Animal models of postnatal conditions associated with reduced levels of plasmalogens

Inducible conditional knockout animal models with controlled gene editing address the limitations of existing models by allowing postnatal reduction of plasmalogen levels, enhancing the study and treatment of conditions like neurodegenerative diseases.

JP2026528799APending Publication Date: 2026-08-25MED LIFE DISCOVERIES LP
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2026507635
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-08-11
Filing Date
2024-08-09
Publication Date
2026-08-25

AI Technical Summary

Technical Problem

Current animal models fail to adequately mimic postnatal plasmalogen deficiency, which is prevalent in neurodegenerative diseases, limiting understanding and treatment of conditions associated with reduced plasmalogen levels.

Method used

Development of inducible conditional knockout animal models with controlled gene editing sites to reduce plasmalogen levels postnatally, allowing for systemic evaluation of chronic deficiency effects.

Benefits of technology

Enables the study of conditions associated with reduced plasmalogen levels at any postnatal point, facilitating the evaluation of disease progression and testing of therapeutic compounds.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026528799000003
    Figure 2026528799000003
  • Figure 2026528799000004
    Figure 2026528799000004
  • Figure 2026528799000005
    Figure 2026528799000005
Patent Text Reader

Abstract

This invention describes a transgenic non-human animal model for testing postnatal conditionally inducible plasmalogen deficiency. The genome of the animal model comprises genes capable of regulating the plasmalogen biosynthesis pathway, and these genes have regulatory regions. Within the regulatory regions are at least one conditionally inducible gene editing site that, when edited, blocks gene expression. The genome also has nucleic acid editing sequences that are integrated into a locus separate from the gene encoding the gene product. The gene product, when conditionally induced, edits the gene editing site, ultimately downregulating or disrupting the plasmalogen biosynthesis pathway. Methods and uses comprising the transgenic non-human animal model are also provided.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention generally relates to animal models for studying conditions associated with reduced postnatal levels of plasmalogens. More specifically, the present invention relates to inducible conditional knockout animal models in which the levels of one or more proteins involved in plasmalogen biosynthesis are reduced. Inducible conditional knockout animals can be used to study the effects of reduced plasmalogen levels at any postnatal point in the animal's life. In addition, inducible conditional knockout animals can be used to study the effects of specifically reduced plasmalogen levels in one or more tissues. Inducible conditional knockout animals can also be used to test compounds of potential in the treatment of conditions associated with reduced postnatal levels of plasmalogens. [Background technology]

[0002] Plasmalogens are membrane phospholipids characterized by the presence of a vinyl ether bond at the sn1 position of the glycerol backbone. Plasmalogens constitute 15–20% of the total phospholipid content of cell membranes, and are particularly enriched in nerve tissue (Braverman NE, Moser AB. Functions of plasmalogen lipids in health and disease. Biochim Biophys Acta. 2012;1822(9):1442-1452). The vinyl ether bond results in conformational changes that have a significant impact on the physical properties of the cell membrane. The direct effect of reduced membrane plasmalogens is a decreased tendency towards vesicle fusion, a process crucial for neurotransmission (Glaser PE, Gross RW. Plasmenylethanolamine facilitates rapid membrane fusion: a stopped-flow kinetic investigation correlating the propensity of a major plasma membrane constituent to adopt an HII phase with its ability to promote membrane fusion. Biochemistry. 1994;33(19):5805-5812; Donninger F, Herbst R, Kravic B, et al. Reduced muscle strength in ether lipid-deficient mice is accompanied by altered development and function of the neuromuscular junction. Journal of neurochemistry. 2017;143(5):569-583; Donninger F, Konig T, Scholze P, et al. Disturbed neurotransmitter homeostasis in Ether Lipid Deficiency. Human molecular genetics. 2019).Plasmalogens are also important for the structure of membrane microdomain regions required for the proper function of membrane-bound proteins such as membrane-bound enzymes, receptors, and transporters (da Silva TF, Eira J, Lopes AT, et al. Peripheral nervous system plasmalogens regulate Schwann cell differentiation and myelination. The Journal of clinical investigation. 2014;124(6):2560-2570, Wood PL, Khan MA, Smith T, Goodenowe DB. Cellular diamine levels in cancer chemoprevention: modulation by ibuprofen and membrane plasmalogens. Lipids Health Dis. 2011;10:214, Farooqui AA, Horrocks LA. Plasmalogens: workhorse lipids of membranes in normal and injured neurons and glia. The Neuroscientist: a review journal bringing neurobiology, neurology and psychiatry). It also possesses potent antioxidant activity (Luoma AM, Kuo F, Cakici O, et al. Plasmalogen phospholipids protect internodal myelin from oxidative damage. Free radical biology & medicine. 2015;84:296-310, Kuczynski B, Reo NV. Evidence that plasmalogen is protective against oxidative stress in the rat brain. Neurochemical research. 2006;31(5):639-656).

[0003] Alzheimer's disease (AD) (Han X. Lipid alterations in the earliest clinically recognizable stage of Alzheimer's disease: implication of the role of lipids in the pathogenesis of Alzheimer's disease. Current Alzheimer research. 2005;2(1):65-77, Goodenowe DB, Cook LL, Liu J, et al. Peripheral ethanolamine plasmalogen deficiency: a logical causative factor in Alzheimer's disease and dementia. J Lipid Res. 2007;48(11):2485-2498), Parkinson's disease (Fabelo N, Martin V, Santpere G, et al. Severe alterations in lipid composition of frontal cortex lipid rafts from Parkinson's disease and incidental Parkinson's disease. Mol Med. 2011;17(9-10):1107-1118, Dragonas C, Bertsch T, Sieber CC, Brosche T. Plasmalogens as a marker of elevated systemic oxidative stress in Parkinson's disease. Clinical chemistry and laboratory medicine : CCLM / FESCC. 2009;47(7):894-897), schizophrenia (Kaddurah-Daouk R, McEvoy J, Baillie R, et al. Impaired plasmalogens in patients with schizophrenia. Psychiatry research.Numerous diseases, including Down syndrome (Murphy EJ, Schapiro MB, Rapoport SI, Shetty HU. Phospholipid composition and levels are altered in Down syndrome brain. Brain research. 2000;867(1-2):9-18) and Gaucher disease (Moraitou M, Dimitriou E, Dekker N, Monopolis I, Aerts J, Michelakakis H. Gaucher disease: plasmalogen levels in relation to primary lipid abnormalities and oxidative stress. Blood cells, molecules & diseases. 2014;53(1-2):30-33), have been linked to plasmalogen deficiency. Mechanistically, plasmalogens promote a specific cellular process called vesicle fusion, in which vesicles inside cells fuse with the plasma membrane. This fusion process is crucial in the brain because it is necessary for the release and reuptake of neurotransmitters from neurons. Therefore, the direct effect of reduced membrane plasmalogens is reduced neurotransmission. Plasmalogens are also important for the structure of membrane microdomain regions required for the proper functioning of membrane-bound proteins such as membrane-bound enzymes, receptors, and transporters. The diverse consequences of plasmalogen deficiency, combined with the physiological importance of these functions, lead to the hypothesis that reduced plasmalogen levels may underlie and drive the disease courses of numerous age-related diseases. Confirmation of this direct relationship between disease state and plasmalogen levels has been hindered by the lack of acceptable animal models of plasmalogen deficiency occurring only after birth.

[0004] There are currently available genetic models that mimic the human disease rhizomelic chondrodysplasia punctata (RCDP), based on germline mutations in genes involved in plasmalogen biosynthesis. This disease presents with an extreme phenotype characterized by proximal shortening of the bones, punctate epiphysis around the large joints, severe cognitive impairment, recurrent respiratory illness, cardiac malformations, and an extremely short lifespan (Duker AL, Niiler T, Kinderman D, et al. Rhizomelic chondrodysplasia punctata morbidity and mortality, an update. American journal of medical genetics Part A. 2020;182(3):579-583; Duker AL, Niiler T, Eldridge G, Brereton NH, Braverman NE, Bober MB. Growth charts for individuals with rhizomelic chondrodysplasia punctata. American journal of medical genetics Part A. 2017;173(1):108-113; Duker AL, Eldridge G, Braverman NE, Bober MB. Congenital heart defects common in rhizomelic chondrodysplasia punctata). American journal of medical genetics Part A. 2016;170A(1):270-272, White AL, Modaff P, Holland-Morris F, Pauli RM. Natural history of rhizomelic chondrodysplasia punctata. American journal of medical genetics Part A. 2003;118A(4):332-342).The severity of the disorder highlights the importance of appropriate plasmalogen levels in human development, function, and survival; however, these animal models have shown numerous developmental abnormalities in the brain (Brites P, Motley AM, Gressens P, et al. Impaired neuronal migration and endochondral ossification in Pex7 knockout mice: a model for rhizomelic chondrodysplasia punctata. Human molecular genetics. 2003;12(18):2255-2267, Brodde A, Teigler A, Brugger B, et al. Impaired neurotransmission in ether lipid-deficient nerve terminals. Human molecular genetics. 2012;21(12):2713-2724, Teigler A, Komljenovic D, Draguhn A, Gorgas K, Just WW. Defects in myelination, paranode tissue and Purkinje cell innervation in the ether lipid-deficient mouse cerebellum (Human molecular genetics. 2009;18(11):1897-1908), and also exhibit a short lifespan. However, these models are not useful in the context of understanding the role of plasmalogens in conditions associated with postnatal plasmalogen reduction, which is most prominent in neurodegenerative diseases.Transient knockdown of genes involved in plasmalogen biosynthesis using injected small hairpin RNA (sh-RNA) has been reported as an alternative to complete knockout animals (Hossain MS, Mawatari S, Fujino T. Plasmalogens, the Vinyl Ether-Linked Glycerophospholipids, Enhance Learning and Memory by Regulating Brain-Derived Neurotrophic Factor. Front Cell Dev Biol. 2022;10:828282). While this approach allows researchers to control the timing and location of knockdown, it has serious limitations in its usefulness for evaluating the disease course associated with chronic plasmalogen deficiency. This approach results in mRNA-level knockdown in only a very limited area of ​​the body, which in previously reported studies was the hippocampus of the brain. While this is useful for understanding the effects of plasmalogen reduction on specific regions of anatomical structures, it does not allow for the evaluation of the systemic effects of plasmalogen biosynthesis reduction that occur in human diseases. Additionally, the use of sh-RNA only results in a transient reduction of mRNA levels; therefore, assessment of chronic plasmalogen deficiency requires repeated injections. [Prior art documents] [Non-patent literature]

[0005] [Non-Patent Document 1] 1. Braverman NE, Moser AB. Functions of plasmalogen lipids in health and disease. Biochim Biophys Acta. 2012;1822(9):1442-1452 [Non-Patent Document 2] 2. Glaser PE, Gross RW. Plasmenylethanolamine facilitates rapid membrane fusion: a stopped-flow kinetic investigation correlating the propensity of a major plasma membrane constituent to adopt an HII phase with its ability to promote membrane fusion. Biochemistry. 1994;33(19):5805-5812 [Non-Patent Document 3] 3. Dorninger F, Herbst R, Kravic B, et al. Reduced muscle strength in ether lipid-deficient mice is accompanied by altered development and function of the neuromuscular junction. Journal of neurochemistry. 2017;143(5):569-583 [Non-Patent Document 4] 4. Dorninger F, Konig T, Scholze P, et al. Disturbed Neurotransmitter Homeostasis in Ether Lipid Deficiency. Human molecular genetics. 2019 [Non-Patent Document 5] 5. da Silva TF, Eira J, Lopes AT, et al. Peripheral nervous system plasmalogens regulate Schwann cell differentiation and myelination. The Journal of clinical investigation. 2014;124(6):2560-2570 [Non-Patent Document 6] 6. Wood PL, Khan MA, Smith T, Goodenowe DB. Cellular diamine levels in cancer chemoprevention: modulation by ibuprofen and membrane plasmalogens. Lipids Health Dis. 2011;10:214 [Non-Patent Document 7] 7. Farooqui AA, Horrocks LA. Plasmalogens: workhorse lipids of membranes in normal and injured neurons and glia. The Neuroscientist : a review journal bringing neurobiology, neurology and psychiatry. 2001;7(3):232-245 [Non-Patent Document 8] 8. Luoma AM, Kuo F, Cakici O, et al. Plasmalogen phospholipids protect internodal myelin from oxidative damage. Free radical biology & medicine. 2015;84:296-310 [Non-Patent Document 9] 9. Kuczynski B, Reo NV. Evidence that plasmalogen is protective against oxidative stress in the rat brain. Neurochemical research. 2006;31(5):639-656 [Non-Patent Document 10] 10. Han X. Lipid alterations in the earliest clinically recognizable stage of Alzheimer's disease: implication of the role of lipids in the pathogenesis of Alzheimer's disease. Current Alzheimer research. 2005;2(1):65 - 77

Non - Patent Document 11

Non - Patent Document 12

Non - Patent Document 13

Non - Patent Document 14

Outdoor Tools 15

Outdoor Content 16

Outdoor Track 17

Outdoor Tools 18

Outdoor Tools 19

Outdoor Tools20

Direct Environment21

Optional Website22

[0006] Therefore, available animal models are not satisfactory, and there is a need for an animal model that can mimic the adult onset of conditions associated with plasmalogen deficiency in humans. [Means for solving the problem]

[0007] The shortcomings of the prior art are largely mitigated by the construction of the models described herein for reducing postnatal levels of plasmalogens in non-human animals or animal models. The models may be constructed in various ways, such as by inducing recombination of genes, or parts thereof, involved in plasmalogen biosynthesis in inducible conditional knockout non-human animals or non-human animal models at a desired age or in a desired tissue.

[0008] Embodiments of the present invention provide a transgenic non-human animal or non-human animal model comprising the genome of a transgenic non-human animal or non-human animal model having a gene comprising at least one regulatory region, the gene being a gene that regulates the plasmalogen biosynthesis pathway. The regulatory region of the gene comprises at least one conditionally inducible gene editing site. The at least one conditionally inducible gene editing site comprises either an exogenous nucleic acid sequence or an endogenous nucleic acid sequence. The genome further comprises at least one nucleic acid editing sequence incorporated into a locus separate from the gene. The at least one nucleic acid editing sequence encodes a gene product capable of editing the conditionally inducible gene editing site, thereby blocking or disrupting the expression of the gene that regulates the plasmalogen biosynthesis pathway. In another embodiment of the present invention, there may be two or more genes capable of regulating the plasmalogen biosynthesis pathway to be disrupted as described above. In some embodiments of the present invention, the downregulation or disruption of the gene is conditionally induced or induced by using an exogenous compound or exogenous stimulus.

[0009] In another embodiment, a transgenic non-human animal or animal model relating to postnatal conditionally inducible plasmalogen deficiency is provided. The animal or animal model has a genome comprising a gene having at least one regulatory region capable of modulating the plasmalogen biosynthesis pathway. The at least one regulatory region comprises at least one conditionally inducible gene editing site capable of blocking gene expression when edited; and at least one nucleic acid editing sequence incorporated into a locus separate from the gene, encoding a gene product capable of editing at least one gene editing site when conditionally induced, thereby downregulating or disrupting the plasmalogen biosynthesis pathway.

[0010] In another aspect of the present invention, an animal model is provided for inducing plasmalogen deficiency postnatally and conditionally. The animal model comprises a transgenic non-human animal having a genome with a gene capable of modulating the plasmalogen biosynthesis pathway. The gene has at least one regulatory region. The regulatory region of the gene has at least one conditionally inducible gene editing site, which, when edited, can block the expression of a gene responsible for the plasmalogen biosynthesis pathway. The genome further comprises at least one nucleic acid editing sequence incorporated into or taken up at a locus separate from the gene. The at least one nucleic acid editing sequence, when conditionally induced, can edit at least one conditionally inducible gene editing site, thereby encoding a gene product that downregulates or disrupts the plasmalogen biosynthesis pathway. Downregulation or disruption of the gene editing sequence is conditionally induced or triggered by the use of an exogenous compound or exogenous stimulus.

[0011] In aspects of the present invention, the transgenic animal or animal model containing a transgenic animal is any non-human animal. In some aspects of the present invention, the non-human animal or non-human animal model is a rodent.

[0012] In aspects of the present invention, at least one conditionally inducible gene editing site further comprises a second, third, fourth, or fifth conditionally inducible gene editing site. Each of the second, third, fourth, or fifth conditionally inducible gene editing sites comprises either an exogenous nucleic acid sequence or an endogenous nucleic acid sequence. The gene product encoded by the nucleic acid editing sequence is capable of editing the second, third, fourth, and fifth conditionally inducible gene editing sites.

[0013] In some aspects of the present invention, one or more conditionally inducible gene editing sites, or in some cases the first, second, third, fourth, and fifth conditionally inducible gene editing sites, are LoxP sites, flippase recognition target (FRT) sites, attP and attB sites, sgRNA binding sites, FokI sites, zinc finger nuclease sites, or any combination thereof.

[0014] In some aspects of the present invention, the gene product encoded by the nucleic acid editing sequence is Cre, flippase, PhiC31, Cas9, sgRNA, crRNA, transcription activator-like effector nuclease (TALEN), zinc finger nuclease (ZFN), any variant thereof, or any combination thereof.

[0015] In some aspects of the present invention, at least one conditionally inducible gene editing site or one or more conditionally inducible gene editing sites are LoxP sites, and the gene product is Cre or a variant thereof. The Cre gene product is a fusion protein further comprising a mutant estrogen ligand binding domain (ERT2). The Cre gene product is operably linked from a transgenic animal to a promoter element containing a tetracycline-responsive element capable of inducing gene expression in response to the addition or removal of tetracycline.

[0016] In certain embodiments, one or more conditionally inducible gene editing sites are FRT sites, and the gene product is a flippase or a variant thereof. In certain embodiments, one or more conditionally inducible gene editing sites are attP and attB sites, and the gene product is PhiC31 or a variant thereof. In certain embodiments, one or more conditionally inducible gene editing sites are FokI sites, and the gene product is a TALEN or a variant thereof. In certain embodiments, one or more conditionally inducible gene editing sites are zinc finger nuclease sites, and the gene product is a zinc finger nuclease. In certain embodiments, one or more conditionally inducible gene editing sites are sgRNA-binding sites, and the gene product is Cas9 or a variant thereof, and / or one or more sgRNAs, crRNAs, or both capable of binding to sgRNA-binding sites. In certain embodiments, at least one conditionally inducible gene editing site is adjacent to at least one regulatory region.

[0017] In certain embodiments, at least one regulatory region is an exon, an element required for gene transcription, an element required for gene translation, an element required for the function of a protein encoded by the genome sequence containing the gene, or any combination thereof. In certain specific embodiments, at least one regulatory region is an exon.

[0018] In aspects of the present invention, the expression of the gene product is conditionally inducible. The expression of the gene product can be conditionally induced by the addition of an exogenous compound, an exogenous stimulus, or both. In certain embodiments, the expression of the gene product can be conditionally induced by the addition of tamoxifen, 4-hydroxytamoxifen (4-OHT,4-hydroxytamoxifen), mifepristone, tetracycline, doxycycline, light, temperature, or any combination thereof.

[0019] In some embodiments, genes capable of regulating the plasmalogen biosynthesis pathway include fatty acid reductase 1 (FAR1), glycerone phosphate O-acyltransferase (GNPAT), alkylglycerone phosphate synthase (AGPS), acyl / alkyl-DHAP reductase, alkyl / acyl-GPA acyltransferase, phosphatidic acid phosphatase, ethanolamine phosphotransferase, plasmanylethanolamine desaturase, choline phosphotransferase, or any combination thereof. In certain specific embodiments, the gene capable of regulating the plasmalogen biosynthesis pathway is glycerone phosphate O-acyltransferase (GNPAT). In the embodiments described above, at least one conditionally inducible gene editing site is not edited by the gene product at or before the birth of the animal, i.e., it is edited only after birth.

[0020] In certain embodiments, the transgenic animal or animal model has one or more additional genes, each comprising at least one regulatory region, that regulate the plasmalogen biosynthesis pathway. In these embodiments, at least one additional conditionally inducible gene editing site is located within at least one regulatory region. In these embodiments, one or more additional genes may include a first additional conditionally inducible gene editing site and / or a second additional gene editing site, where each of the at least one conditionally inducible gene editing sites comprises an exogenous nucleic acid sequence or an endogenous nucleic acid sequence.

