Method for recovering two or more genes or gene products encoding immune receptors

Abstract

The present invention relates to a method for recovering two or more genes, gene products, or cDNAs encoding an immune receptor having two or more subunits, wherein the two or more genes or gene products are contained in a given source cell. The present invention also relates to a method for generating an expression cell library, wherein each cell in the library is capable of expressing two or more genes or gene products encoding immune receptor subunits. The present invention also relates to a method for screening the expression cell library generated by the above method for a cell expressing an immune receptor specific for a given target molecule.

Description

[0001] The present invention relates to a method for recovering two or more genes or gene products encoding immune receptors.

[0002] Genes encoding proteins can be isolated from libraries or from natural sources in order to make them useful for therapeutic, diagnostic, scientific or commercial purposes. This applies in particular to immune receptors.

[0003] The immune receptors encoded by T- and B cells are assembled from families of germline gene segments through a process called somatic recombination, resulting in each individual cell expressing a different receptor. These cells can then undergo a process of somatic mutation, called affinity maturation, which further increases the diversity of immune receptors.

[0004] If such an immunoreceptor has two or more genes or gene products encoding it—as is the case with antibodies and T-cell receptors, where both gene products contribute together to the receptor's ability to bind antigen—maintaining the original pairing of the two or more genes or gene products is crucial to ensure authentic and proper function of the resulting protein once it is expressed in a suitable expression cell.

[0005] This phenomenon is crucial, for example, in recovering the genes encoding individual immunoglobulins from an individual's antibodyome. Here, as it occurs in naturally occurring B-cells, maintaining the original immunoglobulin heavy and light chain (IgH+IgL) pairing is crucial for producing a true recombinant copy of each antibody, thereby ensuring its functionality. IgH and IgL are the products of two different genes and are both required to determine the specificity of an antibody. Each B-cell expresses a different set of IgH+IgL and therefore has a unique antibody specificity.

[0006] Another example is T-cell receptor-fusion proteins, which are derived from T-cell receptors, characterized by alpha and beta chains (α and β), and where their correct pairing is likewise required for functionality.

[0007] Although there are methods for isolating immunoglobulin genes from human B cells and producing various monoclonal antibodies, such as phage display, these methods result in random pairing of immunoglobulin heavy and light chains.

[0008] Methods for cloning antibodies that retain the original immunoglobulin heavy and light chain pairing information, as present in B-cells isolated from selected donors (as a source of diversity), have specific advantages. In particular, it is expected that such authentic antibodies have undergone an in vivo selection process, which results in the absence of specificities that may be potentially harmful to the host.

[0009] Furthermore, there is evidence that, in addition to expressing the original specificity of the parental B cells, antibodies with cognate IgH- and IgL-pairing exhibit improved stability, better expression capacity, and other favorable physicochemical properties compared to antibodies formed by randomly paired IgH and IgL. These favorable properties are important for screening and large-scale production.

[0010] Historically, the challenge of obtaining monoclonal antibodies, particularly from human B-cells, has been addressed by various cell B-cell cloning techniques, wherein B-cells are stimulated to divide and / or produce antibodies, the production of which is required to identify a single B cell or mixture of B cells that produces the antibody of interest. Identification of B cell clones expressing the antibody of interest can then be performed by cell cloning, such as limiting dilution cloning, or by combining cell stimulation with molecular cloning steps, followed by repetition of the screening process using recombinantly expressed antibodies using suitable methods established in the art.

[0011] These cell cloning methods, such as hybridoma technology, are inefficient, with cloning efficiencies typically below 1%, and are therefore only feasible in situations where the antibody of interest is expressed by highly abundant B-cells (e.g., in infections, during immunizations). However, this is a serious limitation, as antibodies are typically intended to be directed against targets that are not involved in infections or other conditions that produce high B-cell abundance. Examples are found in immune-mediated diseases, neurodegenerative diseases, or cancer.

[0012] Therefore any technology aiming at molecular cloning of a true antibody repertoire, e.g., from B-cell donors, is needed to work at the single cell level. However, to date, single B-cell molecular cloning of such antibodies has not been achieved in high enough yields to encompass a complete antibody repertoire (antibodyome) of 100,000 or more different antibody specificities at an affordable cost or in an acceptable timeframe. SUMMARY OF THE INVENTION

[0014] It is an object of the present invention to facilitate the isolation of two or more genes or gene products encoding immune receptors.

[0015] Another object of the present invention is to provide a method for delivering two or more genes or gene products encoding immune receptors, which proteins have advantages when used for therapeutic, diagnostic, scientific or industrial purposes.

[0016] Another object of the present invention is to provide a method which makes it possible to obtain immunoreceptors encoded by two or more genes or gene products, which proteins have no deviation or at least a very low degree of deviation in properties other than binding to the desired antigen.

[0017] Another object of the present invention is to allow the maintenance of the original pairing of two or more genes or gene products encoding immune receptors present in a single cell during isolation.

[0018] Another object of the present invention is to allow high throughput screening of cell libraries having the potential to express two or more genes or gene products or immune receptors encoded by their mRNA.

[0019] Embodiments of the present invention

[0020] Before describing the present invention in detail, it should be understood that the present invention is not limited to the specific components of the device or the process steps of the method, as such steps and methods may vary. It should also be understood that the terminology used herein is for the purpose of describing specific embodiments only and is not intended to be limiting. It must be noted that when used in this specification and the appended claims, the singular forms "a", "an" and "the" include singular and / or plural references unless the context clearly dictates otherwise. It should also be understood that where parameter ranges defined by numerical values ​​are given, the ranges are considered to include these limiting values.

[0021] According to one aspect of the present invention, a method for recovering two or more genes or gene products or cDNAs encoding an immune receptor having two or more subunits, wherein the two or more genes or gene products are contained in a given source cell, is provided. The method comprises the following steps:

[0022] a) Encapsulating source cells and mRNA capture moieties in microreactors

[0023] b) Lysing cells in a microreactor to release cellular mRNA into the lumen of the microreactor, which then adheres to the mRNA capture moiety

[0024] c) Reverse transcription of the mRNA attached to the mRNA capture moiety to obtain the corresponding cDNA gene product

[0025] d) generating a construct encompassing two or more gene products encoding said immune receptor subunits, and

[0026] e) Cloning the PCR product into a plasmid vector to obtain a bicistronic or multicistronic expression construct.

[0027] In this way, a library of plasmids is generated containing cDNAs encoding immune receptors of a given source cell population.

[0028] As used herein, the term "immunoreceptor" refers to a protein having two or more subunits and capable of specifically binding to a given target molecule (preferably a protein). Such an immunoreceptor is, for example, an antibody, having its heavy and light chains, or a T-cell receptor, having its α and β chains.

[0029] As used herein, the term "target molecule" encompasses molecules against which an immunoreceptor is to be prepared, for example, for therapeutic, diagnostic, analytical, scientific or industrial purposes. This can encompass peptides, proteins, glycoproteins, carbohydrates, nucleic acids, protein-nucleic acid complexes and small molecules, in particular receptor proteins, cytokine proteins, protein aggregates (in particular pathological aggregates, such as Abeta, Tau or α-synuclein), protein complexes such as MHC-antigen peptide complexes and structural proteins.

[0030] As used herein, the term "specific for a given target molecule" defines the ability of an immune receptor to react with a given target but not with other molecules. Specificity depends on the chemical composition, physical forces, and structure of the molecule at the binding site.

[0031] As used herein, the term "source cell" refers to a cell that has the potential to express the immune receptor or its mRNA, i.e., the cell from which the gene encoding the immune receptor is derived. This may, for example, involve a cell or cell collection isolated from nature, such as a donor. These cells may be, for example, B cells from a donor, each of which encodes another antibody. Similarly, the source cell may be a T cell from a donor, each of which encodes another T-cell receptor.

[0032] Therefore, the two or more genes or gene products or cDNAs encoding the antibodies or T-cell receptors are intended to be recovered for their further use.

[0033] As used herein, the term "microreactor" refers to a physical entity that allows three-dimensional encapsulation of source cells. In a preferred embodiment, these microreactors have a spherical shape, are free-floating, and can be operated in a micro or microfluidic environment.

[0034] As used herein, the term "reverse transcription of mRNA" refers to reverse transcription PCR, also known as RT-PCR, in which a single-stranded mRNA template is transcribed into double-stranded DNA, sometimes referred to as cDNA.

[0035] It is important to understand that this method allows for the simultaneous recovery of two or more genes and gene products encoding immunoreceptors having two or more subunits. Consequently, the specific combination of two or more subunits is conserved throughout the process, which is the subject of the present invention. This applies, for example, to immunoglobulin-based proteins, which consist of a light chain and a heavy chain that are specific for each other, i.e., a specific pairing of their respective chains is mandatory for the normal function of each antibody. The inventors consider this feature to be a particular advantage of the present invention, since other methods from the prior art do not provide for the conservation of specific pairings of heavy and light chains and can therefore result in dysfunctional antibodies.

[0036] The source cells may be cells from a cell collection, such as a cell library and / or a cell collection isolated from nature, such as from a donor. In a preferred embodiment, the collection or library may comprise up to 1,000,000 different cells (thus encoding up to 1,000,000 different antibodies).

[0037] The fact that the mRNAs encoding the different subunits of the immune receptor are first linked to the capture moiety via adhesion sterics and then physically linked by overlap extension PCR, and / or the fact that PCR products comprising two or more cDNAs encoding the different subunits of the immune receptor are cloned into a bicistronic or multicistronic expression construct ensures that two or more genes or gene products are processed and recovered in combination and that the specific combination of the two or more subunits is conserved throughout the process.

[0038] Overlap extension PCR (referred to herein as oePCR) is a variant of PCR that is used to join smaller DNA fragments into larger polynucleotides (Embleton et al., 1992).

[0039] As in most PCR reactions, two primers - one at each end - are used to amplify a given nucleotide sequence. To connect two DNA molecules, special primers are used at the ends to be connected. For each molecule, a primer is constructed at the end to be connected so that it has 5' overhang complementarity with the end of the other molecule. After annealing, when replication occurs, the DNA is extended by a new sequence complementary to the molecule to be connected. Once the amplification of the two DNA molecules reaches a critical concentration, the two different genes will pair at the position where the two complementary primer sequences annealed.

[0040] The introduced overlapping complementary sequences will serve as primers for extending the heteroduplex and leading to fusion of the two sequences. Further amplification of the heteroduplex occurs when the two primers anneal at the free ends of the newly formed heteroduplex (those that were not part of the ligation process).

