Methods and uses for improving metabolism

Administering medium-chain dodecanedioic acid (DDDA or DC 12) for an extended period addresses the inefficacies of previous metabolism improvements by achieving substantial weight loss and visceral fat reduction through oral administration, enhancing metabolic processes.

WO2026112081A1PCT designated stage Publication Date: 2026-05-28JEMYLL LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/055996
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-11-20
Filing Date
2025-11-18
Publication Date
2026-05-28

Smart Images

  • Figure US2025055996_28052026_PF_FP_ABST
    Figure US2025055996_28052026_PF_FP_ABST
Patent Text Reader

Abstract

Methods and uses are presented in which a therapeutically effective unit dose of dodecanedioic acid (DDDA or DC12) is administered for an extended period of time to improve a subject's lipid metabolism. Preferred dosage units comprise no more than 5% of the subject's standard daily caloric intake and improvements in metabolism are associated with weight loss and / or reduction of visceral fat.
Need to check novelty before this filing date? Find Prior Art

Description

METHODS AND USES FOR IMPROVING METABOLISM

[0001] This application claims priority to our co-pending US Provisional Patent Application with the serial number 63 / 723,060, which was filed 11 / 20 / 2024, and which is incorporated by reference herein.Sequence Listing

[0002] The content of the XML file of the sequence listing named 104026.0099PCT.xml, which is 20,167 bytes in size was created on 11 / 11 / 2025 and electronically submitted via Patent Center along with the present application, and is incorporated by reference in its entirety.Field of the Invention

[0003] The field of the invention is methods and uses for nutritional supplements, especially as it relates to low dose, oral administration of Dodecanedioic acid (DDDA or DC 12) over an extended period of time to promote weight loss and reduce visceral fat.Background of the Invention

[0004] The background description includes information that may be useful in understanding the present invention. It is not an admission that any of the information provided herein is prior art or relevant to the presently claimed invention, or that any publication specifically or implicitly referenced is prior art.

[0005] All publications and patent applications herein are incorporated by reference to the same extent as if each individual publication or patent application were specifically and individually indicated to be incorporated by reference. Where a definition or use of a term in an incorporated reference is inconsistent or contrary to the definition of that term provided herein, the definition of that term provided herein applies and the definition of that term in the reference does not apply.

[0006] A new study released from the Lancet, a weekly medical journal that publishes research on clinical, public health, and global healthy topics, shows that in 2022, more than 1 billion people in the world are now living with obesity (URL: www.who.int / news / item / 01-03-2024- one-in-eight-people-are-now-living-with-obesity). Worldwide, obesity among adults has more than doubled since 1990, and has quadrupled among children and adolescents (5 to 19 years ofage). Id. The date also shows that 43% of adults were overweight in 2022. Id. According to the National Institutes of Health, obesity and overweight together are the second leading cause of preventable death in the United States, with an estimated 300,000 deaths per year being due to obesity . (URL : www. wvdhhr. org / bph / oehp / obesity / mortality . htm# : ~ :text=According%20 to%20the%20National%20Institutes,the%20obesity%20epidemic%20(57)).

[0007] Obesity, and associated hyperglycemia and diabetes, is a problem that is still missing effective and well-tolerated solutions. Despite an effort to efficiently influence metabolism, few methods and uses are known. For example, in U.S. patent application US 2015 / 0125426 Al, nutraceutical compositions comprising medium chain dicarboxylic acids and / or derivatives of medium chain dicarboxylic acids were contemplated to be used to treat or prevent metabolic disorders, and particularly diabetes and hyperglycemia. While various data for glucose levels were presented, specific effective dosages were not contemplated, and neither weight loss nor visceral fat reduction was tested or observed. Similarly, in U.S. patent application US 2019 / 0358183 Al compositions comprising odd chain fatty acids for metabolic syndrome treatment and prophylaxis were provided, including compositions and methods for treating diabetes, obesity, hyperferritinemia, elevated insulin, glucose intolerance, dyslipidemia, and related conditions. Although interesting, significant reductions in weight and / or visceral fat were neither observed nor considered. Efforts in influencing metabolism have also not yet been contemplated in either in vivo or in vitro contexts.

[0008] Likewise, in WO 2023 / 220567, it is contemplated that DDDA may be used to reduce, reverse, and / or prevent liver inflammation, hepatic steatosis, and / or liver fibrosis in NASH (non-alcoholic steatohepatitis), improve blood glucose control, and provide additional cytoprotective benefits. Despite data for the contemplated benefits was provided, there was no weight loss or reduction in visceral fat observed in the subjects.

[0009] Thus, even though various methods of improving metabolism are known in the art, all or almost all of them suffer from several drawbacks, particularly in significantly reducing weight and visceral fat. Therefore, there remains a need for improved methods and uses to promote weight loss and reduce visceral fat.Summary of The Invention

[0010] The inventive subject matter is directed to methods and uses for improving the metabolism of a subject through administering a therapeutically effective unit dose of mediumchain dodecanedioic acid (DDDA or DC 12) for an extended period of time.

[0011] In one aspect of the inventive subject matter, the inventor contemplates a method of improving metabolism in a subject that involves administering to the subject, a therapeutically effective unit dose of medium-chain dodecanedioic acid (DDDA or DC 12) for an extended period of time, wherein the therapeutically effective unit dose comprises between no more than 5% of a standard daily caloric intake of a mammal, wherein the extended period of time is for at least 6 weeks, and improving metabolism in a subject is associated with weight loss and / or reduction of visceral fat.

[0012] Viewed from another perspective, the inventor contemplates medium-chain dodecanedioic acid (DDDA or DC 12) for use in treatment of obesity in a subject, wherein treatment of obesity is associated with weight loss and / or reduction of visceral fat, and wherein DDDA is administered to the subject in a therapeutically effective unit dose for an extended period of time.

[0013] In both perspectives, it is generally contemplated that improving metabolism in a subject is associated with at least 20% weight loss as compared to the subject not having been administered the therapeutically effective unit dose of medium-chain DDDA. Most typically, the subject is a human.

[0014] In both perspectives, it is also generally contemplated that the therapeutically effective dose provides equal or less than 3% of a standard daily caloric intake of a mammal. In some embodiments, the therapeutically effective dose provides equal or less than 1% of a standard daily caloric intake of a mammal. Consequently, the therapeutically effective dose most typically comprises equal or less than 5 g of the medium-chain DDDA. In various embodiments, the therapeutically effective does comprises equal or less than 3 g of the medium-chain DDDA.

[0015] In both perspectives, the medium-chain DDDA is formulated for oral administration and to provide between 0.05g and 5.0g as a daily dosage. Most typically, administration is foran extended period of time ranging for a length of between 8 and 12 weeks or between 14 and 20 weeks.

[0016] Various objects, features, aspects, and advantages of the inventive subject matter will become more apparent from the following detailed description of preferred embodiments, along with the accompanying drawing figures in which like numerals represent like components.Brief Description of The Drawing

[0017] FIG.l are graphs and exemplary schematic illustrations of (A) Design of the prevention study. (B) Body weight time course. (C,D) Liver and visceral adipose tissue (VAT) weight. (E,F) Time courses of blood glucose and plasma insulin concentrations during an oral glucose tolerance test. (G) HOMA-IR index. (H-M) Representative Hematoxylin and Eosin (H&E) (H,I), Oil Red O (ORO) (J,K), and Piero Sirius Red (L,M) staining of liver sections from rats fed high-fat diet (HFD) with or without Dodecanedioic acid (DC 12) supplementation. Data are reported as mean value ±SEM of n=10 animals per group. Statistical significances were calculated by unpaired two-tailed t-test and one-way Anova with Bonferroni’s correction for multiple comparisons, where appropriate.