[0021] In some cases, one or more additional genes may have the first, second, third, fourth, and fifth conditionally inducible gene editing sites. The second nucleic acid sequence may be incorporated into a locus separate from the conditionally inducible gene editing sites, the first nucleic acid sequence, the first gene, and the one or more additional genes, and the second nucleic acid sequence encodes a second gene product capable of editing one or more additional genes. The first, i.e., original gene product and the second gene product may be different.

[0022] In aspects of the present invention, the transgenic animal or animal model may be a rodent, and the rodent genome may include a glyceron phosphate O-acyltransferase (GNPAT) gene containing a loxP site; and a gene encoding a fusion protein of Cre recombinase and a mutant estrogen ligand-binding domain (ERT2). In another alternative aspect of the present invention, the transgenic animal or animal model may be a rodent, and the rodent genome may include a glyceron phosphate O-acyltransferase (GNPAT) gene containing a loxP site; and a Cre recombinase gene encoding Cre under the control of a tetracycline-responsive element. In another alternative aspect of the present invention, the transgenic animal or animal model is a rodent, the rodent genome having a glyceron phosphate O-acyltransferase (GNPAT) gene comprising one or more sites capable of binding to an sgRNA; a promoter operably attached to at least one sgRNA capable of binding to one or more sites capable of binding to an sgRNA; and a gene encoding Cas9 or a variant thereof.

[0023] In another aspect of the present invention, the transgenic animal or animal model may be a rodent, the rodent genome having a first LoxP site upstream of exon 4 of the gene encoding glyceron phosphate O-acyltransferase (GNPAT) and a second LoxP site downstream of exon 4 of the gene encoding glyceron phosphate O-acyltransferase (GNPAT); and CAGGCre-ER T2 A nucleic acid sequence that codes for this.

[0024] In another aspect of the present invention, the transgenic animal or animal model may be a rodent, the rodent genome having a first sgRNA site upstream of exon 4 of the gene encoding glyceron phosphate O-acyltransferase (GNPAT) capable of binding to the sgRNA of GTGAGCTCCCCCGGCCTCTC (SEQ ID NO: 1), a second sgRNA site downstream of exon 4 of the gene encoding glyceron phosphate O-acyltransferase (GNPAT) capable of binding to the sgRNA of ATGGCAGACAGGGGCCCTTC (SEQ ID NO: 2), a first nucleic acid sequence operably ligated to the sequence encoding the sgRNA of GTGAGCTCCCCCGGCCTCTC (SEQ ID NO: 1), and a third nucleic acid sequence encoding Cas9 or a variant thereof, the Cas9 or variant thereof being operably ligated to an inducible regulatory element.

[0025] In another aspect of the present invention, at least one genome of a transgenic animal or animal model contains a genome. During an event, the cells of the transgenic animal or animal model are modified so that only one genome of the transgenic animal or animal model has a genome. In another aspect of the present invention, all of the genomes of the transgenic animal or animal model contain a genome.

[0026] In aspects of the present invention, cells derived from transgenic animals or animal models as described above in this specification are provided.

[0027] Another aspect of the present invention provides a method for reducing postnatal plasmalogen levels in a non-human animal or a non-human animal model. The method comprises the steps of providing a transgenic animal or transgenic model as described above herein, and inducing the expression of a nucleic acid editing sequence encoding a gene product capable of editing at least one conditionally inducible gene editing site, wherein editing of at least one conditionally inducible gene editing site reduces the expression of a gene that regulates the plasmalogen biosynthesis pathway.

[0028] In another aspect of the present invention, the use of the transgenic animals or animal models described above herein for reducing postnatal plasmalogen levels in nonhuman animals or nonhuman animal models, wherein the transgenic animals or animal models are for inducing the expression of a nucleic acid editing sequence encoding a gene product capable of editing at least one conditionally inducible gene editing site, the editing of at least one conditionally inducible gene editing site for reducing the expression of a gene that regulates the plasmalogen biosynthesis pathway.

[0029] In another aspect of the present invention, a transgenic animal or animal model described above is provided for use in reducing postnatal plasmalogen levels in a non-human animal or animal model, the animal or animal model being used to induce the expression of a nucleic acid editing sequence encoding a gene product capable of editing at least one conditionally inducible gene editing site, wherein editing of at least one conditionally inducible gene editing site is for reducing the expression of a gene that regulates the plasmalogen biosynthesis pathway.

[0030] Another aspect of the present invention provides a method for inducing a condition or disease associated with reduced postnatal plasmalogen levels in a non-human animal or animal model. The method comprises the steps of providing a transgenic animal or animal model as described above herein; inducing the expression of a nucleic acid editing sequence encoding a gene product capable of editing at least one conditionally inducible gene editing site, wherein editing of at least one conditionally inducible gene editing site reduces the expression of a gene that regulates the plasmalogen biosynthesis pathway; and monitoring the transgenic animal or animal model with respect to symptoms of the condition or disease.

[0031] In another aspect of the present invention, the use of the transgenic animals or animal models described above herein for inducing a condition or disease associated with reduced postnatal plasmalogen levels in nonhuman animals or animal models, wherein the transgenic animals or animal models are: for inducing the expression of a nucleic acid editing sequence encoding a gene product capable of editing at least one conditionally inducible gene editing site, wherein editing of at least one conditionally inducible gene editing site reduces the expression of a gene that regulates the plasmalogen biosynthesis pathway; and for monitoring the transgenic animals or animal models with respect to the symptoms of the condition or disease.

[0032] In another aspect of the present invention, transgenic animals or animal models described above herein are provided for use in inducing conditions or diseases associated with reduced postnatal plasmalogen levels in non-human animals or animal models. The transgenic animals or animal models are used to induce the expression of a nucleic acid editing sequence encoding a gene product capable of editing at least one conditionally inducible gene editing site, wherein editing of at least one conditionally inducible gene editing site is for reducing the expression of a gene that regulates the plasmalogen biosynthesis pathway; and are used to monitor the transgenic animals or animal models with respect to symptoms of a condition or disease.

[0033] Another aspect of the present invention provides a method for determining the efficacy of a compound or composition for treating a condition or disease associated with reduced plasmalogen levels. The method comprises the steps of providing a transgenic animal or animal model as described above herein. This includes the steps of: inducing the expression of a nucleic acid editing sequence encoding a gene product capable of editing at least one conditionally inducible gene editing site, wherein the editing of at least one conditionally inducible gene editing site is for reducing the expression of a gene that regulates the plasmalogen biosynthesis pathway; administering the compound or composition to the transgenic animal or animal model; and monitoring the transgenic animal or animal model with respect to symptoms of the condition or disease. Alternatively, the method comprises the steps of: administering the compound or composition to the transgenic animal or animal model; inducing the expression of a nucleic acid editing sequence encoding a gene product capable of editing at least one conditionally inducible gene editing site, wherein the editing of at least one conditionally inducible gene editing site is for reducing the expression of a gene that regulates the plasmalogen biosynthesis pathway; and monitoring the transgenic animal or animal model with respect to symptoms of the condition or disease. Alternatively, the method comprises the steps of: administering a compound or composition to a transgenic animal or animal model and inducing the expression of a nucleic acid editing sequence encoding a gene product capable of editing at least one conditionally inducible gene editing site, wherein the editing of at least one conditionally inducible gene editing site is for reducing the expression of a gene that regulates the plasmalogen biosynthesis pathway; and monitoring the transgenic animal or animal model with respect to symptoms of a condition or disease.

[0034] In some embodiments, the use of transgenic animals or animal models is provided for determining the efficacy of compounds or compositions for the treatment of conditions or diseases associated with reduced plasmalogen levels. In alternative embodiments, the transgenic animals or animal models described above herein are provided for use in determining the efficacy of compounds or compositions for the treatment of conditions or diseases associated with reduced plasmalogen levels.

[0035] In the above embodiments and aspects of the present invention, inducing the expression of a nucleic acid editing sequence encoding a gene product capable of editing at least one conditionally inducible gene editing site is equivalent to excising or modifying at least a portion of a gene. In these embodiments, the conditions or diseases associated with reduced plasmalogen levels are neurodegenerative diseases, the presence of cataracts, respiratory diseases, chronic inflammation, myelin dysplasia, metabolic syndrome, type II diabetes, or cardiovascular diseases. In some specific embodiments, the neurodegenerative disease is Alzheimer's disease, Parkinson's disease, or multiple sclerosis. In some further embodiments, the respiratory disease is bronchopulmonary dysplasia (BPD) or chronic obstructive pulmonary disease (COPD). In these embodiments, the symptoms of the condition or disease include one or more of the following: reduced plasmalogen levels, and / or one or more symptoms associated with the diseases and / or conditions defined above herein.

[0036] Another aspect of the present invention provides a method for generating a transgenic animal or animal model. The method includes the steps of: providing at least one non-human animal or animal model; introducing at least one gene editing sequence into a gene, a portion thereof, or a regulatory element involved in plasmalogen biosynthesis to generate a first edited gene in the non-human animal or animal model; crossing the non-human animal or animal model having the first edited gene with a second non-human animal or animal model having a nucleic acid editing sequence in a separate locus encoding a gene product to generate a transgenic animal or animal model; and inducing the expression of a gene product in the transgenic animal or animal model to edit the first edited gene, wherein the editing of the first edited gene results in a decrease in the level of the gene product of the first edited gene, reduced activity of the first edited gene product of the first edited gene, reduced plasmalogen levels in the transgenic animal or animal model, or any combination thereof.

[0037] In any of the embodiments described above, gene product expression is induced by providing an exogenous compound or exogenous stimulus to an animal or animal model. Gene product expression can be induced by adding tamoxifen, 4-hydroxytamoxifen (4-OHT), mifepristone, tetracycline, light, temperature, or any combination thereof.

[0038] Other and further aspects and advantages of the present invention will be better understood by reading the exemplary embodiments which are to be described shortly, or various advantages shown in the appended claims and not referenced herein will come to mind for those skilled in the art when using the present invention in practice. [Brief explanation of the drawing]

[0039] The above and other aspects, features and advantages of the present invention will become more readily apparent from the following description with reference to the accompanying drawings. [Figure 1]This figure shows a schematic diagram of the Gnpat gene region targeted for animal model construction, including the relative positions of LoxP sites resulting in conditional deletion of exon 4 and subsequent recombination between LoxP sites after TMX administration, according to the embodiment. [Figure 2] This figure shows box plots of relative plasmalogen levels one month after TMX treatment in homozygous Gnpat cKO hemiCAGGCRE-ER mice. Total relative plasmalogen levels across various tissues (based on the sum of all eight measured individual molecular species and normalized to the mean of the medium). Asterisks indicate p<0.05 relative to the mean of the corresponding medium-treated plasmalogen. [Figure 3] This figure shows box plots of relative levels of specific plasmalogens in Gnpat cKO mice one month after TMX treatment across various tissues (A-serum; B-brain; C-heart; D-liver; E-intestine; and F-lung) based on the sum of all eight measured individual molecular species in various tissues of the medium and TMX-treated animals, and normalized to the mean of the medium. The first number in the x-axis label represents the carbon length and saturation of the sn1 side chain; the second number represents the sn2 side chain. An asterisk indicates p<0.05 relative to the wild type. An asterisk indicates p<0.05 relative to the mean of the corresponding medium-treated plasmalogen. [Figure 4] This figure shows box plots of total relative plasmalogen levels 4 months after TMX treatment in homozygous Gnpat cKO hemiCAGGCRE-ER mice, based on the sum of all 8 measured individual molecular species across various tissues and normalized to the mean of the medium. Asterisks indicate p<0.05 relative to wild-type. Asterisks indicate p<0.05 relative to the mean of the corresponding medium-treated plasmalogen. [Figure 5]This figure shows box plots of relative levels of specific plasmalogens in Gnpat cKO mice 4 months after TMX treatment across various tissues (A-serum; B-brain; C-heart; D-liver; E-intestine; and F-lung) based on the sum of all 8 measured individual molecular species in various tissues of the medium and TMX-treated animals, and normalized to the mean of the medium. The first number in the x-axis label represents the carbon length and saturation of the sn1 side chain; the second number represents the sn2 side chain. An asterisk indicates p<0.05 relative to the wild type. An asterisk indicates p<0.05 relative to the mean of the corresponding medium-treated plasmalogen. [Figure 6] According to the embodiment, this figure shows the correlation between serum and brain plasmalogen levels across all 4-month-old animals. [Figure 7] This figure shows the results of an open field test. A) Average distance traveled per minute in an open field test for animals one month after TMX treatment. B) Total average distance traveled over 10 minutes one month after TMX treatment. C) Average distance traveled per minute four months after TMX treatment. D) Total average distance traveled over 10 minutes four months after TMX treatment. [Figure 8] According to the embodiment, this figure shows the correlation between the distance traveled and the concentration of individual plasmalogen molecular species in the brains of eight animals. The asterisk indicates p<0.01. [Figure 9] This figure shows nerve conduction velocity (NCV) results. Box plots of (A) latency, (B) NCV, and amplitude over a period of 4 months after media treatment, control, and TMX treatment. [Figure 10] According to the embodiment, this figure shows a correlation plot between serum plasmalogen levels and latency across all animals four months after TMX treatment. [Figure 11] According to the embodiment, this figure shows a correlation plot between serum plasmalogen levels and NCV across all animals four months after TMX treatment. [Figure 12]This figure shows box plots of total relative plasmalogen levels (based on the sum of all eight measured individual molecular species) across various tissues 8 months after media or TMX treatment in homozygous Gnpatdel / flox cKO hemiCAGGCRE-ER mice. The boxes represent the interquartile range with the median of the horizontal line. The whiskers represent the minimum-maximum range of the data, and outliers are shown as individual points. The asterisk indicates p<0.001 relative to the mean of the corresponding media-treated plasmalogen. [Figure 13] This figure shows box plots of open-field test results in homozygous Gnpatdel / flox cKO hemiCAGGCRE-ER mice 8 months after media or TMX treatment, compared to wild-type controls. A) Mean total distance traveled, B) Mean travel speed, C) Mean activity duration. The boxes represent the interquartile range with the median of the horizontal line. The whiskers represent the minimum-maximum range of the data, and outliers are shown as separate points. An asterisk indicates p<0.01. [Figure 14] This figure shows box plots of sleep percentages in homozygous Gnpatdel / flox cKO hemiCAGGCRE-ER mice 8 months after media or TMX treatment, compared to wild-type controls, during the light phase (A) or dark phase (B). The boxes represent the interquartile range with the median of the horizontal line. The whiskers represent the minimum-maximum range of the data, and outliers are shown as separate points. The asterisk indicates p<0.01. [Figure 15] This figure shows box plots of total brain volume for the left and right hemispheres of homozygous Gnpatdel / flox cKO hemiCAGGCRE-ER mice 8 months after medium or TMX treatment, compared to wild-type controls, as determined by anatomical MRI. For each group, the median is represented by a horizontal line, the shaded box represents the interquartile range, and the whiskers represent the minimum-maximum range. Outliers are represented by dots outside the whiskers. Asterisks indicate p<0.01. [Figure 16]This figure shows box plots of temporoparietal cortex volume in homozygous Gnpatdel / flox cKO hemiCAGGCRE-ER mice 8 months after medium or TMX treatment, compared to wild-type controls, as determined by anatomical MRI. For each group, the median is represented by a horizontal line, the shaded box represents the interquartile range, and the whiskers represent the minimum-maximum range. Outliers are represented by dots outside the whiskers. Asterisks indicate p<0.01. [Figure 17] This figure shows box plots of occipital cortex volume in homozygous Gnpatdel / flox cKO hemiCAGGCRE-ER mice 8 months after medium or TMX treatment, compared to wild-type controls, as determined by anatomical MRI. For each group, the median is represented by a horizontal line, the shaded box represents the interquartile range, and the whiskers represent the minimum-maximum range. Outliers are represented by dots outside the whiskers. Asterisks indicate p<0.01. [Figure 18] This figure shows box plots of hippocampal volume in homozygous Gnpatdel / flox cKO hemiCAGGCRE-ER mice 8 months after media or TMX treatment, compared to wild-type controls, as determined by anatomical MRI. For each group, the median is represented by the horizontal line, the shaded box represents the interquartile range, and the whiskers represent the minimum-maximum range. Outliers are represented by dots outside the whiskers. Asterisks indicate p<0.01. [Figure 19] This figure shows box plots of olfactory cortex volume in homozygous Gnpatdel / flox cKO hemiCAGGCRE-ER mice 8 months after media or TMX treatment, compared to wild-type controls, as determined by anatomical MRI. For each group, the median is represented by a horizontal line, the shaded box represents the interquartile range, and the whiskers represent the minimum-maximum range. Outliers are represented by dots outside the whiskers. Asterisks indicate p<0.01. [Figure 20]This figure shows box plots of striatum volume in homozygous Gnpatdel / flox cKO hemiCAGGCRE-ER mice 8 months after media or TMX treatment, compared to wild-type controls, as determined by anatomical MRI. For each group, the median is represented by a horizontal line, the shaded box represents the interquartile range, and the whiskers represent the minimum-maximum range. Outliers are represented by dots outside the whiskers. Asterisks indicate p<0.01. [Figure 21] This figure shows box plots of thalamic volume in homozygous Gnpatdel / flox cKO hemiCAGGCRE-ER mice 8 months after media or TMX treatment, compared to wild-type controls, as determined by anatomical MRI. For each group, the median is represented by a horizontal line, the shaded box represents the interquartile range, and the whiskers represent the minimum-maximum range. Outliers are represented by dots outside the whiskers. Asterisks indicate p<0.01. [Figure 22] This figure shows box plots of brainstem volume in homozygous Gnpatdel / flox cKO hemiCAGGCRE-ER mice 8 months after medium or TMX treatment, compared to wild-type controls, as determined by anatomical MRI. For each group, the median is represented by a horizontal line, the shaded box represents the interquartile range, and the whiskers represent the minimum-maximum range. Outliers are represented by dots outside the whiskers. Asterisks indicate p<0.01. [Figure 23] This figure shows box plots of brain white matter volume in homozygous Gnpatdel / flox cKO hemiCAGGCRE-ER mice 8 months after medium or TMX treatment, compared to wild-type controls, as determined by anatomical MRI. For each group, the median is represented by a horizontal line, the shaded box represents the interquartile range, and the whiskers represent the minimum-maximum range. Outliers are represented by dots outside the whiskers. Asterisks indicate p<0.01. [Figure 24]This figure shows box plots of neurofilament light chain (NfL) concentrations in CSF (A) and plasma (B) in homozygous Gnpatdel / flox cKO hemiCAGGCRE-ER mice 8 months after media or TMX treatment, compared to wild-type controls. For each group, the median is represented by a horizontal line, the shaded box represents the interquartile range, and the whiskers represent the minimum-maximum range. Outliers are represented by dots outside the whiskers. Asterisks indicate p<0.01. [Figure 25] This figure shows the plasma levels of 16:0 / 22:6 plasmalogen isoforms in WT control, cKO control, cKO TMX Veh, and cKO TMX 1011 mice 4 months after treatment with the medium or PPI-1011. [Figure 26] This figure shows that treatment with PPI-1011 increased brain volume in plasmalogen-deficient mice, as measured by anatomical MRI. [Figure 27] This figure shows representative mass spectrometry images of plasmalogen molecular species in the brains of plasmalogen-deficient (TMX) and PPI-1011-treated mice, compared to a control group. [Modes for carrying out the invention]

[0040] The following description is for illustrative purposes only and does not limit the combination of features necessary to carry out the present invention; it represents preferred embodiments.

[0041] All terms are intended to be understood as those understood by those skilled in the art. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art to which this disclosure belongs. Section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described herein.

[0042] While various features of this disclosure may be described in the context of a single embodiment, features may also be provided individually or in any preferred combination. Conversely, while this disclosure may be described herein in the context of separate embodiments for clarity, this disclosure may also be implemented in a single embodiment.

[0043] The following definitions complement the definitions used in the art and apply to this application. Therefore, the technical terms used herein are for the sole purpose of describing specific embodiments and are not intended to be limiting.

[0044] Definitions and Embodiments In this application, the use of the singular form includes the plural form unless otherwise specifically stated. It should be noted that, as used herein, the singular forms "a," "an," and "the" include the plural referent unless the context clearly indicates otherwise.

[0045] In this application, the use of "or" means "and / or" unless otherwise specified. The terms "and / or" and "any combination thereof," as well as their grammatical equivalents, may be used interchangeably as used herein. These terms can convey that any and all combinations are specifically considered. The term "or" may be used conjunctively or disjunctively unless the context specifically implies disjunctive use.

[0046] Furthermore, the use of the term "including," as well as other forms such as "include," "includes," and "included," is not limited to these.