[0041] An optional additional amplification step is performed in a second PCR using nested primers specific for the free ends of two separate genes.

[0042] This method has the advantage over other gene ligation technologies that it does not require restriction endonucleases (or ligases). Thus, oePCR enables the consolidation / conversion of the slight "steric ligation" of two separate genes on mRNA capture matrix beads into a covalent linkage in the form of heteroduplex DNA molecules.

[0043] Preferably, step c) can be followed by an additional quality control step in which the homogeneity of the mRNA attached to the mRNA capture moiety is evaluated. According to a particularly preferred embodiment, mRNA capture moieties that have no attached mRNA and those that form aggregates of two or more moieties are eliminated in this step.

[0044] According to a preferred benchmark, ≥30% of the mRNA capture moieties have attached mRNA, more preferably ≥40%, ≥50%, ≥60%, ≥70%, ≥80%, or most preferably, ≥90% of the mRNA capture moieties have attached mRNA.

[0045] Preferably, step d) can be followed by an additional quality control step in which the uniformity of the distribution of two or more genes or gene products encoding different subunits is assessed. According to a preferred benchmark, ≥30% of the mRNA capture fraction contains a clonable amplification product (cDNA). More preferably, ≥40%, ≥50%, ≥60%, ≥70%, ≥80%, or most preferably, ≥90% of the mRNA capture fraction contains a clonable amplification product.

[0046] Preferably, step d) may be followed by an additional quality control step in which the cross-contamination rate is assessed, for example by determining the diversity of the paired IgH and IgL genes, respectively, by sequence analysis of representative samples of linked subunits or genes. According to a preferred benchmark, the latter is ≤35%. More preferably, the cross-contamination rate is ≤30%, ≤25%, ≤20%, ≤15%, ≤10%, or most preferably, ≤5% of the mRNA capture fractions contain clonable amplification products.

[0047] In step c), the selection of nucleic acid molecules used to capture mRNA and initiate reverse transcription can be controlled, for example, by an mRNA capture moiety. In some embodiments, the latter can exhibit an adherent, specific capture nucleic acid sequence complementary to all mRNAs of a given cell, such as an oligo dT or random hexamer primer.

[0048] In other embodiments, nucleic acid molecules used for mRNA capture and priming of reverse transcription can be designed in such a way that only specific mRNAs are transcribed, such as mRNAs encoding the HC and LC chains of immunoglobulins.

[0049] According to a preferred embodiment, the method of the present invention further comprises, after step c), a step of amplifying the construct encompassing two or more genes encoding said immune receptor subunits.

[0050] For this purpose, specific PCR primers are used. For example, in order to amplify the construct encoding the antibody, primers can be used that are specific for the variable regions ("v-regions") of the immunoglobulin heavy and light chain cDNAs that are rearranged (V(D)J rearrangement) after V(D)J recombination (the light chain cDNA gene product is considered to be downstream). Specific PCR primers suitable for this purpose are, for example, described in Wardemann, et al. (2003).

[0051] Also preferably, after step c), a further quality control step may be performed, which comprises the following steps

[0052] (i) monitoring cDNA synthesis on the mRNA capture moiety, and

[0053] (ii) Exclusion of aggregated mRNA capture fraction.

[0054] This approach helps eliminate the interference between two or more mRNA capture moieties from different microreactors, which can lead to the disruption of HC / LC pairing.

[0055] Monitoring cDNA synthesis on the mRNA capture moiety can be performed, for example, using methods similar to those used in reverse transcription RT-PCR, where the progress of RT-PCR is monitored, for example, by a DNA probe bound to the substrate that has a fluorescent acceptor at one end and a quencher at the opposite end.

[0056] According to another preferred embodiment of the present invention, as shown in step d), the generation of the construct encompassing two or more gene products encoding immune receptor subunits is accomplished by amplifying cDNA by overlap extension PCR.

[0057] According to another preferred embodiment of the present invention, the step of amplifying the construct encompasses the use of nested PCR (also referred to herein as nPCR).

[0058] As shown in step e) above, this method not only provides amplified PCR products so that sufficient cDNA copies can be used for cloning, but also allows the introduction of appropriate restriction sites and provides sufficient specificity to amplify only two or more gene products encoding immune receptor subunits.

[0059] Nested PCR is a modification of the polymerase chain reaction (PCR) that is intended to reduce nonspecific binding in the product due to amplification of unwanted primer binding sites. The polymerase chain reaction (PCR) itself is a method used to amplify a DNA sample by temperature-mediated DNA polymerase. The products can be used for sequencing or analysis, and this method is a key part of many genetic research laboratories, along with its use in DNA fingerprinting for forensics and other human genetic situations. Conventional PCR requires primers that are complementary to the ends of the target DNA. A common problem is that the primers bind to the wrong areas of the DNA, producing unwanted products. The nested PCR involves two sets of primers used in two consecutive runs of the PCR, with the second set intended to amplify a second target within the product of the first run.

[0060] According to another preferred embodiment of the present invention, the method further comprises the step of inserting a regulatory element that supports cDNA expression into the PCR product. Such regulatory element is, for example, a cleavage site, a signal peptide or a promoter.

[0061] According to another preferred embodiment of the present invention, the microreactor is lysed or broken after step b), step c) or step d).

[0062] In the case of microreactors composed of alginate (as discussed elsewhere herein), lysis can be achieved by simply adding EDTA (ethylenediaminetetraacetate) to reduce the concentration of divalent cations (e.g., Ca 2+ ) titer to achieve, the alginate needs said divalent cations to maintain its gel-like state. Alternatively, alginate enzymes that digest alginate can be used.

[0063] Alginases are poly(β-D-mannuronic acid) lyases that catalyze the cleavage of polysaccharides containing β-D-mannuronic acid residues to provide oligosaccharides with 4-deoxy-α-L-erythro-hexa-4-enopyranuronosyl groups at their termini. Alginases belong to the lyase family and their systematic name is poly(β-D-1,4-mannuronide) lyase. Other commonly used names include alginate lyase I, alginate lyase, alginate enzyme I, and alginate enzyme II.

[0064] Because the mRNA capture moiety is able to capture the entire mRNA of a given source cell, once the entire cellular mRNA is bound to the mRNA capture moiety, the decisive step of ensuring cell-specific pairing of two or more genes or gene products or cDNAs encoding the immune receptor subunits of interest is completed. As shown elsewhere herein, this specific pairing is mandatory for the normal function of each immune receptor of interest.

[0065] This means that the earliest possible time to lyse the microreactor (without losing the specific pairing of two or more genes or gene products or cDNAs encoding the immune receptor subunits of interest) is after step b) because then the entire cellular mRNA (including the mRNA encoding the immune receptor subunits of interest) is captured on the given mRNA capture portion.

[0066] Preferably, between > 1 and < 100 mRNA capture moieties are used per microreactor. More preferably, between > 5 and < 50 mRNA capture moieties are used per microreactor.

[0067] In some embodiments, the subsequent steps, i.e., (i) reverse transcribing the mRNA attached to the mRNA capture moiety to obtain the corresponding cDNA (step c), (ii) generating a construct encompassing two or more gene products encoding immune receptor subunits (step d), and / or (iii) cloning the PCR product into a plasmid vector to obtain a bicistronic or multicistronic expression construct (step e) can occur in solution, i.e., outside the microreactor, without the risk of losing the specific pairing of the two or more genes or gene products or cDNAs encoding the immune receptor subunits of interest.

[0068] However, according to other embodiments, some or all of these steps still occur within the microreactor.

[0069] According to another preferred embodiment of the present invention, the mRNA capture fraction is emulsified with suitable primers and at least one polymerase after step b).

[0070] For this purpose, mRNA annealed to an mRNA capture moiety (eg, poly(dT) magnetic beads) is preferably collected, washed, and emulsified with primers, reverse transcriptase, and a thermostable DNA polymerase to perform RT-PCR, optionally followed by oePCR.

[0071] Such a process can be accomplished, for example, by precipitation of poly(dT) magnetic beads with captured cellular mRNA on a magnetic stand, followed by washing and resuspension steps. The beads can then be suspended in a suitable RT-PCR mixture, and the resulting suspension added to a stirred vessel containing an oil phase. The resulting emulsion is then added to a suitable PCR plate or tube and placed in a thermal cycler.

[0072] According to another preferred embodiment of the present invention, the immunoreceptor is an antibody having at least two subunits, or a T-cell receptor having at least two subunits. In antibodies, the subunits are heavy and light chains, while in T-cell receptor-like antibodies, the subunits are α and β chains.

[0073] As used herein, the term "antibody" shall refer to an immunoreceptor that is essentially based on the concept of immunoglobulin. When isolated from a source cell, i.e., a cell that has the potential to express the immunoreceptor, the antibody is still in the conventional Ig form (IgG, IgD, IgE, IgA and / or IgM). Preferably, this is also the form that is the subject of the screening process described elsewhere herein, in which a library of expressing cells is screened to obtain a cell that expresses an immunoreceptor specific for a given target molecule.

[0074] However, this does not mean that the immunoreceptor then used for treatment, diagnosis, analysis, scientific or industrial purposes is still in this form. It can exist as a fragment or derivative thereof, for example, as scFv, Fab and / or F(ab). Similarly, the immunoreceptor then used for treatment, diagnosis, analysis, scientific or industrial purposes can be in the form of a new antibody, such as a bispecific or trispecific antibody construct, a diabody, a camelid antibody, a domain antibody, a bivalent homodimer with two chains consisting of scFv, an IgA (two IgG structures connected by a J chain and a secretory component), a shark antibody, an antibody consisting of a New World primate framework plus a non-New World primate CDR, a dimeric construct comprising CH3+VL+VH, and an antibody conjugate (for example, an antibody or fragment or derivative connected to a toxin, a cytokine, a radioisotope or a label). However, this list is not limiting.

[0075] The skilled person knows how to translate a given antibody which is still in conventional Ig format and has demonstrated specificity for a given target into a fragment or derivative thereof as indicated above, or into a new antibody format as indicated above.

[0076] Another preferred format is a "reverse chimera format," in which a human variable region is isolated from a human antibody obtained using this method and fused to a non-human constant region, such as a mouse constant region. This reverse chimera format offers particular advantages for selected diagnostic, analytical, scientific, or industrial applications, where a complete infrastructure has been established that relies on non-human antibodies, particularly mouse or rabbit antibodies, including assay formats, histological formats, and screening formats, and where, for example, a labeled anti-mouse antibody is used to label a target-specific detection antibody (which is mouse and therefore has a mouse Fc region). In such an environment, a fully human detection antibody would not be compatible with the rest of the environment.