[0018] FIG.2 is an exemplary schematic illustration of (A) Design of the MASH reversion study. (B) Body weight time course. (C,D) Liver and visceral adipose tissue (VAT) weight. (E,F) Time courses of blood glucose and plasma insulin concentrations during an oral glucose tolerance test. (G) HOMA-IR index. Data are reported as mean ±SEM of n=10 animals per group. Statistical significances were calculated by unpaired two-tailed t-test and one-way Anova with Bonferroni’s correction for multiple comparisons, where appropriate.

[0019] FIG.3 are graphs and exemplary schematic illustrations of (A-F) Representative H&E (A,B), Oil Red O (ORO) (C,D), and Piero Sirius Red (E,F) staining of liver sections from rats fed HFD with or without DC12 supplementation. (G) Gene expression of hepatic fibrosis markers, namely alpha smooth muscle Actin (ASMA), Collagen Type I Alpha 1 Chain (COLA1A) and transforming growth factor-beta (TGFP). (H) Gene expression of hepatic key rate limiting enzymes of de novo lipogenesis, namely ATP-citrate lyase (ACLY), acetyl-CoA carboxylase (ACC), fatty acid synthase (FAS) and Diacylgycerol acyltransferase (DGAT). (I, J) Gene and protein expression of Carnitine Palmitoyltransferase 1A (CPT1A), the ratelimiting enzyme of fatty acid P-oxidation. Data are reported as mean ±SEM of n=10 animals per groups. Statistical significances were calculated by unpaired two-tailed t-test.

[0020] FIG.4 is a volcano plot showing the most significant lipid species found by univariate analysis. Grey values indicate those lipid species that are not significantly changed (p>0.05). Negative values (in violet) indicate downregulated lipid species, while positive (in orange) values reflect upregulated lipids in rats fed HFD and DC 12 (p<0.05).

[0021] FIG.5 are graphs of (A,B) Hepatic gene and protein expression of mlNDY in rats fed HFD with or without DC 12 supplementation. (C) Plasma citrate concentration in rats fed HFD with or without DC 12 supplementation. (D,E) Gene and protein expression of mlNDY in rat primary hepatocytes treated with palmitic acid (400 pM) in the presence or absence of DC 12 (100 pM). (F) In vitro citrate uptake using increasing concentrations of DC12 (50-1000 pM); citrate uptake fit in the presence of increasing concentrations of DC12 with 90% confidence band (shaded area). The following are the estimates of the parameters of the model: Kmin=19.85±0.70% (CI: 18.48-21.22%); IC50= 95.76±10.13 pM (CI:75.90-115.61%); gamma= 1.75 ± 0.21# (CI: 1.33-2.17). Data are reported as mean value ±SE of n=10 animals per group. Statistical significances were calculated by unpaired two-tailed t-test and Kruskal- Wallis test where appropriate. In vitro data are reported as mean value of ±SE of five independent experiments (D,E) and mean value ±SE and 95% CI of three independent experiments (F).

[0022] FIG.6 is a graph of gene expression of key limiting enzymes involved in hepatic gluconeogenesis and glycolysis, namely Phosphoenolpyruvate carboxykinase (PEPCK), Glucose 6-phosphatase (G6Pase), Glucokinase (GCK), Pyruvate kinase (PK). Data are reported as mean ±SEM of n=10 animals per group. Statistical significances were calculated by unpaired two-tailed t-test.

[0023] FIG.7 is a Hierarchical clustering heatmap analysis of triacylglycerols (A), lysophosphatidylcholines (B), phosphatidylcholines (C), sphingomyelins (D) and ceramides (E) in rats fed HFD with or without DC 12 supplementation.

[0024] FIG.8 is northern blot results for gene expression of CPT-1, P-Actin, and mlNDY.

[0025] FIG.9 is a graph of body weight in human subjects at baseline and after DC12 supplementation.

[0026] FIG.10 is a graph of HOMA-IR in human subjects before and during DC12 supplementation.

[0027] FIG.11 is an exemplary graph depicting anticipated lower post-load glucose excursion.

[0028] FIG.12 is an exemplary graph depicting an anticipated reduction in insulin peak and faster return to baseline.Detailed Description

[0029] The inventors have discovered various methods and uses for improving the metabolism of a subject through administering a therapeutically effective unit dose of the medium-chain fatty acid dodecanedioic acid (DDDA or DC 12) for an extended period of time. Moreover, it was unexpectedly discovered that DDDA had significant effects at a low concentration or dosage, over an extended period of time, on promoting weight loss and / or reducing visceral fat in a subject.

[0030] Dodecanedioic acid (DDDA or DC 12) is a medium-chain aliphatic, a, co-dicarboxylic acid that is present in nature as a component of cutin and suberin. Cutin is a waxy polymer composed primarily of hydroxy and hydroxyepoxy fatty acids and functions as a critical component of the plant cuticle, providing a barrier that minimizes water loss and protects against pathogens. Suberin is present in the inner cell wand next to the plasma membrane at the level of root endodermal and exodermal cell layers.

[0031] Throughout the present disclosure, the terms “dodecanoic dicarboxylic acid”, “DDA”, “DDDA”, “C12”, and “DODA” are being used interchangeably, and refer to the dicarboxylic acid with the formula (CH2)IO(COOH)2, CAS number 693-23-2.

[0032] Unexpectedly, and in at least some embodiments, it has been discovered that administration of DDDA (and other dicarboxylic acids) may be an excellent way to not only treat but also reverse obesity or an above normal weight condition (as identified by a BMI chart) and related symptoms or side-effects. Notably, and as is shown in more detail below, reduction of body weight and visceral fat was achieved even without a dietary change. Among other observations, the inventors discovered that such reduction in fat could be attributed to reducing de novo lipogenesis, increasing fatty acid oxidation, reversing glucose intolerance, improving liver function, encouraging weight loss, and / or reducing visceral fat.

[0033] It is generally contemplated that administration of DDDA improves metabolism, treats, or reverses obesity or reduces body weight in an overweight subject and is also associated with a significant reduction in visceral fat weight as compared to a subject not having been administered therapeutically effective quantities of DDDA. For example, the reduction of weight may be at least 2%, or at least 3%, or at least 4%, or at least 5%, or at least 7.5%, or at least 10%, or at least 15% of a person’s body weight, and in obese subjects even at least 20%, or at least 25%, or at least 30%, or at least 35% of a person’s body weight. Likewise, a subject may have a reduction in visceral fat of at least 2%, or at least 4%, or at least 6%, or at least 8%, or at least 10%, or at least 15%, or at least 20%, and in obese subjects even of at least 30%, or at least 40%, or at least 50%. Such reductions in body weight and visceral fat will typically be observed after continuous daily administration of effective dosages of DDDA over at least 6 weeks, or more typically at least 8 weeks, or at least 10 weeks, or at least 12 weeks, or at least 14 weeks, or at least 20 weeks.

[0034] With regard to the DDDA included in exemplary compositions, it is generally preferred that the DDDA is present as zein nanoparticles (nanocaps) having an average particle size of less than 80 nm. For example, the zein nanocaps may have an average particle size of 120 nm (+ / - 10 nm), 110 nm (+ / - 10 nm), 100 nm (+ / - 10 nm), 90 nm (+ / - 10 nm), 80 nm (+ / - 10 nm), 70 nm (+ / - 10 nm), 60 nm (+ / - 10 nm), 50 nm (+ / - 10 nm), or even smaller.

[0035] An overweight subject with excessive body weight refers to a person who has a Body Mass Index (BMI) of between 25 - 29.9. An obese subject refers to a person who has a BMI of 30 and above. Total body fat may also be measured by various techniques including Bioelectrical Impedance Analysis (BIA), Electrical Impedance Myography (EIM), hydrostatic weighing, or skinfold calipers. Additionally, or alternatively, visceral body fat may be determined by CT, MRI scan, or use of DEXA (Dual-energy X-ray absorptiometry).

