Microorganism, and method for producing l-arginine using same

Abstract

The present disclosure relates to an L-arginine-producing microorganism in which the activity of a regulator of nitrate reductase operon expression is attenuated and the activity of glutamine synthetase is enhanced, and to a method for producing L-arginine using same, wherein the L-arginine-producing microorganism, in which the activity of the regulator of nitrate reductase operon expression is attenuated and the activity of glutamine synthetase is enhanced, has been confirmed to exhibit increased L-arginine production capability compared to a parent strain, and thus can be widely used for L-arginine production.

Description

Microorganisms and methods for producing L-arginine using the same

[0001] Cross-citation with related application(s)

[0002] The present disclosure claims the benefit of priority based on Korean Patent Application No. 10-2024-0167778 filed November 21, 2024, and all contents disclosed in the documents of said Korean patent application are incorporated as part of the present disclosure.

[0003] The present disclosure relates to an L-arginine-producing microorganism in which the activity of a nitrate reductase operon expression level regulator is weakened and the activity of a glutamine synthase is enhanced, and a method for producing L-arginine using the same.

[0004] Microorganisms of the genus Corynebacterium are Gram-positive microorganisms widely used in the production of L-amino acids.

[0005] Various studies are being conducted to develop high-efficiency production microorganisms for the production of L-amino acids and other useful substances. Specifically, for the production of L-arginine, target substance-specific approaches are mainly used, such as increasing the expression of genes encoding enzymes primarily involved in L-arginine biosynthesis in Corynebacterium strains or removing genes unnecessary for L-arginine biosynthesis (US Patent 9644009 B2).

[0006] However, with the increasing demand for L-arginine, there is a growing need for research on methods to produce L-arginine efficiently and with high efficiency.

[0007]

[0008] One example of the present disclosure provides a microorganism of the genus Corynebacterium in which the activity of an aerobic repressor of nitrate reductase R is weakened and the activity of glutamine synthetase is enhanced.

[0009] Another example of the present disclosure is the step of culturing a microorganism of the genus Corynebacterium in which the activity of the nitrate reductase operon expression level regulator is weakened and the activity of glutamine synthase is enhanced, and

[0010] A method for producing L-arginine is provided, comprising the step of recovering L-arginine from the cultured microorganism, the medium, or both.

[0011] Another example of the present disclosure provides a composition for producing L-arginine comprising a microorganism of the genus Corynebacterium in which the activity of the nitrate reductase operon expression level regulator is weakened and the activity of the glutamine synthase is enhanced.

[0012] Another example of the present disclosure provides a use for L-arginine production in a microorganism of the genus Corynebacterium in which the activity of the nitrate reductase operon expression level regulator is weakened and the activity of glutamine synthase is enhanced.

[0013]

[0014] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in this disclosure may also be applied to other descriptions and embodiments. That is, all combinations of the various elements disclosed in this disclosure fall within the scope of this disclosure. Furthermore, the scope of this disclosure should not be considered limited by the specific descriptions provided below.

[0015]

[0016] The present disclosure provides a microorganism with enhanced L-arginine production capacity and a method for producing L-arginine using the same.

[0017] One example of the present disclosure provides a microorganism of the genus Corynebacterium in which the activity of an aerobic repressor of nitrate reductase R is weakened and the activity of glutamine synthetase is enhanced.

[0018] In the present disclosure, the term “aerobic repressor of nitrate reductase R” refers to a transcription regulator that inhibits the expression of the nitrate reductase operon narKGHJI. The aerobic repressor of nitrate reductase R of the present disclosure may be used in combination with the ArnR protein, and the sequence of the aerobic repressor of nitrate reductase R of the present disclosure may be obtained from GenBank of NCBI, a known database. More specifically, the aerobic repressor of nitrate reductase R may have and / or include the amino acid sequence of SEQ ID NO. 1, or may be essentially composed of or consist of said amino acid sequence.

[0019] For example, the protein consisting of the amino acid sequence of SEQ ID NO. 1 may refer to a protein that is intrinsically present in microorganisms of the genus Corynebacterium encoded by the known NCgl1138 gene, but is not limited thereto. Specifically, the protein consisting of the amino acid sequence of SEQ ID NO. 1 may refer to a nitrate reductase operon expression level regulator derived from Corynebacterium glutamicum ATCC13869 encoded by the NCgl1138 gene, but is not limited thereto.

[0020] In addition, the nitrate reductase operon expression level regulator of the present disclosure may include not only the amino acid sequence of SEQ ID NO. 1, but also an amino acid sequence having at least 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% sequence identity or homology with the amino acid sequence of SEQ ID NO. 1. Furthermore, if the amino acid sequence has such sequence identity or homology and has biological activity identical or corresponding to that of the nitrate reductase operon expression level regulator of the present disclosure, cases in which some of the sequences have deletions, modifications, substitutions, conservative substitutions, or additions may also be included within the scope of the present disclosure. For example, it may have sequence additions or deletions that do not alter the activity of the nitrate reductase operon expression level regulator at the N-terminus, C-terminus, and / or within the amino acid sequence, naturally occurring mutations, silent mutations, or conservative substitutions.

[0021] In the present disclosure, the term “glutamine synthetase” may mean an enzyme that mediates the ATP-dependent biosynthetic reaction of glutamine from glutamate and ammonia (EC: 6.3.1.2). In the present disclosure, the term glutamine synthetase may be used interchangeably with “type I glutamate-ammonia ligase,” “glutamine synthetase,” and “GlnA protein.”

[0022] In one example, the glutamine synthase may be derived from a microorganism of the genus Corynebacterium (e.g., Corynebacterium glutamicum), a microorganism of the genus Aureibacillus (e.g., Aureibacillus halotolerans), or a microorganism of the genus Bacillus (e.g., Bacillus subtilis), but is not limited thereto.

[0023] In the present disclosure, the sequence of the glutamine synthase can be obtained from the known database, NCBI’s GenBank (e.g., glutamine synthase derived from Corynebacterium glutamicum is NCBI registration number “NCgl2133”, glutamine synthase derived from Aureibacillus halothorax is NCBI Reference number “WP_133580410.1”, glutamine synthase derived from Bacillus subtilis is NCBI Reference number “WP_003231737.1”). More specifically, the glutamine synthase may have and / or include the amino acid sequence of SEQ ID NO. 3, SEQ ID NO. 33, or SEQ ID NO. 35, or may be essentially composed of or consist of said amino acid sequence.

[0024] In addition, the glutamine synthase of the present disclosure may include not only the amino acid sequence of SEQ ID NO. 3, SEQ ID NO. 33, or SEQ ID NO. 35, but also an amino acid sequence having at least 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% sequence identity or homology with the amino acid sequence of SEQ ID NO. 3, SEQ ID NO. 33, or SEQ ID NO. 35. Furthermore, if the amino acid sequence has such sequence identity or homology and has biological activity identical or corresponding to that of the glutamine synthase of the present disclosure, cases in which some sequences are deleted, modified, substituted, conservedly substituted, or added may also be included within the scope of the present disclosure. For example, it may have sequence additions or deletions that do not alter glutamine synthase activity at the N-terminus, C-terminus, and / or within the amino acid sequence, naturally occurring mutations, silent mutations, or conservative substitutions.

[0025] The aforementioned "conservative substitution" refers to the substitution of one amino acid with another amino acid having similar structural and / or chemical properties. Such amino acid substitutions can generally occur based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues. Typically, conservative substitutions have little to no effect on the activity of a protein or polypeptide.

[0026] In this disclosure, 'homology' or 'identity' refers to the degree of similarity between two given amino acid sequences or base sequences and may be expressed as a percentage. The terms homology and identity may often be used interchangeably.

[0027] Sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard arrangement algorithms, and a default gap penalty established by the program used may be utilized. Practically, homologous or identical sequences can generally be hybridized with the entire sequence or a part thereof under moderate or high stringent conditions. It is evident that hybridization also includes hybridization with polynucleotides containing common codons or codons that account for codon degeneracy.

[0028] Whether any two polynucleotide or polypeptide sequences have homology or identity can be determined using a known computer algorithm, such as the “FASTA” program, using default parameters as in, for example, Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, it can be determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), as performed in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) (GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Homology or identity can be determined, for example, using BLAST from the National Biotechnology Information Database Center or ClustalW.

[0029] The homology or identity of polynucleotides or polypeptides can be determined by comparing sequence information using a GAP computer program, such as that described in, for example, Smith and Waterman, Adv. Appl. Math (1981) 2:482, or Needleman et al. (1970), J Mol Biol. 48:443. In summary, a GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly arranged symbols (i.e., nucleotides or amino acids). The default parameters for a GAP program are (1) a binary comparison matrix (containing values ​​of 1 for identity and 0 for non-identity) and, as disclosed by Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979), or Gribskov et al. (1986) Nucl. Acids Res. 14: A weighted comparison matrix of 6745 (or an EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for terminal gaps.

[0030]

[0031] In this disclosure, the term "L-arginine" refers to a conditionally essential amino acid present in all living organisms, C6H 14 It refers to an L-amino acid having the chemical formula N4O2.

[0032] In the present disclosure, the term “microorganism (or strain)” includes both wild-type microorganisms and microorganisms that have undergone natural or artificial genetic modification, and may be microorganisms in which specific mechanisms are enhanced or weakened due to causes such as the insertion of external genes or the enhancement or weakening of the activity of endogenous genes, and may be microorganisms that include genetic modification for the production of a desired polypeptide, protein, or product.

[0033]

[0034] In the present disclosure, the term “enhancement” of polypeptide activity means that the activity of the polypeptide is increased compared to its intrinsic activity. Such enhancement may be used interchangeably with terms such as activation, up-regulation, overexpression, and increase. Here, activation, enhancement, up-regulation, overexpression, and increase may include exhibiting activity that was not originally possessed, or exhibiting improved activity compared to the intrinsic activity or activity prior to modification. The “intrinsic activity” refers to the activity of a specific polypeptide originally possessed by the parent strain or the non-modified microorganism prior to the change in traits caused by genetic mutations due to natural or artificial factors. This may be used interchangeably with “activity prior to modification.” "Enhancement," "upregulation," "overexpression," or "increase" of polypeptide activity relative to intrinsic activity means that the activity and / or concentration (expression amount) of a specific polypeptide were originally possessed by the parent strain or non-modified microorganism prior to transformation.

[0035] The above enhancement can be achieved by introducing an exogenous polypeptide or by enhancing the activity and / or increasing the concentration (expression amount) of the intrinsic polypeptide. Whether the activity of the polypeptide is enhanced can be confirmed by an increase in the degree of activity, expression amount, or amount of product resulting from the polypeptide activity of said polypeptide.

[0036] The enhancement of the activity of the above polypeptide may be achieved by applying various methods well known in the art, and is not limited to, as long as the activity of the target polypeptide can be enhanced compared to the microorganism before modification. Specifically, it may utilize, but is not limited to, gene engineering and / or protein engineering known to a person skilled in the art, which are routine methods of molecular biology (e.g., Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).

[0037] Specifically, the reinforcement of the polypeptide of the present disclosure is

[0038] 1) Increase in the intracellular copy number of polynucleotides encoding polypeptides;

[0039] 2) Replace the chromosomal gene expression regulatory region encoding a polypeptide with a potent sequence;

[0040] 3) A modification of the nucleotide sequence encoding the start codon or the 5'-UTR region of the gene transcript encoding the polypeptide;

[0041] 4) Modification of the amino acid sequence of the polypeptide to enhance polypeptide activity;

[0042] 5) Modification of the polynucleotide sequence encoding the polypeptide to enhance polypeptide activity (e.g., modification of the polynucleotide sequence of the polypeptide gene to code for a polypeptide modified to enhance polypeptide activity);

[0043] 6) Introduction of an exogenous polypeptide exhibiting polypeptide activity or an exogenous polynucleotide encoding the same;

[0044] 7) Codon optimization of polynucleotides encoding polypeptides;

[0045] 8) Analyze the tertiary structure of the polypeptide to select and modify or chemically modify the exposed sites; or

[0046] 9) Regulation of the cellular localization of proteins (polypeptides); or

[0047] 10) It may be a combination of two or more selected from 1) to 9) above, but is not specifically limited thereto.

