Distribution of AAV particles in different tissues

By incorporating14C-labeled leucine into AAV capsids during synthesis and using AMS, the method addresses the limitations of traditional labeling methods, providing precise and safe tracking of AAV distribution, thereby optimizing therapeutic applications.

WO2026119948A1PCT designated stage Publication Date: 2026-06-11F HOFFMANN LA ROCHE & CO AG +1
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
F HOFFMANN LA ROCHE & CO AG
Filing Date
2025-12-03
Publication Date
2026-06-11

Smart Images

  • Figure EP2025085215_11062026_PF_FP_ABST
    Figure EP2025085215_11062026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention is concerned with a method for determining the distribution of 14C-labeled AAV particles in different tissues of a mammalian organism. Additionally, this invention describes a radiolabeled AAV particle composition for use in such methods.
Need to check novelty before this filing date? Find Prior Art

Description

[0001]

[0002] Distribution of AAV particles in different tissues

[0003] The invention relates to a novel radiolabeling concept of adeno associated virus (AAV) capsides with carbon- 14 and its use in disposition studies.

[0004] Technical Field

[0005] The invention pertains to a method for determining the distribution of14C-labeled AAV particles in different tissues of a mammalian organism. This novel approach allows for precise tracking and analysis of AAV distribution within biological systems, thereby enhancing the accuracy of disposition studies. The utilization of carbon- 14 enables detailed monitoring of the viral particles' behavior in vivo, which is crucial for understanding their biodistribution and optimizing their therapeutic applications. Art

[0006] Adeno-associated virus (AAV) vectors are widely employed in gene therapy due to their ability to effectively deliver genetic material to host cells. Understanding the distribution and targeting efficiency of these vectors in different tissues is crucial for optimizing therapeutic outcomes and minimizing off-target effects. Prior methodologies have been limited in their ability to efficiently and accurately map the distribution of these vectors within the body.

[0007] Gene therapy is poised to become a significant modality in the near future, with adeno-associated virus vectors being a promising delivery method. However, the in vivo fate of the viral capsid remains largely unknown. This invention aims to address this by labeling the capsid proteins of AAV with sufficient carbon- 14 (14C) amino acids to enable tracking of capsid distribution in different tissues of a mammalian organism, in particular a non-human mammalian organism. One of the primary challenges is the safety concern regarding dosage restrictions and the detection of minimal amounts of radioactivity. Given the relatively large size of AAV capsids, the actual number of radioactive molecules is quite small. This necessitates high specific activity, which is directly correlated with the number of tags per protein.

[0008] If each protein required several hundred14C isotopes, traditional chemical labeling methods, such as lysine conjugation, would significantly alter the physicochemical properties of the virus. The impact of such changes was demonstrated in studies by Kothari et al.1through direct radioiodination or modification of lysine residues. To avoid these alterations,14C labeling must occur during the AAV vector synthesis stage within cell culture.

[0009] SMU 21-11-2025 Additionally, the limited dosage constraint means that conventional radio detection methods lack the necessary sensitivity.

[0010] Seo et al.ucombine optical and positron emission tomography imaging of reporter genes and capsid tags to assess the temporal and spatial distribution of AAVs and track viruses111.

[0011] Detailed description of the invention

[0012] It is an object of the present invention to provide a robust and precise method for determining the distribution of14C-labeled AAV particles in different tissues of a mammalian organism, in particular a non-human mammalian organism. This approach involves the synthesis of AAV transgene protein particles, incorporating14C-labeled amino acids into the capsid proteins of the AAV vectors, and subsequent monitoring of their distribution post-injection. The method also outlines specifics about the types of cells used for production, the particular amino acids that are labeled, and the time frames for incorporation, leading to enhanced insight into vector distribution and transfection efficiency. Furthermore, the invention encompasses radiolabeled virus particle compositions, with a particular focus on AAV particles, in particular AAV9, labeled with14C- leucine, which facilitate the methods described herein.