[0077] Reverse chimeric forms prepared from human variable regions obtained using this method thus combine the advantages of the present invention (superior binding qualities due to conserved heavy and light chain pairings) with the compatibility of the generated antibodies with standard assay formats, histological formats or screening formats.

[0078] Such reverse chimeras can be generated, for example, by established recombinant methods in a manner similar to chimeric antibodies, such as discussed in Boulianne et al. (1984) or Morrisson et al. (1984).

[0079] The T-cell receptor (TCR) is a molecule found on the surface of T lymphocytes. The T-cell receptor is responsible for recognizing antigens bound to major histocompatibility complex (MHC) molecules. The T-cell receptor is typically composed of two different protein chains, the α and β chains (in 5% of T lymphocytes, the T-cell receptor consists of the γ and δ (γ / δ) chains).

[0080] When the TCR attracts an antigen target and MHC, T lymphocytes are activated through a series of biochemical events mediated by associated enzymes, co-receptors, specialized adaptor molecules, and activated or released transcription factors.

[0081] Recombinant T-cell receptor fusion proteins have recently emerged as a means of targeting peptide antigens, which are present as a complex of the peptide and the major histocompatibility complex (MHC) on the cell surface.

[0082] For this purpose, soluble variants of T-cell receptors can be produced, for example, by fusing TCRs to immunostimulants. These fusion proteins can be used to target optional intracellular antigens. Such intracellular antigens are inaccessible to other targeted therapies, particularly antibodies. In this way, various cancers can be targeted by utilizing soluble variants of T-cell receptors directed against cancer-specific antigens (Card et al., 2004).

[0083] According to another preferred embodiment of the present invention, the immunoreceptor is a therapeutic protein (e.g., a protein used in a human or animal patient to treat a disease or to prevent its occurrence), a protein used for diagnostic or scientific purposes (e.g., a protein used to detect an analyte), or a protein used for commercial purposes (e.g., a protein used in an industrial process, for example, for the separation or purification of a given compound).

[0084] According to another aspect of the present invention, there is provided a method for producing an expression cell library, wherein each cell in the library is capable of expressing two or more genes or gene products encoding immune receptor subunits recovered according to the method of claim 1, the method comprising the steps of:

[0085] g) transfecting the expressing cells with a bicistronic or polycistronic expression construct, and

[0086] h) Encapsulating the expression cells into microreactors

[0087] As discussed elsewhere, these microreactors can be similar in principle to those used for source cells, i.e., cells with the potential to express the immune receptor of interest or its mRNA. However, these microreactors can also be larger because, in a preferred embodiment, the expressing cells are expanded after encapsulation.

[0088] Preferably, these expression cells are cells commonly used for heterologous expression of therapeutic, diagnostic, analytical, scientific or industrial proteins. Thus, the term "expression cell" encompasses bacterial cells (such as E. coli), fungal cells (such as Pichia pastoris, Aspergillus, Saccharomyces cerevisiae, Schizosaccharomyces pombe, Hansenula, Arxula or Trichoderma), mammalian cells (such as CHO, COS, HEK, HeLa, 3T3, NSO or HepG2, PER.C6) or insect cells.

[0089] In this context it is important that the terms "source cell" and "expressor cell" mean two different things. The term source cell relates to the cell that is the source of the gene encoding a given protein, e.g., a cell or collection of cells isolated from nature, e.g., from a donor.

[0090] In contrast, the term "expressing cell" shall refer to the cell actually used in the method of the present invention for expressing the immune receptor in question, so as to obtain it in large quantities and purify it for further use.

[0091] Preferably, in step g) it is ensured that each expressing cell is transfected with only one bicistronic or multicistronic expression construct. Preferably, this can be accomplished by a limiting dilution procedure well known to the skilled person.

[0092] It is also preferred to ensure that only one expressing cell is encapsulated per microreactor in step h). Preferably, this can be accomplished by titrating the number of viral particles per cell so that <<100% is transduced, for example 10% of cells or 30% of cells (limiting dilution).

[0093] Preferably, encapsulated expressing cells are provided and cultured under conditions that allow protein expression and / or cell proliferation.

[0094] In a preferred embodiment, prior to the packaging in step h), transfected cells are provided and incubated under conditions that allow protein expression. This embodiment allows the sorting out of those cells that are dysfunctional or do not express a transgene, for example, an immune receptor combined with a marker gene (fluorescent marker / surface marker).

[0095] Preferably, after step g) or h), an additional quality control step may be performed, wherein the infected cells are checked whether they are able to express functional antibodies.

[0096] According to another aspect of the present invention, there is provided a method for screening an expression cell library produced according to the above method, said method being for detecting a cell (or, respectively, its clonal progeny in a microreactor) that expresses an immune receptor specific for a given target molecule, said method comprising at least one of the following steps:

[0097] i) using a labeled target that is able to enter the microreactor and bind to an immune receptor expressed by the expressing cells contained therein, and / or

[0098] j) Detection of immune receptors expressed by expressing cells that have escaped the microreactor and are now in the supernatant combined with serial fractions of the microreactor culture medium

[0099] With regard to the latter option, established screening techniques capable of detecting immune receptors in the sense of the present invention can be used.

[0100] Regarding the former, the concentration of the immunoreceptor within the microreactor reaches peak levels faster than the concentration of the immunoreceptor in the supernatant. This time-lapse of the immunoreceptor can be exploited for screening by using a wash step to dilute the immunoreceptor concentration in the supernatant surrounding the microreactor prior to detection within the antibody-specific microreactor. Microreactors that stain positive for fluorescently labeled antigen are then sorted and kept intact for, for example, additional confirmatory screening, or destroyed to allow further growth of antigen-reactive / specific cell clones and production of monoclonal antibodies.

[0101] With regard to the latter, the supernatant surrounding the microreactor obtained after sedimentation or centrifugation of the microreactor culture can be directly tested for the presence of an immune receptor having the desired functional or other property.

[0102] In each case, each experiment will provide a positive result ("hit") if the immune receptor expressed by each expressing cell is specific for the labeled target.

[0103] Such labels for labeling the target may for example consist of radioisotopes, enzymes, luminescent entities, fluorescent entities, phosphorescent entities, metal-containing particles (e.g., gold-containing particles), X-ray dense entities, antibodies, etc. Finding a suitable label is well within the routine of the skilled person.

[0104] It should be understood that the present invention comprises three separate methods or sub-steps, which are interconnected by the same inventive concept, namely (i) a method for recovering two or more genes or gene products or cDNAs encoding immune receptors, (ii) a method for generating an expression cell library based on the recovered genes or gene products or cDNAs, and (iii) a method for screening such an expression cell library.

[0105] Each of these three methods is in its own right. However, in a preferred embodiment, it is of course contemplated that the method of the present invention may comprise sub-steps (i) and (ii), (ii) and (iii), or (i) - (iii).

[0106] According to another preferred embodiment of the present invention, the mRNA capturing moieties are beads or particles, preferably magnetic beads or particles.Preferably, the mRNA capturing moieties comprise oligo dT DNA sequences bound to their surface.

[0107] In this context, magnetic beads containing oligo dT DNA sequences are preferred. An example of this type of bead is provided by Life Technologies. Oligo (dT) 25. The use of oligo dT beads relies on base pairing between the poly A tail of messenger RNA and the oligo dT sequence bound to the bead surface, so oligo dT beads can be used to recover the entire mRNA of a given cell. After annealing, the vial is placed on a magnet to concentrate the beads and their bound mRNA on one side of the tube. The supernatant containing unwanted contaminants is discarded. This protocol can be performed in 15 minutes and does not require preparation of total RNA or any other purification steps. The oligo dT bound to the bead surface can be used to capture mRNA and serve as a primer for reverse transcriptase in first-strand cDNA synthesis.

[0108] According to another preferred embodiment of the present invention, the bicistronic or polycistronic expression vector is a 2A peptide-linked polycistronic vector, in combination with or without an IRES (Internal Ribosome Entry Site) sequence.

[0109] Polycistronic vectors linked to 2A peptides are described, for example, in Szymczak et al. (2004). However, the skilled person will readily appreciate that other suitable bicistronic or polycistronic expression vectors are also encompassed within the scope of the present invention and can be used in its context without requiring additional inventive steps.

[0110] The materials and techniques for preparing microreactors in the sense of the present invention are known to the person skilled in the art.In principle, all techniques can be used which a) produce capsules of suitable size and b) produce capsules with high monodispersity.

[0111] Furthermore, in preferred embodiments, materials can be used that a) result in capsules having the desired permeability to all or some of the reactants used in their presence, and b) result in capsules that are stable to all reaction conditions employed in their presence, and c) exhibit low or no inhibitory effects on enzymatic reactions carried out within the capsule structure. Obviously, the cells and / or the transformed and / or amplified nucleic acids should not be able to leave the capsule until lysis of the capsule.

[0112] To practice the methods of the present invention, it may be necessary to employ capsule materials that exhibit low or no inhibitory effects on enzymatic reactions, such as amplification or sequencing reactions, carried out within the capsule structure. Examples of capsule materials with suitably low inhibitory effects on amplification and sequencing reactions include those listed above. Many capsule materials allow for enclosed cell proliferation. Furthermore, it is desirable to employ capsule materials that are stable to all employed reaction conditions. Preferably, the capsule is resistant to chemical, physical, and mechanical stresses induced, for example, by cell growth, cell lysis, in vitro amplification, or DNA sequencing. Preferred capsule materials are those discussed elsewhere herein.

[0113] More preferably, the microreactor used to implement the present invention is prepared by the method for preparing single droplets as described by Serp et al. (2000). Other techniques that provide suitable results are flow focusing techniques ( Ingeniatrics Tecnologías, SL, Sevilla, Spain), Gomez-Herreros et al (2012), flow focusing nozzles incorporated into microfluidic devices as described by Martinez et al (2012), emulsion polymerization methods (One Cell Systems, Inc., USA) and jet-cutter technology as described by Prüβe et al. (1998).

[0114] Preferably, the capsules used in the present invention have a pore size that allows them to be permeated with some or all of the reactants used. In order to practice the methods of the present invention, it is advantageous to use a capsule material that is permeable to a number of reactants required, for example, for cell proliferation, removal of catabolites, amplification, labeling and / or sequencing, and to aid in purification.