[0047] Any reference herein to “partial embodiments,” “embodiment,” “one embodiment,” “alternative embodiment,” or “other embodiments” means that certain features, structures, or specifications described in relation to an embodiment are included in at least some embodiments of this disclosure, but not necessarily in all embodiments.

[0048] As used herein and in the claims, the words “comprising” (and any form of “comprise” such as “comprise” and “comprises”), “having” (and any form of “have” and “has”), “including” (and any form of “includes” and “include”), or “containing” (and any form of “contains” and “contain”) are inclusive or open-ended and do not exclude additional unlisted elements or method steps. It is taken into consideration that any embodiment discussed herein can be carried out with respect to any method or composition of the Disclosure, and vice versa. Furthermore, the compositions of the Disclosure can be used to achieve the methods of the Disclosure.

[0049] The term “about” and its grammatical equivalents, when used herein, may include the number itself and a range of values ​​plus or minus 10% from the number. The terms “about” and “approximately” mean within an acceptable margin of error for a particular value as determined by a person skilled in the art, which will depend in part on the limitations of the measuring system. For example, “about” may mean within one or two or more standard deviations through practice in the art. Alternatively, “about” may mean a range of up to 20%, up to 10%, up to 5%, or up to 1% of a given value. In another example, the quantity “about 10” includes 10 and any quantity between 9 and 11. In yet another example, the term “about” in reference to a number may also include a range of values ​​of plus or minus 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% from that value. Alternatively, particularly with respect to biological systems or processes, the term “about” may mean within one order of magnitude of the value, preferably within five times, more preferably within two times. Where a particular value is described herein or in the claims, unless otherwise specified, the term “about” should be assumed to mean within an acceptable margin of error for that particular value.

[0050] The term “isolated” and its grammatical equivalent, as used herein, means the extraction of nucleic acids from their natural environment. However, it should be understood that whether nucleic acids are extracted from nature (including genomic DNA and mRNA) or synthesized (including cDNA) and / or amplified under laboratory conditions, nucleic acids and proteins can be formulated with diluents or adjuvants and still be isolated for practical purposes. For example, when used for introduction into cells, nucleic acids are typically mixed with an acceptable carrier or diluent.

[0051] As used herein, the term “gene” can mean (a) a gene comprising a DNA sequence encoding a protein, such as FAR1, GNPAT, or AGPS; (b) any DNA sequence encoding a protein, such as FAR1, GNPAT, or AGPS, and / or (c) any DNA sequence that hybridizes to the complement of a protein-coding sequence or a non-protein gene product-coding sequence, such as RNA. In certain embodiments, the term “gene” includes coding and non-coding regions, and preferably includes all sequences necessary for normal gene expression. As used herein, the term “gene” means a nucleic acid molecule that can be used to produce mRNA, antisense RNA, siRNA, shRNA, miRNA, etc. A gene may or may not be used to produce a functional protein. A gene may include both coding and non-coding regions (e.g., regulatory elements including introns, promoters, enhancers, termination sequences, and 5' and 3' untranslated regions). A gene can be “isolated,” meaning a nucleic acid molecule that substantially or essentially does not contain components normally found with nucleic acid molecules in their native state. Such components include other cellular substances, culture media from recombinant production, and / or various chemicals used in the chemical synthesis of nucleic acid molecules.

[0052] References to “gene” also include, within its scope, references to genes having continuous sequences, i.e., sequences defining continuous nucleic acid entities as defined herein, or discontinuous sequences, i.e., sequences defining discontinuous nucleic acid entities as defined herein. In certain embodiments, the term “gene” includes, within its scope, open reading frames, introns, and adjacent 5' and 3' non-coding nucleotide sequences that encode a specific polypeptide and are involved in the regulation of expression. In this regard, a gene may further include regulatory sequences, such as promoters, enhancers, termination signals and / or polyadenylation signals, or heterologous regulatory sequences that are naturally associated with a given gene. Gene sequences may be cDNA or genomic DNA or fragments thereof. Genes may be introduced into a suitable vector for extrachromosomal maintenance or for introduction into a host.

[0053] As used herein, "genome" refers to the entirety of an organism's genetic information, represented by genes and non-coding sequences of DNA, which are either chromosomal or non-chromosomal genetic elements such as linear polynucleotides, including, for example, the genes that are to be assembled and / or recombined. In other words, the term "genome" is intended to include the entirety of an organism's DNA, including nuclear DNA components, chromosomal or extrachromosomal DNA, and cytoplasmic domains (e.g., mitochondrial DNA).

[0054] The terms “nucleic acid,” “polynucleotide,” “oligonucleotide,” or “nucleotide,” or any grammatical equivalent thereof, as used herein, mean a polymeric form of a nucleotide or nucleic acid of any length, which is either a ribonucleotide or a deoxyribonucleotide. This term means only the primary structure of a molecule; that is, it includes double-stranded and single-stranded DNA, trimer DNA, and double-stranded and single-stranded RNA. This term also includes polynucleotides in modified forms, for example, by methylation and / or capping, as well as in their unmodified forms. This term also means molecules containing nucleotides and nucleotide analogs that do not exist naturally or are synthetic. Nucleic acid sequences and vectors disclosed or considered herein can be introduced into cells, for example, by transfection, transformation, or transduction.

[0055] As used herein, the terms “identical” and their grammatical equivalents, or “sequence identity” in the context of two nucleic acid sequences or amino acid sequences of polypeptides, mean residues in two sequences that are identical when aligned for maximum correspondence across a specified comparison window.

[0056] The term "substantially identical" and its grammatical equivalent, when applied to nucleic acid sequences, means that a nucleic acid or amino acid sequence contains at least 90% sequence identity (at least 95%, at least 98%, and at least 99%) when compared to a reference sequence using the above-mentioned program, e.g., BLAST, with standard parameters. For example, the BLASTN program (for nucleotide sequences) uses a word length (W) of 11, an expected value (E) of 10, M=5, N=-4, and comparison of both strands as defaults. The percentage of sequence identity is determined by comparing two optimally aligned sequences across a comparison window, where portions of the polynucleotide sequence within the comparison window may contain additions or deletions (i.e., gaps) when compared to a reference sequence (without additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions where identical nucleic acid bases exist in both sequences, obtaining the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity. In the embodiment, substantial identity exists over sequence regions of at least approximately 25 base pairs, 50 base pairs, 100 base pairs, 125 base pairs, and 150 base pairs, and in the embodiment, the sequences are substantially identical over at least approximately 180 base pairs. In the embodiment, the sequences are substantially identical over the entire length of the coding region.

[0057] A “donor plasmid,” “expression vector,” or “vector” is any genetic element, such as a plasmid, chromosome, virus, or transposon, that behaves as an autonomous unit of polynucleotide replication within a cell (i.e., capable of replication under its own control) or becomes replicable by insertion into a host cell chromosome, when ligated to another polynucleotide segment, thereby resulting in the replication and / or expression of the ligated segment. Such vectors include, but are not limited to, plasmids, transposons, bacteriophages, and cosmids. A vector may contain polynucleotide sequences necessary to achieve ligation or insertion of the vector into a desired host cell and to achieve expression of the ligated segment. Such sequences vary depending on the host organism and may include promoter sequences for achieving transcription, enhancer sequences for increasing transcription, ribosome-binding site sequences, and transcription and translation termination sequences. Alternatively, an expression vector may directly express the nucleic acid sequence product encoded therein without ligation or integration of the vector into a host cell DNA sequence. In some embodiments, the vector is an episomal expression vector that can replicate in a host cell and persist as an extrachromosomal segment of DNA within the host cell in the presence of appropriate selective pressure. The vector may also include a selectable marker gene. As used herein, the term “selectable marker gene” means a nucleic acid sequence that enables a cell to express a nucleic acid sequence that is specifically selected with respect to or against a corresponding selective agent.

[0058] The term “coding sequence” or “coding sequence” as used herein means a segment of polynucleotide that codes for a protein. The region or sequence is joined to the start codon closer to its 5' end and to the stop codon closer to its 3' end. The coding sequence may also be referred to as an open reading frame. The present invention further aims at a nucleotide construct comprising the nucleic acid described above, operably linked to one or more regulatory elements. A “regulatory element” means a portion of nucleic acid that is typically upstream of a gene but not always, and can consist of DNA or RNA, or both DNA and RNA. Regulatory elements may include those that mediate organ specificity or control developmental or temporal gene activation. Furthermore, “regulatory elements” include elements that reduce or increase promoter activity, such as promoter elements, core promoter elements, elements that can be induced in response to external stimuli, elements that are constitutively activated, or negative regulatory elements or transcriptional enhancers. A nucleotide sequence exhibiting regulatory element activity means that, when operably ligated with a target coding sequence, the nucleotide sequence functions as a promoter, core promoter, constitutive regulatory element, negative element or silencer (i.e., an element that reduces promoter activity), or transcription or translation enhancer.

[0059] As used herein, the terms “transgenic non-human animal or animal model” or “transgenic non-human cell” may mean an animal, animal model, or cell whose genome contains a specific sequence that has been disrupted, otherwise modified, or mutated by the methods described herein or by other methods well known in the art. It should be considered that the non-human animal or animal model or cell may be a mammal, bird, reptile, amphibian, fish, arthropod, vertebrate, or invertebrate. In certain embodiments, the non-human transgenic animal or animal model or cell is a mammal. In certain embodiments, the mammal or cell may be a rodent such as a rat or mouse, a rabbit, a monkey, a guinea pig, a dog, a sheep, a horse, a cow, a cat, etc. In addition, “transgenic animal or animal model” or “transgenic cell” may be a heterozygous animal or cell (i.e., one modified allele and one wild-type allele) or a homozygous animal or cell (i.e., two modified alleles). Embryos are considered to fall within the definition of an animal. In certain embodiments, the transgenic animal or animal model or cells may be an embryo or cells derived therefrom. The provision of the animal includes the provision of an embryo or fetus in utero, whether by mating or otherwise, and whether the embryo progresses to birth.

[0060] As considered herein, the forms of administration may include, but are not limited to, injectables, solutions, creams, gels, implants, pumps, ointments, emulsions, suspensions, microspheres, particles, fine particles, nanoparticles, liposomes, pastes, patches, tablets, capsules, transdermal delivery devices, sprays, aerosols, or other means well known to those skilled in the art.

[0061] As used herein, the terms “modification,” “modification,” or “modified” may, in the context of a regulatory region or a conditionally inducible gene editing site, include any modification to the conditionally inducible gene editing site, such as deletion of one or more base pairs, substitution of one or more base pairs, or addition of one or more base pairs, in which case the gene containing the editing site modulates the plasmalogen biosynthesis pathway, and the modification alters the expression, level, or activity of the gene containing the conditionally inducible gene editing site.

[0062] As used herein, "plasmalogen precursor" refers to any and all known molecules that are converted to plasmalogens in the plasmalogen biosynthesis pathway. Preferably, the plasmalogen precursor is an alkyl or alkenylglycerol containing an ether or vinyl ether at the sn1 position of the glycerol skeleton.

[0063] As used herein, the reduced or diminished level may include, for example, a reduction in the level of plasmalogens, plasmalogen precursors, or any of these biological molecules. In certain embodiments, the reduced or diminished level may include a reduction in the level of a non-human animal as a whole, such as a systemic reduction, or a reduction in the level of a part of a non-human animal, such as a cell, body fluid, tissue, or any combination thereof.

[0064] As used herein, a “regulatory region” of a gene may be any coding region and / or non-coding region of a gene that regulates the expression, activity and / or function of the gene and / or its products. In certain embodiments, a regulatory region may be an exon, an element required for gene transcription, an element required for gene translation, an element required for the function of a protein encoded by the genome sequence containing the gene, or any combination thereof. In certain embodiments, a regulatory region may be adjacent to the gene, or it may not be adjacent to the gene. In certain embodiments, proximity to the gene may include sequences within the gene, such as exons or uncoding regions, or it may include regions outside the gene, such as introns, promoters or enhancers. In certain embodiments, proximity may be zero base pairs (bp, base) upstream or downstream of the gene. pair)~10000bp, e.g. 1bp, 2bp, 3bp, 4bp, 5bp, 6bp, 7bp, 8bp, 9bp, 10bp, 11bp, 12bp, 13bp, 14bp, 15bp, 16bp, 17bp, 18bp, 19bp, 20bp, 21bp, 22bp, 23bp, 24bp, 25bp, 26bp, 27bp, 28b p, 29bp, 30bp, 31bp, 32bp, 33bp, 34bp, 35bp, 36bp, 37bp, 38bp, 39bp, 40bp, 41bp, 42bp, 4 3bp, 44bp, 45bp, 46bp, 47bp, 48bp, 49bp, 50bp, 51bp, 52bp, 53bp, 54bp, 55bp, 56bp, 57bp, 58bp, 59bp, 60bp, 61bp, 62bp, 63bp, 64bp, 65bp, 66bp, 67bp, 68bp, 69bp, 70bp, 71bp, 72b p, 73bp, 74bp, 75bp, 76bp, 77bp, 78bp, 79bp, 80bp, 81bp, 82bp, 83bp, 84bp, 85bp, 86bp, 87 bp, 88bp, 89bp, 90bp, 91bp, 92bp, 93bp, 94bp, 95bp, 96bp, 97bp, 98bp, 99bp, 100bp, 101b p, 102bp, 103bp, 104bp, 105bp, 106bp, 107bp, 108bp, 109bp, 110bp, 111bp, 112bp, 113bp,114bp、115bp、116bp、117bp、118bp、119bp、120bp、121bp、122bp、123bp、124bp、125bp、126bp、127bp、128bp、129bp、130bp、131bp、132bp、133bp、134bp、135bp、136bp、137bp、138bp、139bp、140bp、141bp、142bp、143bp、144bp、145bp、146bp、147bp、148bp、149bp、150bp、151bp、152bp、153bp、154bp、155bp、156bp、157bp、158bp、159bp、160bp、161bp、162bp、163bp、164bp、165bp、166bp、167bp、168bp、169bp、170bp、171bp、172bp、173bp、174bp、175bp、176bp、177bp、178bp、179bp、180bp、181bp、182bp、183bp、184bp、185bp、186bp、187bp、188bp、189bp、190bp、191bp、192bp、193bp、194bp、195bp、196bp、197bp、198bp、199bp、200bp、201bp、202bp、203bp、204bp、205bp、206bp、207bp、208bp、209bp、210bp、211bp、212bp、213bp、214bp、215bp、216bp、217bp、218bp、219bp、220bp、221bp、222bp、223bp、224bp、225bp、226bp、227bp、228bp、229bp、230bp、231bp、232bp、233bp、234bp、235bp、236bp、237bp、238bp、239bp、240bp、241bp、242bp、243bp、244bp、245bp、246bp、247bp、248bp、249bp、250bp、251bp、252bp、253bp、254bp、255bp、256bp、257bp、258bp、259bp、260bp、261bp、262bp、263bp、264bp、265bp、266bp、267bp、268bp、269bp、270bp、271bp、272bp、273bp、274bp、275bp、276bp、277bp、278bp、279bp、280bp、281bp、282bp、283bp、284bp、285bp、286bp、287bp、288bp、289bp、290bp、291bp、292bp、293bp、294bp、295bp、296bp、297bp、298bp、299bp、300bp、301bp、302bp、303bp、304bp、305bp、306bp、307bp、308bp、309bp、310bp、311bp、312bp、313bp、314bp、315bp、316bp、317bp、318bp、319bp、320bp、321bp、322bp、323bp、324bp、325bp、326bp、327bp、328bp、329bp、330bp、331bp、332bp、333bp、334bp、335bp、336bp、337bp、338bp、339bp、340bp、341bp、342bp、343bp、344bp、345bp、346bp、347bp、348bp、349bp、350bp、351bp、352bp、353bp、354bp、355bp、356bp、357bp、358bp、359bp、360bp、361bp、362bp、363bp、364bp、365bp、366bp、367bp、368bp、369bp、370bp、371bp、372bp、373bp、374bp、375bp、376bp、377bp、378bp、379bp、380bp、381bp、382bp、383bp、384bp、385bp、386bp、387bp、388bp、389bp、390bp、391bp、392bp、393bp、394bp、395bp、396bp、397bp、398bp、399bp、400bp、401bp、402bp、403bp、404bp、405bp、406bp、407bp、408bp、409bp、410bp、411bp、412bp、413bp、414bp、415bp、416bp、417bp、418bp、419bp、420bp、421bp、422bp、423bp、424bp、425bp、426bp、427bp、428bp、429bp、430bp、431bp、432bp、433bp、434bp、435bp、436bp、437bp、438bp、439bp、440bp、441bp、442bp、443bp、444bp、445bp、446bp、447bp、448bp、449bp、450bp、451bp、452bp、453bp、454bp、455bp、456bp、457bp、458bp、459bp、460bp、461bp、462bp、463bp、464bp、465bp、466bp、467bp、468bp、469bp、470bp、471bp、472bp、473bp、474bp、475bp、476bp、477bp、478bp、479bp、480bp、481bp、482bp、483bp、484bp、485bp、486bp、487bp、488bp、489bp、490bp、491bp、492bp、493bp、494bp、495bp、496bp、497bp、498bp、499bp、500bp、501bp、502bp、503bp、504bp、505bp、506bp、507bp、508bp、509bp、510bp、511bp、512bp、513bp、514bp、515bp、516bp、517bp、518bp、519bp、520bp、521bp、522bp、523bp、524bp、525bp、526bp、527bp、528bp、529bp、530bp、531bp、532bp、533bp、534bp、535bp、536bp、537bp、538bp、539bp、540bp、541bp、542bp、543bp、544bp、545bp、546bp、547bp、548bp、549bp、550bp、551bp、552bp、553bp、554bp、555bp、556bp、557bp、558bp、559bp、560bp、561bp、562bp、563bp、564bp、565bp、566bp、567bp、568bp、569bp、570bp、571bp、572bp、573bp、574bp、575bp、576bp、577bp、578bp、579bp、580bp、581bp、582bp、583bp、584bp、585bp、586bp、587bp、588bp、589bp、590bp、591bp、592bp、593bp、594bp、595bp、596bp、597bp、598bp、599bp、600bp、601bp、602bp、603bp、604bp、605bp、606bp、607bp、608bp、609bp、610bp、611bp、612bp、613bp、614bp、615bp、616bp、617bp、618bp、619bp、620bp、621bp、622bp、623bp、624bp、625bp、626bp、627bp、628bp、629bp、630bp、631bp、632bp、633bp、634bp、635bp、636bp、637bp、638bp、639bp、640bp、641bp、642bp、643bp、644bp、645bp、646bp、647bp、648bp、649bp、650bp、651bp、652bp、653bp、654bp、655bp、656bp、657bp、658bp、659bp、660bp、661bp、662bp、663bp、664bp、665bp、666bp、667bp、668bp、669bp、670bp、671bp、672bp、673bp、674bp、675bp、676bp、677bp、678bp、679bp、680bp、681bp、682bp、683bp、684bp、685bp、686bp、687bp、688bp、689bp、690bp、691bp、692bp、693bp、694bp、695bp、696bp、697bp、698bp、699bp、700bp、701bp、702bp、703bp、704bp、705bp、706bp、707bp、708bp、709bp、710bp、711bp、712bp、713bp、714bp、715bp、716bp、717bp、718bp、719bp、720bp、721bp、722bp、723bp、724bp、725bp、726bp、727bp、728bp、729bp、730bp、731bp、732bp、733bp、734bp、735bp、736bp、737bp、738bp、739bp、740bp、741bp、742bp、743bp、744bp、745bp、746bp、747bp、748bp、749bp、750bp、751bp、752bp、753bp、754bp、755bp、756bp、757bp、758bp、759bp、760bp、761bp、762bp、763bp、764bp、765bp、766bp、767bp、768bp、769bp、770bp、771bp、772bp、773bp、774bp、775bp、776bp、777bp、778bp, 779bp, 780bp, 781bp, 782bp, 783bp, 784bp, 785bp, 786bp, 787bp, 788bp, 789bp, 790bp, 791bp, 792bp, 793bp, 794bp, 795bp, 796bp, 797bp, 798bp, 799bp, 800bp, 801bp 、802bp、803bp、804bp、805bp、806bp、807bp、808bp、809bp、810bp、811bp、812bp、813bp、814bp、815bp、816bp、817bp、818bp、819bp、820bp、821bp、822bp、823bp、824bp、825bp、826bp、827bp、828bp、829bp、830bp、831bp、832bp、833bp、834bp、835bp、836bp、837bp、838bp、839bp、840bp、841bp、842bp、843bp、844bp、845bp、846bp、847bp、848bp、849bp、850bp、851bp、852bp、853bp、854bp、855bp、856bp、857bp、858bp、859bp、860bp、861bp、862bp、863bp、864bp、865bp、866bp、867bp、868bp、869bp、870bp、871bp、872bp、873bp、874bp、875bp、876bp、877bp、878bp、879bp、880bp、881bp、882bp、883bp、884bp、885bp、886bp、887bp、888bp、889bp、890bp、891bp、892bp、893bp、894bp、895bp、896bp、897bp、898bp、899bp、900bp、901bp、902bp、903bp、904bp、905bp、906bp、907bp、908bp、909bp、910bp、911bp、912bp、913bp、914bp、915bp、916bp、917bp、918bp、919bp、920bp、921bp、922bp、923bp、924bp、925bp、926bp、927bp、928bp、929bp、930bp、931bp、932bp、933bp、934bp、935bp、936bp、937bp、938bp、939bp、940bp、941bp、942bp、943bp、944bp、945bp、946bp、947bp、948bp、949bp、950bp、951bp、952bp、953bp、954bp、955bp、956bp、957bp、958bp、959bp、960bp、961bp、962bp、963bp、964bp、965bp、966bp、967bp、The regulatory region may include regulatory regions of 968bp, 969bp, 970bp, 971bp, 972bp, 973bp, 974bp, 975bp, 976bp, 977bp, 978bp, 979bp, 980bp, 981bp, 982bp, 983bp, 984bp, 985bp, 986bp, 987bp, 988bp, 989bp, 990bp, 991bp, 992bp, 993bp, 994bp, 995bp, 996bp, 997bp, 998bp, 999bp, or up to 1000bp. In certain embodiments, the regulatory region may not be in close proximity to the gene, while still regulating gene expression, activity, and / or function. In certain embodiments, regulatory regions not in proximity to a gene are located more than 1000 bp away from the gene, for example, more than 1000 bp, more than 1100 bp, more than 1200 bp, more than 1300 bp, more than 1400 bp, more than 1500 bp, more than 1600 bp, more than 1700 bp, more than 1800 bp, more than 1900 bp, more than 2000 bp, more than 2100 bp, more than 2200 bp, more than 2300 bp, more than 2400 bp, more than 2500 bp, more than 2600 bp , over 2700bp, over 2800bp, over 2900bp, over 3000bp, over 3100bp, over 3200bp, over 3300bp, over 3400bp, over 3500bp, over 3600bp, over 3700bp, 38 Over 00bp, over 3900bp, over 4000bp, over 4100bp, over 4200bp, over 4300bp, over 4400bp, over 4500bp, over 4600bp, over 4700bp, over 4800bp, 4900b More than p, More than 5000bp, More than 5100bp, More than 5200bp, More than 5300bp, More than 5400bp, More than 5500bp, More than 5600bp, More than 5700bp, More than 5800bp, More than 5900bp, More than 6000bp , more than 6100bp, more than 6200bp, more than 6300bp, more than 6400bp, more than 6500bp, more than 6600bp, more than 6700bp, more than 6800bp, more than 6900bp, more than 7000bp, more than 7100bp, 72 More than 00bp, More than 7300bp, More than 7400bp, More than 7500bp, More than 7600bp, More than 7700bp, More than 7800bp, More than 7900bp, More than 8000bp, More than 8100bp, More than 8200bp, 8300b More than p, more than 8400bp, more than 8500bp, more than 8600bp, more than 8700bp, more than 8800bp, more than 8900bp, more than 9000bp, more than 9100bp, more than 9200bp, more than 9300bp, more than 9400bp,It may be greater than 9500 bp, greater than 9600 bp, greater than 9700 bp, greater than 9800 bp, greater than 9900 bp, or greater than 10000 bp. In certain embodiments, the regulatory region may include one or more conditionally inducible gene editing sites. In certain embodiments, the regulatory region may include two conditionally inducible gene editing sites.