[0013] The14C labeling occurs during the AAV vector synthesis stage within cell culture to prevent altering the physicochemical properties of the virus.

[0014] Accelerator mass spectrometry (AMS) was employed, owing to its heightened sensitivity in detecting small quantities of radioactivity.

[0015] The following definitions of the general terms used in the present description apply irrespective of whether the terms in question appear alone or in combination.

[0016] Transfection refers to the process of introducing foreign nucleic acids (such as DNA, RNA, or oligonucleotides) into eukaryotic cells to manipulate gene expression. This can include the introduction of plasmids, but it also encompasses other forms of nucleic acids such as siRNA, miRNA, mRNA, and CRISPR components. When introducing plasmids into cells, the cells can be transfected with three plasmids: pHelper (provides necessary helper functions), pAAVRep-Cap (encodes replication and capsid proteins), and pAAV transgene protein (encodes the therapeutic gene). Transfection can be performed on a wide variety of cell types, examples include HEK293, HEK293T, Chinese Hamster Ovary Cells, and the like. Preferred transfecting cells are HEK293T.

[0017] AAV particles are viral vectors derived from the adeno-associated virus. AAV particles are known for their ability to infect a wide range of cell types without causing disease. AAVs are classified into various serotypes based on differences in their capsid proteins, which influence their tissue tropism, transduction efficiency, and immune response, making them suitable for different therapeutic applications and tissue- specific targeting. Common AAV serotypes are AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 and the like. A preferred AAV serotype according to the present invention are AAV9 and AAV9 derived engineered capsids.

[0018] AAV-transgene protein particles are AAV particles comprising a transgene. An AAV-transgene- detectable protein vector is an AAV particles.

[0019] AAV transgene-detectable protein refers to a protein encoded by a transgene introduced into cells using AAV vectors, which has properties that allow it to be easily detected and monitored. These properties can include fluorescence, bioluminescence, or other detectable markers that enable researchers to visualize, track, and measure the expression and localization of the protein within the target cells or tissue. Examples include Green Fluorescent Protein (GFP), mGreenLantern (mGL), Enhanced Green Fluorescent Protein (EGFP), Luciferase, Red Fluorescent Protein (RFP), Microglia Marker (MGL), Blue Fluorescent Protein (BFP), Yellow Fluorescent Protein (YFP) and the like.

[0020] Capsid refers to the protein shell that encapsulates the viral genome. The capsid determines the infectivity and tropism (preference for specific cell types or tissues) of the AAV particle.

[0021] Radiolabeling refers to incorporating a14C-labeled amino acid such as14C-labeled leucine into the AAV capsid proteins during synthesis. This involves culturing the cells in a medium containing the14C-labeled amino acid.

[0022] 14C-labeled leucine refers to is a form of the amino acid leucine in which one or more carbon atom within the molecule is replaced by the radioactive isotope carbon- 14 (14C). This labeling allows for the tracking and detection of leucine molecules, and any biomolecules incorporating them in mammalian tissue and serum, via techniques such as Accelerator Mass Spectrometry (AMS). The14C serves as a tracer that enables the precise measurement of the distribution and incorporation of the labeled leucine within biological systems.14C-labeled leucine can be uniformely labeled, i.e. all carbon atoms within the leucine molecule are labeled with14C or the labeling is positionspecific, where14C is specifically incorporated into a particular carbon position within the leucine molecule, for example at the acid position. The14C-labeled leucine can contain 1 - 614C isotopes, resulting in a molar activity in the range of 1.85 GBq / mmol - 12.2 TBq / mmol (50-330 mCi / mmol), a preferred14C-labeled leucine has 2 MBq / mmol (55 mCi / mmol).