[0115] According to another preferred embodiment of the present invention, each microreactor comprises a source cell, for example a B-cell or a T-cell. The number of cells in each microreactor is also referred to as "occupancy rate" (DOO). In this embodiment, single-cell RT-PCR is actually performed to recover mRNA. The specific advantage of this embodiment is that, as described above, this is a method that allows simultaneous recovery of two or more genes or gene products encoding protein subunits with two or more subunits from a cell.

[0116] However, to date, single-cell RT-PCR has not been used to recover two or more genes or gene products encoding protein subunits from one cell that is part of a cell pool, such as a library, or from a B-cell donation from a human donor, and to generate an expressing cell library based thereon, because it has not been possible to combine single-cell RT-PCR with high-throughput methods.

[0117] For this reason, single-cell RT-PCR is considered to constitute a bottleneck for recovering two or more genes or gene products encoding protein subunits having two or more subunits.

[0118] However, this preferred embodiment in which each microreactor contains one source cell does not apply to microreactors used to encapsulate expression cells.

[0119] However, the microreactor used to encapsulate the source cell or preferably one source cell may further contain so-called feeder cells, i.e. cells that do not have the potential to express the immune receptor or its mRNA. However, when lysed, these cells can deliver non-immune receptor-related mRNA that can help saturate the mRNA capture moiety.

[0120] Preferably, the microreactor comprises a material selected from the group consisting of:

[0121] Hydrogel-forming polymers, preferably poly(diallyldimethylammonium chloride), poly(ethyleneimine), polylysine, polyacrylamide and / or acrylic acid

[0122] Cellulose derivatives, preferably carboxymethylcellulose and cellulose esters, and / or

[0123] Polysaccharides, preferably agarose, alginate, carrageenan, pectinate and / or chitosan

[0124] These types of microreactors are also colloquially referred to herein as "nanoliter reactors" (NLRs), although their volumes are not necessarily in the nanoliter range, but can be higher or lower.

[0125] In a particularly preferred embodiment, the microreactor comprises an alginate hydrogel cross-linked by divalent or trivalent metal cations. Spherical structures such as enzymes and antibodies and short-chain DNA (primers) easily penetrate the microreactor comprising alginate. Large linear DNA molecules such as PCR products penetrate at a much lower rate. Therefore, the time of the PCR product obtained from the single cell in the microreactor is fixed. In addition, the microreactor comprising alginate can be processed by high-throughput analysis and flow cytometry sorting. More preferably, the alginate capsule material comprises calcium alginate, barium alginate and / or strontium alginate. It has been surprisingly found that barium alginate and strontium alginate microcapsules have a significantly reduced inhibitory effect on the polymerase required for PCR reaction. Therefore, barium alginate and strontium alginate can allow much better amplification than calcium alginate.

[0126] The process of forming alginate beads and encapsulating cells therein involves, for example, using a mixture of alginate and cells to be encapsulated, which is moved through a polymer-tube micronozzle. The bead diameter can be arbitrarily adjusted by the nozzle geometry and the rotation frequency of 5–28 Hz. The beads are emitted from the micronozzle through an air gap into a curing agent (e.g., CaCl2 solution) contained in a standard laboratory tube.

[0127] According to another preferred embodiment, the microreactors are formed as aqueous droplets in a water / oil emulsion.These types of microreactors are also colloquially referred to herein as "emulsion droplets".

[0128] Such microreactors can be manufactured using, for example, the QX100 supplied by Biorad. TM Droplet Digital TM The PCR system was created. In the device, the sample and droplet-generating oil are loaded into an eight-channel droplet generator cartridge. A vacuum is then applied to the droplet wells, pulling the sample and oil through a flow-focusing nozzle, where monodisperse droplets are formed.

[0129] The above discussion refers to (i) microreactors used to encapsulate source cells or to recover two or more genes or gene products or cDNAs encoding immune receptors, and (ii) those used to encapsulate expression cells, i.e., in both cases, the microreactors can be formed as aqueous droplets in a water / oil emulsion or from hydrogel-forming polymers, cellulose derivatives and / or polysaccharides, such as agarose, alginates, carrageenans, pectinates and / or chitosan.

[0130] However, in a preferred embodiment, the microreactors provided for (i) are formed as aqueous droplets in a water / oil emulsion, whereas the microreactors provided for (ii) are those derived from hydrogel-forming polymers, cellulose derivatives and / or polysaccharides such as agarose, alginates, carrageenans, pectinates and / or chitosans.

[0131] According to another preferred embodiment of the present invention, the microreactor has a diameter between ≧10 μm and ≦1000 μm.

[0132] According to another preferred embodiment of the present invention, the microreactor has a volume between ≥ 0.52 pl and ≤ 523 nl.

[0133] More preferably, the microreactor used for (i) has a volume between ≥0.5 and ≤5 nl, and the microreactor used for (ii) has a volume between ≥25 and ≤150 nl.

[0134] However, in a preferred embodiment, the microreactors for (i) are formed as aqueous droplets in a water / oil emulsion, while the microreactors for (ii) are those derived from hydrogel-forming polymers, cellulose derivatives and / or polysaccharides such as agarose, alginates, carrageenans, pectinates and / or chitosan. However, preferably, the microreactors used to encapsulate the source cells may be smaller than those used to encapsulate the expression cells.

[0135] The following table gives an overview of the different subtypes of microreactors used in the context of the present invention:

[0136]

[0137]

[0138] Microreactors of the type disclosed herein

[0139] According to another preferred embodiment of the present invention, the microreactor has a spherical shape.

[0140] According to another preferred embodiment of the present invention, the source cell is from a collection of cell members comprising gene products of different immune receptors.Preferably, the source cell is a mammalian cell selected from immature or mature B-cells or T-cells.

[0141] In this embodiment, the cell collection is, for example, a collection of mature B-cells, such as memory B-cells. Such a collection can be a collection of cells compiled from B-cell donations from different donors, as well as a collection of all B-cells from a given donor, a fraction thereof, or at least itself comprising the antibodyome, i.e., the complete set of antibodies encoded by the entire mature B-cells of the donor, or a fraction thereof.

[0142] Immature or mature B-cells are B-cell types in which VDJ rearrangement and VJ rearrangement have occurred. This means that these cells have randomly combined variable, linked, and different gene segments in such a way as to obtain unique rearranged genes encoding unique heavy chains (VDJ) and unique light chains (VJ).

[0143] Preferably, B-cell is plasma B- or memory B-cell. Plasma B-cell (also referred to as plasma cell (plasmacell), plasma cell (plasmocyte) and effector B-cell) is the large B-cell that has been exposed to antigen and produces and secretes a large amount of antibodies, and it is by combining microorganism and making them easier for phagocyte to target to assist destruction microorganism and assist activation complement system. They are sometimes referred to as antibody factory. The electron micrograph of these cells shows a large amount of rough endoplasmic reticulum, is responsible for synthesizing antibody in the cytoplasm of cell. When eliminating the initiator of inducing immune response, cell apoptosis occurs. This is because stop being continuously exposed to the various colony stimulating factors that need to survive and occur.

[0144] Memory B cells are formed from activated B cells specific for an antigen encountered in the primary immune response. These cells can survive for a long time and can respond quickly after a second exposure to the same antigen.

[0145] T-cells or T lymphocytes are a type of lymphocyte that plays a central role in cell-mediated immunity. They can be distinguished from other lymphocytes such as B cells by the presence of T-cell receptors (TCRs) on the cell surface. There are different types of T-cells, i.e., helper, cytotoxic, memory, regulatory and natural killer T (NKT) cells.

[0146] Like B cells, during thymocyte development, T-cells undergo essentially the same sequence of ordered recombination events as described for immunoglobulins. D to J recombination occurs first in the β chain of the TCR. This process can include the transfer of D β 1 gene fragment connected to 6 J β 1 fragment or D β 2 gene fragments connected to 7 J β 2 clips. DJ regrouped and became V β to D β J β Rearrange (as above). β -D β -J β All gene segments between the gene segments were deleted and primary transcripts were synthesized, which incorporated the constant domain genes (V β -D β -J β -C β ). mRNA transcript splices out any spacer sequences and allows TCR C β The α chain of the TCR is rearranged after the β chain and is similar to the V to J rearrangement described for the Ig light chain (see above). The assembly of the β- and α-chains results in the formation of the αβ-TCR expressed on most T cells.

[0147] The specificity of T-cells is MHC restricted, so TCR mainly recognizes linear peptide antigens processed intracellularly in the context of MHC molecules. This is in sharp contrast to the recognition pattern of B-cells, which recognize the three-dimensional target structure of their cognate antigens through soluble or membrane antibodies without any participation of MHC molecules, and do not need this to be compounded with MHC. Therefore, T and B-cells represent two fundamentally different recognition patterns of the specific immune system. Antibodies (TCR-like antibodies) that show the MHC restriction pattern of antigen recognition do not appear to exist naturally, but can be induced by hyperimmunity in laboratory animals. However, it is difficult to produce such specificity to various peptide-MHC complexes, and have the specificity and affinity required.

[0148] According to another preferred embodiment of the present invention, the source cells can be collected from one or more donors. Preferably, such donors are human donors. Similarly, such donors can be from rabbits, mice, pigs, rats, cattle and non-human primates.

[0149] More preferably, such donors are donors who have shown reduced or attenuated symptoms with respect to a given disease, donors who have demonstrated a delay in the progression of the disease, or donors who have become tolerant to the disease. Such donors may have an increased likelihood of containing source cells, such as B memory cells, which encode therapeutic proteins, such as antibodies, which may have a therapeutic, protective, or delaying effect with respect to the disease, for example, because they are antagonists of cancer-mediating cytokines, because they bind to a given pathogen, or because they bind to receptors involved in the immune response.

[0150] According to another preferred embodiment of the present invention, the two or more genes or gene products encoding protein subunits are immunoglobulin (Ig) heavy chain genes (VDJ rearranged) and immunoglobulin (Ig) light chain genes (VJ rearranged). These genes are also called V H and V L , or κ and λ genes.

[0151] Alternatively, the two or more genes or gene products encoding protein subunits are a TCR alpha chain gene (rearranged) and a TCR beta chain gene (rearranged).

[0152] According to another preferred embodiment of the present invention, the method further comprises the step of inserting cDNA encoding Ig constant H and / or Ig constant L subdomain into the PCR product.

[0153] Alternatively, the method further comprises the step of inserting cDNA encoding TCRα and TCRβ chains into the PCR product.

[0154] Furthermore, the immunoreceptors are preferably used for the treatment or diagnosis of a disease. Preferably, the disease is a human or animal disease, more preferably a neoplastic disease, a neurodegenerative disease, an infectious disease, an immune-mediated disease and / or a cardiovascular disease.