[0065] As used herein, "physiologically acceptable carriers" include any and all solvents, dispersions, coatings, adjuvants, stabilizers, diluents, preservatives, antibacterial and antifungal agents, isotonic agents, adsorption retarders, and the like.

[0066] The term “operably linked” means, as used herein, the physical and / or functional linkage of a DNA segment to another DNA segment in a manner that enables the segment to function in its intended manner. A DNA sequence encoding a gene product is operably linked to a regulatory sequence if it is linked to a regulatory sequence, such as a promoter, enhancer, and / or silencer, in a manner that directly or indirectly allows for modification of the transcription of the DNA sequence. For example, a DNA sequence is operably linked to a promoter if it is ligated to the promoter downstream of the promoter's transcription start site in the correct reading frame with respect to the transcription start site, and allows transcription elongation to proceed throughout the entire DNA sequence. An enhancer or silencer is operably linked to a DNA sequence encoding a gene product if it is ligated to the DNA sequence in a manner that increases or decreases the transcription of the DNA sequence, respectively. Enhancers and silencers may be located upstream, downstream, or embedded within the coding region of the DNA sequence. The DNA for the signal sequence is operably ligated to the polypeptide-encoding DNA when the signal sequence is expressed as a preprotein participating in polypeptide secretion. Ligation of the DNA sequence to the regulatory sequence is typically performed by ligation at a suitable restriction site or via an adapter or linker inserted into the sequence, using a restriction endonuclease known to those skilled in the art.

[0067] The terms “induce,” “induce,” and their grammatical equivalents, as used herein, mean an increase in nucleic acid sequence transcription, promoter activity, and / or expression induced by a transcription factor compared to the basal level of some transcriptional or regulatory system used. This increase in nucleic acid sequence transcription, promoter activity, and / or expression may also be induced by translational regulators such as translation-enhancing UTR sequences.

[0068] The term "promoter" refers to a region of polynucleotide that initiates the transcription of a coding sequence. Promoters are located on the same strand and upstream on the DNA (towards the 5' region of the sense strand), near the transcription start site of a gene. Some promoters are constitutive, meaning they are active under all circumstances in a cell, while others, such as inductive promoters, are regulated to become active in response to specific stimuli. The term "promoter activity" and its grammatical equivalent, as used herein, means the degree of expression of a nucleotide sequence operably ligated to a promoter, whose activity is being measured. Promoter activity can be measured directly, for example, by determining the amount of RNA transcript produced by Northern blotting, or indirectly by determining the amount of product encoded by a ligated nucleic acid sequence, such as a reporter nucleic acid sequence ligated to a promoter.

[0069] Constitutive promoters direct gene expression throughout various parts of an organism and / or throughout the entire development of the organism. Any preferred constitutive promoter can be used to drive the expression of the proteins or fragments thereof described herein.

[0070] As used herein, the term "constitutive" indicates that a gene is expressed across a wide range of cell types, although some variation in its abundance is often observed, rather than necessarily indicating that the gene is expressed at the same level across all cell types.

[0071] As used herein, "inducible promoter" means a promoter that is induced to be active by the presence or absence of transcription regulators, such as biofactors or abiotic factors. Inducible promoters are useful because they allow the expression of their operably linked genes to be turned on or off using the inducer at a specific developmental stage of an organism or in a specific tissue. An inducible promoter is a promoter that can directly or indirectly activate the transcription of one or more DNA sequences or genes in response to an inducer. In the absence of an inducer, the DNA sequence or gene will not be transcribed. Typically, a protein factor that specifically binds to an inducible promoter to activate transcription exists in an inactive form, which is then directly or indirectly converted to an active form by the inducer. The inducer can be a protein, a metabolite, a chemical agent such as a growth regulator, or a physiological stress that is induced directly by heat, cooling, or a toxic element, or indirectly by the action of a pathogen or pathogenic substance such as a virus. Non-limiting examples of inducible promoters include alcohol-modulated promoters, tetracycline-modulated promoters, steroid-modulated promoters, metal-modulated promoters, disease-modulating promoters, temperature-modulated promoters, and light-modulated promoters, as well as isopropyl-β-thiogalactopyranoside (IPTG) inducible promoters.

[0072] The term "transcriptional regulator" or "cis-acting regulatory element" refers to a biochemical element that acts to prevent or inhibit the transcription of promoter-driven DNA sequences under specific environmental conditions (e.g., a repressor or nuclear inhibitory protein), or to allow or stimulate the transcription of promoter-driven DNA sequences under specific environmental conditions (e.g., an inducer or enhancer).

[0073] The terms “enhancer” or “translation enhancer,” as used herein, mean, for example, a DNA sequence that increases the transcription of a nucleic acid sequence to which it is operably ligated. Enhancers can be located several kilobases away from the coding region of a nucleic acid sequence and can mediate the binding of regulatory factors, the pattern of DNA methylation, or changes in DNA structure. Numerous enhancers from various different sources are well known in the art and are available as or within cloned polynucleotides (e.g., from depositary institutions such as ATCC or other commercial or private suppliers). Numerous polynucleotides containing promoters (such as the commonly used CMV promoter) also contain enhancer sequences. Enhancers can be located upstream, within, or downstream of the coding sequence.

[0074] As used herein, the terms “treatment,” “to treat,” “improvement,” or their grammatical equivalents mean obtaining a desired pharmacological and / or physiological effect. In embodiments, the effect is therapeutic, i.e., the effect partially or completely cures the disease and / or adverse symptoms resulting from the disease.

[0075] In certain embodiments, the gene and / or one or more additional genes may include genes that regulate the plasmalogen biosynthesis pathway. As used herein, the plasmalogen biosynthesis pathway may mean a series of steps involving enzymes and intermediate molecules for the synthesis of plasmalogens. Plasmalogens are a class of glycerophospholipids characterized by a vinyl ether bond at the sn-1 position. Biosynthesis begins in the peroxisome by a series of non-redundant peroxisome-specific enzymes that generate an ether bond that is reduced to a vinyl ether within the endoplasmic reticulum (ER). Plasmalogens are essential components of lipid membranes and have been shown to have functions in vesicular transport, membrane protein activity, and antioxidant properties in lipid membranes (reviewed in Guedes LC, Chan RB, Gomes MA, et al. Serum lipid alterations in GBA-associated Parkinson's disease. Parkinsonism & related disorders. 2017). A reduction in plasmalogen levels is also associated with Alzheimer's disease (Paesler K, Xie K, Hettich MM, et al. Limited effects of an eIF2αS51A allele on neurological impairments in the 5xFAD mouse model of Alzheimer's disease. Neural plasticity. 2015;2015:825157; Bardgett ME, Davis NN, Schultheis PJ, Griffith MS. Ciproxifan, an H3 receptor antagonist, alleviates hyperactivity and cognitive deficits in the APP Tg2576 mouse model of Alzheimer's disease. Neurobiology of learning and memory.).2011;95(1):64-72, Faizi M, Bader PL, Saw N, et al. Thy1-hAPP(Lond / Swe+) mouse model of Alzheimer's disease displays broad behavioral deficits in sensorimotor, cognitive and social function. Brain and behavior. 2012;2(2):142-154, Fallatah W, Smith T, Cui W, et al. Oral administration of a synthetic vinyl-ether plasmalogen normalizes open field activity in a mouse model of Rhizomelic chondrodysplasia punctata. Disease models & mechanisms. 2019), Parkinson's disease (Glaser PE, Gross RW. Rapid plasmenylethanolamine-selective fusion of membrane bilayers catalyzed by an isoform of glyceraldehyde-3-phosphate dehydrogenase: discrimination between glycolytic and fusogenic roles of individual isoforms. Biochemistry. 1995;34(38):12193-12203, Miville-Godbout E, Bourque M, Morissette M, et al. Plasmalogen Augmentation Reverses Striatal Dopamine Loss in MPTP Mice. PloS one. 2016;11(3):e0151020), schizophrenia (Brites P, Ferreira AS, da Silva TF, et al.Alkyl-glycerol rescues plasmalogen levels and pathology of ether-phospholipid deficient mice. PloS one. 2011;6(12):e28539), Down syndrome (Rodemer C, Thai TP, Brugger B, et al. Inactivation of ether lipid biosynthesis causes male infertility, defects in eye development and optic nerve hypoplasia in mice. Human molecular genetics. 2003;12(15):1881-1895) and Gaucher disease (Weldemichael DA, Grossberg GT. Circadian rhythm disturbances in patients with Alzheimer's disease: a review. International journal of Alzheimer's disease.This has also been reported in other neurodegenerative diseases, including (2010;2010). As used herein, a gene that regulates the plasmalogen biosynthesis pathway may be a gene or a modulo of its product, for example, a gene whose increase or decrease due to gene editing results in a change in the plasmalogen biosynthesis pathway. In certain embodiments, a gene that regulates the plasmalogen biosynthesis pathway may be a gene whose increase or decrease due to gene editing, in combination with one or more additional genes modified by gene editing, results in a change in the plasmalogen biosynthesis pathway. In this case, gene editing of the gene without editing one or more additional genes may not result in a change in the plasmalogen biosynthesis pathway. In certain embodiments, a gene that regulates the plasmalogen biosynthesis pathway may be a gene whose increase or decrease due to gene editing results in an enhancement of the modulation of the plasmalogen biosynthesis pathway caused by gene editing of individual genes.

[0076] In certain embodiments, the regulatory region can regulate the expression, level, activity, or any combination thereof of genes that regulate the plasmalogen biosynthesis pathway. In certain embodiments, the genes that regulate the plasmalogen biosynthesis pathway may be fatty acid reductase 1 (FAR1), glyceron phosphate O-acyltransferase (GNPAT), alkylglyceron phosphate synthase (AGPS), acyl / alkyl-DHAP reductase, alkyl / acyl-GPA acyltransferase, phosphatidic acid phosphatase, ethanolamine phosphotransferase, plasmanylethanolamine desaturase, choline phosphotransferase, any variant thereof, any ortholog thereof, or any combination thereof. In certain embodiments, a transgenic non-human animal or animal model or cell may include one or more conditionally inducible gene editing sites in the genes that regulate the plasmalogen biosynthesis pathway, and one or more conditionally inducible gene editing sites in one or more additional genes that regulate plasmalogen biosynthesis. In certain embodiments, a transgenic non-human animal or animal model or cell may contain two editing sites in the GNPAT gene.

[0077] In certain embodiments, the genome of a transgenic non-human animal or animal model may contain at least one conditionally inducible gene editing site. As used herein, “gene editing site” may be any site to which a gene product capable of editing the editing site can be directed, such as an enzyme or an enzyme:nucleic acid complex. In certain embodiments, the conditionally inducible gene editing site may be an endogenous sequence present in the genome of a non-human animal or animal model. In certain embodiments, the conditionally inducible gene editing site may be an exogenous sequence inserted into the genome of a non-human animal or animal model. In certain embodiments, the gene product capable of editing the editing site may bind to a consensus sequence therein. In certain embodiments, the gene product capable of editing the editing site may be and / or capable of editing the editing site in the presence of additional components, such as an additional enzyme or nucleic acid, such as CRISPR RNA or guide RNA. In certain embodiments, editing of a conditionally inducible gene editing site by a gene product may result in impaired expression, activity and / or function of the edited gene product.

[0078] In certain embodiments, a "conditionally inducible gene editing site" may include two editing sites, and the genomic region between the two editing sites may be excised, recombined, inverted, translocated, or inactivated. In certain embodiments, the two editing sites may be edited by an enzyme or an enzyme in a complex with one or more nucleic acids. In certain embodiments, a conditionally inducible gene editing site may include a LoxP site, which may be edited by Cre. In certain embodiments, a conditionally inducible gene editing site may include a guide RNA or an equivalent binding site, which may be edited by a guide RNA or its equivalent capable of binding the site to the guide RNA or an equivalent binding site, and Cas9 or a variant thereof.

[0079] In certain embodiments, at least one conditionally inducible gene editing site may be capable of modifying at least one regulatory region of a gene involved in the plasmalogen biosynthesis pathway. In certain embodiments, at least one regulatory region may be critical to the plasmalogen biosynthesis pathway. In certain embodiments, modification of at least one regulatory region by at least one conditionally inducible gene editing site may include mutations such as base pair changes, deletions such as the deletion of one or more base pairs, recombination, or any combination thereof. In certain embodiments, modification of at least one regulatory region including at least one conditionally inducible gene editing site may alter the activity, function, expression, and / or level of the gene product of a gene involved in the plasmalogen biosynthesis pathway.

[0080] In certain embodiments, at least one conditionally inducible gene editing site may include an exogenous nucleic acid sequence. The exogenous nucleic acid sequence may be any sequence provided for use herein to a genome. The exogenous nucleic acid sequence may include sequences derived from different species, the same species, or any combination thereof. In certain embodiments, the exogenous sequence may be a sequence directed toward gene editing. In certain embodiments, the exogenous sequence may include a consensus-binding sequence, which can bind to one or more gene products or exogenous sequences capable of editing the exogenous sequence. In certain embodiments, the exogenous sequence may include a consensus site for binding to an endonuclease, recombinase, exonuclease, polymerase, ribonuclease, ligase, integrase, or any equivalent known to those skilled in the art.

[0081] In certain embodiments, at least one conditionally inducible gene editing site may include an endogenous nucleic acid sequence. The endogenous nucleic acid sequence, as used herein, may be any sequence provided in the genome of a non-human animal or animal model or its cells. In certain embodiments, the endogenous sequence may be a sequence directed toward gene editing. In certain embodiments, the endogenous sequence may include a consensus-binding sequence, which can bind to one or more gene editing products or the endogenous sequence that are capable of editing the endogenous sequence. In certain embodiments, the endogenous sequence may include a consensus site for binding to an endonuclease, recombinase, integrase, or any equivalent known to those skilled in the art. In certain embodiments, the endogenous sequence may be CRISPR The sequence may include a sequence capable of binding to an encoded nucleic acid such as RNA or guide RNA, and the encoded nucleic acid may be, for example, 1bp, 2bp, 3bp, 4bp, 5bp, 6bp, 7bp, 8bp, 9bp, 10bp, 11bp, 12bp, 13bp, 14bp, 15bp, 16bp, 17bp, 18bp, 19bp, 20bp, 21bp, 22bp, 23bp, 24bp, 25bp, 26bp, 27bp, 28bp, 29bp, 30bp, 31bp, 32bp, 33bp, 34bp, 35bp, 36bp, 37bp, 38bp, 39bp, 40bp, 41bp, 42bp, 43bp, 44bp, 45bp, 46bp, 47bp, It may include 1 to 100 bp complementary to the endogenous sequence, such as 48 bp, 49 bp, 50 bp, 51 bp, 52 bp, 53 bp, 54 bp, 55 bp, 56 bp, 57 bp, 58 bp, 59 bp, 60 bp, 61 bp, 62 bp, 63 bp, 64 bp, 65 bp, 66 bp, 67 bp, 68 bp, 69 bp, 70 bp, 71 bp, 72 bp, 73 bp, 74 bp, 75 bp, 76 bp, 77 bp, 78 bp, 79 bp, 80 bp, 81 bp, 82 bp, 83 bp, 84 bp, 85 bp, 86 bp, 87 bp, 88 bp, 89 bp, 90 bp, 91 bp, 92 bp, 93 bp, 94 bp, 95 bp, 96 bp, 97 bp, 98 bp, 99 bp, or 100 bp.In certain embodiments, the endogenous sequence may include a sequence capable of binding to a nucleic acid, and the nucleic acid bound to the endogenous sequence can direct the activity of gene products, such as enzymes including Cas9 or its variants, toward the endogenous sequence for editing the endogenous sequence.

[0082] In certain embodiments, at least one nucleic acid editing sequence may be incorporated into a locus separate from the genes involved in the plasmalogen biosynthesis pathway and at least one conditionally inducible gene editing site. As used herein, the separate locus may include any region of the genome of a non-human animal or animal model or cell that does not contain either the first gene or the at least one conditionally inducible gene editing site. In certain embodiments, the gene and at least one conditionally inducible gene editing site are provided in a region of the genome so that the Mendelian ratio or approximate Mendelian ratio of the offspring can be observed when the non-human animal is mated with a non-human animal containing at least one nucleic acid editing sequence. In certain embodiments, the gene and at least one conditionally inducible gene editing site are provided on a different chromosome from the chromosome providing the at least one nucleic acid editing sequence. In certain embodiments, the gene and at least one conditionally inducible gene editing site are provided on a different arm of the same chromosome as the chromosome providing the at least one nucleic acid editing sequence.