[0023] The14C-labeled amino acid is incorporated into the AAV capsid proteins during a period between 8 and 72 hours, in particular 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 or 72 hours, in particular 72 hours. Accelerator Mass Spectrometry (AMS) is an advanced technique to detect and measure the14C- within the mammalian organism's tissues and serum with high sensitivity. The tissue samples for AMS analysis were prepared by homogenising the tissue samples in KOH / ethanol, in particular 1.5 M KOH in 20% ethanol.

[0024] Mammalian organism refers to animals and humans.

[0025] Mammalian organism's tissues refers to epithelial tissue (skin and the like), connective tissue (bone, blood and the like), muscle tissue (skeletal muscle, heart and the like), and nervous tissue (brain, spinal cord and the like). Particular examples are liver, spleen, cortex and muscles.

[0026] The culture medium refers to a specialized nutrient solution designed to support the growth and maintenance of host cells, providing the necessary environment for the replication and production of vectors, such as plasmids or viral vectors, used in genetic engineering and therapeutic applications. It comprises 0.1-0.8 mmol / L leucine with 0.6- 1.8% being14C-labeled leucine, in particular 0.2 mmol / L leucine with 1.8% being14C-labeled leucine.

[0027] Embodiment 1: Present invention concerns a method for determining the distribution of Relabeled AAV particles in different tissues of a mammalian organism, the method comprising the following steps a. Synthesizing AAV-transgene protein particles by transfecting cells with plasmids encoding pHelper, pAAVRep-Cap, and pAAV transgene protein, b. Incorporating a14C-labeled amino acid into the AAV capsid proteins during vector synthesis in cell culture, c. Injecting the radiolabeled AAV-transgene-detectable protein vector into the mammalian organism, and d. Analysing the distribution of14C in the mammalian organism's tissues and serum using Accelerator Mass Spectrometry.

[0028] Embodiment 2: Present invention further concerns the method according to embodiments 1, wherein the AAV transgene-detectable protein is green fluorescent protein (GFP).

[0029] Embodiment 3: Present invention further concerns the method according to any of embodiments 1-2, wherein the capsid is an AAV9 capsid or an AAV9 derived engineered capsid.

[0030] Embodiment 4: Present invention further concerns the method according to any of embodiments 1-3, wherein the capsid is an AAV9 capsid.

[0031] Embodiment 5: Present invention further concerns the method according to any of embodiments 1-3, wherein the capsid is an AAV9 derived engineered capsid. Embodiment 6: Present invention further concerns the method according to any of embodiments 1-5, wherein AAV-GFP particles are AAV9-GFP.

[0032] Embodiment 7 : Present invention further concerns the method according to any of embodiments 1-6, wherein pAAVRep-Cap is pAAV9Rep-Cap.

[0033] Embodiment 8: Present invention further concerns the method according to any of embodiments 1-7, wherein the radiolabeled AAV-GFP vector is a radiolabeled AAV9-GFP vector.

[0034] Embodiment 9: Present invention further concerns the method according to any of embodiments 1-8, wherein the transfecting cells are HEK293T cells.

[0035] Embodiment 10: Present invention further concerns the method according to any of embodiments 1-9, wherein the14C-labeled amino acid is incorporated during a period between 8 and 72 hours, in particular 72 hours.

[0036] Embodiment 11: Present invention further concerns the method according to any of embodiments 1-10, wherein the14C-labeled amino acid is14C-labeled leucine.

[0037] Embodiment 12: Present invention further concerns the method according to any of embodiments 1-11, wherein the culture medium comprises 0.1-0.8 mmol / L leucine with 0.6- 1.8% being Relabeled leucine, in particular 0.2 mmol / L leucine with 1.8% being14C-labeled leucine.

[0038] Embodiment 13: Present invention further concerns the method according to any of embodiments 1-11, wherein the14C-labeled leucine is uniformly labeled.

[0039] Embodiment 14: Present invention further concerns the method according to any of embodiments 1-13, further comprising collecting tissue and serum samples from the mammalian organism at predetermined time points between steps c and d).