[0048] More specifically,

[0049] The increase in the intracellular copy number of the polynucleotide encoding the above 1) polypeptide may be achieved by introducing into a host cell a vector to which the polynucleotide encoding the said polypeptide is operably linked, which can replicate and function independently of the host. Alternatively, it may be achieved by introducing one or more copies of the polynucleotide encoding the said polypeptide into the chromosomes within the host cell. The introduction into the chromosomes may be performed by introducing into the host cell a vector capable of inserting said polynucleotide into the chromosomes within the host cell, but is not limited thereto.

[0050] Replacing the gene expression regulatory region (or expression regulatory sequence) on the chromosome encoding the polypeptide 2) above with a sequence having potent activity may, for example, involve deletion, insertion, non-conservative or conservative substitution, or a combination thereof, to further enhance the activity of the expression regulatory region, or may involve a sequence mutation, or replacement with a sequence having stronger activity. The expression regulatory region may include, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation. As an example, the original promoter may be replaced with a potent promoter, but is not limited thereto.

[0051] Examples of known strong promoters include, but are not limited to, CJ1 to CJ7 promoters (US Patent No. 7662943 B2), lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, tet promoter, gapA promoter, SPL7 promoter, SPL13(sm3) promoter (US Patent No. 10584338 B2), O2 promoter (US Patent No. 10273491 B2), tkt promoter, yccA promoter, lysCP1 promoter (US Patent No. 8426577 B2).

[0052] The above 3) modification of the nucleotide sequence encoding the start codon or 5'-UTR region of the gene transcript encoding the polypeptide may, for example, be a substitution with a nucleotide sequence encoding another start codon that has a higher polypeptide expression rate compared to the intrinsic start codon, but is not limited thereto.

[0053] The modification of the amino acid sequence or polynucleotide sequence of 4) and 5) above may be a sequence variation occurring by deletion, insertion, non-conservative or conservative substitution, or a combination thereof, of the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide to enhance the activity of the polypeptide, or a replacement with an amino acid sequence or polynucleotide sequence modified to have stronger activity or an amino acid sequence or polynucleotide sequence modified to increase activity, but is not limited thereto. Specifically, the replacement may be performed by inserting the polynucleotide into the chromosome by homologous recombination, but is not limited thereto. The vector used in this case may additionally include a selection marker to confirm whether the chromosome is inserted.

[0054] The introduction of an exogenous polynucleotide exhibiting the activity of the polypeptide described in 6) above may be the introduction into a host cell of an exogenous polynucleotide encoding a polypeptide that exhibits the same or similar activity as the polypeptide. The exogenous polynucleotide is not limited in its origin or sequence as long as it exhibits the same or similar activity as the polypeptide. The method used for the introduction may be carried out by a person skilled in the art by appropriately selecting a known transformation method, and the polypeptide may be generated and its activity increased by the expression of the introduced polynucleotide within the host cell.

[0055] The above 7) codon optimization of a polynucleotide encoding a polypeptide may be a codon optimization of the intrinsic polynucleotide such that transcription or translation within the host cell increases, or a codon optimization of the extrinsic polynucleotide such that optimized transcription or translation occurs within the host cell.

[0056] 8) The above method of analyzing the tertiary structure of the polypeptide to select and modify or chemically modify an exposed site may involve, for example, determining a template protein candidate based on the degree of sequence similarity by comparing the sequence information of the polypeptide to be analyzed with a database in which sequence information of known proteins is stored, confirming the structure based on this, and selecting and modifying or modifying an exposed site to be modified or chemically modified.

[0057] The above 9) regulation of the intracellular localization of a protein (polypeptide) may involve targeting the protein (polypeptide) to a specific intracellular organelle or a specific intracellular space. For example, it may involve targeting to the periplasm or cytoplasm through the addition or removal of a leader sequence that functions for the targeting of the protein (polypeptide), but is not limited thereto.

[0058] Such enhancement of polypeptide activity may involve increasing the activity or concentration of the corresponding polypeptide based on the activity or concentration of the polypeptide expressed in the wild-type or pre-modification microbial strain, or increasing the amount of the product produced from said polypeptide, but is not limited thereto.

[0059]

[0060] In this disclosure, the term “weakening” of a polypeptide is a concept that includes both reduced activity relative to its intrinsic activity and inactivity.

[0061] The above weakening may be used interchangeably with terms such as inactivation, deficiency, down-regulation, decrease, reduce, and attenuation.

[0062] The above weakening may include cases where the activity of the polypeptide itself is reduced or eliminated compared to the polypeptide activity originally possessed by the microorganism due to mutations in the polynucleotide encoding the polypeptide, etc.; cases where the overall polypeptide activity and / or concentration (expression amount) within the cell is lower than that of the natural strain due to inhibition of gene expression of the polynucleotide encoding it or inhibition of translation into the polypeptide; cases where the expression of the polynucleotide does not occur at all; and / or cases where the polypeptide is not active even if the polynucleotide is expressed. The above "intrinsic activity" refers to the activity of a specific polypeptide originally possessed by the parent strain, wild-type, or non-modified microorganism prior to the change in trait due to genetic mutation caused by natural or artificial factors. This may be used interchangeably with "activity before modification." The statement that the activity of a polypeptide is "inactivated, deficient, reduced, downregulated, lowered, or attenuated" relative to its intrinsic activity means that the activity of a specific polypeptide has decreased compared to the activity originally possessed by the parent strain or non-modified microorganism prior to transformation.

[0063] The attenuation of the activity of such polypeptides can be performed by any method known in the art, but is not limited thereto, and can be achieved by the application of various methods well known in the art (e.g., Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014;15(2):2773-2793, Sambrook et al. Molecular Cloning 2012 et al.).

[0064] Specifically, the weakening of polypeptides is

[0065] 1) Deletion of all or part of the gene encoding a polypeptide;

[0066] 2) Modification of the expression regulatory region (or expression regulatory sequence) to reduce the expression of the gene encoding the polypeptide;

[0067] 3) Modification of the amino acid sequence constituting the polypeptide so as to remove or weaken the activity of the polypeptide (e.g., deletion / substitution / addition of one or more amino acids in the amino acid sequence);

[0068] 4) Modification of the gene sequence encoding the polypeptide so as to remove or weaken the activity of the polypeptide (e.g., deletion / substitution / addition of one or more nucleotide bases on the nucleotide base sequence of the polypeptide gene to code for a polypeptide modified so as to remove or weaken the activity of the polypeptide);

[0069] 5) A modification of the nucleotide sequence encoding the start codon or the 5'-UTR region of the gene transcript encoding the polypeptide;

[0070] 6) Introduction of an antisense oligonucleotide (e.g., antisense RNA) that binds complementarily to the transcript of the gene encoding the polypeptide;

[0071] 7) Addition of a sequence complementary to the Shine-Dalgarno sequence to the upstream end of the Shine-Dalgarno sequence of a polypeptide-coding gene to form a secondary structure incapable of ribosome attachment;

[0072] 8) Addition of a reverse-transcribed promoter to the 3' end of the open reading frame (ORF) of a gene sequence encoding a polypeptide (Reverse transcription engineering, RTE); or

[0073] 9) Regulation of cellular localization of proteins (polypeptides); or

[0074] 10) It may be a combination of two or more selected from 1) to 9) above, but is not specifically limited thereto.

[0075] for example,

[0076] The deletion of part or all of the gene encoding the polypeptide mentioned above 1) may be the removal of the entire polynucleotide encoding the intrinsic target polypeptide within the chromosome, replacement with a polynucleotide in which some nucleotides have been deleted, or replacement with a marker gene.

[0077] Additionally, modification of the expression regulatory region (or expression regulatory sequence) described in 2) above may be a deletion, insertion, non-conservative or conservative substitution, or a combination thereof, resulting in a mutation on the expression regulatory region (or expression regulatory sequence), or replacement with a sequence having weaker activity. The expression regulatory region includes, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation.

[0078] In addition, the above 3) modification of the nucleotide sequence encoding the start codon or 5'-UTR region of the gene transcript encoding the polypeptide may, for example, be a substitution with a nucleotide sequence encoding another start codon that has a lower polypeptide expression rate compared to the intrinsic start codon, but is not limited thereto.

[0079] In addition, modifications to the amino acid sequences or polynucleotide sequences of 4) and 5) above may involve the occurrence of sequence variations in the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide by deletion, insertion, non-conservative or conservative substitution, or a combination thereof, to weaken the activity of the polypeptide, or may involve replacement with an amino acid sequence or polynucleotide sequence modified to have weaker activity or an amino acid sequence or polynucleotide sequence modified to have no activity, but are not limited thereto. For example, gene expression may be inhibited or weakened by introducing a variation within the polynucleotide sequence to form a stop codon, but are not limited thereto. The "stop codon" is a codon on the mRNA that does not specify an amino acid and acts as a signal indicating that the protein synthesis process has ended; generally, three types, UAA, UAG, and UGA, may be used as stop codons.

[0080] For the introduction of an antisense oligonucleotide (e.g., antisense RNA) that binds complementarily to the transcript of the gene encoding the polypeptide 6) above, refer to the literature [Weintraub, H. et al., Antisense-RNA as a molecular tool for genetic analysis, Reviews - Trends in Genetics, Vol. 1(1) 1986].

[0081] 7) In order to form a secondary structure in which ribosome attachment is impossible, the addition of a sequence complementary to the Shine-Dalgarno sequence to the front of the Shine-Dalgarno sequence of a gene encoding a polypeptide may make mRNA translation impossible or slow it down.

[0082] Reverse transcription engineering (RTE) of a promoter that is transcribed in the opposite direction to the 3' end of the ORF (open reading frame) of the gene sequence encoding the polypeptide above may weaken the activity by creating an antisense nucleotide complementary to the transcript of the gene encoding the polypeptide.

[0083] The above 9) regulation of the intracellular localization of the protein (polypeptide) may involve targeting the protein (polypeptide) to a specific intracellular organelle or a specific intracellular space. For example, it may involve targeting to the periplasm or cytoplasm through the addition or removal of a leader sequence that functions for the targeting of the protein (polypeptide), but is not limited thereto.

[0084] Such weakening of polypeptide activity may involve a reduction in the activity or concentration expression of the corresponding polypeptide relative to the activity or concentration of the polypeptide expressed in the wild-type or pre-modification microbial strain, or a decrease in the amount of product produced from said polypeptide, but is not limited thereto.

[0085]

[0086] Specifically, the microorganism having L-arginine production capacity of the present disclosure may be a genetically modified microorganism in which the activity of the nitrate reductase operon expression level regulator is weakened (e.g., removed or inactivated) and the activity of glutamine synthase is enhanced, thereby increasing (improving) the L-arginine production capacity (or production amount). Specifically, the microorganism with increased L-arginine production capacity (recombinant strain) may be a microorganism with increased L-arginine production capacity compared to a natural wild-type microorganism or a non-modified microorganism of the same species that possesses the intrinsic activity of the nitrate reductase operon expression level regulator (without weakening the activity of the nitrate reductase operon expression level regulator) and has not enhanced glutamine synthase activity, but is not limited thereto.