[0036] Preferably, the DDDA is formulated for oral administration. For example, in one representative embodiment, a nutritional supplement is formulated as a ready-to-use drink or bulk powder that contains about 3 g of dodecane dicarboxylic acid (DDDA or DC 12) in a single dosage unit. The drink is preferably formulated as a flavored aqueous non-alcoholic solution, while the ready-to-use powder may be formulated with an edible and preferably non-caloric or low-caloric carrier (e.g., soluble prebiotic fiber) that can be admixed with a fluid or other food item. In another example, a pharmaceutical formulation for oral administration is formulated as solid tablet(s) to provide as a daily dosage between 0.05g and 5g of dodecanoic dicarboxylicacid. Preferably, but not necessarily, administration is together with a meal, but may also be used while fasting. The benefits of DDDA are contemplated to be seen even when eaten with a high-fat diet.

[0037] In another representative embodiment, a nutritional supplement is formulated as a ready -to-use drink that contains about 2 g of dodecane dicarboxylic acid (DDDA or DC 12) in a single dosage unit. The drink is preferably formulated as a flavored, clear aqueous nonalcoholic solution with a pH of 2.6. Moreover, an exemplary drink may preferably be formulated with 100 mg caffeine, 1.5 mg taurine, and 1.5 mg leucine. The dodecane dicarboxylic acid (DDDA or DC 12) is preferably present as zein nanocaps.

[0038] With respect to suitable carriers, it should be noted that all carriers are suitable so long as they are nutritionally, and / or pharmaceutically acceptable. Therefore, especially preferred carriers will include materials suitable for human and animal consumption that may be solid or liquid. For example, solid carriers will typically include all excipients commonly used in the nutritional and pharmaceutical arts such as fillers, binders, disintegrants, etc. where the composition is formulated as a powder, tablet, capsule, or other orally administrable form. On the other hand, where the composition is formulated as a snack or food item, especially preferred formulations will include snack bars, cookies, gummies, etc. Additionally, solid carriers will also include all baked goods where the medium-chain dicarboxylic acids are used to fortify the baked goods to so blunt a blood glucose and / or insulin spike that would otherwise postprandially be observed. In further examples, liquid carriers will include aqueous formulations and soft drinks that may or may not be carbonated, syrups, fruit juices, and flavored beverages, all of which may be packed into small ready -to-use / single-use containers or containers that store multiple dosage units.

[0039] With regard to suitable aqueous formulations that may be carbonated, it is especially preferred that the amount of dissolved CO2 contained in the ready-to-use carbonated can is between 2.4-2.8 volumes CO2. Viewed from another perspective, it is especially preferred that there are 2.4-2.8 liters of CO2 gas dissolved in the ready-to-use carbonated can.

[0040] Regardless of the particular formulation, it should be appreciated that contemplated compositions and products will include at least one therapeutically effective unit dose of the medium-chain dicarboxylic acid, which will typically (but not necessarily) provide no more than 5% of the standard daily caloric intake of a mammal. For example, contemplatedtherapeutically effective unit doses may also provide equal or less than 10%, or equal or less than 9%, or equal or less than 8%, or equal or less than 7%, or equal or less than 6%, or equal or less than 5%, or equal or less than 4%, or equal or less than 3%, or equal or less than 2%, or equal or less than 1% of a standard daily caloric intake of a mammal. Most typically, the daily caloric intake for human is about 2,000 calories / day for adult women and about 2,500 calories / day for adult men. Where contemplated compositions are used for pet food, a typical caloric intake for cats is about 200 calories / day for a 10 lb cat, and between 200-1,000 calories for a dog having a body weight of 10-70 lbs. Indeed, DDDA is most typically administered to humans, but may also be administered to other mammals as well.

[0041] Viewed from a different perspective, contemplated therapeutically effective unit doses will typically be equal or less than 6 g, or equal or less than 5 g, or equal or less than 4 g, or equal or less than 3 g, or equal or less than 2 g, or equal or less than 1 g, or equal or less than 0.5 g, or equal or less than 0.3 g of the DDDA.

[0042] As will be readily appreciated, contemplated compositions may also include one or more additional functional ingredients that assist in weight loss and / or reducing visceral fat. For example, metformin. Likewise, additional agents may also assist in control of normal blood glucose levels, and exemplary ingredients will include powdered forms and extracts from cinnamon, ginseng, various probiotics, Aloe vera, Gymnema sylvestre, as well as alpha lipoic acid, and berberine, and trivalent chromium complexed with one or more ligands. Still further contemplated additional agents include those that promote and / or maintain a ketogenic state, and especially preferred agents include beta-hydroxybutyric acid, butyric acid, tributyrin, acetoacetate, etc.

[0043] Moreover, contemplated compositions may also include one or more functional ingredients that assist in muscle performance and / or muscle endurance. Especially preferred agents include taurine, carnitine, glutamine, beta-alanine, protein, BCAAs, sodium bicarbonate, calcium, etc. Likewise, additional agents may also assist in the support of muscle protein synthesis and / or muscle recovery. Exemplary agents include leucine, isoleucine, valine, glutamine, arginine, etc. Although either stereoisomer of the amino acids may be used, especially preferred embodiments use the L-amino acid.

[0044] Total taurine (or other preferred agent) may be present in a single dosage unit in an amount of between 0.5 g and 0.7 g, or between 0.7 g and 1 g, or between 1 g and 1.3 g, or between 1.3 g and 1.5 g, and in some cases even higher.

[0045] Moreover, contemplated compositions may also include one or more functional ingredients that assist in hydration. Exemplary agents include sodium, potassium, magnesium, chloride, coconut water powder, Himalayan sea salt, etc.

[0046] In another representative embodiment, a nutritional supplement is formulated as a ready -to-use drink that contains about 2 g of dodecane dicarboxylic acid (DDDA or DC 12) in a single dosage unit. The drink is preferably formulated with 60 gAloe vera, 55 mg magnesium, 70 mg sodium, 120 mg potassium, 1.5 g L-leucine, and 1.5 g taurine.

[0047] As will be readily appreciated, contemplated compositions may also include one or more functional ingredients that assist in performance enhancement. For example, caffeine, ginseng, guarana, etc. Still further contemplated additional agents include those that provide palatability and / or have reduced calorie content. Especially preferred agents include sucralose and / or acesulfame-K. Further exemplary agents include high-purity stevia, aspartame, sucrose, glucose, high-fructose com syrup, monk fruit, etc.

[0048] Total caffeine (or other preferred agent) may be present in a single dosage unit in an amount of between 10 mg and 50 mg, or between 50 mg and 100 mg, or between 100 mg and 150 mg, or between 150 mg and 200 mg, and in some cases even higher.

[0049] Total sucralose (or other preferred sweetener) may be present in a single dosage unit in an amount of between 0.1 g and 0.15 g, or between 0.15 g and 0.20 g, or between 0.20 g and 0.40 g, and in some cases even higher.

[0050] In another representative embodiment, a nutritional supplement is formulated as a ready -to-use drink that contains about 2 g of dodecane dicarboxylic acid (DDDA or DC 12) in a single dosage unit. The drink is preferably formulated with 60 g Aloe vera, 0.35 g sucralose, 1.5 g L-leucine, and 1.5 g taurine.

[0051] Moreover, contemplated compositions may also include vitamin components. Especially preferred vitamins include vitamin C, vitamin Bl, vitamin B2, vitamin B3, vitamin B5, vitamin B6, vitamin B7, and vitamin B 12. Further exemplary vitamins include vitamin E.