[0040] Embodiment 15: Present invention further concerns the method according to any of embodiments 1-13, wherein the tissue samples are collected from major organs including the liver, spleen, cortex and muscles.

[0041] Embodiment 16: Present invention further concerns the method according to any of embodiments 1-15, wherein the mammalian organism is a human.

[0042] Embodiment 17: Present invention further concerns the method according to any of embodiments 1-16, further comprising purifying the14C-labeled AAV particles using iodixanol gradient ultracentrifugation to separate the14C-labeled AAV particles from cell debris and empty capsids. Embodiment 18: Present invention further concerns the method according to any of embodiments 1-17, further comprising determining the viral titer of the14C-labeled AAV particles by quantitative PCR. Embodiment 19: Present invention further concerns the method according to any of embodiments 1-18, further comprising assessing the full-empty ratio of the14C-labeled AAV particles by an Elisa assay.

[0043] Embodiment 20: Present invention further concerns the method according to any of embodiments 1-19, further comprising preparing tissue samples for AMS analysis by homogenising the tissue samples in 1.5 M KOH in 20% ethanol using a bead mill apparatus.

[0044] Embodiment 21: Present invention further concerns the method according to any of embodiments 1-20, further comprising measuring the total radioactivity in tissue and serum samples by i) drying the samples in tin foil cups under a gentle stream of nitrogen and ii) analysing the dried samples using AMS.

[0045] Embodiment 22: Present invention further concerns the method according to any of embodiments 1-21, further comprising performing endotoxin quantification using a chromogenic endotoxin assay kit.

[0046] Embodiment 23: Present invention further concerns a method for selecting a capsid variant for a specific tissue, said method comprising a method according to any of embodiments 1-22.

[0047] Embodiment 24: Present invention further concerns a method for determining the efficiency of transfection, said method comprising a method according to any of embodiments 1-22.

[0048] Embodiment 25: Present invention further concerns a therapeutic molecule comprising a capsid variant selected by a method according to any of embodiments 1-22.

[0049] Embodiment 26: Present invention further concerns a pharmaceutical composition comprising a capsid variant selected by a method according to any of embodiments 1-22.

[0050] Embodiment 27: Present invention further concerns a method of synthesis a capsid variant comprising applying a method according to any of embodiments 1-22.

[0051] Embodiment 28: Present invention further concerns a method of synthesis a therapeutic molecule comprising applying a method according to any of embodiments 1-22.

[0052] Figure 1: Map of plasmid pAAV9 Rep / Cap. Plasmid expressing the AAV2 Rep ORF and the AAV9 Cap ORF. The p5 distal and proximal promoters drive the Rep expression. The p40 promoter drives the Cap expression.

[0053] Figure 2: Map of plasmid pHelper. A plasmid derived from the Adenovirus that encodes the ORFS E2A, E4 and VA. This plasmid provides the adenovirus helper functions that are required for rAAV production. Figure 3: Map of plasmid pAAV GFP. This plasmid encodes the green fluorescent protein (GFP) flanked by two AAV2 ITRs. The ITRs enable the packaging of GFP into the AAV capsid.

[0054] Figure 4: Time dependent vector genome levels in serum and tissue samples

[0055] Experimental Part

[0056] Examples of compositions according to the invention are, but are not limited to the following:

[0057] Abbreviations:

[0058] AAV Adeno associated virus

[0059] AMS Accelerator mass spectrometer

[0060] Bq Becquerel

[0061] Ci Curie

[0062] DMEMDulbecco’s modified eagle medium

[0063] DPM Disintegrations per minute

[0064] ELISA Enzyme-linked immunosorbent assay

[0065] FBS Foetal bovine serum

[0066] GFP Green fluorescent protein

[0067] HEK293T Human embryonic kidney 293

[0068] HCP Host cell protein kDa Kilodalton

[0069] LAL Limulus amoebocyte lysate

[0070] LSC Liquid scintillation counting

[0071] MOI Multiplicity of infection

[0072] PBS Phosphate-buffered saline

[0073] PEI Polyethyleneimine

[0074] Pen / Strep Penicillin / streptavidin qPCR Quantitative (or real-time) polymerase chain reaction rpm Round per minutes RT Room temperature