[0087] In the present disclosure, the term “non-mutated microorganism” does not exclude strains containing mutations that may naturally occur in microorganisms, and may refer to wild-type strains or natural-type strains themselves, or strains before their traits are altered by genetic mutations caused by natural or artificial factors. For example, the non-mutated microorganism may refer to a strain in which the activity of the nitrate reductase operon expression level regulator described in the present disclosure is not weakened relative to its intrinsic activity or before it is weakened, and / or the activity of glutamine synthase is not strengthened relative to its intrinsic activity or before it is strengthened. The term “non-mutated microorganism” may be used interchangeably with “pre-mutation strain,” “pre-mutation microorganism,” “non-mutated strain,” “non-mutated microorganism,” or “reference microorganism,” and may be expressed as “parent microorganism or parent strain.”

[0088] In one example, the parent strain may be of the wild type or mutated to increase L-arginine production capacity, for instance, in which the protein activity involved in the biosynthesis or metabolism of L-arginine is regulated (increased (promoted) or decreased (inhibited) compared to the wild type, but is not limited thereto.

[0089] In one example, the parent strain may be any microorganism of the genus Corynebacterium or the genus Escherichia that has the ability to produce L-arginine by introducing a mutation into a parent strain that has no or significantly less ability to produce L-arginine. The microorganisms of the genus Corynebacterium may include, but are not limited to, Corynebacterium glutamicum, Corynebacterium stationis, Brevibacterium lactofermentum, Brevibacterium flavum, Corynebacterium thermoaminogenes, Corynebacterium efficiens, etc. More specifically, the above-mentioned microorganism of the genus Corynebacterium may be Corynebacterium glutamicum, and the above-mentioned strain of the genus Escherichia may be Escherichia coli.

[0090] In one example, a method of deleting all or part of a gene encoding a polypeptide can be used to weaken the activity of the nitrate reductase operon expression level regulator. Specifically, this can be done by replacing a polynucleotide encoding an intrinsic target protein within a chromosome with a polynucleotide having some nucleotide sequences deleted or with a marker gene through a vector for chromosome insertion into a microorganism. As an example of a method of deleting all or part of such a polynucleotide, a method of deleting the polynucleotide by homologous recombination can be used, but is not limited thereto.

[0091] The above-mentioned gene deletion method includes a method based on genetic recombination technique. For example, this can be achieved by injecting a polynucleotide sequence or vector containing a polynucleotide sequence homologous to the target gene into the microorganism to induce homologous recombination. Additionally, the injected polynucleotide sequence or vector may include a dominant selection marker.

[0092] In one example, to enhance the activity of the glutamine synthase, a method of increasing the copy number or enhancing the activity of the promoter may be used, but is not limited thereto.

[0093]

[0094] One example of the present disclosure provides a microorganism that produces L-arginine in which the activity of the nitrate reductase operon expression level regulator is weakened, the activity of glutamine synthase is enhanced, and additionally, the activities of malate:quinone oxidoreductase, malate dehydrogenase, aspartate transaminase, and NADP-specific glutamate dehydrogenase are enhanced compared to a non-modified microorganism.

[0095] In the present disclosure, the term “malate:quinone oxidoreductase” refers to an enzyme on the TCA cycle that catalyzes the reversible conversion of malate (malate) and quinone to quinol and oxaloacetate. The malate:quinone oxidoreductase of the present disclosure may be used in combination with MQO proteins, and the sequence of the malate:quinone oxidoreductase in the present disclosure can be obtained from GenBank of NCBI, a known database. More specifically, the malate:quinone oxidoreductase may have and / or include the amino acid sequence of SEQ ID NO. 54, or may be essentially consisting of or composed of said amino acid sequence.

[0096] For example, the protein consisting of the amino acid sequence of SEQ ID NO. 54 may refer to a protein inherently present in microorganisms of the genus Corynebacterium encoded by the known NCgl1926 gene, but is not limited thereto. Specifically, the protein consisting of the amino acid sequence of SEQ ID NO. 54 may refer to a malate:quinone oxidoreductase derived from Corynebacterium glutamicum ATCC13032 encoded by the NCgl1926 gene, but is not limited thereto.

[0097] In addition, the malate:quinone oxidoreductase of the present disclosure may include not only the amino acid sequence of SEQ ID NO. 54, but also an amino acid sequence having at least 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% sequence identity or homology with the amino acid sequence of SEQ ID NO. 54. Furthermore, if the amino acid sequence has such sequence identity or homology and has biological activity identical or corresponding to that of the malate:quinone oxidoreductase of the present disclosure, cases in which some sequences have deletions, modifications, substitutions, conservative substitutions, or additions may also be included within the scope of the present disclosure.

[0098] In this disclosure, the term “malate dehydrogenase” refers to an enzyme on the TCA cycle that reversibly catalyzes the oxidation of malate (malate) to oxaloacetate by reducing NAD+ to NADH. The malate dehydrogenase of this disclosure may be used in combination with MDH protein, and the sequence of the malate dehydrogenase in this disclosure can be obtained from GenBank of NCBI, a known database. More specifically, the malate dehydrogenase may have and / or include the amino acid sequence of SEQ ID NO. 58, or may be essentially composed of or consist of said amino acid sequence.

[0099] For example, the protein consisting of the amino acid sequence of SEQ ID NO. 58 may refer to a protein inherently present in microorganisms of the genus Corynebacterium encoded by the known NCgl0631 gene, but is not limited thereto. Specifically, the protein consisting of the amino acid sequence of SEQ ID NO. 58 may refer to malate dehydrogenase derived from Corynebacterium glutamicum ATCC13032 encoded by the NCgl0631 gene, but is not limited thereto.

[0100] In addition, the malate dehydrogenase of the present disclosure may include not only the amino acid sequence of SEQ ID NO. 58, but also an amino acid sequence having at least 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% sequence identity or homology with the amino acid sequence of SEQ ID NO. 58. Furthermore, if the amino acid sequence has such sequence identity or homology and has biological activity identical or corresponding to that of the malate dehydrogenase of the present disclosure, cases in which some sequences have deletions, modifications, substitutions, conservative substitutions, or additions may also be included within the scope of the present disclosure.

[0101] In the present disclosure, the term "aspartate transaminase" refers to an enzyme that catalyzes a reaction in which the amino group of L-aspartic acid is transferred to 2-oxoglutarate to produce L-glutamic acid and oxaloacetate. The aspartate transaminase of the present disclosure may be used in combination with AspB protein, and the sequence of the aspartate transaminase in the present disclosure can be obtained from GenBank of NCBI, a known database. More specifically, the aspartate transaminase may have and / or include the amino acid sequence of SEQ ID NO. 60, or may be essentially composed of or consist of said amino acid sequence.

[0102] For example, the protein consisting of the amino acid sequence of SEQ ID NO. 60 may refer to a protein inherently present in microorganisms of the genus Corynebacterium encoded by the known NCgl0237 gene, but is not limited thereto. Specifically, the protein consisting of the amino acid sequence of SEQ ID NO. 60 may refer to an aspartate transaminase derived from Corynebacterium glutamicum ATCC13032 encoded by the NCgl0237 gene, but is not limited thereto.

[0103] In addition, the aspartate transaminases of the present disclosure may include not only the amino acid sequence of SEQ ID NO. 60, but also amino acid sequences having at least 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% sequence identity or homology with the amino acid sequence of SEQ ID NO. 60. Furthermore, if the amino acid sequence has such sequence identity or homology and has biological activity identical or corresponding to that of the aspartate transaminases of the present disclosure, cases in which some sequences have deletions, modifications, substitutions, conservative substitutions, or additions may also be included within the scope of the present disclosure.

[0104] In the present disclosure, the term "NADP-specific glutamate dehydrogenase" refers to an enzyme that catalyzes the reaction of converting glutamate into 2-oxoglutarate and ammonia depending on NADP. The NADP-specific glutamate dehydrogenase of the present disclosure may be used in combination with GDH proteins, and the sequence of the NADP-specific glutamate dehydrogenase in the present disclosure can be obtained from GenBank of NCBI, a known database. More specifically, the NADP-specific glutamate dehydrogenase may have and / or include the amino acid sequence of SEQ ID NO. 62, or may be essentially consisting of or composed of said amino acid sequence.

[0105] For example, the protein consisting of the amino acid sequence of SEQ ID NO. 62 may refer to a protein inherently present in microorganisms of the genus Corynebacterium encoded by the known NCgl1999 gene, but is not limited thereto. Specifically, the protein consisting of the amino acid sequence of SEQ ID NO. 62 may refer to NADP-specific glutamate dehydrogenase derived from Corynebacterium glutamicum ATCC13032 encoded by the NCgl1999 gene, but is not limited thereto.

[0106] In addition, the NADP-specific glutamate dehydrogenase of the present disclosure may include not only the amino acid sequence of SEQ ID NO. 62, but also an amino acid sequence having at least 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% sequence identity or homology with the amino acid sequence of SEQ ID NO. 62. Furthermore, if the amino acid sequence has such sequence identity or homology and has biological activity identical or corresponding to that of the NADP-specific glutamate dehydrogenase of the present disclosure, cases in which some sequences have deletions, modifications, substitutions, conservative substitutions, or additions may also be included within the scope of the present disclosure.

[0107] In one specific example, in order to increase L-arginine production capacity, the activity of the nitrate reductase operon expression level regulator was weakened and the activity of glutamine synthase was strengthened, and additionally, the activities of malate:quinone oxidoreductase, malate dehydrogenase, aspartate transaminase, and NADP-specific glutamate dehydrogenase were simultaneously strengthened, and it was confirmed that L-arginine production capacity increased. Specifically, it was confirmed that the L-arginine production capacity of L-arginine-producing microorganisms into which a gene combination encoding fumarate hydratase, malate:quinone oxidoreductase, malate dehydrogenase, aspartate transaminase, and NADP-specific glutamate dehydrogenase was introduced using a plasmid was further enhanced compared to L-arginine-producing microorganisms in which the activity of the nitrate reductase operon expression level regulator was weakened and the activity of glutamine synthase was strengthened.

[0108] The above "L-arginine," "microorganisms," "weakening of activity," and "enhancement of activity," etc., are as described above.

[0109]

[0110] Another example of the present disclosure provides a method for increasing the L-arginine production capacity of a microorganism, or a method for conferring L-arginine production capacity to the microorganism, comprising the steps of weakening the activity of a nitrate reductase operon expression level regulator of the microorganism and strengthening the activity of a glutamine synthase.

[0111]

[0112] Another example of the present disclosure provides a method for producing L-arginine, comprising the step of culturing a microorganism in a medium in which the activity of a nitrate reductase operon expression level regulator is weakened and the activity of a glutamine synthase is enhanced.

[0113] In the present disclosure, "culture" means growing a microorganism of the genus Corynebacterium, such as a strain of Corynebacterium glutamicum, in which the activity of the nitrate reductase operon expression level regulator of the present disclosure is weakened and the activity of the glutamine synthase is enhanced, under appropriately controlled environmental conditions. The culture process of the present disclosure may be carried out according to suitable media and culture conditions known in the art. Such culture process can be easily adjusted and used by those skilled in the art depending on the selected strain. Specifically, the culture may be batch, continuous, and / or fed-batch, but is not limited thereto.

[0114] In the present disclosure, "medium" refers to a substance mixed with nutrients as the main component required to culture a microorganism of the genus Corynebacterium, such as a strain of Corynebacterium glutamicum, in which the activity of the nitrate reductase operon expression level regulator of the present disclosure is weakened and the activity of the glutamine synthase is enhanced, and supplies nutrients and growth factors, including water, which is indispensable for survival and growth. Specifically, any medium and other culture conditions used for culturing the microorganism of the present disclosure may be used without special limitations as long as they are media used for culturing ordinary microorganisms, but the microorganism of the present disclosure may be cultured under aerobic conditions while controlling the temperature, pH, etc. in a conventional medium containing a suitable carbon source, nitrogen source, phosphorus, inorganic compounds, amino acids, and / or vitamins.

