normal glume opening, and exposed anthers for pollen shedding, indicating normal fertility (Figure 5C). These results suggest that transcription of the ZmKO1 coding region can restore the fertility of the def1 mutant.

[0080] Meanwhile, using CRISPR-Cas9 gene-targeted editing technology, with the immature embryo of maize inbred line B104 as the gene editing recipient, the second exon of the ZmKO1 gene was edited (Figure 6A). Three different types of non-transgenic homozygous mutant lines were screened: KO#1 with an insertion of 1 bp (an insertion of a T base between the 16th and 17th bases of the target sequence “GTCTCTGGTTTACCCCTGAT(SEQ ID NO:7)” in the second exon of the ZmKO1 gene), KO#2 with a deletion of 1 bp (a deletion of a T base at the 17th position of the target sequence), and KO#3 with a deletion of 16 bp (a continuous deletion of 16 bp starting from the 6th position of the target sequence) (Figure 6B). All three mutation types led to frameshift mutations and premature termination of ZmKO1 gene protein translation (Figure 6C). Field phenotypic observations revealed that, compared to the wild-type B104, the male spikelet filaments of the three lines KO#1, KO#2, and KO#3 failed to grow and elongate normally, the glumes failed to open, and the anthers failed to expose and release pollen. However, after spraying with gibberellin GA3, they exhibited male fertility, displaying characteristics similar to the def1 mutant (Figure 6, D and E). Simultaneously, allelic tests were performed by crossing the mutant def1 with inbred lines B104 and KO#1. The F1 plants from the cross between def1 and B104 showed normal male flowering and pollen release, while the F1 plants from the cross between def1 and KO#1 showed that the male spikelet filaments failed to grow and elongate normally, the glumes failed to open, and the anthers failed to expose and release pollen (Figure 6, F), indicating that the male sterility mutation site in the KO#1 line is allelic to def1.

[0081] In summary, three methods—transgenic complementation experiments, CRISPR-Cas9 gene site-directed editing, and allelic assays—have all demonstrated that mutations in the ZmKO1 gene lead to male sterility in the def1 line. Furthermore, exogenous application of gibberellin can effectively restore male fertility in both the def1 mutant and the ZmKO1 gene-edited lines, making it possible to utilize the ZmKO1 gene to create dual-purpose male-sterile maize lines.

[0082] 2. Creating male-sterile maize lines using the ZmKO1 gene

[0083] There are two methods for creating male-sterile maize lines using the ZmKO1 gene. The first method involves backcrossing and converting the def1 mutant to create male-sterile lines with different maternal parents. First, based on the gene sequence of the def1 mutant ZmKO1-82, a polymorphic molecular marker is developed to identify the def1 mutant ZmKO1-82 gene. Through backcrossing combined with marker-assisted selection and phenotypic selection, the backcrossing and conversion of male-sterile lines is rapidly completed (Figure 7A). Using this method, the inbred line Jing92 (Figure 7B) was converted into the male-sterile line Jing92A (Figure 7C). Spraying with gibberellic acid promotes flowering and pollen shedding in the male-sterile line Jing92A (Figure 7D), enabling self-pollination of the Jing92A male-sterile line.

[0084] Further results are shown in Figure 8. Using this method, this application completed the conversion of 10 sterile lines, namely Jing92, DH351, Zheng58, ZNC442, B73, Mo17, PH6WC, Jing724, Chengzi21429, and Y9614. Exogenous spraying of gibberellin GA3 can restore the flowering and pollen shedding of the sterile lines (partial results are shown in Figure 8, B, C, and D), and self-pollination of the sterile lines can be achieved.

[0085] The second method involves the rapid development of sterile lines using CRISPR-Cas9 gene-targeted editing technology. As shown in Figure 6A, the sequence “GTCTCTGGTTTACCCCTGAT (SEQ ID NO:7)” from exon 2 was used as the sgRNA to construct a gene-editing vector, which was then transformed into Agrobacterium EHA105 competent cells. Genetic transformation of the inbred line B104 was then performed via Agrobacterium-mediated embryogenic callus. Three editing types were identified in the T0 generation (Figure 6B and C), and these were backcrossed with B104. Through genotyping of the editing sites, transgenic screening, and self-pollination, homozygous mutant non-transgenic lines exhibiting male sterility were obtained. Fertility returned to normal after spraying with gibberellin GA3 or gibberellic acid (Figure 6D and E). This gene-editing method was also used to create a sterile line for the inbred line SCML0849 (Figure 8E).

[0086] 3. Using the ZmKO1 gene to create male-sterile maize lines for two-line male-sterile hybridization seed production.

[0087] The prerequisite for applying maize nuclear male-sterile lines to commercial hybrid seed production is the ability of the sterile lines to be propagated economically and efficiently. This application presents a male-sterile line created based on the ZmKO1 gene. Its fertility can be effectively restored by exogenous spraying of gibberellin (such as GA3, GA1, GA4, or GA7) or agricultural growth regulators containing gibberellin. The male flowers of the sterile line bloom and shed pollen normally, making it suitable as a maintainer line for economically and efficiently propagating the sterile line's seeds (Figure 9A). In commercial hybrid seed production, under natural growth conditions, it can be used as a sterile line, with the sterile line as the female parent and the fertile inbred line as the male parent, to achieve sterile hybrid seed production of maize (Figure 9B). Therefore, the maize male-sterile line created using the ZmKO1 gene can achieve sterile hybrid seed production using the two-line method in maize.