[0052] Viewed from a different perspective, it is preferred that a dosage unit of the composition will equal the RDA (recommended daily allowance) or DV (daily value) for most of the vitamins. The following representative embodiment provides 100% DV for each of the vitamin components.

[0053] In another representative embodiment, a nutritional supplement is formulated as a ready -to-use drink that contains about 2 g of dodecane dicarboxylic acid (DDDA or DC 12) in a single dosage unit. The drink is preferably formulated as a flavored, clear aqueous nonalcoholic solution with a pH of 2.6. Moreover, an exemplary drink may preferably be formulated with 100 mg caffeine, 1.5 g taurine, 2 g leucine, 90 mg vitamin C, 1.2 mg vitamin Bl, 1.3 mg vitamin B2, 16 mg vitamin B3, 5 mg vitamin B5, 1.7 mg vitamin B6, 30 pg vitamin B7, and 2.4 pg vitamin B 12.

[0054] In another representative embodiment, a nutritional supplement is formulated as a ready -to-use drink that contains about 2 g of dodecane dicarboxylic acid (DDDA or DC 12) in a single dosage unit. The drink is preferably formulated with 200 mg caffeine, 1.5 g taurine, 1.5 g leucine, 90 mg vitamin C, 1.2 mg vitamin Bl, 1.3 mg vitamin B2, 16 mg vitamin B3, 5 mg vitamin B5, 2.5 mg vitamin B6, 30 pg vitamin B7, and 4 pg vitamin B12, 55 mg magnesium, 70 mg sodium, and 170 mg potassium.

[0055] It should be recognized that contemplated compositions may include vitamin components that include 5%, 10%, 20%, 30%, 40%, 50%, or even higher of the DV.

[0056] Viewed from a different perspective, the therapeutically effective unit dose will generally be a dose that is effective to produce a physiologically desirable effect associated with the prevention and / or reduction of weight gain and / or visceral fat build up. Administration of therapeutically effective unit doses may occur over a period of at least 3 days, at least 1 week, or at least 2 weeks, or at least 4 weeks, or at least 6 weeks, or at least 8 weeks, or at least 10 weeks, or at least 12 weeks. Administration for an extended period of time may also range between 8 and 12 weeks, or between 14 and 20 weeks, or longer.

[0057] As will be readily appreciated, various medium-chain dicarboxylic acids other that DDDA can also be used in contemplated compositions and especially preferred alternate or additional dicarboxylic acids include sebacic acid, and generally dicarboxylic acids having the general formula of (CIB CChH)? in which n is preferably an integer between 6 and 12. Therefore, it should be appreciated that the combinations of various medium-chaindicarboxylic acids having different molecular weights are also deemed appropriate. Still further, it should be appreciated that various modifications to the medium-chain di carboxylic acids are also deemed suitable, and exemplary modifications include addition of a functional group (e.g., hydroxyl group, halogen, amino group, thiol group, etc.) or replacement of a hydrogen in the medium-chain dicarboxylic acids with a functional group. Likewise, contemplated medium-chain dicarboxylic acids may be modified to form mono- or diesters with various groups to modulate absorption, serum half-life, etc. Additionally, it should also be recognized that the medium-chain dicarboxylic acids contemplated herein include all metabolites of the medium-chain dicarboxylic acids and mixtures thereof.EXAMPLES

[0058] The inventors extensively studied DC12 use in both animals and humans, primarily for its potential metabolic and therapeutic benefits.

[0059] DC 12 supplementation (100 mg / kg / day) was added to a high-fat diet (HFD) for 8 weeks in rodents to assess its impact on obesity, metabolic dysfunction-associate steatohepatitis (MASH), and non-alcoholic steatohepatitis (NASH) prevention. Rats given DC12 experienced significant reduction of weight gain (32% less than HFD-only rats), reduced liver and visceral fat weight, and improved glucose tolerance and insulin sensitivity. Liver histology showed protection against diet induced MASH, with reduced steatosis, hepatocyte ballooning and fibrosis.

[0060] As will be readily appreciated, a rat drinks 6 ml of water per 100 g of body weight per day. See, Body weight and water consumption in rats (March 2013 Physiological Psychology l(l):21-23 DOL10.3758 / BF03326861). 1000 mg of DC12 in 100 ml of water (1% DC12) equates to 10 mg in 1 ml of water. For a rat weighing 200 g (as in the inventors’ experiments) 12 ml of water drinking per day corresponds to 120 mg of DC12. Moreover, 7.2*0.120 g= 0.864 kcal energy consumption of a rat, which has a maximum energy consumption of 100 kcal / day. Thus, 0.864% of energy from DC12 translating to a human with an energy intake of 2000 kcal / day is 0.862 *2000 / 100 = 17,28 kcal from DC12 or 2,4 g DC12 per day.

[0061] The rats used in the present experiment drank 10 ml of water per day on average and thus 100 mg of DC12 or 7.2 kcal *0.100 g = 14.4 kcal / day which corresponds to 2 g of DC 12. Using an online converter (rat to human dose https: / / acmeresearchlabs.in / animal-to-human-dose-calculator / ), for the reversion of NASH in rats with obesity (400 g), 100 mg / kg per day corresponds to 3.2 g in a man weighing 70 kg.

[0062] For weight-loss and MASH reversion, rats were fed HFD for 14 weeks, followed by 6 weeks with or without DC12. DC12 supplementation (100 mg / kg / day) led to 46% weight loss and significantly lower liver and visceral fat weight. It also improved glucose tolerance, insulin sensitivity, and reduced hepatic gluconeogenic gene expression. Liver histology revealed a significant reduction in steatosis, hepatocyte ballooning and inflammation as well as fibrosis, indicating MASH reversal.

[0063] DC 12 reduced hepatic lipogenesis enzymes as well as de novo lipogenesis measured by deuterated water and increase fatty acid P-oxidation. Plasma lipid profile showed lower triglycerides and phosphatidylcholines in the DC 12 group. Notably, DC 12 decreased mlNDY expression, the cell membrane Na+-coupled citrate transporter, reducing citrate uptake and de- novo lipogenesis, linking its effects to improved lipid metabolism and reduced steatosis.

[0064] The inventors contemplated that DC 12 could improve liver function counteracting the effects of a high-fat diet (HFD) that causes metabolic dysfunction-associated steatohepatitis (MASH) in rodents by inhibiting the citrate / Na+symporter, highly active in hepatocytes. This transporter facilitates the cotransport of various di- and tri-carboxylic acids.

[0065] In order to study the effect of DC 12 in the prevention of MASH as well as in the improvement of established MASH, the inventors administered lOOmg / kg / day of DC12 as a sodium salt in drinking water along with a HFD diet for 8 weeks or lOOmg / kg / day of DC12 sodium salt in drinking water after 14 weeks of a HFD diet that continued in association with DC 12 for further 6 weeks.DC12 Supplementation Prevents MASH and Obesity Development

[0066] To assess the effects of DC 12 dietary intake on MASH prevention, 20 male Wistar rats were fed a HFD for 8 weeks with or without DC12 supplementation (100 mg / kg / day) in the drinking water, as shown in FIG.1A.

[0067] The inventors found that after two weeks of dietary intervention, rats fed HFD and DC 12 showed a decrease in body weight gain when compared to HFD-fed rats withpreservation of lean body mass. By the end of the study, rats that received HFD and DC12 supplementation weighed on average 32% less than HFD-fed rats, as shown in FIG.1B.

[0068] In addition, the DC 12 group showed a significant reduction in the weight of both liver and visceral adipose tissue, as shown in FIGS. 1C and ID.

[0069] Rats fed HFD in association with DC 12 showed significantly lower glycemic and insulinemic excursions in response to an oral glucose load as compared with HFD alone, as shown in FIGS. IE and IF. Moreover, the values of the homeostatic model assessment for insulin resistance (HOMA-IR) were significantly lower in DC 12 rats as compared with the HFD group, as shown in FIG.1G, suggesting a higher hepatic insulin sensitivity.