[0115] Specifically, culture media for the microorganisms of the present disclosure, such as strains of the genus Corynebacterium, can be found in the literature ["Manual of Methods for General Bacteriology" by the American Society for Bacteriology (Washington DC, USA, 1981)].

[0116] In the present disclosure, the carbon source may include carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, etc.; sugar alcohols such as mannitol, sorbitol, etc.; organic acids such as pyruvate, lactic acid, citric acid, etc.; and amino acids such as glutamic acid, methionine, lysine, etc. Additionally, natural organic nutrient sources such as starch hydrolysate, molasses, blackstrap molasses, rice bran, cassava, sugarcane residue, and corn steeping liquid may be used. Specifically, carbohydrates such as glucose and sterilized pre-treated molasses (i.e., molasses converted into reducing sugars) may be used, and other carbon sources in appropriate amounts may be used in various ways without limitation. These carbon sources may be used individually or in combination of two or more types, but are not limited thereto.

[0117] The above nitrogen sources may include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc.; and organic nitrogen sources such as amino acids such as glutamic acid, methionine, glutamine, etc., peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquid, casein hydrolysate, fish or its decomposition products, defatted soybean cake or its decomposition products, etc. These nitrogen sources may be used alone or in combination of two or more, but are not limited thereto.

[0118] The above ingredients may include monopotassium phosphate, dipotassium phosphate, or corresponding sodium-containing salts. Inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc., and may also include amino acids, vitamins, and / or suitable precursors. These components or precursors may be added to the culture medium in a batch or continuous manner. However, they are not limited thereto.

[0119] In addition, during the cultivation of the microorganism of the present disclosure, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc., may be added to the medium in an appropriate manner to adjust the pH of the medium. In addition, during cultivation, an antifoaming agent such as a fatty acid polyglycol ester may be used to suppress the formation of bubbles. Furthermore, to maintain an aerobic state of the medium, oxygen or an oxygen-containing gas may be injected into the medium, or nitrogen, hydrogen, or carbon dioxide gas may be injected without gas injection to maintain an anaerobic and microaerobic state, but is not limited thereto.

[0120] In the culture of the present disclosure, the culture temperature may be maintained at 20 to 45°C, specifically 25 to 40°C, and culture may be carried out for about 10 to 160 hours, but is not limited thereto.

[0121] L-arginine produced by the culture of the present disclosure may be secreted into the medium or remain in the cell.

[0122] The method for producing L-arginine of the present disclosure may additionally include, for example, the step of preparing a microorganism (strain) of the present disclosure, the step of preparing a medium for culturing said microorganism, or a combination thereof (in any order), prior to the culturing step.

[0123] The method for producing L-arginine according to the present disclosure may further include a step of recovering L-arginine from a culture medium (a culture medium in which the culture is performed) or a microorganism (e.g., a strain of the genus Corynebacterium) according to the culture. The recovery step may be further included after the culture step.

[0124] The above recovery may involve collecting the desired L-arginine using a suitable method known in the art according to the culture method of the microorganism disclosed in this disclosure, for example, batch, continuous, or fed-batch culture methods. For example, various chromatographs such as centrifugation, filtration, treatment with a crystallizing protein precipitating agent (salting out), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, HPLC, or a combination thereof may be used, and the desired L-arginine may be recovered from the culture medium or microorganism using a suitable method known in the art.

[0125] Additionally, the method for producing L-arginine of the present disclosure may further include a purification step. The purification may be performed using a suitable method known in the art. In one example, where the method for producing L-arginine of the present disclosure includes both a recovery step and a purification step, the recovery step and the purification step may be performed continuously or discontinuously regardless of the order, or simultaneously or integrated into a single step, but are not limited thereto.

[0126] In the method for producing L-arginine of the present disclosure, the microorganism (strain), culture medium, L-arginine, etc. are as described in the other examples above.

[0127]

[0128] Another example of the present disclosure is to provide a composition for producing L-arginine comprising the microorganism of the present disclosure, a culture medium in which the microorganism is cultured, or a combination thereof.

[0129] The composition of the present disclosure may further include any suitable excipients commonly used in compositions for L-arginine production, such excipients may be, for example, preservatives, wetting agents, dispersants, suspending agents, buffers, stabilizers or isotonic agents, but are not limited thereto.

[0130] In the composition of the present disclosure, the microorganism (strain), culture medium, L-arginine, etc. are as described in the other examples above.

[0131]

[0132] Another example provides a use for a Corynebacterium microorganism in which the activity of the nitrate reductase operon expression level regulator is weakened and the activity of glutamine synthase is enhanced for the production of L-arginine.

[0133] Another example provides a use for a Corynebacterium microorganism in which the activity of the nitrate reductase operon expression level regulator is weakened and the activity of glutamine synthase is enhanced, for use in the preparation of a composition for L-arginine production.

[0134]

[0135] Another example of the present disclosure provides a microorganism, method, composition, product, process, or use characterized by one or more elements disclosed in the present disclosure.

[0136]

[0137] The present disclosure relates to an L-arginine-producing microorganism in which the activity of a nitrate reductase operon expression level regulator is weakened and the activity of a glutamine synthase is enhanced, and a method for producing L-arginine using the same. It was confirmed that the L-arginine-producing microorganism in which the activity of a nitrate reductase operon expression level regulator is weakened and the activity of a glutamine synthase is enhanced has an increased L-arginine production capacity compared to the parent strain, and thus the microorganism can be widely utilized for L-arginine production.

[0138] The present disclosure is to be explained more specifically below with reference to examples, but these are merely illustrative and are not intended to limit the scope of the disclosure. It is obvious to those skilled in the art that the embodiments described below may be modified without departing from the essential gist of the disclosure.

[0139]

[0140] Example 1. Preparation of a plasmid for the attenuation of activity of a nitrate reductase operon expression level regulator

[0141] To determine the effect on L-arginine production resulting from the weakening of the Aerobic repressor of nitrate reductase R gene (hereinafter arnR) of Corynebacterium glutamicum, a vector was constructed as follows in which the BBD29_RS06340 gene (Sequence No. 2), NCBI registry number NCgl1138 derived from Corynebacterium glutamicum ATCC13869, was deleted.

[0142] Specifically, to construct a vector, PCR was performed using the chromosome of the Corynebacterium glutamicum ATCC13869 strain as a template and the respective primer pairs of SEQ ID NOs 6 and 7 and SEQ ID NOs 8 and 9.

[0143] PfuUltra™ high-reliability DNA polymerase (Stratagene) was used as the polymerase for the PCR reaction, and the PCR conditions were denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and polymerization at 72°C for 1 minute, and these denaturation, annealing, and polymerization reactions were repeated 28 times. As a result, DNA fragments of 985 bp and 964 bp were obtained, respectively. The obtained DNA product was purified using a PCR Purification kit (QUIAGEN), and the purified amplification product was treated with the restriction enzyme SmaI and heat-treated at 65°C for 20 minutes. Then, the pDC24 vector (SEQ No. 80) was used to construct the BBD29_RS06340 deletion vector pDC24ΔBBD29_RS06340 by cloning according to the provided manual using an Infusion Cloning Kit (TaKaRa).

[0144] The sequence of the primer used in Example 1 above is shown in Table 1 below.

[0145] Name Sequence (5'-> 3') Sequence Number RS06340-5'-FGTGAATTCGAGCTCGGTACCCATGGCAATTGAACTGAACGTC Sequence Number 6 RS06340-5'-RCAGAGCGAGCCCGACagtactTTGCTGCACTAATAAGGCCCC Sequence Number 7 RS06340-3'-FGCCTTATTAGTGCAGCAAagtactGTCGGGCTCGCTCTGGTG Sequence Number 8 RS06340-3'-RGGTCGACTCTAGAGGATCCCCATGTCAAACTTTGAAACGTTC Sequence Number 9 RS06340-FCTCCGAATGGGTAAACCG Sequence Number 10 RS06340-RCCTAAATTCCTCACAAGC Sequence Number 11

[0146] Comparative Example 1. Production of an L-arginine-producing microorganism with undamaged activity of the nitrate reductase operon expression level regulator

[0147] As a control group to confirm the effect of increased L-arginine productivity due to weakening of the nitrate reductase operon expression level regulator activity, Corynebacterium glutamicum CJR2 strain, in which the argR gene was deleted and an argB (M54V) gene mutation was introduced into the Corynebacterium glutamicum ATCC13869 strain, and Corynebacterium glutamicum CJR100 strain, in which the argR gene was deleted and an argB (M54V) gene mutation and an argC gene enhancement were introduced, were constructed as follows (Ikeda, Masato et al., Applied and environmental microbiology 75(6)1635-41, 2009).

[0148]

[0149] Comparative Example 1-1. Production of a microorganism in which the argR gene is deleted and the argB (M54V) mutation is introduced

[0150] Vectors for the introduction of argR deletion and argB (M54V) mutations were constructed as follows. Using the genomic DNA of Corynebacterium glutamicum ATCC13869 as a template, PCR was performed using primer pairs of SEQ ID NOs. 16 and 17 and SEQ ID NOs. 18 and 19, and overlapping PCR was performed using primer pairs of SEQ ID NOs. 16 and 19 to obtain homologous recombination fragments containing the argR deletion mutation sequence. In the same manner as above, to prepare homologous recombination fragments containing the argB (M54V) mutation, PCR was performed using primer pairs of SEQ ID NOs. 20 and 21 and SEQ ID NOs. 22 and 23, and overlapping PCR was performed using primer pairs of SEQ ID NOs. 20 and 23. The PCR reaction consisted of denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and the 2-minute extension process at 72°C was repeated 30 times. Then, the linearized pDC24 vector and each homologous recombination fragment were fusion cloned using the same method as described in Example 1. The constructed vectors (recombination plasmids) were named pDC24-ΔargR and pDC24-argB (M54V), respectively.

[0151] Then, to introduce an argR deletion mutation into wild-type Corynebacterium glutamicum ATCC13869, a recombinant strain was obtained by transforming the strain into Corynebacterium glutamicum ATCC13869 via chromosomal homologous recombination using the pDC24-ΔargR plasmid constructed above (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). PCR was performed on the obtained recombinant strain using the primer pair of SEQ ID NOs. 16 and 19 to confirm that a deletion mutation had been introduced into the chromosomal argR gene. The PCR reaction was performed by repeating the following steps 30 times: denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and extension at 72°C for 2 minutes. The transformed strain was named CJR1.

[0152] The argB (M54V) mutation was introduced into the above Corynebacterium glutamicum CJR1 using the same method as above. The above-constructed pDC24-argB (M54V) plasmid was used, and PCR was performed using primer pairs (sequence numbers 20 and 23) on the transformed strain after secondary recombination was completed to confirm that the M54V mutation was introduced into the chromosomal argB gene, and the transformed strain was named Corynebacterium glutamicum CJR2.

[0153]

[0154] The sequence of the primer used in Comparative Example 1 above is shown in Table 2 below.