[0155] Neoplastic diseases encompass malignant diseases such as tumors, cancer, etc. Immune-mediated diseases encompass autoimmune diseases. Neurodegenerative diseases encompass diseases that affect the integrity of the central and / or peripheral nervous system. Infectious diseases encompass diseases caused by parasites, protozoa, prokaryotes, viruses, prions, and fungi. Immune-mediated diseases encompass diseases characterized by dysfunction of the immune system, for example, because the immune system is overactive or underactive. Cardiovascular diseases encompass any disease that affects the cardiovascular system, primarily heart disease, vascular diseases of the brain and kidneys, and peripheral arterial disease.

[0156] Brief description of the embodiments and drawings

[0157] Additional details, characteristics, features and advantages of the objects of the present invention are disclosed in the dependent claims and the following description of the various figures and examples, which show preferred embodiments of the invention in an illustrative manner. However, these figures should not be understood as limiting the scope of the invention.

[0158] experiment

[0159] Recombinant display of the complete antibody repertoire (antibodyome) from a human individual or from an animal species.

[0160] Human memory B-cells are used as starting material for recombinant display of the human antibodyome. An individual's memory B-cell pool retains antibody specificity and, possibly, the frequency of antibodies produced during previous encounters with antigen (McHeyzer-Williams and Ahmed (1999), Bernasconi et al. (2002)).

[0161] Alternatively, all types of B-cells of human or non-human origin such as plasma cells, pre-plasma cells, B1 B-cells and immature B-cells or hybridoma cells can be processed by this technology.

[0162] 1. Capture of Antibodyome mRNA by NLR

[0163] 1.1 Human Memory B Cells

[0164] Memory B-cells were isolated from peripheral blood mononuclear cells by cell sorting (MoFlo XDP cell sorter, Beckman-Coulter, Nyon, Switzerland) using the following sorting criteria: expression of the pan B-cell marker CD22, combined with the absence of surface IgM and IgD, markers of immature B-cells. Other combinations of surface markers such as CD19 and CD27, with or without surface expressed IgG, can also be used.

[0165] Co-encapsulation of memory B cells and mRNA capture matrix beads in a 1.2 nanoliter reactor

[0166] 100,000 CD22-positive, IgM-, IgD-, gA-negative B cells were then encapsulated in NLR with mRNA-capturing Dynabeads. 20,000 surrogate B cells expressing human IgG were emulsified in emulsions with mRNA-capturing Dynabeads using a QX100 droplet generator.

[0167] 1.2.1 Co-encapsulation of Antibody-Producing Cells and mRNA Capture Matrix Beads in Nanoliter Reactors

[0168] Antibody-producing cells were packaged with 5 oligo-dT-doted Dynabeads at an occupancy of 1 (DOO) (1 B-cell and 5-50 Dynabeads per NLR).

[0169] Resuspend 20,000 antibody-producing cells in 1.6 ml of coating buffer and add 0.5-5x10 6 mRNA capture matrix beads (Dynabeads). 6.4 ml of sterile filtered 2.5% alginate solution (Pronova) was added and mixed gently. The alginate-cell-magnetic bead suspension was processed at 700 Hz using a laminar spray disruptor through a 150 μm diameter nozzle.

[0170] Collect droplets in a continuously stirred beaker containing 100 ml of sclerosing solution. Allow the alginate to stabilize for 15 minutes to form NLRs. Recover the NLRs from the sclerosing solution by sieving and wash twice in 80 ml of coating solution. Collect the NLRs in coating solution at 4°C / RT and perform large particle sorting to eliminate cell-free NLRs and those containing more than one cell.

[0171] 1.3 Cell lysis and mRNA capture on Dynabeads within NLR

[0172] The NLR suspension was allowed to settle for 5 min and the supernatant was aspirated. The obtained NLR was gently resuspended in an equal volume of freshly prepared lysis buffer and incubated at RT, 20 RPM for 30 min to allow complete cell lysis.

[0173] 1.4 NLR Dissolution, Washing and Retention of mRNA Capture Matrix

[0174] The cleavage reaction was filtered, the NLR was retained, and the NLR was washed twice with coating buffer. The washed NLR was solubilized by treatment with EDTA solution and the oligo dT beads were harvested using a magnetic device provided by the kit manufacturer.

[0175] Typically 5-30% of the Dynabeads contained mRNA on their surface.

[0176] 2. Capturing Antibodyome mRNA by Emulsion Droplets

[0177] In another preferred embodiment of the present invention, a water-in-oil emulsion is used to create the microreactor.The water-in-oil emulsion is formed by mixing an aqueous phase with an oil phase in the presence of a suitable surfactant.

[0178] The oil phase may be composed of mineral oil, silicone oil, Tegosoft DEC, engineered fluids such as Novec 7500, FC-40, FC-43, FC-70 or other common fluorinated oils, or any mixture thereof.

[0179] As surfactants, detergents such as Triton X-100, Nonidet P-40 (NP-40), Tween 80, Tween 40, Tween 20, ABIL EM 90, ABIL WE 09, sodium lauryl sulfate or lithium lauryl sulfate, or fluorinated detergents such as Krytox or other perflouropolyether (PFPE)-based surfactants or any mixtures thereof can be used.

[0180] Several additives can be added to the aqueous phase of the water-in-oil emulsion as microreactor stabilizers and PCR reaction enhancers, such as 2-pyrrolidone, polyvinylpyrrolidone, betaine, DMSO, PEG8000, Pluronic F-68, glycerol, BSA and / or gelatin.

[0181] Water-in-oil emulsions can be prepared in several ways. In one embodiment, (i) the droplets can be formed by vortexing the water-surfactant-oil mixture, with or without the addition of one or more glass or steel beads. The beads have a diameter of 5 mm, 1 mm, or, preferably, an average of 400 nm. The mixing frequency can be controlled by using a TissueLyser mixer mill instead of vortexing, with a selected setting of 15-17 Hz.

[0182] In another embodiment (ii), the PCR product can be prepared by using a Bio-Rad (QX100 TM Droplet Digital TM PCR) or Raindance( The microfluidic droplet generator provided by Digital PCR was used to prepare water-in-oil emulsions. Here, the microfluidic chip was used to generate water-in-oil microreactors with uniform sizes of 1 nl and 1 pl, respectively.

[0183] In the case of water-in-oil emulsions, recovery of mRNA capture moieties, cDNA, or PCR products from the microreactor can be accomplished by adding an organic solvent. This organic solvent can be ethanol, 1-propanol, isopropanol, butanol, hexanol, chloroform, acetonitrile, any mixture thereof, and / or a mixture with water. The method is described in Diehl et al (2006).

[0184] 2.1. Cell Encapsulation, Cell Lysis, mRNA Capture, and Reverse Transcription

[0185] Antibody-expressing cells were harvested and diluted to 2×10 in cell lysis buffer (50 mM Tris-HCl pH 8.3, 50 mM KCl, 50 mM LiCl, 5 mM EDTA, 10 mM DTT). 6 cells / ml. Oligo-dT Dynabeads (Life Technologies, catalog number 61006) were washed once in cell lysis buffer, beads were collected on a dynal magnet (Life Technologies, catalog number 12321D) and the supernatant was discarded. Cells were added to the magnetic beads and mixed carefully, with a final amount of 15,000 cells and 180,000 beads per 20 μl. The mixture was kept on ice and transferred to a QX100 droplet generator (Bio-Rad). Directly on DG8 TM Before the emulsion formation in the cartridge (Bio-Rad) was started, proteinase K (Applichem, catalog number A4392) was added to the cell / dynabeads mixture to a final concentration of 0.2 mg / ml. Droplets were generated in parallel for 8 samples of 20 μl according to the manufacturer's instructions. As the emulsifying oil, Pico-SurfTM 2 (2% in Novec 7500) (Dolomite Microfluidics, catalog number 3200281). 8 times 40 μl of the emulsion were transferred from the cartridge to two separate 1.5 ml reaction tubes by pipetting (resulting in 2 samples of 160 μl emulsion). The encapsulated cells (see Figure 6 ) cracking. After this, the sample is placed at room temperature, and allows slow cooling. This 15-minute room temperature incubation step promotes the mRNA released by the cells to be bound to oligo-dT dynabeads. In the next step, by adding 1ml isopropanol to the emulsion and vortexing to break the oil phase, thereby reclaiming the oligo-dT beads with the mRNA adhered to. The clarified solution is placed on a spin filter (Thermo Scientific, catalog number (Cat. No.) F2517-5) and centrifuged for 30 seconds at 3500rcf. Abandon the flow-through liquid, and the beads collected are washed once in 70% ethanol. Oligo-dT dynabeads are resuspended in the buffer B of the mRNA purification kit (Life Technologies, catalog number (Cat. No.) 61006) of 300 μl, and are transferred to fresh 1.5ml reaction tubes. Beads are collected on a magnet, and the 1x DNase buffer solution is replaced with 100 μl of buffer. 300 μ l RNase I (NEB, catalog number (Cat. No.) M0303S) is added subsequently, and the mixture is incubated 10min at 37 ℃ to digest the DNA that is bound to the oligo-dT beads. The reaction is terminated by adding the 0.5M EDTA of 1 μ l. The beads are washed twice with the buffer B of the mRNA purification kit (Life Technologies, catalog number (Cat. No.) 61006) of 300 μ l, and washed once with the 1x RT buffer of the maximum RT reverse transcriptase (Life Technologies, catalog number (Cat. No.) EP0742) of 300 μ l. Supernatant is discarded, and the oligo-dT beads covered by mRNA are resuspended in the reverse transcriptase mixture comprising 0.5mM dNTPs, 1x RT buffer, 20U RiboLock RNase inhibitor (ThermoScientific, catalog number (Cat. No.) EO0381) and 200U maximum reverse transcriptase (Life Technologies, catalog number (Cat. No.) EP0742). The reaction is incubated 1 hour at 55 ℃. The reaction was then terminated by raising the temperature to 85°C for 5 minutes. The oligo-dT beads with covalently attached cDNA were recovered using a magnet. The supernatant was discarded and the beads were resuspended in 20 mM Tris pH 8.0 and stored at 4°C until further processing.