[0070] Histological analysis of the liver for MASH hallmarks revealed that rats fed a HFD plus DC 12 were protected from developing diet-induced MASH. Indeed, the DC 12 rats displayed absence of significant steatosis with a reduction in neutral lipid content, no hepatocyte ballooning or liver inflammation as well of liver fibrosis as compared with HFD-fed rats, as shown in FIGS. 1H-M.DC12 Supplementation Promotes Weight Loss and Reverses MASH

[0071] To assess the effects of DC 12 dietary intake on weight-loss and MASH reversion, 20 male Wistar rats were fed a HFD for 14 weeks followed by 6 weeks of HFD with or without DC12 supplementation (100 mg / kg / day), as shown in FIG.2A.

[0072] Consistently with the previous results, rats fed HFD and DC 12 showed a decrease in body weight starting from the second week of DC 12 administration. By the end of the study (20 weeks), rats receiving HFD and DC 12 supplementation weighed 46% less than HFD-fed rats, as shown in FIG.2B. Furthermore, the weight of both liver and visceral adipose tissue was significantly lower in the DC12 group, as shown in FIGS. 2C and 2D. Rats fed HFD and DC12 showed significantly lower glycemic and insulinemic levels in response to an oral glucose load as compared with HFD-fed rats, as shown in FIGS. 2E and 2F. Moreover, HOMA-IR values, were significantly lower in DC 12 rats than in HFD mates, as shown in FIG.2G, suggesting improvement of hepatic insulin resistance. Next, we assessed the hepatic expression of genes coding for key rate-limiting enzymes of gluconeogenesis and glycolysis. Rats fed a HFD plus DC 12 showed a lower expression of gluconeogenic genes and an increase in genes involved inglycolysis, in line with the decreased glucose excursion observed during the glucose load, as shown in FIG.6.

[0073] Histological analysis of the liver for MASH hallmarks revealed that DC 12 largely improved diet-induced MASH. Indeed, the DC12 rats displayed a significant reduction of liver steatosis and neutral lipid content as well as hepatocyte ballooning and inflammation when compared with HFD alone, FIGS 3A-D. Although fibrosis did not completely reverse, we observed a substantial reduction, as shown in FIGS 3E and 3F. Indeed, the expression of hepatic fibrosis markers was significantly reduced in DC 12 rats as compared with HFD-fed rats, as shown in FIG 3G.

[0074] In line with the reduction of hepatic steatosis showed by histological analysis, the inventors observed a decrease in the four key rate-limiting enzymes of DNL, namely ATP- citrate lyase (ACLY), acetyl-CoA carboxylase 1 (ACC1), fatty acid synthase (FASN) and Diacylglycerol acyltransferase (DGAT), and an increase in fatty acids P-oxidation (Carnitine palmitoyltransferase 1 (CPT1)) in rats with MASH fed DC 12, as shown in FIGS 3H-J. Moreover, hepatic DNL flux, measured by2H incorporation into fatty acids following deuterated water (2H2O) administration, was decreased with DC12 (1.12 0.75 vs. 5.39 0.17 %; P=0.009).Plasma Lipidomics

[0075] As will be readily appreciated, plasma triglycerides, lysophosphatidylcholines and other phosphatidylcholines were significantly lower in rats fed a HFD and DC 12 than HFD alone, as shown in FIG 4 and FIG 7. This excess fatty acid likely stimulates the synthesis and release of sphingolipids.

[0076] Indeed, the inventors observed an increase in plasma sphingolipids (including sphingomyelins and ceramides), suggesting liver detoxification of saturated fatty acids, rather than de novo lipogenesis, which was reduced.

[0077] The inventors also found a similar pattern in the plasma lipidomic of rodents with MASH that received DC 12, which showed a substantial reversal of liver fibrosis, as shown in FIG 4 and FIG 7A-EDC12 Reduces Citrate Uptake Through mlNDY Inhibition

[0078] To determine if the reduction in DNL was related to a decrease in citrate uptake the inventors measured mlNDY expression both in vivo and in vitro. Rats with MASH fed a HFD plus DC 12 displayed a significant reduction of mlNDY expression both at gene and protein levels, as shown in FIGS 5A and 5B. In line with the decreased expression of mlNDY, we also observed an increase in plasma citrate levels in these rats, suggesting a reduction of cytosolic citrate uptake, as shown in FIG 5C.

[0079] As shown in FIGS 5D and 5E, the inventors next assessed the expression of mlNDY in rat primary hepatocyte cultures treated with palmitic acid (400 pM) in the presence or absence of DC12 (100 pM). In vitro stimulation with DC12 decreased gene and protein expression of mlNDY.

[0080] To confirm that DC12 could be a potential inhibitor of mlNDY the inventors measured citrate uptake in rat primary hepatocytes using increasing concentrations of DC12 (50-1000 pM). As shown in FIG 5F, DC 12 inhibited citrate transport in a dose-dependent manner, with an estimated half maximal inhibitory concentration (IC50) value of 96 pM, meaning that DC 12 displaces citrate from its transporter with a 1 : 1 molar concentration.

[0081] The inventors demonstrated that DC 12 not only prevents the development of diet- induced MASH but also promotes regression of MASH when it is already established. It was demonstrated that DC 12 prevents the development of MASH and reverses liver steatosis, hepatocyte ballooning, and hepatic inflammation, effectively reversing MASH. Additionally, it significantly ameliorates live fibrosis.

[0082] It is of outmost clinical importance to prevent or at least improve MASH and liver fibrosis.

[0083] The inventors discovered that in vivo and in vitro administration of DC12 significantly reduce mlNDY gene and protein expression and inhibited hepatic citrate uptake.

[0084] The inventors also unexpectedly discovered that daily administration of DC12 reduces de novo lipogenesis and increases fatty acid oxidation, while reversing glucose intolerance and MASH, without increasing circulating triglycerides.

[0085] Moreover, in the inventors’ animal model, daily administration of DC12 decreased hepatic DNL (de novo lipogenesis) flux, plasma triglycerides and phosphatidylcholine levels. Increased levels of some sphinogomyelins were also discovered.

[0086] Lastly, it was also discovered the DC12 ameliorates insulin resistance and drastically improves glycemic response to an oral glucose challenge.

[0087] In conclusion, the experiments indicated that DC12 administration protected against MASH and even reversed diet-induced MASH by inhibiting mlNDY and DNL, underlying a possible role of DC 12 as a therapeutic option for the prevention and treatment of MASH.Study Design

[0088] Forty adult Wistar rats, aged 8 10 weeks, were included in the study. The rats were housed in individual cages at 22°C with 12-h light cycles and had ad libitum access to food and water. Following one week of acclimation, rats were randomly divided into two groups.

[0089] Prevention Study (FIG 1A): Twenty Rats were fed a high fat diet (20% Carbohydrate, 20% Protein, 60% Fat) (Mucedola, Milan, IT) for 8 weeks in the presence (n=10 rats) or absence (n=10 rats) of Dodecanedioic acid, high purity sodium salt (Metabolyte®) (100 mg / kg / day) dissolved in water.

[0090] Dodecanedioic acid, high purity sodium salt was kindly provided by Jemyll Ltd.