[0155] Name Sequence (5'-> 3') Sequence Number argR-5'-Ftgaattcgagctcggtaccccactggtgaactccttgtcc Sequence Number 16 argR-5'-Rttgaactaggggcgctttaaaagttttccggtgttgacgg Sequence Number 17 argR-3'-Fccgtcaacaccggaaaacttttaaagcgcccctagttcaa Sequence Number 18 argR-3'-Rgtcgactctagaggatcccccgttgaactgcttgccagcc Sequence Number 19 argB-5'-Ftgaattcgagctcggtaccctgcggctcgcacggttgctc Sequence Number 20 argB-5'-Racggtgcgcaagaagaccacgtcggcaaaagcagcct Sequence Number 21argB-3'-FggctgcttttgctgccgacgtggtcttcttgcgcaccgtgSequence No. 22argB-3'-RgtcgactctagaggatccccctcttatcaggccaatcggtSequence No. 23

[0156] Comparative Example 1-2. Production of a microorganism having a deleted argR gene, an argB (M54V) gene mutation, and an argC gene enhancement introduced

[0157] Using the Corynebacterium glutamicum CJR2 strain produced in Comparative Example 1-1 above, a CJR100 strain was produced in which the N-acetyl-gamma-glutamyl-phosphate reductase gene (hereinafter, argC) was further reinforced to improve L-arginine productivity.

[0158] Specifically, to enhance the activity of the N-acetyl-gamma-glutamyl-phosphoriphosphate reductase gene argC (Sequence No. 24, NCBI Registration No. BBD29_RS07535), a plasmid was constructed to enhance argC activity by replacing the wild-type promoter of the argC gene with Po2 using the o2 promoter (Korean Patent Registration No. 10-1632642, hereinafter Po2), which is known as a potent promoter. The upstream and downstream regions of the argC gene were obtained. More specifically, to construct a strain of argC introduced with Po2, PCR was performed using the chromosomal DNA of Corynebacterium glutamicum ATCC13869 as a template to amplify the gene fragment of the upstream region of the argC gene using primers of SEQ ID NO. 27 and SEQ ID NO. 28, and the gene fragment of the downstream region of the argC gene using primers of SEQ ID NO. 29 and SEQ ID NO. 30. Additionally, the o2 promoter fragment was obtained using the primer pair of SEQ ID NO. 31 and SEQ ID NO. 32 with the pDC24-Po2 template.

[0159] PfuUltra™ high-reliability DNA polymerase (Stratagene) was used as the polymerase for the PCR reaction. The PCR conditions were denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and polymerization at 72°C for 1 minute, and the denaturation, annealing, and polymerization reactions under these conditions were repeated 28 times. As a result, an 86 bp DNA fragment of the o2 promoter region, a 610 bp DNA fragment of Corynebacterium glutamicum ATCC13869argC upstream, and a 1086 bp DNA fragment of the downstream region were obtained, respectively. PCR was performed using primers of SEQ ID NO. 24 and SEQ ID NO. 25 with the amplified promoter fragment and DNA fragment as templates. The PCR conditions were denaturation at 95°C for 5 minutes, followed by denaturation at 95°C for 30 seconds; and annealing at 55°C for 30 seconds; After repeating polymerization for 2 minutes at 72°C 28 times, the polymerization reaction was performed for 5 minutes at 72°C. The PCR fragment obtained above underwent DNA purification and was then linked to a pDC24 plasmid treated with SmaI restriction enzyme using the In-Fusion® HD Cloning Kit (Clontech) for fusion cloning. The resulting vector was named pDC24-Po2-argC.

[0160] Then, a recombinant strain was obtained by transforming the CJR2 strain produced in Comparative Example 1 into the CJR2 strain via chromosomal homologous recombination using the pDC24-Po2_argC plasmid produced above (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). PCR was performed on the obtained recombinant strain using the primer pair of SEQ ID NOs. 31 and 30 to confirm that the chromosomal argC gene was enhanced to Po2. At this time, the PCR reaction was performed by repeating the process of denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and extension at 72°C for 2 minutes 30 times. The transformed strain was named the Corynebacterium glutamicum CJR100 strain.

[0161]

[0162] The sequences of the primers used in Comparative Examples 1-2 above are shown in Table 3 below.

[0163] Name Sequence (5'-> 3') Sequence Number argC-5'-FGTGAATTCGAGCTCGGTACCCGCCCCGAAAAGCCGTTAAAAG Sequence Number 27 argC-5'-RtgccaaaattcacgattattgCCCACCTACAGCTAAAACTGC Sequence Number 28 argC-3'-FttattggaggagatcaaaacaATGACAATCAAGGTTGCAATC Sequence Number 29 argC-3'-RTTAAGGTGCGACGCCGACCTGGGGGATCCTCTAGAGTCGACC Sequence Number 30 Po2-Fcaataatcgtgaattttggca Sequence Number 31 Po2-Rtgttttgatctcctccaataa Sequence Number 32

[0164] Example 2. Preparation of L-arginine-producing microorganisms with weakened activity of nitrate reductase operon expression level regulators and evaluation of L-arginine production capacity

[0165] Example 2-1. Production of an L-arginine-producing microorganism with weakened activity of the nitrate reductase operon expression level regulator

[0166] In order to construct an L-arginine-producing microorganism with weakened activity of the nitrate reductase operon expression level regulator, a recombinant strain was obtained by transforming the Corynebacterium glutamicum CJR100 strain constructed in Comparative Examples 1-2 with the pDC24ΔBBD29_RS06340 plasmid constructed in Example 1 via chromosomal homologous recombination (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). PCR was performed on the obtained recombinant strain using the primer pair of SEQ ID NOs. 10 and 11 to confirm that the nitrate reductase operon expression level regulator (Aerobic repressor of nitrate reductase R_arnR) was deleted. At this time, the PCR reaction was performed with denaturation at 95°C for 30 seconds; The process of annealing at 55°C for 30 seconds and elongation at 72°C for 2 minutes was repeated 30 times. The transformed strain was named Corynebacterium glutamicum CJR1005 (CJR100ΔarnR).

[0167]

[0168] Example 2-2. Evaluation of L-amino acid production capacity of L-arginine-producing microorganisms with weakened activity of nitrate reductase operon expression level regulators

[0169] To confirm the effect of weakening of the activity of the nitrate reductase operon expression level regulator on L-arginine production capacity, the L-arginine production capacity was confirmed by culturing the Corynebacterium glutamicum CJR1005 strain, which has L-arginine production capacity with weakened activity of the nitrate reductase operon expression level regulator prepared in Example 2-1, the Corynebacterium glutamicum CJR2 strain and the Corynebacterium glutamicum CJ100 strain, which have unweakened activity of the nitrate reductase operon expression level regulator prepared in Comparative Examples 1-1 and 1-2, in the following manner.

[0170] Specifically, the Corynebacterium glutamicum CJR2 strain, the Corynebacterium glutamicum CJ100 strain, and the Corynebacterium glutamicum CJR1005 strain were each inoculated into a 250 ml corner-baffle flask containing 25 ml of the following production medium, and cultured at 30°C for 44 hours with shaking at 200 rpm. The composition of the production medium is as follows.

[0171]

[0172] Production Medium (pH 7.2)

[0173] Sucrose 50 g, ammonium sulfate 57 g, magnesium sulfate heptahydrate 2 g, beet molasses 5 g, calcium chloride 1 mg, cobalt chloride 1 mg, monopotassium phosphate 2 g, biotin 0.01 mg, thiamine-HCl 0.1 mg, calcium pantothenate 2 mg, nicotinamide 3 mg, ferrous sulfate 10 mg, manganese sulfate 10 mg, zinc sulfate 0.02 mg, copper sulfate 0.5 mg, calcium carbonate 30 g (based on 1 liter of distilled water)

[0174]

[0175] After the culture was finished, the production capacity (concentration) of L-arginine was measured using HPLC (Waters 2478). The above experiment was repeated three times, and the average L-arginine concentration values ​​from the analysis results are shown in Table 4 below.

[0176] Strain Name L-Arginine(g / ℓ)CJR25.12CJR1005.87CJR1005(CJR100ΔarnR)5.91

[0177] As a result, as shown in Table 4, it was confirmed that the L-arginine producing Corynebacterium glutamicum CJR1005 strain, which has weakened activity of the nitrate reductase operon expression level regulator, showed an improvement in L-arginine production capacity of about 1% compared to the Corynebacterium glutamicum CJR100 strain, which has no weakened activity of the nitrate reductase operon expression level regulator.

[0178] From the above results, it was confirmed that a mutation introducing only the weakening of the activity of the nitrate reductase operon expression level regulator did not significantly affect L-arginine productivity in microorganisms of the genus Corynebacterium.

[0179]

[0180] Example 3. Preparation of L-arginine-producing microorganisms with enhanced glutamine synthase activity and evaluation of L-arginine production capacity

[0181] Example 3-1. Construction of a plasmid for the introduction of the glutamine synthase gene

[0182] In order to determine the effect on L-arginine production resulting from the enhancement of glutamine synthase (type 1 glutamate-ammonia ligase) activity, a recombinant plasmid vector into which the glutamine synthase (BBD29_RS10525) gene (hereinafter, glnA) derived from Corynebacterium glutamicum ATCC13869 was introduced was constructed as follows.

[0183] Specifically, to reinforce the glutamine synthase gene (glnA) within the Corynebacterium glutamicum chromosome, BBD29_RS15405 (SEQ No. 37), known as the gene encoding a transposon in Corynebacterium glutamicum, was used as the insertion site (Journal of Biotechnology 104, 5-25 Jorn Kalinowski et al, 2003). To replace the BBD29_RS10525 gene in a reinforced form, a BBD29_RS15405 deletion and target gene insertion vector was constructed. To construct the vector, PCR was performed using primer pairs SEQ Nos. 39 and 40 and SEQ Nos. 41 and 42, using the chromosome of Corynebacterium glutamicum ATCC13869 as a template.

[0184] PfuUltra™ high-reliability DNA polymerase (Stratagene) was used as the polymerase for the PCR reaction, and the PCR conditions were denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and polymerization at 72°C for 1 minute. The denaturation, annealing, and polymerization reactions were repeated 28 times to obtain DNA fragments of 791 bp and 804 bp, respectively. The obtained DNA products were purified using a PCR Purification kit (QUIAGEN), and the purified DNA fragments were treated with the restriction enzyme SmaI. Then, the pDC24 vector (SEQ No. 80), which was heat-treated at 65°C for 20 minutes, and the BBD29_RS15405 deletion vector pDC24ΔBBD29_RS15405 were constructed by cleaning according to the provided manual using an Infusion Cloning Kit (TaKaRa).

[0185] Then, in order to further enhance the activity of glutamine synthase (GlnA), a plasmid was constructed to further enhance the glnA gene using the lysCP1 promoter (Korean Patent No. 10-0930203) (Sequence No. 45), which is known as a strong promoter.

[0186] Specifically, PCR was performed to obtain the glnA gene fragment using the primer pair of SEQ ID NOs 48 and 49, with the chromosome of Corynebacterium glutamicum ATCC13869 as a template.

[0187] PfuUltra™ high-reliability DNA polymerase (Stratagene) was used as the polymerase for the PCR reaction, and the PCR conditions were denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and polymerization at 72°C for 1 minute. The denaturation, annealing, and polymerization reactions were repeated 28 times to obtain a 386 bp DNA fragment of the lysCP1 promoter region and a 1434 bp DNA fragment of the glnA gene derived from Corynebacterium glutamicum ATCC13869, respectively.

[0188] PCR was performed using primers of SEQ ID NOs. 46 and 49 with the above promoter region DNA fragment and glnA gene DNA fragment as templates. Under PCR conditions, denaturation at 95°C for 5 minutes was followed by 28 cycles of denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and polymerization at 72°C for 2 minutes, after which a polymerization reaction was performed at 72°C for 5 minutes to obtain an 1820 bp lysCP1_glnA(C.gl) DNA fragment containing the lysCP1 promoter and the glnA gene derived from Corynebacterium glutamicum ATCC13869.