[0083] In certain embodiments, at least one nucleic acid editing sequence encodes a gene product capable of editing a conditionally inducible gene editing site. In certain embodiments, the expression of at least one nucleic acid editing sequence can be regulated by a constitutive regulatory system, a tissue-specific regulatory sequence, or used in conjunction with an inducible system whose expression is regulated by the introduction of an exogenous factor such as a small molecule, light, or temperature. In certain embodiments, the gene product capable of editing a conditionally inducible gene editing site may be a nucleic acid, a protein, or a combination thereof. In certain embodiments, the gene product capable of editing a conditionally inducible gene editing site may include an enzyme. In certain embodiments, the gene product capable of editing a conditionally inducible gene editing site may include an enzyme capable of binding to and modifying a nucleic acid. In certain embodiments, the gene product capable of editing a conditionally inducible gene editing site may be an enzyme capable of binding to a consensus nucleic acid sequence and / or a consensus-binding motif or domain. In certain embodiments, gene products capable of editing conditionally inducible gene editing sites may be, for example, zinc finger nucleases, TALEN, FokI, Cas9, or Cas9 variants, or recombinases such as Cre, PhiC31, or FRP.

[0084] In certain embodiments, the expression of a gene product capable of editing a conditionally inducible gene editing site can be regulated by gene-derived regulatory elements, such as promoters and / or enhancers, which provide expression in specific tissues, cells, or combinations thereof. Adipocyte adiponectin (also known as Acrp30, AdipoQ, and GBP28), Adipoq, adipsin, ALK7, adipocyte lipid-binding protein / aP2 (ALBP / aP2), CCAAT-enhancer binding protein alpha / beta (C / EBP alpha / beta), D0L54 (pre-adipocyte marker), fatty acid binding protein (FABP), FABP4, GLUT4, glycerol-3-phosphate dehydrogenase (GPDH), leptin, LPIN-1, lipoprotein lipase (LPL), perilipin, phosphoenolpyruvate carboxykinase-C (PEPCK-C), peroxisome proliferator-activated receptor (PPAR). (receptor), pre-adipocyte factor-1 (Pref-1), resistin, S-100, uncoupling protein-1 / 2 (UCP-1 / UCP-2), Mest / Pegl, aP2 alveolar alkaline phosphatase, cytokeratin, HTI56, MEP-1, Maclura pomifera lectin (MPA), MPA-gp330 (MPA-binding glycoproteins), P2X7 and GABRP, Pro-SPC, receptor for advanced glycation endproducts (RAGE), RTI(40), soybean agglutinin (SBA), surfactant protein A (SPA, SP-A), surfactant protein B (SPB, surfactant protein B, SP-B), Surfactant Protein C (SPC,surfactant protein C (SP-C), ameloblastin, amelogenin, amelotin, AP-1 family proteins (c-Jun, JunB, JunD, c-Fos, FosB, Fra-1, and Fra-2), adenomatous polyposis coli gene protein (APC), connexin 43 (Cx43), cytokeratin 14, enamel matrix proteins (EMP), insulin-like growth factor-I receptor (IGF-I receptor), TGF-beta 1, tumor suppressor in lung cancer-1 (TSLC1), Apud cell neuron-specific enolase (NSE), eBasal cell 34-beta El 2 (high molecular weight cytokeratin), Bc1-2, CD44, keratin 14, p63, P-cadherin, S100A6 (calcyclin), basophil BB1 (basogranulin), Bsp-1, CCR3 (eotaxin receptor), CD11a / CD11b / CD11c, CD13 (WS-80274, clone A8), CD44 and CD54, CD63 (gp53), CD69, CD107a (WS-80280, clone E63-880), CD164 (WS-80160, clone N6B6 and WS-80162, clone 67D2), CD203c (E-NPP3), CDwl 7 (lactosylceramide), IL-3, IL-4 receptor, beta-1, beta-2, and beta-7 integrins, interleukin-4 (IL-4), major basic protein (MBP), MMCP-8, NCA, PSGL-1 (CD162), Toll-like receptor-4 (TLR4,Toll-like receptor-4), B cells B220, BLAST-2 (EBVCS), Bu-1, CD19, CD20 (L26), CD22, CD24, CD27, CD57, CD72, CD79a, CD79b, CD86, chB6, D8 / 17, immunoglobulin beta (B29), FMC7, L26, M17, MUM-1, Pax-5 (BSAP), PC47H, cancer stem cells CD7, CD10, CD18 (integrin f32), CD19, CD20, CD24 (HSA), CD27, CD29 (integrin), CD31 (PECAM-1), CD33, CD34 (mucosialin), CD38, CD44, CD49b (integrin a2), CD49f (integrin a6) CD74, CD90 (Thy-1), CD96 (Tactile), CD105 (Endoglin), CD117 (c-Kit), CD123 (IL-3Ra), CD133 (Prominin-1), CD138 (Syndecane-1), CD166 (ALCAM), CD184 (CXCR4), CD324 (E-Cadherin), CD338 (ABCG2), D111, EpCAM (TROP-1), Jagged-2, Nestin, Notchl, Notch3, Notch4, Podoplanin, SSEA-1, SSEA-3, SSEA-4, TRA-1-60, TRA-1-80, Cardiomyocyte Adrenomedullin, ALCAM (CD166), Alpha-Actinin, Annexin 5, CA02756833 201-0,3-27 Annexin 6, atrial natriuretic peptide (ANP), bFGF, brain natriuretic peptide (BNP), cardiac troponin I (cTnI), cardiac troponin-T (cTnT), cardiac adriamycin-responsive protein (CARP), caveolin-2, caveolin-3, CHAMP, C-type natriuretic peptide (CNP,C-type natriuretic peptide), Connexin-43, Desmin, dHAND, eHAND, GATA-4, GATA-6, H-FABP, Insulin-like growth factor I (IGF-1), MEF2C, Myosin heavy chain (MHC), Myosin light chain (MLC), N-cadherin, Nlo(2.5 (cardiac homeobox protein), Oct-4, Phenylethanolamine N-methyltransferase (Pnmt), Sarcomere alpha-actin / actinin, Sarcomere myosin, Sarcomere tropomyosin, Skeletal alpha-actin chondrocyte agrecan, Annexin VI, Beta-1 integrin (CD29), Cartilage oligomeric matrix protein (COMP) (protein), cathepsin B, CD44, CD151, and CD49c, chondrocyte-expressed protein (CEP-68), cartilage matrix protein (CMP, matrilin-1), collagen II, collagen IX, collagen X, IGF-I and IGF-II, melanoma inhibitory activity (MIA), matrix metalloproteinase-13 (MMP13), osteonectin (SPARC), PCNA, p21, Sox9, syndecan-3, YKL39 and YKL40, Clara cell CC10 (Clara cell secretory protein), CC16 (Clara cell secretory protein), CC26, CCSP (Clara cell secretory protein), CYP2F2 / CYP2B4, cytochrome P-450 (CYP450,Cytochrome P-450), NADPH reductase, SP-A, SP-B, SP-C, SP-D, urinary protein 1, uteroglobin, UGRP1 dendritic cell ADAM19 (MADDAM), BDCA-2, CD1a, CD11c, CD21, CD83, CD86, CD208, CLIP-170 / Restin, Clasterin, DC-LAMP (CD208), DEC-205, estrogen receptor-alpha, Fascin, HLA-DR, NLDC-145, S-100 endothelial cell angiotensin-converting enzyme (ACE, angiotensin-converting enzyme) enzyme), BNH9 / BNF13, CD31 (PECAM-1), CD34, CD54 (ICAM-1), CD62P (p-selectin GMP140), CD105 (endoglin), CD146 (P1H12), D2-40, E-selectin, EN4, endocan (ESM-1), endoglin (CD105), Endoglyx-1, endomucin (Endomuci), endothialin (tumor endothelial marker I, TEM-1, FB5), eotaxin-3, endothelial PAS domain protein 1 (EPAS1, Endothelial PAS domain protein 1) Factor VIII-related antigen, FB21, Flk-1 (VEGFR-2), Flt-1 (VEGFR-I), guanylate-binding protein-1 (GBP-1), GRO-alpha, Hex, intercellular adhesion molecule 2 (ICAM-2), LYVE-1, magic roundabout (MRB), nucleolin, pathologische anatomie Leiden-endothelium (PAL-E), receptor protein tyrosine phosphatase mu (RPTPmu), RTKs, sVCAM-1, TEM1 (tumor endothelial marker 1), TEM5 (tumor endothelial marker 5), TEM7 (tumor endothelial marker 7), TEM8 (tumor endothelial marker 8), thrombomodulin (TM,Thrombomodulin (TM, CD141), vascular cell adhesion molecule-1 (VCAM-1, CD106), VE-cadherin (CD144), vascular endothelial growth factor (VEGF), von Willebrand factor (vWF), enterocyte aminopeptidase N, carbonic anhydrase (CA), carbamoylphosphate synthase (CPS), CD10, dipeptidyl peptidase IV (DDP IV, CD26), E-cadherin, enterocytin, glucose transporter-5 (GLUTS), intestinal alkaline phosphatase (IAP). Phosphatase, intestinal fatty acid-binding protein (I-FABP), liver fatty acid-binding protein (L-FABP), lactase, lectin, neutral endopeptidase (NEP; neprilysin), sodium glucose co-transporter 1 (SGLT1), sucrase isomaltase (SI), virine, zonucleus occluders (Z01, ZO-1), eosinophils BMK-13, CD9, CD44 and CD69, eosinophil cationic protein (ECP, EGI / EG2), eosinophil-derived neurotoxin (EDN), eosinophil peroxidase (EPO, Eosinophil Peroxidase), eosinophil protein-X (EPX,Eosinophil Protein-X), IL-5, LA antigen, MBP1 / MBP2 (major basic proteins), epithelial cell A6 antigen, A33 antigen, adenosine 5'-triphosphatase (ecto-ATPase), aminopeptidase N, APN / CD13, AUA1, BG8 (Lewis Y blood antigen), 20 02756833 201 -Crd-27 Bmi-1 oncoprotein, BRCA1, BTEB1, CA-125, calcyclin, CAR-5, carcinoembryonic antigen (CEA), cathepsin E (CaE), CCIO (Clara cell-specific protein) protein), cystatin C, cytokeratin 8, 14, 18, and 19, connexin-43 (Cx43), desmin, EMA, Exo-1 (Pa-G14), EZH2, ezrin, Foxal, GABRP, galectin-3, gamma, -Glutamyl transpeptidase (GGT), glutamine synthase, H4, HLA-DR, HME1, keratin 5 (K5), keratin 13 and 19, KL-6, lactoferrin, lysosomal-associated membrane protein 1 (LAMP-1), lectin, Leu-7, LhS28, Ly110, Ml, MBEC, MEP-1, MEP7, MOC-31, NSE (neuron-specific enolase), neutral aminopeptidase, P2X7, p16, p16 (INK4A), p63, P-cadherin, prostate-derived factor (PDF), PHM-5, PR1A3, prominin-1 (CD133), prostate antigen (PA) Antigen), Protein Gene Product 9.5 (PGP9.5), Prostatic Binding Protein (PBP), Prostate stem cell antigen (PSCA), Rab13, RAGE, Rat liver antigen (RLA), Rex-1 (Zinc finger protein-42 (Zfp42)), RTE1, 2, 3, 7, 9, 11, 12, 13, RTI40, Secretory components (SC) Component), SPA, SPB, SPC (surfactant protein A, B, C), SPRR1B, SQM1 protein, sucrase-isomaltase (SI), thioesterase H, transthyretin, VAT-1, vimentin red blood cell BGP1, CD36, CD47, CD71 (transferrin receptor), globin, glycophorin A (GPA), glycophorin B, hemoglobin, Rh polypeptide and Rh glycoprotein, N-acetyl-9-O-acetylneuraminic acid, TER119, VLA4 fibroblast ER-TR7, FSP1, prolyl 4-hydroxylase (5B5) germ cells 43-9F, alpha-fetoprotein (AFP,Alpha-fetoprotein), Aggrus, AP-2 gamma, Axdazl, bone morphogenetic protein 15 (BMP15), CA-125, c-Kit (CD117), DAZ-like I (DAZLI), Dppa3, Epidermal growth factor receptor (EGFR), germ cell nuclear antigen 1 (GCNA1, GCNA-1), growth and differentiation factor 9 (GDF9), glypican 3, GP9O-MC301, keratin 7, lactate dehydrogenase (LD), lactate dehydrogenase isoenzyme, lactate dehydrogenase isoenzyme 1 (LDH) 1) M2A, M-CSF, MAGE-44, MATER, OCT p53, PD-GFA, PLAP, podoplanin, proacrosin, RNA-binding motif (RBMA), telomerase, Tesmin, TEXI01, TRA-1-60, VASA, ZAR1, GCAP, sACE, Notch-1, c-kit, GFR alpha-1 glial cell A2B5-antigen (A2B5), GD3, O4-antigen (O4), RC1, Sox-1 / Sox-2, vimentin goblet cell CDX-2, CK7, CK20, ITF, keratin polypeptide 20 (K20), lectin, Muc2, MUC5AC, MUC5B, PKD (PKCmu), trefoil factor (Tff3, Trefoil Factors) Granulosa cell anti-mullerian hormone (AMH), aromatase (CYP19A1), chZPC, follicular regulatory protein (FRP), inhibin, melanoma cell adhesion molecule (MCAM,Melanoma cell adhesion molecule (CDI46), hematopoietic system AC133, BAALC, CD31, CD34, CD43, CD44, CD45, CD84, precursor CD133 / prominin-1, CUB-domain-containing protein I (CDCP1, CUB-domain-containing protein) I) C-Kit / CD117, Endomucin, Flk-2, Flk-2 / F1t3, Flt-3L, LR-1, Ly-5, MYADM, Seal, SCGF, STK-1, TGF-Beta-2, Thy-1, Hepatoblast alpha-fetoprotein (AFP), C / EBP alpha, Cytokeratin 8, 14, and 18, Dfic / Pref-1, E-cadherin, Foxnlb, HNF4, Id3, Liv2 (liv-2), Proxl, SEK1, Interneuronal Parvalbumin (Paravalbumin), Calretinin, Calbindin, Type 1 Cannabinoid Receptor (CB1), CCKpan (Cholecystokinin), Choline Acetyltransferase (ChAT, Choline Acetyl-transferase), Chx10, DLX, Pan-Engralled (EN1, pan-Engralled-1, EN-1), ER81, EVX1, GAD65, GABA(B) receptor I-like (GBRI-L1, GABA(B) receptor I-like), GAD65, GAD67, GATA, GluR-8, ISL1, Lhx1, Lhx5, Lhx3, Lhx6, mGluRl-alpha, MOR, Nloc2-2 (NIcx2.2), NMDAR2D, NOS, Pax2, SDF-I, SPO, Substance P receptor (SPR, Substance P Receptor) islet cell beta-2 / NeuroD, FoxAl, FoxA3, Glutamate decarboxylase (GAD, glutamic acid decarboxylase), GAD65 / GAD67, Gdfl1, GLUT1, GLUT3, GLUT2, GLUT4, 20 02756833 201 -Crd-27 IA2 / ICA512, IAPP / amylin, IGRP, pancreatic islet neogenesis-related protein (INGAP,Islet neogenesis-associated protein), IPF1, Islet-1, MafB, Neurogenin (Ngn3), NIOC6.1, Pax4, Pax6, Pancreatic duodenal homeobox factor-1 (PDX-1), PEK, STF-1 keratinocyte calmodulin, calmodulin-like skin protein, CD24 (thermal stable antigen, nectadrine), CD34, CD98, Epidermal calcium-binding protein (ECaBP), filaggrin, GP37, gp80, hKPRP, ICAM-1, involucrin, keratinocyte transglutaminase, KL3, KPRP, minoxidil sulfotransferase, MTS24, p63, rSQ20 and hSQ16, small proline-rich protein-1 (SPR1, small proline-rich protein-1), SPRR1, SPRR1A, SPRR1B, SPRR2A, SQM I protein, Tob Kupfer cells BGS-18, CD14, CD68, EDI, ED2, F4 / 80, fucose receptor, glucose-6-phosphate dehydrogenase (G6PD), lectin, lysozyme, TNF-α Langerhans cell acetylcholinesterase (AchE), ATPase, CD1a (Leu6), E-cadherin, facin, Fc gamma receptor (FcR, Fc gamma receptor), HLA-DM, HLA-DR(la), KL-6, Langerin (CD207), MHC class II, MT1, neuron-specific enolase (NSE), OKT6, T6(CD1), Leydig cell 3-beta-HSD (3-hydroxysteroid dehydrogenase (3b-HSD, 3-hydroxysteroid dehydrogenase)), 7-dehydrocholesterol reductase (7-DHCR,7-dehydrocholesterol reductase, 11-beta-hydroxysteroid dehydrogenase, calretinin, Cyp17 and Cypllal, esterase, inhibin-alpha, IGF-1 (insulin-like growth factor-1), insulin-like factor 3 (INSL3), Leydig insulin-like gene (Ley IL), liver receptor homolog-1 (LRH-1), luteinizing hormone (LH) receptor, Melan-A, nestin, neuron-specific enolase (NSE), cytochrome P450 aromatase (P450arom), peripheral-type benzodiazepine receptor (PBR), relaxin-like factor (RLF) factor), P450 side-chain cleavage enzyme (SCC), steroidogenic acute regulatory protein (STAR), steroidogenic factor-1 (SF-1, Nr5al, and Ad4bp), thrombospondin 2 (TSP2), 301-1SD VI, PGD synthase, EST, 17I3HSD III, 3-beta-hydroxysteroid dehydrogenase (3beta-HSD) VI, 17-beta-hydroxysteroid dehydrogenase (17beta-HSD) III, vascular cell adhesion molecule 1, estrogen sulfotransferase, and prostaglandin D (PGD) synthase leukocyte, 8-hydroxydeoxyguanosine (8-0HdG,8-hydroxydeoxyguanosine), beta-2 leukocyte integrins (CD11 / CD18), cathepsin G, CD15 (leuM1), CD18 (MHM23), CD43 (leu-22, leu-22), CD45, CD45RA / CD45RB / CD45RO, CD53 (Ox-44), CD68 (KPI, macrocyalin), CD95 (fas), CD166, diiodotyrosine (DIT), EFCC, fecal lactoferrin, glucose-6-phosphatase (G-6-Pase), human leukocyte antigen (HLA), human leukocyte elastase (HLE) Elastase), ICAM-1, Interleukin-8 (IL-8), Li, Lactoferrin, Leukocyte Adhesion Molecule-1 (LAM-1), Leukocyte alkaline phosphatase (LAP), Lectin, L-selectin, Leukocyte-specific protein-1 (LSP1), Ly-9, M6 (Leukocyte Activating Antigen), Mac-1, Myeloperoxidase (MPO), Vasoactive Intestinal Polypeptide (VIP), Macrophage Carboxypeptidase M (CPM) M), cathepsin K, chitotriosidase, CD14, CD68 (Ki-M7, Y2 / 131, Y1 / 82A, EBM11), CD163, sCD163, colony-stimulating factor-1 receptor (CSF-1R), ED-1, ED-2, epidermal growth factor module-containing mucin-like receptor 1 (EMR1,epidermal growth factor module-containing mucin-like receptor 1), factor XIII A, ferritin, HAM-56, Ki-MIP, lysozyme M, MAC-1 / MAC-3, myeloid-related protein (MRP) 14, RFD7 / RFD9, RM3 / 1 mast cell carboxypeptidase A, chymase, CD25, CD34, CD117 (c-Kit), Ki-MC1, Ki-MIP, LAMP-1 / LAMP-2, mast cell tryptase, PDG2 melanocyte ETB (endothelin-B) receptor, HMB-45 (gp100), lipocalin-type prostaglandin D synthase (L-PGDS) synthase), MATP, Mell / Me12, Melan-A (A103), MelEM, Microphthalmia-associated transcription factor (Mitf), PNL2, tyrosinase (T4), tyrosinase-related proteins (TRP) / gp75 20 02756833 20, 1-Crd-27 mesenchymal stem Msxl, TAX, Twistl cells, Merkel cells CD56, Chromogranin A (CGA), cytokeratin 20, Fli-1 and CD99, Go alpha (alpha subunit of guanine nucleotide-binding protein Go), keratin 20, NSE (neuron-specific enolase), TROMA-1, Villin mesothelial cell calretinin, cancer antigen (CA). Antigen)125, CD44, CD44H, cytokeratin 5 / 