[0091] Reversion Study (FIG 2A): Twenty rats were fed a high fat diet (20% Carbohydrate, 20% Protein, 60% Fat) for 14 weeks followed by 6 weeks of high fat diet in the presence (n=10 rats) or absence (n=10 rats) of Dodecanedioic acid, sodium salt (100 mg / kg / day) dissolved in water. Body weight and food intake were monitored weekly. All animal procedures were approved by the Catholic University of Rome Institutional Animal Care Committee.Oral Glucose Tolerance Test (OGTT)

[0092] All animals underwent an OGTT at the end of the study. After an overnight fasting, all rats received a 50% D-glucose solution (Ig / kg body weight) by oral gavage. Blood samples were taken by tail bleeding and collected in EDTA tubes. All blood samples were immediately centrifuged, and plasma divided into appropriate subsamples and stored at -20°C for further analysis. Blood glucose was measured at 0, 20, 40, 60, 80, 100 and 120 minutes, while plasmainsulin was measured at 0, 60 and 120 minutes. Blood glucose levels were measured by a glucometer (Accu-Chek, Roche Diagnostics Division, Grenzacherstrasse, CH). Plasma insulin was measured by ELISA (EMD Millipore Corporation, Billerica, MA), with a sensitivity of 0.1 ng / ml and an intra- and inter-assay precision of 1.9% and 7.6%, respectively. Plasma citrate was assessed by Citrate Assay Kit (Abeam, Cambridge, UK), with a sensitivity > 0.002 mM.Histology

[0093] The day of the sacrifice fresh portions of liver were embedded in cryo-embedding media (OCT) and snap frozen in liquid nitrogen. Biopsies were cut using a cryostat (5 pm) and slides stored a -20°C until analyses. Hematoxylin and Eosin staining was performed to assess hepatic steatosis. Slides were fixed in 95% ethanol, stained with hematoxylin, washed with distilled water, stained with eosin and cleared in two changes of pure ethanol and two changes of xylene. Oil Red O was performed to assess intracellular lipid accumulation. Slides were fixed overnight with 4% formalin, stained with Oil Red O solution and counterstain was performed with H&H solution. Sirius Red was used to detect hepatic fibrosis. Slides were fixed with 4% formalin, stained in Direct red 80, washed in acidified water and dehydrate in 3 changes of absolute ethanol. After brief clearing in xylene, the slides were mounted in a resinous medium. Images were taken with an optical microscope (Leica DM2000, Wetzlar, DE). All reagents for histological analysis were obtained from Sigma-Aldrich (St. Louis, MO).Quantitative Real-Time PCR Analysis

[0094] Total RNA from rats liver and rat primary hepatocytes was extracted using the RNeasy Plus Mini Kit (QiagenGmbH, Hilden, DE) following manufeaturer’s instruction. A small aliquot of total RNA (3 pl) was subjected to qualitative and quantitative control using microdrop (ThermoFischer Scientific, Waltham, MA) and the assessment of the individual samples was performed using a dedicated software. Total RNA was reverse transcribed into cDNA by using i Script RT (Bio-Rad Laboratories, Hercules, CA). SYBR Green gene expression assays were performed according to the manufacturer’s instruction using the iQ SYBR® Green Supermix (Bio-Rad Laboratories, Hercules, CA) and the CFX96 Touch Real- Time PCR Detection System (Bio-Rad Laboratories, Hercules, CA). The following pairs of primer were used: Phosphoenol pyruvate carboxykinase (Pck) (forward 5’ATGACAACTGCTGGTTGGCT 3’ and reverse 5’ CCACCACGT AGGGTGAA TCC 3’), Glucose 6-phosphatase (G6Pc) (forward 5’ ACAGGTCCAGGAAGTCCATCT 3’ and reverse5’ GCATGCCACCAATTACTCCAAG 3’), Glucokinase (Gck) (forward 5’ AGTTGTTGACTCTGGGCACC 3’ and reverse 5’ TTCATGTGCCCGTTGTGAGT 3’), Pyruvate kinase (Pk) (forward 5’ CTTCCCCTTGCTCTACCGTG 3’ and reverse 5’ ACCACGGAGCTTTCCACTTTC 3’), ATP-citrate lyase (Acly) (forward 5’ ATTGGGGCTTACCTTGTCCG 3’ and reverse 5’ CCACGGTTCGGGTTTCTACA 3’), Acetyl-CoA Carboxylase (Accl) (forward 5’ ATTGGGGCTTACCTTGTCCG 3’ and reverse 5’ CCACGGTTCGGGTTTCTACA 3’), Fatty acid synthase (Fasn) (forward 5’ GAATCCGCACAGGCTACCAA 3’ and reverse 5’ CTGGGCTTCACCATCACCAT 3’), Diglyceride acyltransferase (Dgat) (forward 5’ AGCAGGAGTAGGCCCCATAG 3’ and reverse 5’ ATTGGGGCTTACCTTGTCCG 3’), solute carrier family 13 member 5 (Slcl3A5) (forward 5’ AGAGGCAGTGGTAGTCGTGT 3’ and reverse 5’ TCCCCTTTAGCCCTTGTTCC 3’), carnitine palmitoyltransferase 1A (CptlA) (forward 5’ AGTGCAGAGCAATAGGTCCC 3’; and reverse 5’ AAACATCCAGCCGTGGTAGG 3’). mRNA expression levels were normalized to p2-microglobulin (forward 5’ AGGACTGGTCTTTCTATCTCTTGT 3’; and reverse 5’ ACCTCCATGATGCTGCTTACA 3’) and quantification of relative gene expression, presented as percentage of the relevant baseline, was calculated using the 2-ACT (comparative threshold) method.Western Blot Analysis

[0095] Liver was homogenized in RIPA buffer containing a cocktail of protease inhibitors. Homogenates were cleared by centrifugation (19,000 x g; 30 min, 4 °C). The protein content was determined using Bradford Protein Assay (Bio-Rad Laboratories, Hercules, CA). Protein lysates (30 pg) were separated on 10% SDS-PAGE, transferred on PVDF membrane and blocked with EveryBlot Blocking Buffer (Bio-Rad Laboratories, Hercules, CA) for 5 min. Membranes were probed overnight with CPT1A and SLC13A5. Detection and analysis were performed, respectively, with Chemidoc XRS Image system and Image Lab 5.0 software (BioRad Laboratories, Hercules, CA). All the results were normalized with PActin. CPT1A, SLC13A5 and PActin antibodies were obtained from Santa Cruz Biotecnology (Dallas, TX).Rat Primary Hepatocytes Isolation

[0096] Primary rat hepatocytes were isolated using a 2-step perfusion method. Briefly, rat livers were perfused with PBS, containing 5 mM glucose and 0.5 mM EDTA, followed by PBS, containing 5 mM glucose, 5 mM CaC12 and 0.5 mg / ml collagenase (Merck, Darmstadt,DE,). The liver was then removed and gently agitated Dulbecco’s Modified Eagle Medium (DMEM) (Merck, Darmstadt, DE), and filtered through nylon mesh (100 gm). The cells were washed and resuspended in DMEM. Equal volumes of normal hepatocyte suspension and isotonic Percoll (Merck, Darmstadt, DE) and centrifuged.

[0097] Isolated cells were grown until confluent in Dulbecco’s Modified Eagle Medium (DMEM) (Merck, Darmstadt, DE) medium supplemented with 10% fetal bovine serum (FBS) (Merck, Darmstadt, DE). Primary rat hepatocytes were stimulated with palmitic acid (400 pM) with or without the addition of Dodecanedioic acid, sodium salt (100 pM) for 24 hours. Cells cultured in DMEM were used as control.In Vitro Citrate Uptake

[0098] Primary rat hepatocytes were incubated with or without Dodecanedioic acid, sodium salt (50-1000pM) and citrate (500 pM) for 40 minutes. At the end of the stimulation citrate uptake was evaluated using Citrate Assay Kit (Sigma-Aldrich, St. Louis, MO) following manufacturer’s instruction and data analyzed with Varioskan™ LUX multimode microplate reader (Thermo Fisher scientific, Waltham, MA).