[0189] The DNA fragment obtained above was purified using a PCR purification kit (QIAGEN) and used as an insert DNA fragment for vector construction. After treating the purified DNA fragments with the restriction enzyme ScaI, the molar concentration (M) ratio of the insert DNA fragment to the pDC24ΔBBD29_RS15405 vector, which was heat-treated at 65°C for 20 minutes, was set to 1:2. A plasmid expressing the glnA gene was obtained by cloning according to the provided manual using the In-Fusion® HD Cloning Kit (Clontech). The vector containing the glnA gene derived from Corynebacterium glutamicum ATCC13869 and the lysCP1 promoter was named "pDC24-ΔBBD29_RS15405::lysCP1_glnA(C.gl)".

[0190] The sequence of the primers used in Example 3-1 is shown in Table 5 below.

[0191] Nominal sequence (5'-> 3') Sequence No. RS15405-5'-FaacgacggccagtgaattcGCTCGAATGCCTGACTGACA Sequence No. 39 RS15405-5'-RgtttAGTACTaaaccggaagggccAAAGGACGACTTCACGGTTA Sequence No. 40 RS15405-3'-FccggtttAGTACTaaacaggaagagccATTGAGGATGCGAAACTGT Sequence No. 41 RS15405-3'-RtgcatgcctgcaggtcgacGTAATCGAATCACCGGCCAG Sequence No. 42 RS15405-FACGTGTGCTGACTTCTCATG Sequence No. 43 RS15405-RCTCATTAGTGCAAAGGTATC Sequence No. 44 lysCP1-FGTCGTCCTTTGGCCCTTCCGGTTTAGTggcccttccggtttagt Sequence No 46lysCP1-RTTCCGGGGTTTCAAACGCCATatgtgtgcacctttcgatctacg Sequence No. 47glnA(C.gl) -FtagatcgaaaggtgcacacatATGGCGTTTGAAACCCCGGAA Sequence No. 48glnA(C.gl)-RCCTCAATGGCTCTTCCTGTTTAGTTTAGCAGTCGAAGTACAATTC Sequence No. 49

[0192] 3-2. Production of L-arginine-producing microorganisms with enhanced glutamine synthase activity

[0193] In order to determine the effect of enhancing glutamine synthetase activity on L-arginine productivity in a Corynebacterium glutamicum strain capable of producing L-arginine, a strain with enhanced glutamine synthetase (GlnA) activity by additionally introducing the glnA gene was prepared by the following method.

[0194] Specifically, the pDC24-ΔBBD29_RS15405::lysCP1_glnA(C.gl) vector constructed in Example 3-1 above was transformed into the L-arginine-producing strain Corynebacterium glutamicum CJR100 constructed in Comparative Example 1-2 above. A recombinant strain was obtained by transforming the Corynebacterium glutamicum CJR100 strain through chromosomal homologous recombination (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). PCR was performed on the obtained recombinant strain using the primer pair of SEQ ID NOs 43 and 43 to confirm that the glutamine synthase gene had been introduced. At this time, the PCR reaction was performed as follows: denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and the process of elongation at 72°C for 2 minutes was repeated 30 times. The transformed strain was named CJR1007(CJR100ΔBBD29_RS15405::lysCP1_glnA(C.gl).

[0195]

[0196] 3-3. Evaluation of L-arginine production capacity of L-arginine-producing microorganisms with enhanced glutamine synthase activity

[0197] The Corynebacterium glutamicum CJR1007 strain produced in Example 3-2 above and the parent strain Corynebacterium glutamicum CJR100 strain were cultured in a flask in the following manner to analyze the L-arginine production capacity.

[0198] Specifically, each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of seed medium and cultured at 30°C for 44 hours with shaking at 200 rpm. After the culture was completed, the production (concentration) of L-arginine was measured using HPLC (Waters 2478). The experiment was repeated three times, and the average values ​​of the analysis results are shown in Table 6 below.

[0199]

[0200] Production Medium (pH 7.2)

[0201] Sucrose 50 g, ammonium sulfate 57 g, magnesium sulfate heptahydrate 2 g, beet molasses 5 g, calcium chloride 1 mg, cobalt chloride 1 mg, monopotassium phosphate 2 g, biotin 0.01 mg, thiamine-HCl 0.1 mg, calcium pantothenate 2 mg, nicotinamide 3 mg, ferrous sulfate 10 mg, manganese sulfate 10 mg, zinc sulfate 0.02 mg, copper sulfate 0.5 mg, calcium carbonate 30 g (based on 1 liter of distilled water)

[0202] Strain Name L-Arginine(g / ℓ)CJR1005.87CJR1007(CJR100ΔBBD29_RS15405::lysCP1_glnA(C.gl)5.86

[0203] As a result, as shown in Table 6, it was confirmed that the L-arginine strain with enhanced glutamine synthase activity produced arginine at a level equivalent to that of the parent strain Corynebacterium glutamicum CJR100, which is a strain without enhanced glutamine synthase activity.

[0204]

[0205] Example 3-4. Construction of a plasmid for the introduction of an exogenous glutamine synthase gene

[0206] To determine the effect of introducing foreign heterologous glutamine synthase genes on L-arginine production, recombinant plasmid vectors were constructed as follows to introduce glutamine synthase genes (glnA) derived from Aureibacillus halotolerans and Bacillus subtilis subsp. 168.

[0207] Specifically, to insert the foreign glutamine synthase (BBD29_RS10525) gene (glnA) into the Corynebacterium glutamicum chromosome, the pDC24ΔBBD29_RS15405 vector constructed in Example 3-1 was used as the insertion region. To further enhance the activity of glutamine synthase (GlnA), a plasmid was constructed to further enhance the glnA gene using the lysCP1 promoter (Korean Registered Patent No. 10-0930203) (Sequence No. 45), which is known as a strong promoter.

[0208] Specifically, to construct a vector containing a foreign glnA introduced gene having a lysCP1 promoter, PCR was performed using the chromosomes of Aureibacillus halothorrans (A.ht) and Bacillus subtilis subsp. 168 (B.su), respectively, with primer pairs of SEQ ID NO. 50 and 51 to obtain a glnA gene fragment derived from Aureibacillus halothorrans (A.ht) (SEQ ID NO. 34), and primer pairs of SEQ ID NO. 52 and 53 to obtain a glnA gene fragment derived from Bacillus subtilis subsp. 168 (B.su) (SEQ ID NO. 36).

[0209] PfuUltra™ high-reliability DNA polymerase (Stratagene) was used as the polymerase for the PCR reaction, and the PCR conditions were denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and polymerization at 72°C for 1 minute. The denaturation, annealing, and polymerization reactions were repeated 28 times to obtain a 386 bp DNA fragment of the lysCP1 promoter region, a 1338 bp DNA fragment of the glnA gene derived from Aureibacillus halothorax, and a 1335 bp DNA fragment of the glnA gene derived from Bacillus subtilis subsp. 168, respectively.

[0210] PCR was performed using the primers of SEQ ID NOs. 46 and 51 and SEQ ID NOs. 46 and 53, with the above promoter region DNA fragment and each glnA gene DNA fragment as templates. Under PCR conditions, denaturation at 95°C for 5 minutes was followed by 28 cycles of denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and polymerization at 72°C for 2 minutes, followed by polymerization at 72°C for 5 minutes to obtain a 1724bp lysCP1_glnA(A.ht) DNA fragment containing the lysCP1 promoter and the glnA gene derived from Aureibacillus halotorerans, and a 1721bp lysCP1_glnA(B.su) DNA fragment containing the lysCP1 promoter and the glnA gene derived from Bacillus subtilis subsp. 168.

[0211] The above-mentioned DNA fragments were purified using a PCR Purification kit (QIAGEN) and used as insert DNA fragments for vector construction. After treating the purified DNA fragments with the restriction enzyme ScaI, the molar concentration (M) ratio of the insert DNA fragments to the pDC24ΔBBD29_RS15405 vector, which had been heat-treated at 65°C for 20 minutes, was set to 1:2. Plasmids expressing each glnA gene were obtained by cloning according to the provided manual using the In-Fusion® HD Cloning Kit (Clontech). Vectors containing the glnA gene derived from Aureibacillus halotorrens and the lysCP1 promoter were "pDC24-ΔBBD29_RS15405::lysCP1_glnA(A.ht)", and Bacillus subtilis subsp. The vector containing the 168-derived glnA gene and the lysCP1 promoter was named "pDC24-ΔBBD29_RS15405::lysCP1_glnA(B.su)" respectively.

[0212] The sequences of the primers used in Examples 3-4 are listed in Table 7 below.

[0213] Name Sequence (5'-> 3') Sequence No. glnA(A.ht)-FtagatcgaaaggtgcacacatATGGGTTCTAAGTACACGAGAAAAG Sequence No. 50 glnA(A.ht)-RCTCTTCCTGTTTAGTTTAGTAAAGGGTAAGGTACTGC Sequence No. 51 glnA(B.su)-FtagatcgaaaggtgcacacatATGGCAAAGTACACTAGAGAAGATA Sequence No. 52 glnA(B.su)-RCTCTTCCTGTTTAGTTTAATACTGAGACATATACTGTTCG Sequence No. 53

[0214] Examples 3-5. Production of L-arginine-producing microorganisms with enhanced activity of exogenous glutamine synthase

[0215] In order to determine the effect of enhancing glutamine synthase activity on L-arginine production following the introduction of an exogenous heterologous glutamine synthase gene into a Corynebacterium glutamicum strain capable of producing L-arginine, a strain into which an exogenous glnA gene was introduced was prepared by the following method.

[0216] Specifically, a recombinant strain was obtained by transforming the Corynebacterium glutamicum CJR100 strain prepared in Comparative Examples 1-2 above into the Corynebacterium glutamicum CJR100 strain via chromosomal homologous recombination using the pDC24-ΔBBD29_RS15405::lysCP1_glnA(A.ht) and pDC24-ΔBBD29_RS15405::lysCP1_glnA(B.su) plasmids prepared in Examples 3-4 above (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). PCR was performed on the obtained recombinant strain using the primer pair of SEQ ID NOs 43 and 43 to confirm that the glutamine synthase gene had been introduced. At this time, the PCR reaction was performed at 95°C for 30 seconds; The process of annealing at 55°C for 30 seconds and elongation at 72°C for 2 minutes was repeated 30 times. The transformed strains were named CJR1008 (CJR100ΔBBD29_RS15405::lysCP1_glnA(A.ht)) and CJR1009 (CJR100ΔBBD29_RS15405::lysCP1_glnA(B.su).

[0217]

[0218] Example 3-6. Evaluation of L-arginine productivity of L-arginine-producing microorganisms into which an exogenous glutamine synthase gene was introduced

[0219] In order to evaluate the L-arginine productivity of L-arginine-producing microorganisms into which an exogenous glutamine synthase gene was introduced, the L-arginine production ability of the Corynebacterium glutamicum CJR1008 (CJR100ΔBBD29_RS15405::lysCP1_glnA(A.ht) strain and Corynebacterium glutamicum CJR1009 (CJR100ΔBBD29_RS15405::lysCP1_glnA(B.su) strain prepared in Examples 3-5, and the Corynebacterium glutamicum CJ100 strain prepared in Comparative Examples 1-2 was confirmed using the same method as in Example 3-3, and the results are shown in Table 8 below.

[0220] Strain nameL-arginine (g / ℓ)CJR1005.87CJR100ΔBBD29_RS154055.86CJR1007 (CJR100ΔBBD29_RS15405::lysCP1_glnA(C.gl)5.86CJR1008(CJR100ΔBBD29_RS15405: :lysCP1_glnA(A.ht)5.90CJR1009(CJR100ΔBBD29_RS15405::lysCP1_glnA(B.su)5.84

[0221] As a result, as shown in Table 8, it was confirmed that the L-arginine production capacity with the introduced foreign glutamine synthase gene was equivalent to that of the parent strain, Corynebacterium glutamicum CJR100.