6, desmin, E-cadherin, HBME-1, keratin, keratin 7 (K7, Keratin7), MCp130, ME1 / ME2, mesothelin, N-cadherin, protein phosphatase inhibitor 1 (I-1, Inhibitor-1), thrombomodulin, vimentin, Wilms' tumor susceptibility gene 1 (WT1, Wilms' tumor susceptibility gene 1), monocyte adipophyllin, angiotensin-converting enzyme, CB12, CD1la (LFA-1 alpha), CD11b, CD14, CD15, CD54, CD62L (L-selectin), CD163, cytidine deaminase (CDD, Cytidine Deaminase, EC 3.5.4.5), DH59B, Fe-receptor, Flt-1 (VEGFR-1), HLA-DR, hMGL, Ki-Mlp, leukocyte tartrate-resistant acid phosphatase (FATRE), Leu-, lysozyme, mannosyl receptor, peanut agglutinin (PNA), thromboplastin, thymidine phosphorylase (TP), tumor necrosis factor (TNF), urokinase (UK), VEP8 and VEP9, thiol-protein disulfide oxidoreductase, motor neuron ChAT (choline acetyltransferase), Choxl 0, En!, Even-skipped (Eve) transcription factor, Evx1 / 2, fibroblast growth factor-1 (FGF1,Fibroblast growth factor-1 (or acid FGF), HB9, Isll (Islet-1), Is12, Islet1 / 2, Lim3, Nloc6, p75 neurotrophic factor receptor (p75(NTR), p75 neurotrophin receptor), REG2, Simi, SMI32 (SMI-32), Zfhl myeloid arginase-1, BM-1 / BM-2 / BM-3 / BM-4 (granulocytes), ClqR(P), CD11a / CD18, CD11b / CD11c, CD13, CD14, CD15, CD18 (beta(2) leukocyte integrin), CD31, CD33, CD34, CD38, CD43, CD123, CD138, C-type lectin-like molecule-1 (CLL-1, C-Type Lectin-Like Molecule-1), CSC-1, F4 / 80, Glut3, Elastase, GPIIb-IIIa, GR-1, Lactoferrin (LF), Ly498, Lysozyme, MAC-1, MC52, M01 (CD11b), MPO (Myeloperoxidase), MY3, MY4, MY7, MY7 / MY9, MY8, MYADM, VIM-D5, Yml, Myoblast Acetylcholinesterase (AChE), ADAM12, Alpha- and Beta-tropomyosin (pT), Beta-enolase, CD56, Desmin, Lactate Dehydrogenase (LDH), M-Cadherin (Muscle Cadherin) cadherin), M-cadherin (muscle cadherin), M-calpain, M-CAM (melanoma cell adhesion molecule), myogenic / muscle regulating factor-4 (MRF4), muscle regulatory factor-5 (Myf-5), MyoD, myogenin, myosin, nls beta-galactosidase, N-cadherin (neural cadherin), p21, phosphoprotein (pp, Phosphoprotein (65;4.5)), Pax3, Pax7, K-isozyme of pyruvate kinase (PK-K), M-isozyme of pyruvate kinase (PK-M,M-isozyme of pyruvate kinase), Tbx3, Titn myocyte ANP (atrial natriuretic peptide), Arpp, BBF-1, B-type natriuretic peptide (BNP), Caveolin-3 (Cav-3), Connexin-43, Desmin, Dystrophin (Xp21), EGFP, Endothelin-1, FABP (Heart fatty-acid-binding protein), GATA-4, MEF-2 (MEF2), MLC2v, Myosin, N-cadherin, Nestin, Popeye domain containing gene 2 (Popdc2) 2) Sarcomere actin, troponin, troponin 1 myoepithelial 14-3-3 sigma, alpha-SMA, caldesmon (CALD), calponin, carbonic cell (MEC) anhydrase III (CAIII), CD10, CD29 and 14-3-3 sigma, CD109, cytokeratin 14, cytokeratin 17, EGFR, L2E3, massin, neuropilin-1, osteonectin (SPARC), p63, p75 neurotrophic factor receptor (p75NTR), p-cadherin, smooth muscle myosin heavy chain (SMMHC). Chain), Thy-1 (thymocyte differentiation antigen), vimentin myofibroblast actin, cadherin-11, desmin, EDA (ED-A fibronectin), GB42, Palladin 4Ig, smooth muscle actin-alpha (SMA-alpha), transforming growth factor (TGF) beta-1, Thy-1, tropomyosin-1 natural killer cell 2B4, CD2, CD3, CD7, CD16 (Leu11b), CD33, CD45, CD56, CA02756833 201 -0,3-27 CD57 / 1-[NK I, CD69, CD107a, CD161, CS I, apple snail (HP, Helix pomatia) receptor, linker for T cell activation (LAT,Linker for activation of T cells), Ly24 (Pgp-I), NKG2A and NKp80, NKH1 (N901), protocadherin 15 (PCDH15), neural stem cell CD15, CD24 (HSA), CD29 (integrin CD49f (integrin a6), (ICAM-1), CD81, CD95 (FAS / APO-1), CD133, CD140a (PDGFRa), CD146, CD184 (CXCR4), CD338 (ABCG2), nestin, Notchl, SSEA-1 neuron ATP-binding cassette transporter A2 (ABCA2), acetylcholinesterase, A1z-50, activating transcription factor 3 (ATF3) 3) Bc1-2, BM88, Calbindin D28, Bag1, Beta-tubulin, c-Fos, Calbindin D28K, Calcineurin, Calretinin, Celebrine, ChAT (Choline Acetyltransferase), Cytochrome Oxidase, Cystathionine, DSS-3, ELF, Herpes Simplex Virus Type 1 (HSV-1), Importin Alpha 5, Myelin-Associated Glycoprotein (MAG), MAP2, MIT-23, N-Acetylaspartate (NAA), NADPH-Diaphorase, Nestin, NeuN (Neuronal Nucleus) nuclei), neurofilaments, non-angiotensin II[(125)I]CGP42112, NSE (neuron-specific enolase), neuroendocrine-specific protein C (NSP-C), olfactory marker protein (OMP), Pax6, Pitx3, Tbr2, Tbrl, PGP9.5 (neuronal marker protein gene product 9.5), protein kinase C (PKC,Protein kinase C), RC3 / neurogranin, S199, SBDP120s, SSEA-1, synapsin 1, TG-1, TGF-beta neutrophil, 8-hydroxydeoxyguanosine (8-0H-dGUA), B-beta 30-43, CD11b, CD18, CD64, C-reactive protein (CRP), gelatinase, granulocyte receptor-1 (Gr-1), HNE ANCAs, human neutrophil lipocalin (HNL), human neutrophil peptides 1-3 (HNP-1-3), L-selectin, lactoferrin, lysozyme, myeloperoxidase (MPO), neutrophil alkaline phosphatase (NAP) Phosphatase), Neutrophil Elastase (NE), Neutrophil Gelatinase-Associated Lipocalin (NGAL), Polymorphonuclear Neutrophil Elastase (PMN-E), Odontoblast Alkaline Phosphatase (ALP), Alpha-1 Type I Collagen (Alpha-II Collagen), DMP1 / DMP2 (Dentin Matrix Protein), Dentin Phosphoprotein (DPP), Dentin Sialoprotein (DSP), Dentin Sialophosphoprotein (DSPP) sialophosphoprotein), enamelicin, Mov13 allele, nestin, osteoadherin (OSAD), osteopontin (OPN), osteocalcin (OC,Osteocalcin), Phex (phosphate-regulating gene with homologies to endopeptidases on X chromosome), oocyte Bicaudal-D (Bic-D), BMP15 (bone morphogenetic protein 15), c-kit, c-Mos, GDF9 (growth and differentiation factor 9), heparin-binding placental protein (HBPP), IGFBP-1, Kit ligand (KL), leptin, LH receptor (LH-R), maternal antigen that embryos require (MATER), MSY2, NALP9, Orb, Oskar, p180, pentraxin 3, VASA, zona pellucida (ZP) Pellucida (ZP1, ZP2, ZP3 or ZPA, ZPB, ZPC), zygotic arrest 1 (ZAR1), osteoblast alkaline phosphatase (ALP), alpha-1 procollagen, bone Gla protein (BGP), bone sialoprotein (BSP), Cbfal / Osf2, type I collagen, Ell, osteocalcin, osteopontin, Phex, RP59 osteoclast acidic ATPase, calcitonin (CT) receptor (CTR), type I collagen carboxyterminal telopeptide (1CTP), cathepsin K, creatine kinase BB (CKBB) BB), EDI, Kati antigen (Katl-Ag, Kati-antigen), procollagen carboxyterminal propeptide (P1CP, procollagen carboxyterminal propeptide), RANK, tartrate-resistant acidic ATPase, tartrate-resistant acidic phosphatase (TRAP,(tartrate-resistant acid phosphatase), Vitronectin Receptor (VR, VNR), Paneth cell alpha-defensin (cryptin), cryptin, cryptin-1, cryptin-2, cryptin-3, cryptin-4, defensin, Enhancing factor (EF), Granulocyte-macrophage colony-stimulating factor (GM-CSF), Human Defensin 5 (HD-5), Lysozyme, Matrili, Syn, group II phospholipase A2 (PLA2), trypsin pericytes alpha-smooth muscle actin (α-SMA), angiopoietin-1, angiopoietin-CA02756833 201-0,3-27' (Ang2), CD13, desmin, endothiarin (CD248), NG2 chondroitin sulfate proteoglycan (proteoglyean), PDGFR-beta, RGS5, Thy-1 phagocyte alpha-l-antitrypsin, c-fms, CD11b / CD18 (beta-2 integrin), CD11c / CD18, CD14, CD36, CD64, CD68, CD204, C3 receptor (CR3, C3 Receptor), CSF-1, ED1 / ED2, F4 / 80, Mac-1, MARCO, M-CSF, MITF, MRP8 / MRP14, Myeloperoxidase (MPO), RFD7, S100 protein, TacP (Tartrate-resistant acid phosphatase), TFEC, TPP-ase, Platelet, Adenylate kinase (AK), Annexin V, Beta-thromboglobulin (BTG), (Platelet (thrombocyte)) CD31, CD36, CD49b, CD62, CD62P (P-selectin), CD63 (Glycoprotein-53), Glycocalicin (GC), GMP-140 (Platelet alpha-granulosa membrane protein), Glycoprotein V (GPV) V), lysosome-associated membrane protein-2 (LAMP2), PAC-1, platelet-derived microparticles (PDMP), platelet-related factor XIIIa, platelet factor 4 (PF4), P-selectin (CD62P), serotonin (5-HT), thrombospondin (TSP), thromboxane B2 lung cell alkaline phosphatase, aquaporin 5 (Aqp-5),Aquaporin 5), Bauhinia purpurea lectin (BPL), Caveolins (Cav-1, -2, and -3), CD44v6, CD208 (DC-LAMP), CP4, Cx43, DC-LAMP (CD208), gp600, HTI56, ICAM-1, KL-6, MUC1, TI alpha, Thomsen-Friedenreich antigen, IF antigen, Thyroid Transcription Factor 1 (TTF-1), Podocyte alpha-actinin-4, B7-1, CD2AP, CD10, Cortactin, Desmin, Dystroglycan (DG), Ezrin, FAT, Glomerular epithelial protein 1 (GLEPP1), Lmx lb, Microtubule-associated protein 1 light chain 3 (MAP-LC3), Myocilin, NEPH1, Nephrin, P-Cadherin, Podocalyxin-like protein in humans (PHM-5), Podosin, Podoplanin, Podocalyxin (PC), Synaptopodin, T- / H-Cadherin (CDH13), VEGF, Vimentin, Wilms' tumor-1 protein (WT-1), Zonula-1 (ZO-1) Occludens-1), primordial germ cells Blimpl, Mili, Miwi, UTF1, AP-2, Eps8, GCNA1, 0C13 / 4, PLAP, cells (gonocytes) VASA, Purkinje cell aldolase C (zebrin II), calmodulin-dependent phosphodiesterase (CaM-PDE), Car8 CD3 (Leu-4), calbindin (CaBP, 28-kDa calbindin-D, calcium-binding protein calbindin-D28K), celeveline, cGMP-dependent protein kinase, clatheline, ELF, gamma-aminobutyric acid transaminase (GABA-T,gamma-aminobutyric acid transaminase), 67kDa isoform of glutamic acid decarboxylase (GAD67), guanosine 3':5'-phosphate-dependent protein kinase, HDAC6, HFB-16 (KIAA0864 protein), inositol 1,4,5-triphosphate receptors (IP3R), L7, microtubule-associated protein 2 (MAP2), MAP-120lcDa, NMDA-NR1 (NMDA-Rl receptor subtype), OMP (olfactory marker protein), P400 protein, P450 side chain cleavage (P450scc). cleavage), PCA-1 / PCA-2, Purkinje cell phosphoprotein of Mr 260,000 (PCPP-260), PDE5 / PDE1B, PDE9A, PEP-19 (PEP19), PMCA (plasma membrane calcium pump), SERCA, Spot35 (S-35, Spot 35) protein, Zebrin I and Zebrin II pyramidal cell calcium / calmodulin-dependent protein kinase II (CaMK, CaMKII), Emxl, GluR2 / 3, MAP2 (microtubule-related protein 2), MATH-2, mGluRl / mGluR5, neurogranin / RC3, PSD-95 / SAP90, RPTP alpha, receptor protein tyrosine phosphatase gamma (RPTP gamma,Receptor protein tyrosine phosphatase gamma), RPTP zeta / beta, SCIP, SMI-32, Tbrl, Zfp312, Pax6, Tbr2 / Eomes, NeuroD, Reed-Stemberg CD15 (Leu-M1), CD30 (Ber-H2, Ki-1), CD74 (LN2), Fascin cells, Sertoli cells, androgen-binding protein (ABP), AMH (anti-Müllerian hormone), calretinin, cathepsin L, cytokeratin 18 (CK18), cytokeratin, clatherin, cyclic protein (CP-2), Desert Hedgehog (Dhh) hedgehog), desmin, Fas / FasL, GATA-1, GATA-4, inhibin B, M2A, Müllerian duct inhibitor (MIS, Müllerian CA 02756833 201-0,3-27 inhibiting substance), serotonin receptor, stem cell factor (SCF), Sox9, sulfated glycoprotein-1 (SGP-1), sulfated glycoprotein-2 (SGP-2), transferrin, vimentin, Wilms' tumor suppressor 1 (WT-1, WTI), spermatocyte 8D11, acrosin binding protein (ACRBP), GCNA1, GP9O-MC301, lactate dehydrogenase-X (LDH-X, Lactate Dehydrogenase-X), p73 / 5.7, Pgk-2, Proacrosin, SCP1 / SCP2 / SCP3 (Synaptonemal Complex Protein), SOX-17, SPTRX-3, TEX101, XMR, sperm amidase, aromatase, CD46, TEPA, astrocellular alpha-SMA (smooth muscle actin, alpha), c-Myb, cysteine ​​and glycine-rich protein 2 (CRP2,Cysteine- and glycine-rich protein 2), Desmin, Fibroblast Activation Protein (FAP), GFAP, Reelin, S100, Synaptophysin, Vimentin, Vinculin, Interstitial cell cadherin-11, Calretinin, CD10, CD1I7, Desmin, Endoglix-1, Endosialin (TEM1, CD248), Fibroblast Activation Protein (FAP), Neuronal ganglioside GD2, Nucleostemin, Interstitial nidogen extracellular matrix protein (Snep) Protein), tenascin, CD13, CD29, CD44, CD63, CD73, CD90, CD166, STRO-1, HOP-26 (CD63), CD49a, SB-10 (CD166), alpha and beta subunits of inhibin / activin, alpha-smooth muscle actin stem cell 4G10.3, AA4, AC133, Bcrp / ABCG2, c-Mpl, CD9, CD15, CD24, CD29, CD30, CD34, CD133 (prominin-1), CDCP1, connexin 43, endoglin, ER-MP12, fibroblast growth factor receptor-3, Flk-2, gpt, human Rex-1 (hRex-1, Human Rex-1), Importin alpha 1, Interleukin-2 receptor, Interleukin-3 receptor alpha chain, KDR, Keratin 19, c-kit, Lamin A / C, Macromolecular insoluble cold globulin (MICG), Musashi-1, Nanog, Nestin, Notchl, Nucleostemin, 0ct4 (Oct-4), p63, Podocalyxin, R2 / 60, PSCA (Prostate stem cell antigen), Soxl, SOX2, SSEA-1, SSEA-3, Stem cell antigens 1 and 2 (Sca-1 and Sca-2), Telomerase, Thy-1, Transcription factor Stat5, Synaptic cell brain spectrin, Chromogranin A / Chromogranin C, ConA-binding glycoprotein, D2-protein, D3-protein, Growth-related protein-43 (GAP-43,Growth-Associated Protein-43), Neural cell adhesion molecule (NCAM / N-CAM D2), p65, Post-Synaptic Density protein-95 (PSD95), Secretogranin II, Synapsin, Synaptin, Synaptobrevin, Synaptoglyline (p29), Synaptophysin, Synaptoporin, Synaptotagmin I, Syntaxin, Synaptic vesicle protein 2 (SV2), Vesicular glutamate transporter (VGLUT1 and VGLUT2), T cell ART2, CD1a, CD1d, CD2, CD3, CD4, CD5, CD7, CD8, CD1 lb (Mac-1), CD25 (Interleukin-2 receptor alpha), CD38, CD45RO, CD72, CD134 (0X40), CD150, CRTAM, FOXP3, FT2, GPCA, HLA-DR, HML-1, HT23A, Leu-22, Ly-2, Ly-m22, MICG, MRC OX-8, MRC, OX-22, 0X40, Programmed death-1 (PD-1), RT6, T cell receptor (TCR), Thy-1 (CD90), Thymic shared antigen-2 (TSA-2), Theca cell alkaline phosphatase (AP). phosphatase), BMP-4, CYP17, NR5A1 (steroidogenic factor-1, SF-1), thymocyte 20 alpha SDH, CD1, CD1a, CD2, CD4, CD5, CD8, CD25, CD26, CD45RA, CD53, CD69, CD71, CD150, cortical thymocyte-specific antigen (CTX) of Xenopus), GIX, granzyme, H-2, H-2D, HBA-71, ICT-1 antigen (thymocyte differentiation antigen), IL-7, immature thymocyte antigen-1 (1MT-1,Immature thymocyte antigen-1), J11d (heat-stable antigen), JL1, lymphocyte function associated antigen-1 (LFA-1), Ly-1 / Ly-2, Ly-2 / 3, Ly-24 and Ly6C, M241, MRC OX-2, PNA receptor, Sca-1 / Sca-2 (stem cell antigen), T3 (OKT3), T6 (OKT6), T cell-activating protein (TAP), thymocyte-activating molecule (THAM), Thy-1, Thy-1.1, Thy-2, Thymic common antigen-1 (TSA-1, Thymic shared antigen-1), thymic leukemia antigens (TL antigens), TL3, H-2, TL, LyI and Ly2, Thy-1, Ly-1, Ly-2, T200, T1, T4, T5, 16, T8 trophoblast cells Cdknlc, Cdx2, CHL1, cytokeratin (Cytokeration), cytokeratin-7 (CK7), D1x3, FD0161G, glial cell deficiency 1 (Gcml), H315, H316, Handl, HASH2, human chorionic gonadotropin (hCG), human chorionic gonadotropin beta (hCG-beta) beta), HLA-A / HLA-B / HLA-CiFILA-G, human placental lactogen (hPL), Id-1, Id2, 1-mfa, inhibin A, integrin, Kip2, M30, Mash2, MNF116, NDOGI / NDOG2, OKT9, plasminogen activator inhibitor-1 (PAL-1), PHLDA2, placental lactogens (PL-1, PL-2), PLP-A / PLP-B / PLP-C / PLP-D / PLP-E / PLP-F / PLP-L / PLP-M / PLP-N, SBU-I, SP-1, TAl / TA2 (trophoblast antigens), and / or Tfeb Non-limiting examples of such gene-derived regulatory elements include: In certain embodiments, the gene product is Cre, Cas9, or a variant thereof, which is operably linked to a tissue-specific regulatory element.

[0085] In certain embodiments, the expression of a gene product capable of editing a conditionally inducible gene editing site can be regulated by regulatory elements such as promoters and / or enhancers, which can provide expression in any cell of a transgenic animal or animal model, or substantially any cell of a transgenic animal or animal model. ACTB (beta-actin), cytomegalovirus (CMV), elongation factor 1 alpha (EF1α), simian vacuolating virus 40 (SV40), thymidine kinase (TK), phosphoglycerate kinase (PGK), chicken beta-actin (CAG), and / or ubiquitin c (UbC). Non-limiting examples of such modulating elements, including:

[0086] In certain embodiments, at least one nucleic acid sequence encoding a gene product capable of editing an editing site may include a regulatory element comprising a tetracycline-responsive element capable of inducing gene expression of the gene product in response to the addition or removal of tetracycline from a transgenic animal or animal model or transgenic cell.