[0099] In order to compute IC50, that is the concentration of the competitive antagonist (DC 12) required to reduce the binding of the agonist (citrate) to the hepatocyte receptor by 50%, the following loglogistic function was used:

[0100] Where Kmax=100% uptake, X is the concentration of the antagonist DC12, Kmin is the minimum attainable percent uptake in the presence of very large antagonist concentrations and y is the slope around the inflection point and represents the steepness of the curve.

[0101] All the observed precent uptakes have been computed with respect to the average of the observed hepatic citrate concentrations at DC 12 equal to zero. The estimates of the model parameters were obtained by means of a generalized nonlinear least squares approach with variance increasing with increasing fitted values.Plasma Lipidomic

[0102] Plasma lipidomic was measured by high resolution mass spectrometry (UHPLC- QTOF; Agilent Technologies) with an untargeted acquisition and targeted analysis. lOpL of plasma was deproteinized with 150pL of cold methanol and lOpL of internal standard and centrifuged at 14000 rpm for 20 minutes.

[0103] Lipids were separated by ZORBAX Eclipse Plus C18 2.1x100mm 1.8 pm column (Agilent, Santa Clara CA). Untargeted acquisition was set in positive electrospray ionization mode. Metabolomics Profinder MassHunter software (Agilent Technologies) was used for peak identification and target data analysis of most significant lipids. Quantitative analysis was performed using internal standards TAG(C45:0), PC(C34:0), LPC (C17:0), SM(dl8: 1 / 17:0), CER (d 18 : 1 / 17:0) (Avanti Polar Lipids, Alabaster, AL and Larodan, Soina, SE).De Novo Lipogenesis

[0104] De novo lipogenesis was assessed by deuterated water (2H2O) techniques. Briefly, the day before the sacrifice rats were administered a i.p. bolus injection of2H2O (35 ml / kg). Rats then continued to receive2H2O (6% vol / vol) in the drinking water. The day of the sacrifice, approximately 1 ml of blood was drawn using a cardiac puncture. Blood was centrifuged at 1,500 x g for 10 minutes to separate plasma and stored at -80 degrees. DNL was assessed measuring the deuterium incorporation into hepatic free palmitic acid (i.e., enrichment); briefly, about 25 mg of liver tissues were homogenized using the Precellys Evolution Homogenizer (Bertin Instruments, Frankfurt, Germany) and lipid species were extracted with a modified Folch method (Folch, Lees et al. 1957), using 900 pl of chlorofornrmethanol (2: 1) and 200 pl of water. Lipid phase was dry under gentle nitrogen flux and derivatized using BSTFA + 1% TMCS (Merck KGaA, Darmstadt, Germania). Enrichment of palmitate was measured by gas chromatography / tandem mass spectrometry (GC 8890 / MS 7000D, Agilent, Santa Clara, CA), monitoring ions with mass-to-charge ratios (m / z) of 313 (M+0) and 314 (M+l) and corrected for baseline enrichment. DNL was calculated using free hepatic palmitate enrichment, divided by 22 (i.e. the number of exchanged hydrogens) and divided by D2O enrichment.Statistical Analysis

[0105] Data are expressed as the mean ±SEM unless otherwise specified. Statistical significance was set at P<0.05 (two-tailed). Statistical significances were calculated by unpaired two-tailed t-test and one-2ay Anova with Bonferroni’s correction for multiple comparisons, where appropriate. Heatmaps were used as a graphical representation of plasma lipidomic. The statistical analyses were carried out by the SPSS version 26 software (SPSS Inc., Chicago, IL, USA).FURTHER EXAMPLES

[0106] Moreover, the inventors extensively studied 15-day supplementation with DC 12 in humans.

[0107] Participants consumed 3 g / day of DC 12 daily for 15 consecutive days. Body weight and fasting metabolic parameters were assessed at baseline and after 15 days.Study Design

[0108] Three adult outpatients (two women, one man) participated in this 15-day pilot study assessing the metabolic effects of daily oral supplementation with 3 g DC 12. Mean age was 48.7 ± 17.4 years. Baseline mean body weight was 75.7 ± 12.5 kg.DC12 Supplementation Promotes Body Weight LossMean body weight decreased from 75.7 ± 12.5 kg at baseline to 74.5 ± 11.9 kg at day 15, as shown in FIG 9 and Table 1 below.Table 1 - Individual body weight over time

[0109] With regard to the physical activity of the participants, all three demonstrated a moderate level of physical activity across both occasions, with slightly higher MET min / week totals on the second measurement, as can be seen in Table 2 below. Sitting time remained constant (8-9 h / day).Table 2 - Physical Activity Summary (METmin / week)DC12 Supplementation Reduces HOMA-IR

[0110] Moreover, as shown in FIG. 10, HOMA-IR declined from 1.40 ± 0.24 to 1.13 ± 0.19, reflecting a consistent improvement in insulin sensitivity across all participants.

[0111] Individual linear regression analysis of HOMA-IR over time demonstrated high goodness of fit (R2range: 0.94-0.98) with uniformly negative slopes (-0.014 to -0.021 per day) as seen in Table 2 below. This indicates a progressive reduction in insulin resistance throughout the intervention.Table 2 - Individual linear regression analysis of HOMA-IR over time

[0112] Although the Wilcoxon signed-rank test comparing baseline and day 15 HOMA-IR was not statistically significant (p = 0.25), as shown in Table 2 below, due to the small samplesize, the consistent downward trend across participants supports a potential metabolic benefit of low-dose DC12 supplementation.Table 3 - Group summary ofHOMA-IR over time

[0113] In conclusion, fifteen days of low-dose DC 12 (3 g / day) was well tolerated in human subjects and associated with measurable improvements in insulin sensitivity and body weight.PREDICTED EXAMPLES

[0114] Based on the data presented herein and additional considerations (not shown), the inventors further expect to demonstrate the efficacy of DC 12 supplementation on endurance and insulin sensitivity at beverage doses in humans.Study Design

[0115] Acute Endurance Trial: Twenty -four healthy, trained individuals will participate in a randomized, double-blind, placebo-controlled crossover. Individuals will receive either a beverage with DC 12 (K / Mg salts) + EAAs + caffeine (3 mg / kg) or an identical control beverage with matched electrolytes, without DC 12 during one single session. This is summarized below in Table 4.Table 4 - Acute Endurance Trial Overview

[0116] Insulin Resistance Trial: 100 individuals with obesity or insulin resistance (BMI > 30 kg / m2, HOMA-IR > 2.5) will participate in a randomized, double-blind, placebo-controlled parallel study that will last for at least two weeks. Individuals will receive 3-6 g / day DC12. This is summarized below in Table 5. The inventors expect that there will be 4 visits: screening, randomization, endline, and follow-up as shown in Table 6 below. Fasting labs and oral glucose tolerance tests (OGTT) will be performed during the screening visit. OGTTs will measure glucose, insulin, and C-peptide levels, as can be seen in Table 7 below.Table 5 - Insulin Resistance Study OverviewTable 6 - Visit Schedule (Insulin-Resistance Study)Table 7 - OGTT Sampling ScheduleDC 12 Beverage Improves Endurance Performance

[0117] The inventors expect that the DC 12 beverage will improve time-trial performance by 2-3%. Moreover, the inventors expect that the DC12 beverage will shift the respiratory exchange ratio (RER) of the participants toward fat oxidation with lower lactate accumulation.DC 12 Supplementation Increases Insulin Sensitivity

[0118] As shown in Figure 11, the inventors expect that daily DC12 supplementation will lower post-load glucose excursion. Moreover, as shown in Figure 12, the inventors expect that daily DC 12 supplementation will reduce insulin peak and have a faster return to baseline. As such, the inventors expect that 3-6 g / day DC 12 supplementation will increase insulin sensitivity by 20% and lower fasting insulin by 15-25%. Moreover, the inventors expect that DC12 supplementation will improves [3-cell responsivity and lipid profiles.