[0222]

[0223] Example 4. Preparation of an L-arginine-producing microorganism with weakened activity of the nitrate reductase operon expression level regulator and enhanced activity of glutamine synthase, and evaluation of L-arginine production capacity

[0224] Example 4-1. Preparation of an L-arginine-producing microorganism in which the activity of the nitrate reductase operon expression level regulator is weakened and, simultaneously, the activity of glutamine synthase is enhanced.

[0225] To determine the effect of a combination variant of weakening the activity of the nitrate reductase operon expression level regulator and strengthening the activity of glutamine synthase on L-arginine production capacity, strains with arnR deletion and the additional introduction of the glnA gene were constructed as follows.

[0226] Specifically, a recombinant strain was obtained by transforming the Corynebacterium glutamicum CJR1005 strain, in which the activity of the nitrate reductase operon expression level regulator prepared in Example 2-1 was weakened, into the Corynebacterium glutamicum CRJ1005 strain by chromosomal homologous recombination with the vector pDC24-ΔBBD29_RS15405::lysCP1_glnA(C.gl) prepared in Example 3-1, the vector pDC24-ΔBBD29_RS15405::lysCP1_glnA(A.ht) prepared in Example 3-4, and the vector pDC24-ΔBBD29_RS15405::lysCP1_glnA(B.su) prepared in Example 3-4 (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). PCR was performed on the recombinant strain obtained above using the primer pair of SEQ ID NOs 43 and 44 to confirm that the glutamine synthase gene was introduced. At this time, the PCR reaction was performed by repeating the process of denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and extension at 72°C for 2 minutes 30 times. The transformed strains were named CJR1013 (CJR1005ΔBBD29_RS15405::lysCP1_glnA(B.su), CJR1014 (CJR1005ΔBBD29_RS15405::lysCP1_glnA(A.ht), and CJR1019 (CJR100ΔBBD29_RS15405::lysCP1_glnA(C.gl), respectively.

[0227]

[0228] Example 4-2. Confirmation of the effect of increasing L-arginine productivity in L-arginine-producing microorganisms with weakened activity of nitrate reductase operon expression level regulator and enhanced activity of glutamine synthase.

[0229] The Corynebacterium glutamicum strains CJR1013, CJR1014, and CJR1019 produced in Example 4-1, the Corynebacterium glutamicum strain CJR100 produced in Comparative Example 1-1, the Corynebacterium glutamicum strain CRJ1005 produced in Example 2-1, the Corynebacterium glutamicum strain CJR1007 produced in Example 3-2, and the Corynebacterium glutamicum strains CJR1008 and CJR1009 produced in Example 3-5 were cultured in flasks in the following manner to analyze the L-arginine production capacity.

[0230] Specifically, each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of seed medium and cultured at 30°C for 44 hours with shaking at 200 rpm. After the culture was completed, the production (concentration) of L-arginine in each strain's culture medium was measured using HPLC (Waters 2478). The experiment was repeated three times, and the average values ​​of the analysis results are shown in Table 9 below.

[0231]

[0232] Production Medium (pH 7.2)

[0233] Sucrose 50 g, ammonium sulfate 57 g, magnesium sulfate heptahydrate 2 g, beet molasses 5 g, calcium chloride 1 mg, cobalt chloride 1 mg, monopotassium phosphate 2 g, biotin 0.01 mg, thiamine-HCl 0.1 mg, calcium pantothenate 2 mg, nicotinamide 3 mg, ferrous sulfate 10 mg, manganese sulfate 10 mg, zinc sulfate 0.02 mg, copper sulfate 0.5 mg, calcium carbonate 30 g (based on 1 liter of distilled water)

[0234] Strain Name L-Arginine(g / ℓ)CJR1005.87CJR100ΔBBD29_RS154055.86CJR1005(CJR100ΔarnR)5.91CJR1007 (CJR100ΔBBD29_RS15405::lysCP1_glnA(C.gl)5.86CJR1008(CJR100ΔBBD29 _RS15405::lysCP1_glnA(A.ht)5.90CJR1009(CJR100ΔBBD29_RS15405::lys CP1_glnA(B.su)5.84CJR1019(CJR1005ΔBBD29_RS15405::lysCP1_glnA(C.g l)6.10CJR1014(CJR1005ΔBBD29_RS15405::lysCP1_glnA(A.ht)6.30CJR1013 (CJR1005ΔBBD29_RS15405::lysCP1_glnA(B.su)6.17

[0235] As a result, as shown in Table 9, it was confirmed that the L-arginine production capacity of the Corynebacterium glutamicum CJR1019, CJR1014, and CJR1013 strains, in which the activity of the nitrate reductase operon expression level regulator was weakened and the activity of glutamine synthase was strengthened at the same time, was improved by 4%, 7%, and 5%, respectively, compared to the parent strain CJR100. In addition, it was confirmed that the L-arginine production capacity of Corynebacterium glutamicum strains, in which the activity of the nitrate reductase operon expression level regulator was weakened and the activity of glutamine synthase was simultaneously enhanced, was higher than that of Corynebacterium glutamicum CJR1005, in which only the activity of the nitrate reductase operon expression level regulator was weakened, and Corynebacterium glutamicum CJR1007, CJR1008, and CJR1009, in which only the activity of glutamine synthase was enhanced.

[0236] Based on the above results, it was confirmed that when only arnR-deficient and glnA-enhanced variants were introduced into Corynebacterium microorganisms, the L-arginine production capacity was equivalent to that of the parent strain; however, when both arnR deficiency and glnA-enhanced variants were introduced simultaneously, the L-arginine production capacity of Corynebacterium microorganisms was enhanced, making it effective for L-arginine production.

[0237]

[0238] Example 5. Construction of a plasmid for inserting the complex genes of malate:quinone oxidoreductase, malate dehydrogenase, aspartate transaminase, NADP-specific glutamate dehydrogenase, and fumarate hydrase.

[0239] According to the additional introduction of a complex comprising all of the following genes of Corynebacterium glutamicum: the gene encoding malate:quinone oxidoreductase (SEQ No. 54) (SEQ No. 55, hereinafter mqo), the gene encoding malate dehydrogenase (SEQ No. 58) (SEQ No. 59, hereinafter mdh), the gene encoding aspartate transaminase (SEQ No. 60) (SEQ No. 61, hereinafter asaspB), the gene encoding NADP-specific glutamate dehydrogenase (SEQ No. 62) (SEQ No. 63, hereinafter gdh), and the gene encoding fumarate hydratase (SEQ No. 64) (SEQ No. 65, hereinafter fumC). To confirm the productivity-enhancing effect of L-arginine, a complex reinforcing vector was prepared using the following method.

[0240] Specifically, to insert the complex gene into the Corynebacterium glutamicum chromosome, the mqo gene within the complex was used as the insertion site. A target gene insertion vector containing the mqo gene was constructed to replace the complex form within the mqo gene. PCR was performed using the primer pairs of each complex gene listed in Table 10, with the chromosome of the Corynebacterium glutamicum ATCC13032 strain as a template.

[0241] PfuUltra™ high-reliability DNA polymerase (Stratagene) was used as the polymerase for the PCR reaction, and the PCR conditions were denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and polymerization at 72°C for 1 minute, and the denaturation, annealing, and polymerization reactions under the above conditions were repeated 28 times. As a result, DNA fragments were obtained using primer pairs of SEQ ID NOs. 66 and 67 for the mqo gene fragment (1947 bp), primer pairs of SEQ ID NOs. 68 and 69 for the mdh gene fragment (1357 bp), primer pairs of SEQ ID NOs. 70 and 71 for the aspB gene fragment (1575 bp), primer pairs of SEQ ID NOs. 72 and 73 for the gdh gene fragment (1794 bp), primer pairs of SEQ ID NOs. 74 and 75 for the fumC gene fragment (1686 bp), and primer pairs of SEQ ID NOs. 76 and 77 for the mqo gene fragment (1916 bp). PCR was performed using the obtained DNA products with primers of SEQ ID NOs. 66 and 77. PfuUltra™ high-reliability DNA polymerase (Stratagene) was used as the polymerase for the PCR reaction, and the PCR conditions were denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and polymerization at 72°C for 10 minutes, and the denaturation, annealing, and polymerization reactions under the above conditions were repeated 28 times. As a result, a 10,275 bp mqo-mdh-aspB-gdh-fumC-mqo complex gene DNA fragment was obtained.The obtained DNA product was purified using a PCR Purification kit (QUIAGEN), and the purified amplification product was treated with the restriction enzyme SmaI and heat-treated at 65°C for 20 minutes. Then, the pDC24 vector (SEQ No. 80) was constructed to introduce mqo-mdh-aspB-gdh-fumC-mqo into the chromosome using an Infusion Cloning Kit (TaKaRa) according to the provided manual.

[0242] The sequence of the primers used in Example 5 above is shown in Table 10 below.

[0243] Name Sequence (5'-> 3') Sequence Number mqo-5'-FGTGAATTCGAGCTCGGTACCCATACTACTCATGTTTGCGAAT Sequence Number 66 mqo-3'-RTCCTGATATCGGGCACCATTTGGCAAAGAATACGCAAAGCAC Sequence Number 67 mdh-5'-FTGCTTTGCGTATTCTTTGCCAAATGGTGCCCGATATCAGGA Sequence Number 68 mdh-3'-RAACAAAGCAGCCATGCGTTGCAGCCGTTACTTAAACCAAGTC Sequence Number 69 aspB-5'-FCGACTTGGTTTAAGTAACGGCTGCAACGCATGGCTGCTTTGTT Sequence Number 70 aspB-3'-RGCGAATGAGACCAGTTGACTGTTAGTTAGCGTAATGCTCCGC Sequence Number 71gdh-5'-FGCGGAGCATTACGCTAACTAACAGTCAACTGGTCTCATTCGC Sequence No. 72gdh-3'-RGGTTAATATCCAATATGGAAGTTAGATGACGCCCTGTGCCAG Sequence No. 73fumC-5'-FCTGGCACAGGGCGTCATCTAACTTCCATATTGGATATTAACC Sequence No. 74fumC-3'-RATTCGCAAACATGAGTAGTATTTAGAACTTGTTCTCGCGCTC Sequence No. 75mqo-5'-FCGCGAGAACAAGTTCTAAATACTACTCATGTTTGCGAATTG Sequence No. 76mqo-3'-RGGTCGACTCTAGAGGATCCCCTTAGGCTTCCTCAAGCTTCAG Sequence No. 77Mqo-FCTCTTCACCAGCATT Sequence No. 78Mqo-RTTGTCACAACATCTGTTTCA Sequence No. 79

[0244] Example 6. Preparation of microorganisms with enhanced activities of malate:quinone oxidoreductase, malate dehydrogenase, aspartate transaminase, NADP-specific glutamate dehydrogenase, and fumarate hydrase, and evaluation of L-amino acid production capacity

[0245] Example 6-1. Preparation of a microorganism in which the activities of malate:quinone oxidoreductase, malate dehydrogenase, aspartate transaminase, NADP-specific glutamate dehydrogenase, and fumarate hydrase are all enhanced

[0246] In order to produce microorganisms with enhanced activities of malate:quinone oxidoreductase, malate dehydrogenase, aspartate transaminase, NADP-specific glutamate dehydrogenase, and fumarate hydrase, recombinant strains were obtained by transforming the Corynebacterium glutamicum CJR100 strain produced in Comparative Example 1-2 and the Corynebacterium glutamicum CJR1005 strain produced in Example 2-1 with the pDC24mqo-mdh-aspB-gdh-fumC-mqo plasmid produced in Example 5 by chromosomal homologous recombination (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). PCR was performed on the recombinant strain obtained above using the primer pair of SEQ ID NOs. 78 and 79 to confirm that the mqo-mdh-aspB-gdh-fumC-mqo complex was introduced into the chromosome of Corynebacterium glutamicum. At this time, the PCR reaction was performed by repeating the process of denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and extension at 72°C for 2 minutes 30 times. The transformed strain based on the Corynebacterium glutamicum CJR100 strain was named Corynebacterium glutamicum CJR1012 strain, and the transformed strain based on the Corynebacterium glutamicum CJR1005 strain was named Corynebacterium glutamicum CJR1015 strain.