[0186] 2.2. Overlap extension PCR in emulsion

[0187] The cDNA beads prepared as described in Example 2.1 were used as templates for overlap extension PCR to connect the DNA sequences encoding antibody VH and VL. In order to ensure the correct connection of the sequences belonging to one antibody and to avoid crosstalk between sequences, this PCR reaction was carried out in a single bead emulsion. For this purpose, beads were diluted in a PCR reaction mixture comprising 0.25mM dNTPs, 0.25μM of each primer (VH4, Vk2, CH, Ck1), 0.25% w / v BSA, 2% w / v Pluronic F-68, 1x buffer A and 1U KAPA Robust Hotstart Polymerase (Kapa Biosystems, catalog number KK5515). PCR was performed using a QX100 droplet generator and Pico-Surf as described in Example 2.1. TM The beads were emulsified with 1% emulsifying oil (Dolomite Microfluidics, catalog number 3200211). The emulsion was transferred to a 0.2 ml PCR tube and the PCR reaction was performed in a PCR thermal cycler (Peqlab, peqSTAR 2x thermal cycler, catalog number 95-07002) using the following temperature cycle:

[0188] 95℃3min

[0189] ‐5 cycles

[0190] o 95℃15sec (gradual change 1℃ / sec)

[0191] o 62℃15sec (gradual change 1℃ / sec)

[0192] o 72℃15sec (gradient 1℃ / sec)

[0193] ‐30 cycles

[0194] o 95℃15sec (gradual change 0.5℃ / sec)

[0195] o 57℃15sec (gradual change 0.5℃ / sec)

[0196] o 72℃15sec (gradual change 0.5℃ / sec)

[0197] ‐1 cycle

[0198] o 72℃10'

[0199] o 8℃∞

[0200] After the PCR reaction is complete, the emulsion is broken by adding 20 μl TE buffer and 70 μl chloroform and vortexing. The sample is clarified in a centrifugal step of 2 minutes at 14'000 rcf, and the upper phase of each sample is moved to a new tube. DNA loading buffer is added and the samples are analyzed in a 1.2% agarose gel. The band at the size of the connection product of about 1100 bp is visible (compare Figure 6 , first PCR). The band was excised and the DNA was purified from the gel using the Qiagen MinElute Gel Extraction Kit (Cat. No. 28604) according to the manufacturer's instructions.

[0201] Nested PCR

[0202] The purified ligated PCR product obtained in Example 2.2 was used as a template for a PCR reaction using a second set of antibody VH and VL specific primers. The PCR reaction mixture contained the following components in a 25 μl reaction volume: 2 μl template DNA, 0.2 mM dNTPs, 1× buffer A, 0.2 μM of each JH primer (JH1, JH2, JH3, JH4), 0.4 μM Ck2, 0.25% w / v BSA, 1× buffer A, and 1 U KAPA Robust Hotstart Polymerase (Kapa Biosystems, catalog number KK5515). The reaction was performed using the cycling program described in Example 2. The PCR fragment obtained was analyzed by 1.2% agarose gel, and only a single band was observed at the expected size of 1070 bp (see Table 1). Figure 6 , second PCR). This PCR fragment represents the linked IgH+IgL antibody fragment ready for cloning.

[0203] Primers used for oePCR according to Meijer et al. (2006)

[0204]

[0205] 3. Ligation and Amplification of IgVH+IgVL from NLR-Encapsulated Single B Cells

[0206] In this step, single oligodT-Dynabeads with immunoglobulin heavy and light chain mRNA of the single B-cell captured separately are used to synthesize cDNA as template for subsequent PCR reaction. This cDNA remains covalently linked to the beads, so that the correct immunoglobulin heavy and light chain pairing as present in the single cell is maintained on the oligodT Dynabeads. In a subsequent step, the oligodT Dynabeads are emulsified and used for immunoglobulin (H+L)-overlap extension PCR (Ig-oePCR) to physically connect the immunoglobulin heavy and light chains in a continuous polynucleotide chain.

[0207] 3.1 Emulsion PCR on a Single Matrix Bead Combined with PCR Primers and Polymerase

[0208] According to Droplet Digital TM Emulsion PCR using cDNA-conjugated Dynabeads was performed using a PCR system setup. Briefly, cDNA-conjugated Dynabeads and primer mix were mixed with the dNTPs, buffer, and PCR enzyme provided by the kit and prepared for PCR on a QX200 according to the manufacturer's instructions. TM / QX100 TM Droplet Digital TM Droplet generation is performed in a PCR system. The sample is used to generate emulsion droplets, which are then subjected to emulsion PCR. TM The amplification products were recovered after removal of the oil and dissolution of the droplets in tris-EDTA and chloroform as described in the PCR system.

[0209] 3.2PCR Protocol A

[0210] Amplification of linked immunoglobulin variable heavy and light chain regions from oligo dT-Dynabead-bound cDNA was performed by emulsion PCR using an established PCR primer system (Meijer et al. 2006) in a two-step PCR protocol, resulting in head-to-head assembly of the two immunoglobulin chains connected by a linker sequence. This linker sequence contains restriction sites for subsequent insertion of a bidirectional promoter.

[0211] 3.3PCR Protocol B

[0212] Alternatively, for the linkage of immunoglobulin heavy and light chains, PCR primers were used that resulted in a "tail-to-head" orientation of the V-heavy and V-light chain regions. Immunoglobulin-specific primers were derived from Wardemann et al. (2003), the contents of which are expressly incorporated herein. A schematic overview of this approach is provided in Figure 2 Shown in. Figure 3An example of such an Ig-comparable PCR is shown.

[0213] 4. Generation of Antibody Expression Library

[0214] The PCR fragments of the joined IgH and IgL cassettes were cloned in bulk into a recipient plasmid vector using appropriate restriction sites (Notl / Xhol for PCR protocol A and BSSHII and BsiWI for PCR protocol B). Figure 4 The conversion of this receptor into a vector providing all the elements required for the expression of full-length immunoglobulin heavy and light chains is described in .

[0215] From this acceptor plasmid vector, the immunoglobulin expression cassette is transferred to a lentivector transfer vector via the restriction sites PmeI and PacI. This vector provides a mammalian promoter (CMV) and an internal ribosome entry site, followed by the marker gene EGFP. The resulting tricistronic antibody expression plasmid is used as a lentivector transfer vector to produce infectious lentivector particles, which are used to transfect mammalian cells, converting them into antibody-expressing cells.

[0216] Restriction-free and ligation-reduced cloning techniques can also be used for library cloning. These avoid the dangers associated with restriction, which can lead to cleavage of the gene construct at undesirable locations, resulting in the expression of truncated proteins. (See, for example, Gibson DG, Young L, Chuang RY, Venter JC, Hutchison CA 3rd, Smith HO. (2009). "Enzymatic assembly of DNA molecules up to several hundred kilobases". Nature Methods 6(5):343–345.) doi : 10.1038 / nmeth.1318 . PMID19363495 .

[0217] 5. Expression

[0218] 5.1 Generation of Lentivitor Particles for Transduction of Expressing Cells

[0219] Lentivector particles were produced using the so-called third generation lentivector packaging system according to the method described in Dull et al. (1998).

[0220] 5.2 Transduction of expressing cells

[0221] Standard CHO K1 cells were transduced with lentivectors as described by Dull et al. (1998). To ensure that only one lentivector particle was transduced per CHO cell, the multiplicity of infection was adjusted to 0.5 lentivector particles / cell. This resulted in transfection of ≥10% of the cells, as monitored using the marker gene GFP.

[0222] 5.3 Encapsulation of single expressing cells in NLRs / highly parallel clonal expansion

[0223] CHO cells transfected with a tricistronic antibody expression plasmid (positively selected using a flow cytometer for marker gene (GFP) expression) were encapsulated in the NLR at an occupancy rate (DOO) of 0.5. The NLR was cultured in standard culture medium, resulting in cell proliferation within the NLR.

[0224] 4.4 Occupancy Control and Growth Coordination

[0225] 12hs after encapsulation, NLR cultures were subjected to Biosorter large particle sorting to positively select all NLRs containing single viable cells that were also positive for GFP fluorescence. At this point, unoccupied empty NLRs and those containing many cells that may be caused by abnormal growth rates were removed (e.g., cell numbers exceeded the average number of other NLRs by 1.5 times).

[0226] 4.5 Parallel cloning and culture of recombinant antibody-producing cells and identification of screened monoclonal antibodies

[0227] NLRs containing single antibody-producing cells are cultured in standard culture medium, and immunoglobulins produced by growing cell clones can be detected (i) within the NLR, e.g., using fluorescently labeled probe antigens, and (ii) in the culture supernatant surrounding the NLR, e.g., using standard methods such as Western blot, ELISA, immunohistochemistry, or functional assays.

[0228] The immunoglobulin concentrations within the NLR reach their peak levels faster than in the supernatant. This time-lapse of the immunoglobulins is exploited for screening, with a wash step used to dilute the immunoglobulin concentration in the supernatant surrounding the NLR before antibody-specific detection within the NLR. NLRs that stain positive for fluorescently labeled antigens are then sorted and kept intact for, for example, additional confirmatory screening, or destroyed to allow further growth of antigen-reactive / specific cell clones and production of monoclonal antibodies.

[0229] As an alternative to antibody-specific NLR detection, the presence of the antibody of interest is measured in the supernatant of expressing cells. This approach allows for the determination of more complex properties of the protein of interest, such as biological reactivity, staining of tissue sections, etc.

[0230] To this end, the supernatant surrounding the NLR obtained after sedimentation or centrifugation of the NLR culture is directly tested for the presence of antibodies having the desired functional or other properties.

[0231] When the series classification of fractions and retesting are carried out, the single NLR of the cell that comprises the antibody clone of being paid close attention to is identified.For this classification, the standard cell culture receptor that is reduced to microtiter form is used.After the incubation period of up to 24h, the supernatant is harvested.In the final step, the NLR that comprises monoclonal production cell is obtained by being deposited into microtiter template (96-384 hole form) and harvesting supernatant, and is tested after the extended incubation period of 72h.

[0232] 5. Retrieve Clonal Cell Lines Expressing the Antibody of Interest and Screen the Library

[0233] AB2 expressing cells representing the antibody of interest were encapsulated as single cells in NLRs and 30 NLRs were added (spiked) to a 210,000 NLR culture containing cells expressing an unrelated antibody. This large number of NLR cultures representing the expression cell library was cultured in complete medium (see Figure 6 ).

[0234] Subsequently, 210'030 NLRs were fractionated by transferring the culture into 96 wells of a microtiter plate (first fractionation of the culture). This culture was maintained for 3 days to allow cell growth, antibody expression and secretion of the antibody into the supernatant outside the NLRs.