[0119] In conclusion, the inventors expect that DC 12 supplementation will have excellent tolerability, and the DC 12 beverage disclosed herein will be the first beverage clinically shown to improve insulin sensitivity.

[0120] In some embodiments, the numbers expressing quantities of ingredients, properties such as concentration, reaction conditions, and so forth, used to describe and claim certain embodiments of the invention are to be understood as being modified in some instances by the term “about.” As used herein, the terms "about" and "approximately", when referring to a specified, measurable value (such as a parameter, an amount, a temporal duration, and the like), is meant to encompass the specified value and variations of and from the specified value, such as variations of + / -10% or less, alternatively + / -5% or less, alternatively + / -1% or less, alternatively + / -0.1% or less of and from the specified value, insofar as such variations are appropriate to perform in the disclosed embodiments. Thus, the value to which the modifier "about" or "approximately" refers is itself also specifically disclosed. The recitation of ranges of values herein is merely intended to serve as a shorthand method of referring individually to each separate value falling within the range. Unless otherwise indicated herein, each individual value is incorporated into the specification as if it were individually recited herein.

[0121] All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., “such as”) provided with respect to certain embodiments herein is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention otherwise claimed. No language in the specification should be construed as indicating any non-claimed element essential to the practice of the invention.

[0122] As used in the description herein and throughout the claims that follow, the meaning of “a,” “an,” and “the” includes plural reference unless the context clearly dictates otherwise. Also, as used in the description herein, the meaning of “in” includes “in” and “on” unless the context clearly dictates otherwise. As also used herein, and unless the context dictates otherwise, the term "coupled to" is intended to include both direct coupling (in which two elements that are coupled to each other contact each other) and indirect coupling (in which at least one additional element is located between the two elements). Therefore, the terms "coupled to" and "coupled with" are used synonymously.

[0123] It should be apparent to those skilled in the art that many more modifications besides those already described are possible without departing from the inventive concepts herein. The inventive subject matter, therefore, is not to be restricted except in the scope of the appended claims. Moreover, in interpreting both the specification and the claims, all terms should be interpreted in the broadest possible manner consistent with the context. In particular, the terms “comprises” and “comprising” should be interpreted as referring to elements, components, or steps in a non-exclusive manner, indicating that the referenced elements, components, or steps may be present, or utilized, or combined with other elements, components, or steps that are not expressly referenced. Where the specification or claims refer to at least one of something selected from the group consisting of A, B, C .... and N, the text should be interpreted as requiring only one element from the group, not A plus N, or B plus N, etc.

Claims

AMENDED CLAIMS received by the International Bureau on 01 May 2026 (01.05.2026)CLAIMSWhat is claimed is:

1. A method of improving metabolism in a subject, comprising: administering to the subject, a therapeutically effective unit dose of dodecanedioic acid (DDDA) for an extended period of time; wherein the therapeutically effective unit dose comprises no more than 5% of a standard daily caloric intake of the subject; wherein the extended period of time is for at least 6 weeks; and improving metabolism in the subject is associated with weight loss and / or reduction of visceral fat.

2. The method of claim 1, wherein improving metabolism in the subject is associated with at least 10% weight loss over a period of 12 weeks as compared to the subject not having been administered the therapeutically effective unit dose of DDDA.

3. The method of claim 1, wherein improving metabolism in the subject is associated with at least a 10% reduction of visceral fat over a period of 12 weeks as compared to the subject not having been administered the therapeutically effective unit does of DDDA.

4. The method of claim 1, wherein improving metabolism in the subject is associated with a partial reduction or complete reversal of hepatosteatosis, or Non-alcoholic fatty liver disease (NALFD), or Metabolic dysfunction associated steatohepatitis (MASH), or Nonalcoholic steatohepatitis (NASH).

5. The method of claim 1, wherein the weight loss and / or reduction of visceral fat is achieved without dietary intervention.

6. The method of claim 1, wherein improving metabolism in the subject is associated with an increase in beta-oxidation and / or decrease in de-novo lipogenesis.

7. The method of claim 1, wherein improving metabolism in the subject is associated upregulation of SM(d36:l), LPC(18:0), SM (d38:l), SM(d36:2), or CER(dl8: 1 / 18:0) and / or downregulation of TAG(49: 1), PC(32:2), PC(34:3), PC(34:1), LPC(14:0), or TAG (49:2).

8. The method of claim 1, wherein the therapeutically effective dose provides equal or less than 3% of a standard daily caloric intake of a mammal.

9. The method of claim 1, wherein the therapeutically effective dose provides equal or less than 1% of a standard daily caloric intake of a mammal.

10. The method of claim 1 wherein the subject is a human.

11. The method of claim 1, wherein the therapeutically effective dose comprises equal or less than 5 g of the DDDA.

12. The method of claim 1, wherein the therapeutically effective does comprises equal or less than 3 g of the DDDA.

13. The method of claim 1, wherein the DDDA is formulated for oral administration.

14. The method of claim 1, wherein the extended period of time is between 8 and 12 weeks or between 14 and 20 weeks.

15. The method of claim 1, wherein the DDDA is formulated to provide between 0.05g and 5.0g as a daily dosage.

16. Dodecanedioic acid (DDDA or DC12) for use in treatment of obesity or excessive bodyweight in a subject, wherein treatment of obesity is associated with weight loss and / or reduction of visceral fat, and wherein DDDA is administered to the subject in a therapeutically effective unit dose for at least 6 weeks.

17. The DDDA of claim 16, wherein treatment of obesity or excessive bodyweight in a subject is associated with at least 10% weight loss over a period of 12 weeks as compared to the subject not having been administered the therapeutically effective unit dose of mediumchain DDDA.

18. The DDDA of claim 16, wherein improving metabolism in the subject is associated with at least a 10% reduction of visceral fat over a period of 12 weeks as compared to the subject not having been administered the therapeutically effective unit does of DDDA.

19. The DDDA of claim 16, wherein improving metabolism in the subject is associated with a partial reduction or complete reversal of hepatosteatosis, or Non-alcoholic fatty liverdisease (NALFD), or Metabolic dysfunction associated steatohepatitis (MASH), or Nonalcoholic steatohepatitis (NASH).

20. The DDDA of claim 16, wherein the weight loss and / or reduction of visceral fat is achieved without dietary intervention.

21. The DDDA of claim 16, wherein improving metabolism in the subject is associated with an increase in beta-oxidation and / or decrease in de-novo lipogenesis.

22. The DDDA of claim 16, wherein improving metabolism in the subject is associated upregulation of SM(d36:l), LPC(18:0), SM (d38:l), SM(d36:2), or CER(dl8: 1 / 18:0) and / or downregulation of TAG(49: 1), PC(32:2), PC(34:3), PC(34:1), LPC(14:0), or TAG (49:2).

23. The DDDA of claim 16, wherein the therapeutically effective dose provides equal or less than 3% of a standard daily caloric intake of a mammal.

24. The DDDA of claim 16, wherein the therapeutically effective dose provides equal or less than 1% of a standard daily caloric intake of a mammal.

25. The DDDA of claim 16, wherein the subject is a human.

26. The DDDA of claim 16, wherein the therapeutically effective dose comprises equal or less than 5 g of the DDDA.

27. The DDDA of claim 16, wherein the therapeutically effective does comprises equal or less than 3 g of the DDDA.

28. The DDDA of claim 16, wherein the DDDA is formulated for oral administration.

29. The DDDA of claim 16, wherein administration for an extended period of time is for a length of between 8 and 12 weeks or between 14 and 20 weeks.

30. The DDDA of claim 16, wherein the DDDA is formulated to provide between 0.05g and 5.0g as a daily dosage.