[0075] TRA Total radioactivity analysis

[0076] Tris-HCl Tris-(hydroxymethyl)-aminomethane hydrochloride

[0077] ULLA Ultra low level liquid scintillation counting vg Vector genome

[0078] Materials and Methods:

[0079] Table 1 lodixanol gradient ultracentrifugation lodixanol gradient ultracentrifugation was employed as a purification technique to isolate14C- labeled AAV9 vector particles from cell debris and empty capsids, as described by Fakhiri el al.lv. This method leverages the principles of density gradient centrifugation, wherein the sample is layered onto a density gradient and subjected to high-speed centrifugation. This process causes molecules to migrate through the gradient based on their density. Affinity chromatography or anion exchange chromatography is also possible.

[0080] In brief, the vector cell lysate was transferred to the ultracentrifugation tube using a Pasteur pipette. Subsequently, varying concentrations of iodixanol solutions were added sequentially: 7 mL of 15% iodixanol solution, 5 mL of 25% iodixanol solution, 4 mL of 40% iodixanol solution, and 4 mL of 60% iodixanol solution. The tube was then topped off with benzonase buffer and sealed using a heating device before centrifugation. The tubes were centrifuged for 2 hours at 230,000 x g in a Beckman 70.1 Ti rotor using the Beckman Coulter Optima LE-80K Ultracentrifuge. Postcentrifugation, a 1 mL fraction was carefully collected from the 60-40% interphase by puncturing the tube with a needle and syringe. qPCR analysis (GFP) - virus yield (titer) as parameter of transfection efficiency

[0081] Quantitative PCR (qPCR) for GFP was used to determine the vector titer of the virus stock. The assay was performed as described by Fakhiri et al.lv, namely 3 pL sample was added to 10 pL SYBR green master mix containing 400 nM GFP primers (EGFPbckt_forward primer GTAACCACACTGACGTATGG; GFPbckt_reverse primer CCTTAAAGAAGATGGTCCGC). A standard qPCR cycle was performed including a melting curve using the QuantStudio™ 6 Realtime PCR system (ThermoFisher) and corresponding software (Quantstudio™ Real-Time PCR software). Using a standard curveline derived from the GFP plasmid, the viral titer of AAV9 was calculated assuming that AAV9 was equally expressed as GFP. The amplification efficiency was not substantially different between the plasmid and the single- stranded AAV genome.

[0082] Purity control by HCP determination

[0083] The level of HEK host cell protein (HCP) impurities in the virus stock was assessed using an immuno-enzymatic assay per the manufacturer's instructions [Cygnus]. Briefly, a 50 pL sample was taken from the radiolabeled virus stock and added, along with standards and controls, into a 96-well plate pre-coated with anti-HEK:HRP antibodies. The plate was then incubated for 1.5 hours on an orbital shaker (Titramax 1000, Heidolph) at 400-600 rpm and 22°C. Following the incubation, the plate was washed four times before adding the 3,3',5,5'-tetramethylbenzidine (TMB) substrate.

[0084] After allowing the appropriate incubation period for the TMB reaction, a stop solution was added, and the absorbance was measured using a plate reader (BioTek Synergy Hl Multimode Reader) at wavelengths of 450 nm and 650 nm. The amount of HCP in the samples was quantified by comparing the absorbance readings to a standard curve.