[0235] On day 4, 50 μl of culture supernatant from each well of the 96-well plate was screened by ELISA for the presence of AB2-antigen-specific antibodies. Positive cultures were identified as shown in Figure E2. An exemplary positive NLR culture (Bh5) was selected for clonal identification, and individual NLRs from culture Bh5 were plated in microtiter plates and then screened by a second ELISA 3 days later.

[0236] This led to the identification of a single NLR in well E4, representing a clonal cell line expressing the AB2-antigen-specific mAb H5 / E4 (see Figure 7 B).

[0237] 6. List of equipment and materials used

[0238] Biosorter large particle flow cytometer, Union Biometrica, Geel, Belgium

[0239] Nisco laminar spray rupture encapsulator, Nisco Engineering AG, Zurich, Switzerland

[0240] QX100 / 200 droplet generator, Bio-Rad, Cressier, Switzerland

[0241] ·Alginate,Pronova,Norway

[0242] ·Dynabeads mRNA DIRECT Micro Kit; Life Technologies, Basel, Switzerland

[0243] Packaging buffer: 0.9% NaCl (w / v); 2.2 mM HEPES pH 7.4

[0244] Packaging buffer: (0.9% NaCl (w / v); 2.2 mM HEPES pH 7.4)

[0245] Hardening solution: 100 mM CaCl2, 13 mM HEPES pH 7.4

[0246] NLR lysis reagent: 100mM EDTA

[0247] Cell lysis buffer / NLR (100 mM Tris-HCl, pH 7.5; 500 mM LiCl; 5 mM dithiothreitol; 0.1% lauroylsarcosine; 0.1% Tween 20; 0.1% deoxycholate)

[0248] Immunoglobulin-specific SmartFlare RNA detection probes, Millipore, Zug, Switzerland

[0249] ·Maxima RT,Thermo Scientific,Reinach,Switzerland

[0250] oePCR primers: according to Meijers et al. (2006) or Wardemann, et al. (2003), Microsynth, Balgach, Switzerland.

[0251] 5-Propargylamino-dCTP-Cy5, Jena Bioscience GmbH Jena, Germany

[0252] ·dNTPs, Thermo Scientific, Reinach, Switzerland.

[0253] ·ddPCR supermix,Bio Rad,Cressier Switzerland

[0254] Droplet generator oil, Bio Rad, Cressier, Switzerland

[0255] Molecular cloning in plasmid vectors according to standard methods

[0256] Emulsion cell lysis buffer: 50 mM Tris-HCl pH 8.3, 50 mM KCl, 50 mM LiCl, 5 mM EDTA, 10 mM DTT, 0.2 mg / ml proteinase K

[0257] RiboLock RNase Inhibitor #EO0381, Thermo Scientific, Fischer, Reinach, Switzerland

[0258] KAPA Robust Hotstart DNA Polymerase, KAPA Biosystems, KE5506, Axon lab, Baden, Switzerland.

[0259] ·dNTPs,NEB,Bioconcept,Allschwil,Switzerland

[0260] 10% w / v Pluronic F68#A1288,0100 in water, Applichem, Axon lab Baden, Switzerland.

[0261] ·Pico-Surf 1, 2% in Novec 7500 (#3200211, Lot 211014, Dolomite, ValveTechnology AG, Guettingen, Switzerland

[0262] Pico-Surf 2, 2% in Novec 7500 (#3100281, Lot 091014, Dolomite)

[0263] ·peqSTAR 2x Thermocycler,Peqlab,#95-07002

[0264] Agarose, ultrapure, Invitrogen #15510-027

[0265] peqGREEN dye, Peqlab #37-5010, used at 1:20,000

[0266] ·1kb DNA Ladder,NEB,Bioconcept,Allschwil,Switzerland#N3232S

[0267] CHO-K1 culture medium: Ham's F12 containing 2 mM glutamine and 10% FBS, Invitrogen, Zug, Switzerland.

[0268] Peptide antigens for ELISA (AB2-antigen protein sequence: stgdadgpggpgipdgpggn; irrelevant control peptide protein sequence: lpttmnyplwsqsyedssnq) were purchased in unpurified 1 mg scale from Peptides & Elephants GmbH, Potsdam, Germany.

[0269] ELISA plate: EIA / RIA plate, 96-well half-area plate, flat bottom (Costar, Corning)

[0270] Coating buffer: 15mM Na2CO3, 30mM NaHCO3, pH 9.6

[0271] Wash buffer: PBS with 0.05% Tween

[0272] Blocking solution: 2% BSA in PBS

[0273] Secondary antibody: goat α-human IgG Fc-specific (Jackson Immuno, #109-035-098), diluted 1:4000 in 0.5% BSA / PBS

[0274] Detection solution: TMB (Sigma, #T2285) diluted 1:20 in 30 mM citric acid, pH 4.1 (Sigma, #C2402)

[0275] 1M H2SO4 (AppliChem, #A2699) Description of the drawings:

[0276] Figure 1 :Micrograph of co-encapsulation in microreactor

[0277] Single cell (C, here showing a surrogate B-cell expressing an antibody and the marker gene GFP for better visibility) and a microreactor (also referred to herein as a "nanoliter reactor" or "NLR," although these reactors can also provide picoliter volumes) of the mRNA capture matrix Dynabeads (DB). Surrogate B cells were generated by stably transducing CHO-K1 cells with a lentivector containing a weakened bicistronic human IgG expression cassette, resulting in low IgG expression levels to match Ig-expression in the original human memory B cells. Attenuation was achieved by placing the bicistronic antibody expression cassette after the stop codon of the CMV-promoter-EGFP cassette. As used herein, surrogate B cells faithfully reflect the behavior of B cells or T cells.

[0278] Figure 2 : Schematic diagram of immunoglobulin v-region PCR strategy

[0279] First PCR: Overlap extension PCR (oePCR) was used to amplify and join immunoglobulin variable heavy and light chains in a "tail to head" orientation of the V-heavy and V-light chain regions. The linker primers used for OE PCR had the following configuration.

[0280] Ig-variable heavy chain: linker primer 3'SalI JH:tattcgcactgcgcggcGTCGACgc- (JH family-specific sequence)

[0281] Ig-variable kappa light chain: linker primer 5'XbaI Vk:gccgcgcagtgcgaataTCTAGAtgt-(FW1-V-κ family-specific sequence), linker primer 5'XbaI Vl:gccgcgcagtgcgaataTCTAGAtgt-(FW1-V-λ family-specific sequence).

[0282] The additional primers used were 5'L(SP)-VH(1-6) primer, and 3'Cκ543 and 3'Cλ. Capital letters indicate restriction sites for insertion of the polynucleotide cassette providing the constant portion of IgH, cleavage sites for subsequent protease cleavage, and signal peptides for secretion of Igκ / λ in subsequent cloning steps (see below). Lowercase letters indicate linker sequences used for overlap extension PCR to connect heavy and light chain constructs.

[0283] Second PCR: Nested PCR (nPCR) was performed for further amplification by primers and to insert restriction sites into the PCR product in order to facilitate cloning in the expression vector.

[0284] According to this configuration a 5' primer containing a BSSHII restriction site (in uppercase letters) was used.

[0285] 5' primer BSSHII VH-FW1: attttttttGCGCGCtgt-(FW1 -V-heavy chain family specific sequence); 3' primer: 3' BsiWI Jκ-primer as disclosed in Wardemann et al. (2003) was used.

[0286] Figure 3 : Amplification of linked immunoglobulin heavy and light chains from encapsulated (single) antibody-expressing cells.

[0287] A two-step PCR protocol was used to amplify variable heavy and light chains derived from single cells via solid matrix-bound cDNA (oligo dT Dynabeads).

[0288] (A) First PCR amplification of the heavy and light chain variable regions followed by overlap extension in a single tube / one-step reaction on oligo dT Dynabeads-bound cDNA (lane 2). As a control, the same procedure was performed using cells not expressing the antibody (lane 1).

[0289] (B) Second (nested) PCR on first-round PCR products shows the presence of linked immunoglobulin heavy and light chains derived from antibody-expressing cells (lane 2) but not from control cells (lane 1).

[0290] Figure 4 : Schematic representation of the cloning steps to generate the tricistronic antibody expression plasmid.

[0291] I. Insertion of the ligated IgVH+IgVL PCR product into a shuttle vector providing immunoglobulin signal peptide and Igκ / λ constant regions.

[0292] II. Insertion of a polynucleotide cassette providing the constant part of IgH, a cleavage site for subsequent protease cleavage, and a signal peptide for secretion of Igκ / λ by molecular cloning.

[0293] III. The resulting bicistronic expression cassette was shuttled into a Lentivector transfer vector by molecular cloning to obtain the final tricistronic expression vector used to produce Lentivector particles.

[0294] Figure 5 : Clonal expansion of expressing cells and monitoring of antibody production in nanoreactors.

[0295] A) Clonal cell clusters generated from a single CHO expressing cell after 8 days of encapsulation in a nanoliter reactor (NLR). Cells were transformed with lentivector particles encoding a tricistronic antibody-EGFP-expression cassette before encapsulation.

[0296] B) Antibody production (intact IgG) by a clonal cell pellet (clone AB2). Western blot of Prot G-purified antibody recovered from NLR internal fluid. PAGE run under reducing conditions shows expression of Ig-heavy and Ig-light chains.

[0297] Figure 6 : High-throughput single-cell RT-PCR of immunoglobulin heavy and light chain mRNA.

[0298] A) Droplets containing antibody-expressing cells and mRNA capture beads before cell lysis (Step 1: Cell encapsulation). Cells and oligo-dT Dynabeads in lysis buffer were encapsulated in Pico-Surf 2 emulsified oil at a volume of approximately 1 nl per droplet, and images were taken directly after encapsulation and before cell lysis.

[0299] B) Fluorescence-activated sorting of single cDNA-loaded capture beads upstream of digital droplet PCR. A square gate defines the single bead population.

[0300] C) Single-bead digital droplet PCR shows the presence of a major population of capture beads containing IgH and IgL amplified sequences (dashed circles). The presence of IgH and IgL cDNAs was monitored by the release of quenched fluorophores specific for the Ig chains in the PCR reaction (IgH = Y axis, IgL = X axis). Droplet PCR was analyzed using a QX100 droplet analyzer.

[0301] D) Overlap extension PCR confirms the production of linked IgH and IgL originating from a single mRNA capture bead. A first PCR was performed in the emulsion and a second (nested) PCR was performed in bulk.

[0302] Figure 7 : Proliferation of NLR cultures representing antibody-expressing cell libraries

[0303] A) Photograph of an NLR culture consisting of a single encapsulated expressing cell.

[0304] B) Photomicrograph of a portion of a bulk NLR culture at day 1.