[0087] In certain embodiments, the conditionally inducible gene editing sites, such as at least one conditionally inducible gene editing site and / or one or more additional conditionally inducible gene editing sites, include a LoxP site, and at least one nucleic acid editing sequence encodes Cre. In certain embodiments, Cre can be operably linked to a regulatory element, such as a promoter, which restricts its expression to a specific tissue, cell, organ, or combination thereof.

[0088] In certain embodiments, the activity, expression, and / or function of Cre can be induced, which may include exposing transgenic non-human animals or animal models or cells to exogenous stimuli. In certain embodiments, Cre can be fused to peptides that modulate its activity, thereby allowing Cre to provide enzymatic activity only in the presence of exogenous compounds, such as tamoxifen or its analogs or equivalents. In certain embodiments, Cre can be fused to mutant forms of estrogen receptors. In certain embodiments, Cre may be Cre ERT2.

[0089] In certain embodiments, at least one conditionally inducible gene editing site may further include a second conditionally inducible gene editing site, the second conditionally inducible gene editing site may include an exogenous nucleic acid sequence or an endogenous nucleic acid sequence, the nucleic acid editing sequence encoding a gene product capable of editing the second conditionally inducible gene editing site. In certain embodiments, at least one conditionally inducible gene editing site may include two conditionally inducible gene editing sites, each conditionally inducible gene editing site may be adjacent to a regulatory region. In certain embodiments, at least one conditionally inducible gene editing site may include a LoxP site adjacent to a regulatory region. In certain embodiments, at least one conditionally inducible gene editing site may include a LoxP site adjacent to an exon. In certain embodiments, at least one conditionally inducible gene editing site may include a LoxP site adjacent to a critical regulatory region in the Gnpat gene. In certain embodiments, at least one conditionally inducible gene editing site may include a LoxP site adjacent to exon 2 in the mouse Gnpat gene. In certain embodiments, at least one conditionally inducible gene editing site may include a LoxP site adjacent to the regulatory region, and the gene product capable of editing the conditionally inducible gene editing site is Cre.

[0090] In certain embodiments, at least one nucleic acid editing sequence may include one or more sequences encoding a gene product capable of editing a conditionally inducible gene editing site, and each of the one or more sequences encoding a gene product capable of editing a conditionally inducible gene editing site may be provided in the same or different regions of the genome. In certain embodiments, at least one nucleic acid editing sequence includes a sequence encoding one guide RNA or its equivalent, and a sequence encoding Cas9 or a variant thereof. In certain embodiments, at least one nucleic acid editing sequence includes two independent sequences, each encoding one guide RNA or its equivalent, and a sequence encoding Cas9 or a variant thereof. In certain embodiments, at least one nucleic acid editing sequence includes two independent sequences, each encoding one guide RNA or its equivalent, and each guide RNA is capable of binding to a conditionally inducible gene editing site adjacent to a regulatory region. In certain embodiments, at least one nucleic acid editing sequence includes two independent sequences, each encoding one guide RNA or its equivalent, and each guide RNA is capable of binding to a conditionally inducible gene editing site in the Gnpat gene. In certain embodiments, at least one nucleic acid editing sequence comprises two independent sequences, each encoding one guide RNA or its equivalent, and each guide RNA is capable of binding to a conditionally inducible gene editing site adjacent to a regulatory region in the Gnpat gene. In certain embodiments, at least one nucleic acid editing sequence comprises two independent sequences, each encoding one guide RNA or its equivalent, and each guide RNA is capable of binding to a conditionally inducible gene editing site adjacent to an exon of the Gnpat gene. In certain embodiments, at least one nucleic acid editing sequence comprises two independent sequences, each encoding one guide RNA or its equivalent, and each guide RNA is capable of binding to a conditionally inducible gene editing site adjacent to exon 2 of the Gnpat gene.

[0091] In certain embodiments, at least one conditionally inducible gene editing site may include a guide RNA or equivalent binding site adjacent to a regulatory region. In certain embodiments, at least one conditionally inducible gene editing site may include a guide RNA or equivalent binding site adjacent to an exon. In certain embodiments, at least one conditionally inducible gene editing site may include a guide RNA or equivalent binding site adjacent to a critical regulatory region in the Gnpat gene. In certain embodiments, at least one conditionally inducible gene editing site may include a guide RNA or equivalent binding site adjacent to exon 2 in the mouse Gnpat gene. In certain embodiments, at least one conditionally inducible gene editing site may include a guide RNA or equivalent binding site adjacent to a regulatory region, and the gene product capable of editing the conditionally inducible gene editing site is Cas9 or a variant thereof, and one or more guide RNAs or equivalents capable of binding to at least one editing site including the guide RNA or equivalent binding site.

[0092] In certain embodiments described herein, the conditionally inducible gene editing site may include a sequence capable of binding to one or more gene products encoded by at least one nucleic acid editing sequence. Those skilled in the art will be able to select a suitable sequence for the conditionally inducible gene editing site in view of the teachings herein, thereby enabling one or more gene products encoded by at least one nucleic acid editing sequence to modify the conditionally inducible gene editing site. In certain embodiments, the conditionally inducible gene editing site may be one or more of the following: a LoxP site, a flippase recognition target (FRT) site, an attP and attB site, an sgRNA binding site, a FokI site, or a zinc finger nuclease site. In certain embodiments, one or more conditionally inducible gene editing sites may be sequences capable of binding to one or more of the following: Cre, FLP, PhiC31, Cas9, Cas9 variants, guide RNA, CRISPR RNA, FokI, zinc finger nucleases, transcription activator-like effector nucleases, any variant thereof, or any combination thereof. In certain embodiments, the conditionally inducible gene editing site may be ATAACTTCGTATANNNTANNNTATACGAAGTTAT (SEQ ID NO: 3), or any of its reverse complement or equivalent complementary sequences, where N may be any base pair. In certain embodiments, the conditionally inducible gene editing site may be one or more of the following, any of its reverse complement, or a complementary sequence capable of binding to one or more desired gene products: ATAACTTCGTATAATGTATGCTATACGAAGTTAT(Sequence ID 4), ATAACTTCGTATAATGTATaCTATACGAAGTTAT(Sequence ID 5), ATAACTTCGTATAATGTgTaCTATACGAAGTTAT(Sequence ID 6), ATAACTTCGTATAAaGTATcCTATACGAAGTTAT(Sequence ID 7), ATAACTTCGTATAAgaaAccaTATACGAAGTTAT (Sequence ID 8), ATAACTTCGTATAtaaTACCATATACGAAGTTAT (Sequence ID 9), ATAACTTCGTATAAgaTAGAATATACGAAGTTAT (Sequence No. 10), ATAACTTCGTATAcgaTAccaTATACGAAGTTAT(Sequence ID 11), TACCGTTCGTATANNNTANNNTATACGAAGTTAT(Sequence ID 12), ATAACTTCGTATANNNTANNNTATACGAACGGTA (Sequence ID 13), or ATAACTTCGTATAatgtacatTATACGAAGTTAT (Sequence ID 14), where N can be any of the base pairs.

[0093] In certain embodiments, the conditionally inducible gene editing site may be GAAGTTCCTATTCtctagaaaGTATAGGAACTTC (SEQ ID NO: 15), or a reverse complement or equivalent complementary sequence thereof.

[0094] In certain embodiments, the conditionally inducible gene editing site may be GTGCCCCAACTGGGGTAACCTttGAGTTCTCTCAGTTGGGGG (SEQ ID NO: 16) and / or TGCGGGTGCCAGGGCGTGCCCttGGGCTCCCCGGGCGCGTACTCC (SEQ ID NO: 17), or the reverse complement or equivalent complementary sequence of either of these.

[0095] In certain embodiments, at least one nucleic acid editing sequence encoding a gene product capable of editing a conditionally inducible gene editing site may be CAG-CREERT2.

[0096] In certain embodiments, the gene product may be Cre, flippase, PhiC31, Cas9, sgRNA, crRNA, activator-like effector nuclease (TALEN), zinc finger nuclease (ZFN), any variant thereof, or any combination thereof. In certain embodiments, the gene product is Cre, and one or more conditionally inducible gene editing sites include a LoxP site. In certain embodiments, the gene product is one or more guide RNAs or equivalents thereof, and Cas9 or a variant thereof, and the conditionally inducible gene editing sites are capable of binding to the one or more guide RNAs or equivalents, and Cas9 or a variant thereof forms a ribonucleoprotein complex capable of editing the conditionally inducible gene editing sites.

[0097] In certain embodiments, gene product expression is induced by the addition of an exogenous compound, an exogenous stimulus, or both. In certain embodiments, an exogenous compound may mean a compound that is not naturally present in transgenic animals or animal models or transgenic cells, or an exogenous compound may mean a naturally occurring compound that is administered at concentrations exceeding physiological levels to induce expression. In certain embodiments, an exogenous stimulus may be any stimulus that is not naturally present in transgenic animals or transgenic models or transgenic cells. Non-limiting examples of exogenous stimuli may include light, temperature, or a combination thereof, such as a specific duration or wavelength. In certain embodiments, an exogenous compound may be tamoxifen, 4-hydroxytamoxifen, mifepristone, or any compound capable of inducing the activity of Cre fused to a mutant form of the estrogen receptor. In certain embodiments, an exogenous compound may be tetracycline or doxycycline.

[0098] In certain embodiments, in events where two or more conditionally inducible gene editing sites are present, the first, second, third, fourth, fifth and other conditionally inducible gene editing sites are not edited by the gene product at birth or prenatally in the animal. As used herein, "not edited by the gene product at birth or prenatally in the animal" can mean substantially all of the genome of the transgenic animal or transgenic cell in its unedited form, in which case one or more gene products encoded by at least one nucleic acid editing sequence are not expressed in the transgenic animal or animal model or cell, do not edit the genome, or are a combination thereof. In certain embodiments, one or more conditionally inducible gene editing sites may be edited at birth or prenatally in the animal when an exogenous compound or exogenous stimulus is provided to the transgenic animal at birth or prenatally, such as an embryo.

[0099] In certain embodiments, at least one genome of a transgenic animal or animal model or cell includes a genome, where the genome can mean a genome that includes at least one of a conditionally inducible gene editing site in the regulatory region of a gene, a nucleic acid editing sequence encoding a gene product capable of editing a conditionally inducible gene editing site, and may further include one or more additional editing sites in one or more additional regulatory regions of one or more additional genes, and one or more additional nucleic acid editing sequences encoding a gene product capable of editing one or more additional conditionally inducible gene editing sites. In certain embodiments, a transgenic non-human animal or animal model or cell may be heterozygous with respect to one or more of the elements. In certain embodiments, a transgenic non-human animal or animal model or cell may be homozygous with respect to one or more of the elements. In certain embodiments, the entire genome of a transgenic animal or animal model or cell may include a genome. In certain embodiments, gene interactions may occur between one or more additional genes, which may result in a reduction of plasmalogen levels. For example, in a non-human transgenic animal, animal model, or cell having a first gene with normal plasmalogen expression / activity and a second gene with normal plasmalogen expression / activity, the interaction between the first gene and the second gene may result in reduced plasmalogen expression / activity. Alternatively, in a non-human transgenic animal, animal model, or cell having a first gene with reduced plasmalogen expression / activity and a second gene with normal plasmalogen expression / activity, the interaction between the first gene and the second gene may result in reduced plasmalogen expression / activity.

[0100] transgenic cells In embodiments, transgenic cells and / or cells derived from transgenic animals or animal models described herein are provided herein. In certain embodiments, the cells may be derived from or isolated from transgenic animals or animal models described herein, thereby the cells containing the genome of the transgenic animal or animal model. In certain embodiments, the cells may be animal cells, including cells derived from mammals, birds, reptiles, amphibians, fish, arthropods, vertebrates, or invertebrates. In certain embodiments, transgenic cells can be obtained by modifying cells of a non-human animal to contain the genome described herein. Those skilled in the art will be able to select an appropriate method for obtaining the transgenic cells described herein in view of the teachings herein. In certain embodiments, the transgenic cells may not be derived from or isolated from transgenic animals or animal models. In certain embodiments, the transgenic cells can be modified and maintained ex vivo, for example, by culturing cells under appropriate conditions. In certain embodiments, transgenic cells may be immortalized or may be intended for immortalization.

[0101] In another embodiment, transgenic cells can be obtained by modifying a known cell line, either a non-human animal or an animal model, to contain the genome described herein. Those skilled in the art will be able to select an appropriate method for obtaining the transgenic cell lines described herein, in view of the teachings herein. Some non-limiting examples may be tissue-specific Cre lines, inducible ubiquitous driver lines, or any preferred non-human animal cell line.

[0102] Methods and uses of transgenic animals or animal models and cells as described herein. Embodiments herein provide a method for reducing postnatal plasmalogen levels in a non-human animal or animal model, comprising the steps of: providing a transgenic non-human animal or animal model described herein; and inducing the expression of a nucleic acid editing sequence encoding a gene product capable of editing at least one conditionally inducible gene editing site, wherein editing of at least one conditionally inducible gene editing site reduces the expression of a gene that regulates the plasmalogen biosynthesis pathway.

[0103] Embodiments provide a method for inducing a condition or disease in a non-human animal or animal model associated with reduced postnatal plasmalogen levels, the method including the steps of: providing a transgenic animal or animal model as described herein; inducing the expression of a nucleic acid editing sequence encoding a gene product capable of editing at least one conditionally inducible gene editing site, wherein editing of at least one conditionally inducible gene editing site reduces the expression of a gene that regulates the plasmalogen biosynthesis pathway; and monitoring the transgenic animal or animal model with respect to symptoms of the condition or disease.

[0104] Embodiments provide a method for determining the efficacy of a compound or composition for treating a condition or disease associated with reduced plasmalogen levels, the method including the steps of: providing a transgenic animal or animal model or cells as described herein; and one of the following: 1) A step of inducing the expression of a nucleic acid editing sequence encoding a gene product capable of editing at least one conditionally inducible gene editing site, wherein the editing of at least one conditionally inducible gene editing site is for reducing the expression of a gene that regulates the plasmalogen biosynthesis pathway; The steps of administering a compound or composition to a transgenic animal or animal model; and A step of monitoring a transgenic animal or animal model with respect to symptoms of a condition or disease; or 2) A step of administering a compound or composition to a transgenic animal or animal model; A step of inducing the expression of a nucleic acid editing sequence encoding a gene product capable of editing at least one conditionally inducible gene editing site, wherein the editing of at least one conditionally inducible gene editing site is for reducing the expression of a gene that regulates the plasmalogen biosynthesis pathway; and A step of monitoring a transgenic animal or animal model with respect to symptoms of a condition or disease; or 3) A step of administering a compound or composition to a transgenic animal or animal model and inducing the expression of a nucleic acid editing sequence encoding a gene product capable of editing at least one conditionally inducible gene editing site, wherein the editing of at least one conditionally inducible gene editing site is for reducing the expression of a gene that regulates the plasmalogen biosynthesis pathway; and A step of monitoring a transgenic animal or animal model for symptoms of a condition or disease.

[0105] In embodiments, methods for generating transgenic animals or animal models as described herein are provided herein, the methods include the steps of: providing at least one non-human animal or animal model; introducing at least one gene editing sequence into a gene, a portion thereof, or a regulatory element involved in plasmalogen biosynthesis to generate a first edited gene in the non-human animal or animal model; crossing the non-human animal or animal model having the first edited gene with a second non-human animal or animal model having a nucleic acid editing sequence in a separate locus encoding a gene product to generate a transgenic animal or animal model; and inducing the expression of a gene product in the transgenic animal or animal model to edit the first edited gene, wherein the editing of the first gene results in a decrease in the level of the gene product of the first edited gene, reduced activity of the first edited gene product of the first edited gene, reduced plasmalogen levels in the transgenic animal or animal model, or any combination thereof.

[0106] Specific embodiments of the methods or uses described herein may include the step of inducing the expression of a nucleic acid editing sequence encoding a gene product capable of editing at least one conditionally inducible gene editing site. In specific embodiments of the methods or uses, the conditionally inducible gene editing site may include a plurality of conditionally inducible gene editing sites, providing a nucleic acid editing sequence encoding a gene product capable of editing a plurality of conditionally inducible gene editing sites. In specific embodiments where the conditionally inducible gene editing site includes two or more conditionally inducible gene editing sites, the method may include one or more nucleic acid editing sequences capable of editing a plurality of conditionally inducible gene editing sites. In specific embodiments, induction of expression may include administration of an exogenous compound to a transgenic animal or animal model or cells. In specific embodiments, the gene product capable of editing a gene may include Cre ERT2, and induction may include the addition of tamoxifen, 4-hydroxytamoxifen, mifepristone, or any compound capable of inducing the activity of Cre fused to a mutant form of the estrogen receptor. In certain embodiments, a nucleic acid sequence encoding a gene product capable of editing at least one conditionally inducible gene editing site can be operably linked to an inducible regulatory element. In certain embodiments, a nucleic acid sequence encoding a gene product capable of editing at least one conditionally inducible gene editing site can be operably linked to a tetracycline or doxycycline-responsive regulatory element. In certain embodiments, a nucleic acid sequence encoding a gene product capable of editing at least one conditionally inducible gene editing site can be regulated by the addition or removal of tetracycline and / or doxycycline from transgenic animals or animal models or cells.In a particular embodiment, a plurality of nucleic acid sequences encoding a gene product capable of editing multiple gene products includes gene products capable of editing each of the plurality of gene products, such as one gene product, two gene products, three gene products, four gene products, five gene products, six gene products, seven gene products, eight gene products, nine gene products, or ten or eleven or more gene products.