[0088] SEQ ID NO:1 is as follows:

[0089] SEQ ID NO:2 is as follows:

[0090] SEQ ID NO:3 is as follows:

[0091] SEQ ID NO:4 is as follows:

[0092] SEQ ID NO:5 (which is the inverse complementary sequence of SEQ ID NO:3, i.e., the reference sequence of Zm00001eb385100 in Zm-B73-REFERENCE-NAM-5.0) is as follows:

[0093] The sequence of SEQ ID NO:6 (gene number 100274015 in the NCBI database) is as follows:

[0094] The genomic reference sequences of the two genes, SEQ ID NO:5 and SEQ ID NO:6, are the same in the gene protein coding region. They can both encode the amino acid sequence of SEQ ID NO:4. However, 100274015 has 57 bp more at the beginning and 13 bp less at the end compared to Zm00001eb385100.

[0095] The embodiments described above are merely preferred embodiments of this application and are not intended to limit the scope of this application. Any modifications and improvements made to the technical solutions of this application by those skilled in the art without departing from the spirit of this application shall fall within the protection scope defined by the claims of this application.

Claims

1. The application of the ZmKO1 gene in any of the following: (1) Application in regulating the development of silks in maize male spikelets; (2) Application in regulating the opening of the glumes of maize male spikelets; (3) Application in regulating the fertility of maize male flowers; (4) Application in male-sterile hybrid seed production of maize; The ZmKO1 gene is the Zm00001eb385100 gene in the reference genome Zm-B73-REFERENCE-NAM-5.0 in the EnsemblPlants database, and its gene number in the NCBI database is 100274015.

2. The use of the ZmKO1 gene as described in claim 1 in any of the following: (1) Application in inhibiting pollen shedding from male spikelets of maize; (2) Application in producing male sterility in maize; (3) Application in male-sterile hybrid seed production of maize.

3. The use of the protein expressed by the ZmKO1 gene as described in claim 1 in any of the following: (1) Application in regulating the development of silks in maize male spikelets; (2) Application in regulating the opening of the glumes of maize male spikelets; (3) Application in regulating the fertility of maize male flowers; (4) Application in male-sterile hybrid seed production of maize.

4. The use of the protein expressed by the ZmKO1 gene as described in claim 1 in any of the following: (1) Application in inhibiting pollen shedding from male spikelets of maize; (2) Application in producing male sterility in maize; (3) Application in male-sterile hybrid seed production of maize.

5. The use of the recombinant vector comprising the ZmKO1 gene as described in claim 1 in any of the following: (1) Application in regulating the development of silks in maize male spikelets; (2) Application in regulating the opening of the glumes of maize male spikelets; (3) Application in regulating the fertility of maize male flowers; (4) Application in male-sterile hybrid seed production of maize.

6. The use of the recombinant vector comprising the ZmKO1 gene as described in claim 1 in any of the following: (1) Application in inhibiting pollen shedding from male spikelets of maize; (2) Application in producing male sterility in maize; (3) Application in male-sterile hybrid seed production of maize.

7. The application as described in any one of claims 1-6, wherein, By using genetic engineering or gene editing techniques to alter the DNA or protein sequence of the ZmKO1 gene, or to regulate the transcriptional expression or protein abundance of the ZmKO1 gene, the length of the filaments of the male spikelet in maize can be reduced and / or the glumes can be closed and / or the male flower can be sterile.

8. The application as described in claim 7, wherein, Genetic engineering techniques are used to alter the DNA or protein sequence of the ZmKO1 gene, or to regulate its transcriptional expression or protein abundance, so that the male spikelets of maize cannot flower and shed pollen, thus making the maize plant male-sterile and used for maize male-sterile hybrid seed production.

9. A method for cultivating male-sterile maize lines, wherein, The method includes (1) using genetic engineering methods to change the transcript sequence or protein sequence of the ZmKO1 gene as described in claim 1 in the recipient plant, or the expression level of the ZmKO1 gene transcription or protein level, and screening out male-sterile lines from the offspring of the recipient plant; or (2) using gene editing technology to edit the ZmKO1 gene as described in claim 1 in the maize recipient plant, and screening out maize male-sterile lines from the offspring of the recipient plant; or (3) using backcrossing to introduce the ZmKO1 gene as described in claim 1, which can cause male sterility, into maize materials with different genetic backgrounds, and creating maize male-sterile lines with different genetic backgrounds.

10. A method for producing maize through male-sterile hybridization, wherein, include: Using the male-sterile maize line bred by the method described in claim 9 as the female parent and the fertile maize inbred line as the male parent, and planting them according to the hybrid seed production method, maize male-sterile hybrid seed production can be achieved.

11. The method of claim 10, wherein, When the male-sterile maize line is propagated, its fertility is restored by spraying exogenous gibberellin or an agricultural growth regulator containing gibberellin during the silking stage, thus completing the self-pollination of the male-sterile line.