[0247]

[0248] Example 6-2. Evaluation of L-arginine production capacity of microorganisms with enhanced activities of malate:quinone oxidoreductase, malate dehydrogenase, aspartate transaminase, NADP-specific glutamate dehydrogenase, and fumarate hydrase

[0249] In order to confirm the effect of enhancing the activity of malate:quinone oxidoreductase, malate dehydrogenase, aspartate transaminase, NADP-specific glutamate dehydrogenase, and fumarate hydrase on L-amino acid production capacity, the Corynebacterium glutamicum CJR1012 and CJR1015 strains prepared in Example 6-1, the Corynebacterium glutamicum CJ100 strain prepared in Comparative Example 1-2, and the Corynebacterium glutamicum CJR1005 strain prepared in Example 2-1 were cultured in the following manner to confirm the production capacity of L-arginine.

[0250] Specifically, Corynebacterium glutamicum CJ100 strain, Corynebacterium glutamicum CJR1005 strain, Corynebacterium glutamicum CJR1012 strain, and CJR1015 strain were each inoculated into a 250 ml corner-baffle flask containing 25 ml of the following production medium, and cultured at 30°C for 44 hours with shaking at 200 rpm. The composition of the production medium is as follows.

[0251]

[0252] Production Medium (pH 7.2)

[0253] Sucrose 50 g, ammonium sulfate 57 g, magnesium sulfate heptahydrate 2 g, beet molasses 5 g, calcium chloride 1 mg, cobalt chloride 1 mg, monopotassium phosphate 2 g, biotin 0.01 mg, thiamine-HCl 0.1 mg, calcium pantothenate 2 mg, nicotinamide 3 mg, ferrous sulfate 10 mg, manganese sulfate 10 mg, zinc sulfate 0.02 mg, copper sulfate 0.5 mg, calcium carbonate 30 g (based on 1 liter of distilled water)

[0254]

[0255] After the culture was finished, the production capacity (concentration) of L-arginine was measured using HPLC (Waters 2478). The above experiment was repeated three times, and the average value of the L-arginine concentration, which was the result of the analysis, is shown in Table 11 below.

[0256] Strain nameL-arginine (g / ℓ)CJR1005.87CJR1005(CJR100ΔarnR)5.91CJR1012 (CJR100-mqo-mdh-aspB-gdh-fumC-mqo)6.40CJR1015 (CJR1005-mqo-mdh-aspB-gdh-fumC-mqo)6.70

[0257] As a result, as shown in Table 11, it was confirmed that the L-arginine production capacity of the Corynebacterium glutamicum CJR1012 strain, which introduced the mqo-mdh-aspB-gdh-fumC-mqo complex, was improved by 9% compared to the parent strain, Corynebacterium glutamicum CJR100, and it was confirmed that the L-arginine production capacity of the Corynebacterium glutamicum CJR1015 strain, which introduced the mqo-mdh-aspB-gdh-fumC-mqo complex with arnR deficiency, was improved by 13% compared to the parent strain, Corynebacterium glutamicum CJR1005.

[0258] From the above results, it was confirmed that enhancing the activity of malate:quinone oxidoreductase, malate dehydrogenase, aspartate transaminase, NADP-specific glutamate dehydrogenase, and fumarate hydrase increases the L-arginine production capacity of microorganisms of the genus Corynebacterium.

[0259]

[0260] Example 6-3. Production of an L-arginine-producing microorganism in which the activity of the nitrate reductase operon expression level regulator is weakened and the activities of glutamine synthase, malate:quinone oxidoreductase, malate dehydrogenase, aspartate transaminase, NADP-specific glutamate dehydrogenase, and fumarate hydrase are simultaneously enhanced.

[0261] In order to construct an L-arginine-producing microorganism in which the activity of the nitrate reductase operon expression level regulator is weakened, the activity of glutamine synthase is enhanced, and the activities of malate:quinone oxidoreductase, malate dehydrogenase, aspartate transaminase, NADP-specific glutamate dehydrogenase, and fumarate hydrase are all enhanced, the pDC24-ΔBBD29_RS15405::lysCP1_glnA(C.gl) plasmid constructed in Example 3-1, the pDC24-ΔBBD29_RS15405::lysCP1_glnA(A.ht) plasmid constructed in Example 3-4, and the Corynebacterium glutamicum CJR1015 strain constructed in Example 6-1 were applied. A recombinant strain was obtained by transforming the pDC24-ΔBBD29_RS15405::lysCP1_glnA(B.su) plasmid into the Corynebacterium glutamicum CJR1015 strain by chromosomal homologous recombination (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). PCR was performed on the obtained recombinant strain using the primer pair of SEQ ID NOs. 43 and 44 to confirm that the glutamine synthase gene was introduced chromosomally. At this time, the PCR reaction was performed by repeating the process of denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and extension at 72°C for 2 minutes 30 times. The above-mentioned transformed strains were named as Corynebacterium glutamicum CJR1016(CJR1015ΔBBD29_RS15405::lysCP1_glnA(C.gl), CJR1017(CJR1015ΔBBD29_RS15405::lysCP1_glnA(B.su), and CJR1018(CJR1015ΔBBD29_RS15405::lysCP1_glnA(A.ht).

[0262]

[0263] Example 6-4. Confirmation of increased L-arginine production capacity in L-arginine-producing microorganisms in which the activity of the nitrate reductase operon expression level regulator was weakened and the activities of glutamine synthase, malate:quinone oxidoreductase, malate dehydrogenase, aspartate transaminase, NADP-specific glutamate dehydrogenase, and fumarate hydrase were simultaneously enhanced.

[0264] In order to confirm the effect of increased L-arginine production capacity of L-arginine-producing microorganisms resulting from weakening of the activity of the nitrate reductase operon expression level regulator, strengthening of the activity of glutamine synthase, and strengthening of the activities of malate:quinone oxidoreductase, malate dehydrogenase, aspartate transaminase, NADP-specific glutamate dehydrogenase, and fumarate hydrase, strains were cultured in the following manner and the concentration of L-arginine in the culture medium was analyzed.

[0265] Specifically, the control strain Corynebacterium glutamicum CJR100 and the Corynebacterium glutamicum strains CJR1016, CJR1017, and CJR1018 produced in Example 6-3 were inoculated into a 250 ml corner-baffle flask containing 25 ml of the production medium described in Example 6-2, and cultured at 30°C for 44 hours with shaking at 200 rpm.

[0266] After the culture was finished, the production capacity (concentration) of L-arginine was measured using HPLC (Waters 2478). The above experiment was repeated three times, and the average L-arginine concentration values ​​from the analysis results are shown in Table 12 below.

[0267] Strain name Histidine (g / L)CJR1005.87CJR1005(CJR100ΔarnR)5.91CJR1012 (CJR100-mqo-mdh-aspB-gdh-fumC-mqo)6.40CJR1015 (CJR1005-mqo-mdh-aspB-gdh-fumC-mqo)6.70CJR1016(CJR1015ΔBBD29_RS15405::lysCP 1_glnA(C.gl)6.83CJR1017(CJR1015ΔBBD29_RS15405::lysCP1_glnA(B.su)7.07CJR1018 (CJR1015ΔBBD29_RS15405::lysCP1_glnA(A.ht)7.43

[0268] As a result, as shown in Table 12, it was confirmed that L-arginine producing strains CJR1016, CJR1017, and CJR1018, in which the activity of the nitrate reductase operon expression level regulator was weakened and the activities of glutamine synthase, malate:quinone oxidoreductase, malate dehydrogenase, aspartate transaminase, NADP-specific glutamate dehydrogenase, and fumarate hydrase were simultaneously enhanced, showed L-arginine production capacity improved by 16%, 20%, and 26%, respectively, compared to the Corynebacterium glutamicum CJR100 strain. In addition, it was confirmed that L-arginine production capacity was improved by 2%, 5%, and 11%, respectively, compared to the Corynebacterium glutamicum CJR1015 strain that did not introduce the mqo-mdh-aspB-gdh-fumC-mqo complex.

[0269] From the above results, it was confirmed that weakening of the activity of the nitrate reductase operon expression level regulator, enhancement of glutamine synthase, and simultaneous enhancement of the activities of malate:quinone oxidoreductase, malate dehydrogenase, aspartate transaminase, NADP-specific glutamate dehydrogenase, and fumarate hydrase increased the L-arginine production capacity of microorganisms of the genus Corynebacterium.

[0270]

[0271] From the foregoing description, those skilled in the art to which this disclosure pertains will understand that this disclosure may be implemented in other specific forms without altering its technical concept or essential features. In this regard, the embodiments described above should be understood as illustrative in all respects and not restrictive. The scope of this disclosure should be interpreted as including all modifications or variations derived from the meaning and scope of the claims set forth below and their equivalents, rather than from the detailed description above.

Claims

1. Microorganisms of the genus Corynebacterium in which the activity of the aerobic repressor of nitrate reductase R, a regulator of nitrate reductase operon expression levels, is weakened and the activity of glutamine synthetase is enhanced.

2. In claim 1, the microorganism is a microorganism of the genus Corynebacterium having the ability to produce L-arginine.

3. A microorganism of the genus Corynebacterium according to claim 1, wherein the nitrate reductase operon expression level regulator comprises the amino acid sequence of SEQ ID NO.

1.

4. A microorganism of the genus Corynebacterium according to claim 1, wherein the glutamine synthase comprises an amino acid sequence having at least 80% sequence identity with any one amino acid sequence selected from the group consisting of the amino acid sequence of SEQ ID NO. 3, the amino acid sequence of SEQ ID NO. 33, the amino acid sequence of SEQ ID NO. 35, or the amino acid sequences of SEQ ID NO. 3, SEQ ID NO. 33, and SEQ ID NO.

35.

5. A microorganism of the genus Corynebacterium according to claim 1, wherein the activity of the nitrate reductase operon expression level regulator is weakened by one or more of the following methods: deletion of all or part of the gene encoding the polypeptide; substitution, modification, and gene mutation of the expression regulatory site.

6. A microorganism of the genus Corynebacterium according to claim 1, wherein the activity of the glutamine synthase is enhanced by one or more of the following methods: copy number increase by chromosome insertion and vector introduction, substitution of expression regulatory sites, modification, and gene mutation.

7. In claim 1, the microorganism of the genus Corynebacterium is additionally a microorganism of the genus Corynebacterium in which the activity of malate:quinone oxidoreductase, malate dehydrogenase, aspartate transaminase, and NADP-specific glutamate dehydrogenase is enhanced.

8. In paragraph 1, the microorganism of the genus Corynebacterium is Corynebacterium glutamicum.

9. In any one of claims 1 to 8, the Corynebacterium microorganism is a Corynebacterium microorganism having increased L-arginine production capacity compared to a homologous non-modified microorganism in which the activity of the nitrate reductase operon expression level regulator is not weakened or the activity of glutamine synthase is not enhanced.

10. A step of culturing a microorganism of the genus Corynebacterium according to any one of claims 1 to 8 in a medium; and A method for producing L-arginine, comprising the step of recovering L-amino acid from the cultured microorganism, the medium, or both.

11. A method for producing L-arginine according to claim 10, wherein the microorganism of the genus Corynebacterium is Corynebacterium glutamicum.

12. Use of a microorganism of the genus Corynebacterium according to any one of paragraphs 1 to 8 for the production of L-arginine.