[0085] Purity control by HCP determination Detection of HEK host cell protein (HCP) impurities in the virus stock was carried out utilizing an immuno-enzymatic assay as per the manufacturer’s guidelines [Cygnus]. Briefly, a 50 pL sample from the radiolabeled virus stock, along with standards and controls, was added to a 96- well plate pre-coated with anti-HEK:HRP. Following 1.5 hours of incubation on an orbital shaker (Titramax 1000, Heidolph) at 400-600 rpm and 22 °C, the plate was washed four times. Subsequently, 3,3’,5,5’-tetramethylbenzidine (TMB) substrate was introduced. After the designated incubation period, a stop solution was added, and absorbance was recorded using a plate reader (BioTek Synergy Hl Multimode Reader) at wavelengths of 450 / 650 nm. The HCP concentration in the samples was then quantified using a standard curve.

[0086] Liquid Scintillation Counting - determining specific activity

[0087] Liquid scintillation counting (LSC; Perkin Elmer Tricarb 5110TR) was employed to measure the disintegrations per minute (DPM) in the sample, enabling the calculation of radioactivity within the virus stock. This value was then used to determine the specific activity of the virus stock. The specific activity was calculated by dividing the measured radioactivity by the quantity of viral genomes obtained from qPCR analysis.

[0088] Full-empty ratio determination

[0089] An ELISA assay was utilized to quantitatively determine the proportion of full and empty AAV9 particles (assembled AAV capsids), in order to ascertain the full-empty ratio in the final virus stock intended for animal injection. The Progen AAV9 Titration ELISA kit was employed following the manufacturer's instructions. The full-empty ratio was calculated by dividing the viral titer obtained from qPCR by the titer derived from the assembled AAV capsid ELISA.

[0090] Endotoxin determination

[0091] To quantify endotoxins in the final product, a chromogenic endotoxin quantification assay kit (LAL assay) was utilized according to the manufacturer's instructions. This assay was conducted to ensure that the radiolabeled virus stock was free of endotoxins and suitable for in vivo injection. Upon completion of the LAL assay, the sample was deemed ready for injection, with no additional assays or interventions required.

[0092] AMS analysis

[0093] AMS analysis was performed on an AMS system, consisting of an Elemental Analyzer, Double Gas Interface and a 1MV multi-element AMS (model 4110 Bo, High Voltage Engineering (software B9188:2.0.0.614 or B7679:2.0.079)). The sample result for TRA measurements is calculated from the14C / 12C ratio generated by the AMS and carbon content (mg C / mL) analysed by the EA. TRA samples are corrected for the SST ANU (see below)14C / 12C isotope ratios and subsequently converted to mBq / mL, using the carbon content of the sample, for serum samples and to mBq / g for tissue homogenates. A reference standard ANU sucrose-8542 (C12H22O11) with a certified14C / 12C isotope ratio was used as a system suitability sample. Each AMS run was started with at least 3 ANU samples. The14C / 12C ratio from (at least 2) ANU samples were within ±15% from the average14C / 12C ratio from the previous 10 runs using this SST, calculated using accepted SST samples only. The CV was <15%. AMS QC samples, STD_1 and STD_5, are prepared approximately once a year. After preparation, the ANU-corrected14C / 12C ratio is established using AMS analysis (n=5 for each sample). At least 3 sets of AMS QC samples were included in each run. The14C / 12C ratio of the AMS QC samples, STD_1 and STD_5 (at least 2 per level), in an analytical run were within ±15% of the nominal ratio. The CV was <15%. For samples, the carbon concentration was determined using a calibration curve prepared from acetanilide. The calibration curves contained 9 calibration levels in this case and were analysed using linear regression (1 / x2). All calibration levels deviated < 15% from the nominal value and the R2was >0.990 (as per criteria).