[0305] C) Fluorescence micrograph of NLR culture taken on day 4 shows GFP-positive clonal clusters (arrows) growing within the NLR, a result of clonal expression from a single encapsulated expressing cell.

[0306] Figure 8 : Identification and isolation of clonal cell lines expressing the mAb of interest.

[0307] A) 30 NLRs containing AB2-expressing cells were mixed to a 300-fold excess of NLRs containing irrelevant expressing cells, and the bulk culture was plated into 80 wells of a 96-well plate. Four days after packaging and plating, the supernatants of the NLR cultures were assayed by AB2 antigen-specific ELISA, and AB2-positive wells were detected. Culture H5 was selected for cloning (arrow).

[0308] B) NLR singlet and characterization of clonal cell line E4. Single NLRs from bulk culture H5 were plated in separate culture wells. After 3 days, the supernatant was assayed by AB2-ELISA, and well E4 was characterized, confirming the isolation of a clonal cell line expressing the AB2-specific monoclonal antibody.

[0309] Positive controls (+) were run in wells A1 and A2.

[0310] References

[0311] Embleton et al.,Nucleic Acids Research,Vol.20,No.15,3831(1992)

[0312] Wardemann, et al.,Science 301,1374(2003)

[0313] Boulianne et al.,Nature 312,643–646,(1984)

[0314] Morrisson et al.,PNAS 82,6851–6855(1984)

[0315] Card et al., Cancer Immunol Immunother.Apr; 53(4):345-57(2004)

[0316] Szymczak et al., Nat Biotechnol 22:589-594(2004)

[0317] Serp et al.,Biotechnology and Bioengineering,Vol.70(1)(2000)

[0318] Gomez-Herreros et al., Nucleic Acids Research, 40, 6508-6519 (2012)

[0319] Martinez et al. Macromol. Biosciences, 12, 946-951 (2012)

[0320] Prüβe et al.,Chem.Eng Technol.1998,21(1):29-33

[0321] McHeyzer-Williams and Ahmed, Curr. Opin. Immunol. 11, 172-179, (1999)

[0322] Bernasconi et al.,Science 298,2199-202(2002)

[0323] Meijer et al.,J Mol Biol.358:764-772(2006)

[0324] Dull et al.,J.Virol 72(11)(1998)

[0325] Diehl et al.Nature Methods,3,551-559(2006)

[0326] Primers used

[0327] First PCR:

[0328] Ig-variable heavy chain:

[0329] Forward primer:

[0330] 1.5'SP-VH1ACAGGTGCCCACTCCCAGGTGCAG

[0331] 2.5'SP-VH3AAGGTGTCCAGTGTGARGTGCAG

[0332] 3.5'SP-VH4 / 6CCCAGATGGTCCTGTCCCAGGTGCAG

[0333] 4.5'SP-VH5CAAGGAGTCTGTTCCGAGGTGCAG

[0334] Reverse primer:

[0335] 5.3' CHg1 linker-GTTGTCCACCTTGGTGTTGCTGG

[0336] 6.3' CμCH1 linker - GGGAATTCTCAGAGGAGACGA

[0337] Ig-variable kappa chain:

[0338] Forward primer:

[0339] 7.5'SP Vκ1 / 2reverseadaptor-ATGAGGSTCCCYGCTCAGCTGCTGG8.5'SP Vκ3reverseadaptor-CTCTTCCTCCTGCTACTCTGGCTCCCAG9.5'SP Vκ4reverseadaptor-ATTTCTCTGTTGCTCTGGATCTCTG

[0340] Reverse primer:

[0341] 10.3'Cκ543GTTTCTCGTAGTCTGCTTTGCTCA

[0342] Ig-variable lambda chain:

[0343] Forward primer:

[0344] 11.5'SP Vλ1reverseadaptor-GGTCCTGGGCCCAGTCTGTGCTG

[0345] 12.5'SP Vλ2reverseadaptor-GGTCCTGGGCCCAGTCTGCCCTG

[0346] 13.5'SP Vλ3reverseadaptor-GCTCTGTGACCTCCTATGAGCTG

[0347] 14.5'SP Vλ4 / 5reverseadaptor-GGTCTCTCTCSCAGCYTGTGCTG

[0348] 15.5'SP Vλ6reverseadaptor-GTTCTTGGGCCAATTTTATGCTG

[0349] 16.5'SP Vλ7reverseadaptor-GGTCCAATTCYCAGGCTGTGGTG

[0350] 17.5'SP Vλ8reverseadaptor-GAGTGGATTCTCAGACTGTGGTG

[0351] Reverse primer:

[0352] 18.3'CλCACCAGTGTGGCCTTGTTGGCTTG

[0353] Overlap extension PCR:

[0354] Forward primer:

[0355] 19.5'BSSH2VH1 / 5CTGCAGCGCGCGTACAT TCCGAGGTGCAGCTGGTGCAG

[0356] 20.5'BSSH2VH3CTGCAGCGCGCGTACATTCTGAGGTGCAGCTGGTGGAG

[0357] 21.5'BSSH2VH4CTGCAGCGCGCGTACATTCCCAGGTGCAGCTGCAGGAG

[0358] 22.5'BSSH2VH3-23CTGCAGCGCGCGTACATTCTGAGGTGCAGCTGTTGGAG

[0359] 23.5'BSSH2VH4-34CTGCAGCGCGCGTACATTCCCAGGTGCAGCTACAGCAGTG

[0360] Reverse primer:

[0361] 24.3'BsiWI Jκ1 / 2 / 4GCCACCGTACGTTTGATYTCCACCTTGGTC

[0362] 25.3'BsiWI Jκ3GCCACCGTACGTTGATATCCACTTTGGTC

[0363] 26.3'XhoICλCTCCTCACTCGAGGGYGGGAACAGAGTG

[0364] oePCR adapter primers

[0365] Ig-variable heavy chain:

[0366] 28.3'SalI JH tattcgcactgcgcggcGTCGACgc-(JH family-specific sequence)

[0367] Ig-variable light chain:

[0368] 29.5'XbaI Vk gccgcgcagtgcgaataTCTAGAtgt-(FW1-V-κ family-specific sequence)

[0369] 30.5'XbaI Vl gccgcgcagtgcgaataTCTAGAtgt-(FW1-V-λ family-specific sequence)

[0370] nPCR

[0371] 5' Primer:

[0372] BSSHII VH-FW1atttttttttGCGCGCtgt-(FW1-V-heavy chain family specific sequence

[0373] 3' primer

[0374] 3'BsiWI Jκ-primer (see table below)

[0375]

[0376] Table 1: Other primers used to perform the present invention.

Claims

1. A method for recovering two or more genes or gene products or cDNAs encoding an immune receptor having two or more subunits and generating an expression cell library, comprising the following substeps: Recovering two or more genes or gene products or cDNAs encoding an immune receptor having two or more subunits, said two or more genes or gene products being contained in a given source cell, comprises the following steps: a) encapsulating source cells together with mRNA capture moieties in a microreactor, wherein the mRNA capture moieties are beads or particles and comprise oligo dT DNA sequences, b) lysing cells in the microreactor, releasing cellular mRNA into the lumen of the microreactor, which then adheres to the mRNA capture moiety, c) lysing or disrupting the microreactor and reverse transcribing the mRNA attached to the mRNA capture portion in solution to obtain the corresponding cDNA gene product, d) generating by PCR a construct encompassing two or more gene products encoding said immune receptor subunits, and e) cloning the PCR product into a plasmid vector to obtain a bicistronic or polycistronic expression construct, f) thereby generating a plasmid library encoding cDNAs of immune receptors of a given source cell population, and Producing a library of expression cells in which each cell is capable of expressing two or more genes or gene products encoding subunits of the recovered immune receptor, said library generation comprising the following steps: g) transfecting expression cells with one or more bicistronic or polycistronic expression constructs obtained in step e), and h) encapsulating the expression cells into a microreactor.

2. The method of claim 1, wherein Prior to encapsulation in step h), the transfected cells are incubated under conditions permissive for protein expression.

3. A method for screening an expression cell library produced according to the method of claim 1 or 2 to select a cell expressing an immune receptor specific for a given target molecule, said method comprising at least one of the following steps: i) using a labeled target that is able to enter the microreactor and bind to an immune receptor expressed by the expressing cells contained therein, and / or j) Detection of immune receptors expressed by expressing cells that have escaped the microreactor and are now in the supernatant combined with serial fractions of the microreactor culture medium.

4. The method of claim 1, further comprising, after step c), a step of amplifying the construct encompassing two or more genes encoding the immune receptor subunits.

5. The method of claim 1, further comprising the following steps after step c): (i) monitoring cDNA synthesis by reverse transcription on the mRNA capture moiety, and (ii) Exclusion of aggregated mRNA capture fractions.

6. The method of claim 1, wherein, as indicated in step d), the generation of a construct encompassing two or more gene products encoding said immune receptor subunits is accomplished by amplifying cDNA by overlap extension PCR.

7. The method of claim 4, wherein the step of amplifying the construct comprises using nested PCR.

8. The method of claim 1, further comprising the step of inserting a regulatory element into the PCR product.

9. The method of claim 1, wherein The immunoreceptor is an antibody having at least two subunits, or a T-cell receptor having at least two subunits, and / or The immunoreceptor is a therapeutic protein, a protein used for diagnostic or scientific purposes, or for commercial purposes, and / or • wherein the bicistronic or multicistronic expression vector is a 2A peptide-linked multicistronic vector, with or without an IRES (internal ribosome entry site) sequence.

10. The method of claim 1, wherein each microreactor contains one source cell.

11. The method of claim 1 , wherein the microreactor comprises a material selected from the group consisting of: Hydrogel-forming polymers, Cellulose derivatives, and / or Polysaccharides.

12. The method of claim 1, wherein the source cell is a mammalian cell selected from an immature or mature B-cell or T-cell.

13. The method of claim 1, wherein the two or more genes or gene products encoding the immune receptor subunits are an Ig heavy chain gene and an Ig light chain gene, or TCRα chain gene and TCRβ chain gene.

14. The method of claim 1, further comprising the step of inserting a cDNA into the PCR product, said cDNA encoding: Ig constant H and / or Ig constant L subdomains, or TCRα chain and TCRβ chain.

15. The method of claim 1, wherein the immune receptor is used in the treatment and diagnosis of a disease selected from the group consisting of: Neoplastic diseases, Neurodegenerative diseases, ·infectious disease, Immune-mediated diseases, and / or Cardiovascular disease.

Images