[0094] 14C-labeled AAV9 particle production

[0095] HEK293T cells were cultured at a density of 6xl06cells per 150 cm2dish 48 hours prior to transfection, with a total of 115 dishes seeded. To produce14C-labeled AAV9 virus particles, these cells were transfected for 72 hours in a [14C]leucine medium containing 0.2 mmol / L total leucine, of which 1.8% was labeled, using the pAAV9 rep / cap, pAAV9-GFP, and pHelper plasmids (1:1:1) combined with a PEI-NaCl transfection mixture, following the protocol by Fakhiri el al.lv

[0096] The primary virus stock was collected by removing the media, harvesting the cells via scraping in 1 mF per dish of PBS, gently washing the cells with PBS, and resuspending the cell pellet in a benzonase buffer (50 mM Tris-HCl, 1 mM MgCh, 0.1 mg / mE BSA). This mixture underwent five freeze -thaw cycles followed by benzonase nuclease treatment (50 U / mE) for 1 hour at 37°C. For iodixanol purification, the crude cell lysate from up to 20 petri dishes was loaded onto an iodixanol gradient, resulting in six tubes that were processed in two separate runs. Four fractions were collected from each iodixanol tube and analyzed after pooling the same fractions from the runs. Fractions 1 and 2 were pooled and diluted with PBS to a volume of 15 mF, then concentrated using a pre- wetted Amicon Ultra- 15 centrifugal filter unit.

[0097] The concentration and rebuffering of the sample were performed at low speeds, beginning with 2000 x g for 5 minutes and then reduced to 800 x g for 2 minutes across several steps, using a Centrifuge 5810 R (Eppendorf). After concentrating the samples to approximately 2 mF, the column was refilled with PBS to 15 mF and concentrated again. This process, involving tube inversion several times, was repeated at least three times before the final sample was sterilized using a 0.2 pm filter. This resulted in a total capsid count of 1.26 x 1013in 1.05 mF, as determined by an EEISA titration assay. qPCR analysis yielded 1.23 x 1013viral genomes per mF, indicating an almost 1:1 ratio of viral genomes to capsids. The specific activity of the final virus stock, determined by ultra-low level liquid scintillation counting, was 1.04 x 104Bq / mg, equivalent to 6.73 x 10'11Bq per particle. The levels of host cell protein and endotoxins (LAL assay) were below the quantification limits of 2.0 ng / mL and 0.01 EU / mL, respectively, confirming the purity of the14C-AAV9 virus stock.

[0098] In vivo study in mice

[0099] The in vivo study design was in general compliance with the animal health and welfare guidelines, the test facility is AAALAC accredited, and the study was conducted under non-GLP. 21 mice (C57 / BL6J, male, age at start of dosing: >9 weeks, Charles River Laboratories), divided in 7 groups a 3 mice, received a dose of 2x 1013vg / kg after single intravenous injection. Serum was collected after 1, 4, 7, 24, 48, 96, 168, and 672 h for dPCR analyses. Mice were sacrificed after 1, 4, 24, 48, 96, and 168 h. Cortex, liver, spleen, and muscle were collected for AMS and dPCR analyses. Furthermore, one group was sacrificed after 672 h for dPCR analyses of cortex, liver, spleen, and muscle. On necropsy day, all animals were anaesthetised with Ketamine / Xylazine. Blood for dPCR and / or AMS were sampled and the animals were perfused with PBS (8 mL / min for 4 min), which led to the death of the animal.

[0100] Organs and tissues from all animals were examined in situ, removed, checked for abnormalities, and verified for the presence / absence of all specified organs / tissues.

[0101] AMS analysis of samples derived from the in vivo study

[0102] Levels of14C-AAV9 in cortex, liver, spleen, muscle, and serum samples were analyzed using standard total radioactivity analysis (TRA) with Accelerator Mass Spectrometry (AMS). Serum samples were transferred directly into tin foil cups and dried under a gentle stream of nitrogen. Approximately 30 mg of tissue samples were placed in Bead Mill tubes, and 500 pL of 1.5 M KOH in ethanol was added by weight to all tissues before homogenization using the Bead Mill Homogenizer (VWR). Aliquots of the homogenized tissues were then transferred to tin foil cups and dried under a gentle stream of nitrogen. Tissue samples were analyzed in triplicate, while serum samples were pipetted as 5 pL aliquots into the cups for single analysis.

[0103] AMS analysis

[0104] A result is defined as the average of the triplicate analyses for the homogenates. The coefficient of variation (CV) must be less than 30% for the result to be considered reportable. Calculations were performed to determine the proportion of tissues preserved in mBq / g from the partial sample, as shown in Table 2. Using the specific activity of 1.04 x 104Bq / mg (equivalent to 6.73 x 10'11Bq per virus particle), these values were converted to represent the number of virus particles per gram of tissue (Table 3).

[0105] Table 2: Radioactivity in mBq measured per mL in serum and per g in tissues after several time points. Values are expressed as mean and standard deviation (SD), n = 3.

[0106] Table 3a: Vector genomes per mL in serum and per g in tissues after several time points. Values are expressed as mean and standard deviation (SD), n = 3

[0107]

[0108] Table 3b: Vector genomes per mL in serum and per g in tissues after several time points. Values are expressed as mean and standard deviation (SD), n = 3

[0109] IKothari et al. Scientific Reports, 2017, 7, 39594

[0110] IISeo et al. Biomaterials (2022), 288;121701

[0111] IIISeo et al. Nature Communication (2020), 11;2102

[0112] IVFakhiri et al. https: / / link.springer.com / protocol / 10.1007 / 978-l-4939-9170-9_8

Claims

Claims1. A method for determining the distribution of14C-labeled AAV particles in different tissues of a mammalian organism, the method comprising the following steps a. Synthesizing AAV-transgene protein particles by transfecting cells with plasmids encoding pHelper, pAAVRep-Cap, and pAAV transgene protein, b. Incorporating a14C-labeled amino acid into the AAV capsid proteins during vector synthesis in cell culture, c. Injecting the radiolabeled AAV-transgene-detectable protein vector into the mammalian organism, and d. Analysing the distribution of14C in the mammalian organism's tissues and serum using Accelerator Mass Spectrometry.

2. The method according to claims 1, wherein the AAV transgene-detectable protein is green fluorescent protein (GFP).

3. The method according to any of claims 1-2, wherein the capsid is an AAV9 capsid.

4. The method according to any of claims 1-3, wherein AAV-GFP particles are AAV9-GFP.

5. The method according to any of claims 1-4, wherein pAAVRep-Cap is pAAV9Rep-Cap.

6. The method according to any of claims 1-5, wherein the radiolabeled AAV-GFP vector is a radiolabeled AAV9-GFP vector.

7. The method according to any of claims 1-6, wherein the transfecting cells are HEK293T cells.

8. The method according to any of claims 1-7, wherein the14C-labeled amino acid is incorporated during a period between 8 and 72 hours, in particular 72 hours.

9. The method according to any of claims 1-8, wherein the14C-labeled amino acid is Relabeled leucine, in particular wherein the culture medium comprises 0.1-0.8 nunol / L leucine with 0.6-1.8% being14C-labeled leucine, in particular 0.2 mmol / L leucine with 1.8% being14C-labeled leucine, more particularly wherein the14C-labeled leucine is uniformly labeled.

10. The method according to any of claims 1-9, further comprising collecting tissue and serum samples from the mammalian organism at predetermined time points between steps c and d), in particular wherein the tissue samples are collected from major organs including the liver, spleen, cortex and muscles.

11. A method for selecting a capsid variant for a specific tissue, said method comprising a method according to any of claims 1-10.

12. A method for determining the efficiency of transfection, said method comprising a method according to any of claims 1-10.

13. A therapeutic molecule comprising a capsid variant selected by a method according to any of claims 1-10.

14. A pharmaceutical composition comprising a capsid variant selected by a method according to any of claims 1-10.

15. A method of synthesis a capsid variant comprising applying a method according to any of claims 1-10.***

Citation Information

Patent Citations

  • AVV Vectors and Methods

    US20100260800A1