[0107] In certain embodiments, editing of at least one conditionally inducible gene editing site reduces the expression of genes that regulate the plasmalogen biosynthesis pathway. In certain embodiments, editing of one or more conditionally inducible gene editing sites reduces the expression of genes that regulate the plasmalogen biosynthesis pathway. As used herein, a reduction in expression may mean a reduction in the expression of any of the genes that regulate the plasmalogen biosynthesis pathway compared to a reference animal, value, tissue, sample, or cell. In certain embodiments, a reduction in the expression of a gene that regulates the plasmalogen biosynthesis pathway may be a reduction in the gene, which may result in the observation of symptoms of a condition or disease in a transgenic animal or animal model or cell when monitored. In certain embodiments, a reduction in the expression of a gene that regulates the plasmalogen biosynthesis pathway may not induce symptoms or a condition in a transgenic animal or animal model or cell. In certain embodiments, a reduction in the expression of a gene that regulates the plasmalogen biosynthesis pathway is a reduction that induces symptoms or a condition in a transgenic animal or animal model. In certain embodiments, the reduction in the expression of genes regulating the plasmalogen biosynthesis pathway was 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, 1.1%, 1.2%, 1.3%, 1.4%, 1.5%, 1.6%, 1.7%, 1.8%, 1.9%, 2%, 2.1%, 2.2%, 2.3%, 2.4%, 2.5%, 2.6%, 2.7%, 2.8%, 2.9%, 3%, 3.1%, 3.2%, 3.3%, 3.4%, 3.5%, 3.6%, 3.7%, 3.8%, 3.9%, 4%, 4.1%, 4.2%, and 4. 3%, 4.4%, 4.5%, 4.6%, 4.7%, 4.8%, 4.9%, 5%, 5.1%, 5.2%, 5.3%, 5.4%, 5.5%, 5.6%, 5.7%, 5.8%, 5.9%, 6%, 6.1%, 6.2%, 6.3%, 6.4%, 6.5%, 6.6%, 6.7%, 6.8%, 6 0.9%, 7%, 7.1%, 7.2%, 7.3%, 7.4%, 7.5%, 7.6%, 7.7%, 7.8%, 7.9%, 8%, 8.1%, 8.2%, 8.3%, 8.4%, 8.5%, 8.6%, 8.7%, 8.8%, 8.9%, 9%, 9.1%, 9.2%, 9.3%, 9.4%, 9.5%、9.6%、9.7%、9.8%、9.9%、10%、10.1%、10.2%、10.3%、10.4%、10.5%、10.6%、10.7%、10.8%、10.9%、11%、11.1%、11.2%、11.3%、11.4%、11.5%、11.6%、11.7%、11.8%、11.9%、12%、12.1%、12.2%、12.3%、12.4%、12.5%、12.6%、12.7%、12.8%、12.9%、13%、13.1%、13.2%、13.3%、13.4%、13.5%、13.6%、13.7%、13.8%、13.9%、14%、14.1%、14.2%、14.3%、14.4%、14.5%、14.6%、14.7%、14.8%、14.9%、15%、15.1%、15.2%、15.3%、15.4%、15.5%、15.6%、15.7%、15.8%、15.9%、16%、16.1%、16.2%、16.3%、16.4%、16.5%、16.6%、16.7%、16.8%、16.9%、17%、17.1%、17.2%、17.3%、17.4%、17.5%、17.6%、17.7%、17.8%、17.9%、18%、18.1%、18.2%、18.3%、18.4%、18.5%、18.6%、18.7%、18.8%、18.9%、19%、19.1%、19.2%、19.3%、19.4%、19.5%、19.6%、19.7%、19.8%、19.9%、20%、20.1%、20.2%、20.3%、20.4%、20.5%、20.6%、20.7%、20.8%、20.9%、21%、21.1%、21.2%、21.3%、21.4%、21.5%、21.6%、21.7%、21.8%、21.9%、22%、22.1%、22.2%、22.3%、22.4%、22.5%、22.6%、22.7%、22.8%、22.9%、23%、23.1%、23.2%、23.3%、23.4%、23.5%、23.6%、23.7%、23.8%、23.9%、24%、24.1%、24.2%、24.3%、24.4%、24.5%、24.6%、24.7%、24.8%、24.9%、25%、25.1%、25.2%、25.3%、25.4%、25.5%、25.6%、25.7%、25.8%、25.9%、26%、26.1%、26.2%、26.3%、26.4%、26.5%、26.6%、26.7%、26.8%、26.9%、27%、27.1%、27.2%、27.3%、27.4%、27.5%、27.6%、27.7%、27.8%、27.9%、28%、28.1%、28.2%、28.3%、28.4%、28.5%、28.6%、28.7%、28.8%、28.9%、29%、29.1%、29.2%、29.3%、29.4%、29.5%、29.6%、29.7%、29.8%、29.9%、30%、30.1%、30.2%、30.3%、30.4%、30.5%、30.6%、30.7%、30.8%、30.9%、31%、31.1%、31.2%、31.3%、31.4%、31.5%、31.6%、31.7%、31.8%、31.9%、32%、32.1%、32.2%、32.3%、32.4%、32.5%、32.6%、32.7%、32.8%、32.9%、33%、33.1%、33.2%、33.3%、33.4%、33.5%、33.6%、33.7%、33.8%、33.9%、34%、34.1%、34.2%、34.3%、34.4%、34.5%、34.6%、34.7%、34.8%、34.9%、35%、35.1%、35.2%、35.3%、35.4%、35.5%、35.6%、35.7%、35.8%、35.9%、36%、36.1%、36.2%、36.3%、36.4%、36.5%、36.6%、36.7%、36.8%、36.9%、37%、37.1%、37.2%、37.3%、37.4%、37.5%、37.6%、37.7%、37.8%、37.9%、38%、38.1%、38.2%、38.3%、38.4%、38.5%、38.6%、38.7%、38.8%、38.9%、39%、39.1%、39.2%、39.3%、39.4%、39.5%、39.6%、39.7%、39.8%、39.9%、40%、40.1%、40.2%、40.3%、40.4%、40.5%、40.6%、40.7%、40.8%、40.9%、41%、41.1%、41.2%、41.3%、41.4%、41.5%、41.6%、41.7%、41.8%、41.9%、42%、42.1%、42.2%、42.3%、42.4%、42.5%、42.6%、42.7%、42.8%、42.9%、43%、43.1%、43.2%、43.3%、43.4%、43.5%、43.6%、43.7%、43.8%、43.9%、44%、44.1%、44.2%、44.3%、44.4%、44.5%、44.6%、44.7%、44.8%、44.9%、45%、45.1%、45.2%、45.3%、45.4%、45.5%、45.6%、45.7%、45.8%、45.9%、46%、46.1%、46.2%、46.3%、46.4%、46.5%、46.6%、46.7%、46.8%、46.9%、47%、47.1%、47.2%、47.3%、47.4%、47.5%、47.6%、47.7%、47.8%、47.9%、48%、48.1%、48.2%、48.3%、48.4%、48.5%、48.6%、48.7%、48.8%、48.9%、49%、49.1%、49.2%、49.3%、49.4%、49.5%、49.6%、49.7%、49.8%、49.9%、50%、50.1%、50.2%、50.3%、50.4%、50.5%、50.6%、50.7%、50.8%、50.9%、51%、51.1%、51.2%、51.3%、51.4%、51.5%、51.6%、51.7%、51.8%、51.9%、52%、52.1%、52.2%、52.3%、52.4%、52.5%、52.6%、52.7%、52.8%、52.9%、53%、53.1%、53.2%、53.3%、53.4%、53.5%、53.6%、53.7%、53.8%、53.9%、54%、54.1%、54.2%、54.3%、54.4%、54.5%、54.6%、54.7%、54.8%、54.9%、55%、55.1%、55.2%、55.3%、55.4%、55.5%、55.6%、55.7%、55.8%、55.9%、56%、56.1%、56.2%、56.3%、56.4%、56.5%、56.6%、56.7%、56.8%、56.9%、57%、57.1%、57.2%、57.3%、57.4%、57.5%、57.6%、57.7%、57.8%、57.9%、58%、58.1%、58.2%、58.3%、58.4%、58.5%、58.6%、58.7%、58.8%、58.9%、59%、59.1%、59.2%、59.3%、59.4%、59.5%、59.6%、59.7%、59.8%、59.9%、60%、60.1%、60.2%、60.3%、60.4%、60.5%、60.6%、60.7%、60.8%、60.9%、61%、61.1%、61.2%、61.3%、61.4%、61.5%、61.6%、61.7%、61.8%、61.9%、62%、62.1%、62.2%、62.3%、62.4%、62.5%、62.6%、62.7%、62.8%、62.9%、63%、63.1%、63.2%、63.3%、63.4%、63.5%、63.6%、63.7%、63.8%、63.9%、64%、64.1%、64.2%、64.3%、64.4%、64.5%、64.6%、64.7%、64.8%、64.9%、65%、65.1%、65.2%、65.3%、65.4%、65.5%、65.6%、65.7%、65.8%、65.9%、66%、66.1%、66.2%、66.3%、66.4%、66.5%、66.6%、66.7%、66.8%、66.9%、67%、67.1%、67.2%、67.3%、67.4%、67.5%、67.6%、67.7%、67.8%、67.9%、68%、68.1%、68.2%、68.3%、68.4%、68.5%、68.6%、68.7%、68.8%、68.9%、69%、69.1%、69.2%、69.3%、69.4%、69.5%、69.6%、69.7%、69.8%、69.9%、70%、70.1%、70.2%、70.3%、70.4%、70.5%、70.6%、70.7%、70.8%、70.9%、71%、71.1%、71.2%、71.3%、71.4%、71.5%、71.6%、71.7%、71.8%、71.9%、72%、72.1%、72.2%、72.3%、72.4%、72.5%、72.6%、72.7%、72.8%、72.9%、73%、73.1%、73.2%、73.3%、73.4%、73.5%、73.6%、73.7%、73.8%、73.9%、74%、74.1%、74.2%、74.3%、74.4%、74.5%、74.6%、74.7%、74.8%、74.9%、75%、75.1%、75.2%、75.3%、75.4%、75.5%、75.6%、75.7%、75.8%、75.9%、76%、76.1%、76.2%、76.3%、76.4%、76.5%、76.6%、76.7%、76.8%、76.9%、77%、77.1%、77.2%、77.3%、77.4%、77.5%、77.6%、77.7%、77.8%、77.9%、78%、78.1%、78.2%、78.3%、78.4%、78.5%、78.6%、78.7%、78.8%、78.9%、79%、79.1%、79.2%、79.3%、79.4%、79.5%、79.6%、79.7%、79.8%、79.9%、80%、80.1%、80.2%、80.3%、80.4%、80.5%、80.6%、. 80.7%、80.8%、80.9%、81%、81.1%、81.2%、81.3%、81.4%、81.5%、81.6%、81.7%、81.8%、81.9%、82%、82.1%、82.2%、82.3%、82.4%、82.5%、82.6%、82.7%、82.8%、82.9%、83%、83.1%、83.2%、83.3%、83.4%、83.5%、83.6%、83.7%、83.8%、83.9%、84%、84.1%、84.2%、84.3%、84.4%、84.5%、84.6%、84.7%、84.8%、84.9%、85%、85.1%、85.2%、85.3%、85.4%、85.5%、85.6%、85.7%、85.8%、85.9%、86%、86.1%、86.2%、86.3%、86.4%、86.5%、86.6%、86.7%、86.8%、86.9%、87%、87.1%、87.2%、87.3%、87.4%、87.5%、87.6%、87.7%、87.8%、87.9%、88%、88.1%、88.2%、88.3%、88.4%、88.5%、88.6%、88.7%、88.8%、88.9%、89%、89.1%、89.2%、89.3%、89.4%、89.5%、89.6%、89.7%、89.8%、89.9%、90%、90.1%、90.2%、90.3%、90.4%、90.5%、90.6%、90.7%、90.8%、90.9%、91%、91.1%、91.2%、91.3%、91.4%、91.5%、91.6%、91.7%、91.8%、91.9%、92%、92.1%、92.2%、92.3%、92.4%、92.5%、92.6%、92.7%、92.8%、92.9%、93%、93.1%、93.2%、93.3%、93.4%、93.5%、93.6%、93.7%、93.8%、93.9%、94%、94.1%、94.2%、94.3%、94.4%、94.5%、94.6%、94.7%、94.8%、94.9%、95%、95.1%、95.2%、95.3%、95.4%、95.5%、95.6%、95.7%、95.8%、95.9%、96%、96.1%、96.2%、96.3%、96.4%、96.5%、96.6%、96.7%、96.8%、96.9%、97%、97.1%、97.2%、97.3%、97.4%、97.5%、97.6%、97.7%、97.8%、97.The reduction in expression may be 9%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100%. In certain embodiments, the reference may include a transgenic animal or animal model that does not contain one or more of the conditionally inducible gene editing sites or at least one nucleic acid editing sequences, or the transgenic animal or animal model may not be treated with exogenous compounds or exogenous stimuli or both.

[0108] Non-limiting examples of conditions or diseases that may be associated with reduced plasmalogen levels include neurodegenerative diseases, the presence of cataracts, respiratory diseases, chronic inflammation, myelin dysplasia, metabolic syndrome, type II diabetes, or cardiovascular diseases. Non-limiting examples of neurodegenerative diseases that may be associated with reduced plasmalogen levels may include Alzheimer's disease, Parkinson's disease, or multiple sclerosis. Non-limiting examples of respiratory diseases that may be associated with reduced plasmalogen levels may include bronchopulmonary dysplasia (BPD) or chronic obstructive pulmonary disease (COPD).

[0109] In certain embodiments, transgenic animals or animal models and / or cells may be monitored or undergo monitoring with respect to symptoms of a condition or disease. In certain embodiments, the condition or disease may be one or more associated with reduced plasmalogen levels. In certain embodiments, the symptoms that are subject to monitoring or for monitoring may include one or more symptoms associated with any condition or disease that may be associated with reduced plasmalogen levels. Non-limiting examples of symptoms that lead to or are associated with reduced expression of genes that regulate the plasmalogen biosynthesis pathway may include animal growth, joint development, joint movement, arthralgia, facial development, cataracts, cardiac function, respiratory function, inflammation, liver size, liver function, cognitive impairment, neurological function, seizures, memory impairment, blood glucose levels, neuronal deficiencies, dopaminergic cell deficiencies, cholinergic cell deficiencies, muscle output, gait, bladder function, bowel function, coordination, visual acuity, blood pressure, cholesterol levels, insulin resistance, body weight, and / or blood triglyceride levels.

[0110] In certain embodiments, the expression of a gene product can be induced by providing an animal or animal model with an exogenous compound or exogenous stimulus. Those skilled in the art will be able to select an appropriate method for inducing a gene product in view of the teachings herein. In certain embodiments, one or more gene products can be induced by one or more of the following: tamoxifen, 4-hydroxytamoxifen (4-OHT), mifepristone, tetracycline, light, temperature, or any combination thereof.

[0111] In certain embodiments of the methods described herein, the step of providing at least one non-human animal or animal model may include providing an animal such as a mammal, bird, reptile, amphibian, fish, arthropod, vertebrate, or invertebrate, wherein the non-human animal or animal model is for genome modification.

[0112] In certain embodiments of the methods described herein, the step of introducing at least one gene editing sequence into a gene, a portion thereof, or a regulatory element involved in plasmalogen biosynthesis in order to generate a first edited gene in a non-human animal or animal model may include any method or technique known to those skilled in the art for transforming the genome of a non-human animal or animal model.

[0113] In certain embodiments of the methods described herein, the step of crossing a non-human animal or animal model having a first edited gene with a second non-human animal or animal model having a nucleic acid editing sequence at a separate locus encoding a gene product in order to produce a transgenic animal or animal model may include any method or technique known to those skilled in the art in view of the teachings herein, which are required for the mating (or copulation) of organisms of the said species.

[0114] nucleic acid In certain embodiments, isolated nucleic acids comprising the sequences GTGAGCTCCCCCGGCCTCTC (SEQ ID NO: 1) and / or ATGGCAGACAGGGGCCCTTC (SEQ ID NO: 2) are provided herein. In certain embodiments, the isolated nucleic acids may include one or more additional elements operably ligated to the sequences GTGAGCTCCCCCGGCCTCTC (SEQ ID NO: 1) and / or ATGGCAGACAGGGGCCCTTC (SEQ ID NO: 2). In certain embodiments, the isolated nucleic acids may further include one or both of a transcription termination sequence and / or a promoter operably ligated to the sequences GTGAGCTCCCCCGGCCTCTC (SEQ ID NO: 1) and / or ATGGCAGACAGGGGCCCTTC (SEQ ID NO: 2).

[0115] In certain embodiments, recombinant DNA constructs are provided herein that include a promoter operably ligated to a sequence encoding a single-chain guide RNA (sgRNA), wherein the sgRNA sequence is GTGAGCTCCCCCGGCCTCTC (SEQ ID NO: 1) and / or ATGGCAGACAGGGGCCCTTC (SEQ ID NO: 2). In certain embodiments, the recombinant DNA construct may further include a transcription termination sequence.

[0116] As used herein, nucleic acids can be “operably ligated” when they are placed in a functional relationship with another nucleic acid sequence. For example, DNA for a presequence or secretion leader is operably ligated to DNA for a polypeptide when it is expressed as a preprotein that participates in the secretion of the polypeptide; a promoter or enhancer is operably ligated to a coding sequence when it affects the transcription of the sequence; or a ribosomal binding site is operably ligated to a coding sequence when it is positioned to facilitate translation. Generally, “operably ligated” means that the ligated DNA sequences are contiguous, and in the case of a secretion leader, contiguous and within the leading phase. Enhancers, however, do not need to be contiguous. Ligation can be performed by ligation at a convenient restriction site, or by other methods or techniques known to those skilled in the art, such as multi-enzyme assembly.

[0117] In certain embodiments, compositions comprising one or more isolated nucleic acids or one or more recombinant DNA constructs described herein are provided herein. In certain embodiments, the composition comprises an isolated nucleic acid or recombinant DNA construct comprising the sequence GTGAGCTCCCCCGGCCTCTC (SEQ ID NO: 1) and / or ATGGCAGACAGGGGCCCTTC (SEQ ID NO: 2). In certain embodiments, the composition may further comprise a Cas9 protein or a variant thereof, or a recombinant nucleic acid encoding a Cas9 protein or a variant thereof.

[0118] Accordingly, this disclosure is well suited to realizing the purposes and benefits mentioned and those inherent therein. The specific embodiments disclosed above are merely illustrative, as they can be modified and implemented in different but equivalent ways that are evident to those skilled in the art, for the benefit of the teachings provided herein. While individual embodiments are discussed, this disclosure covers all combinations of all such embodiments. Furthermore, no limitation is intended on the details of the configuration or design shown herein, other than those described in the claims below. Also, the terms in the claims have their simple, ordinary meanings unless expressly and obviously provided otherwise by the patent holder. Accordingly, the specific exemplary embodiments disclosed above can be modified or altered, and it is clear that all such variations are considered to fall within the scope and spirit of this disclosure. In the event of any inconsistency in the use of words or terms between this specification and one or more patents or other documents referenced herein, the definition consistent with this specification should be adopted.

[0119] Numerous obvious variations of the embodiments shown herein will be suggested to those skilled in the art in view of this disclosure. Such obvious variations are within the full intended scope of the appended claims.

[0120] Exemplary Embodiments and Experimental Data Current animal models of plasmalogen deficiency exhibit numerous developmental abnormalities based on germline mutations, resulting in brain abnormalities and dysfunction, which in turn lead to premature death. Therefore, their use in studying the role of plasmalogens in adult-onset conditions associated with plasmalogen deficiency is hindered. Accordingly, we sought to develop a novel animal model in which plasmalogen deficiency can be initiated only after birth, rather than during development. Preferably, the induction of plasmalogen deficiency can be temporally controlled in the animal, thereby enabling the identification of age-related onset of any plasmalogen deficiency-related conditions, as well as the characterization of the disease course resulting from the deficiency.

[0121] Examples of preferred methods for inducing conditions associated with reduced postnatal levels of plasmalogens in non-human animals or animal models are described herein. Transgenic non-human animals in which plasmalogen deficiency can be induced conditionally, temporally, or locally are also described herein. It will be understood that embodiments and examples are provided for illustrative purposes only as intended and are not intended to be limiting in any way to those skilled in the art.

[0122] A novel method for inducing a state associated with reduced levels of plasmalogen in non-human animals or animal models is described. A novel method for reducing plasmalogen levels in non-human animals or animal models is also described. A first non-human animal strain is initially generated in which a conditionally inducible gene editing site (e.g., a loxP site) is introduced into a gene involved in plasmalogen biosynthesis. The conditionally inducible gene editing site can be introduced anywhere in the gene (i.e., a phloxified gene) to be adjacent to a region of the gene essential for producing a full-length, fully functional protein. The resulting transgenic animal or animal model should show a significant reduction in plasmalogen levels after the adjacent region is excised by a recombinase. Various exons or intron-exon combinations within the gene or combination of genes, or parts thereof, involved in plasmalogen biosynthesis can be targeted to generate a transgenic animal that shows a significant systemic or tissue-specific reduction (depending on the non-human animal model) in plasmalogen levels after the adjacent region is excised by a recombinase.

[0123] The method then inevitably involves generating an inducible conditional knockout non-human animal strain by crossing a first non-human animal strain with a second non-human animal strain carrying a gene for recombinase, which is linked to the genetic code for the ligand-binding domain of a receptor that can be used to control the translocation of the recombinase enzyme into the nucleus. Any preferred means for inducing recombinase translocation into the nucleus is considered. For example, the second non-human animal strain may contain a CreERT2 gene encoding a fusion protein of Cre recombinase and a mutant estrogen ligand-binding domain (ERT2), thereby inducing Cre-mediated recombination of the gene by administering tamoxifen to the inducible conditional knockout non-human animal. Alternatively, a second non-human animal strain to which Cre-mediated recombination can be induced may contain Cre recombinase genes under the control of a tetracycline-responsive element (TRE), thereby enabling the induction of Cre-mediated recombination of one or more targeted genes by administering tetracycline to inducible conditional knockout non-human animals. Purified Cre recombinase or nucleic acids encoding Cre recombinase can also be administered to inducible conditional knockout non-human animals or animal models to induce Cre-mediated recombination of targeted genes. Therefore, the method inevitably involves inducing Cre-mediated recombination of targeted genes involved in plasmalogen biosynthesis in inducible conditional knockout non-human animals or animal models to obtain conditional knockout non-human animals or animal models in which plasmalogen levels are reduced and which exhibit symptoms of a condition associated with reduced plasmalogen levels.

[0124] According to the embodiment, the genes involved in plasmalogen biosynthesis are fatty acid reductase 1 (FAR1), glyceron phosphate O-acyltransferase (GNPAT), alkylglyceron phosphate synthase (AGPS), acyl / alkyl-DHAP reductase, alkyl / acyl-GPA acyltransferase, phosphatidic acid phosphatase, ethanolamine phosphotransferase, plasmanylethanolamine desaturase or choline phosphotransferase, PEX7, and PEX5.

[0125] According to the embodiments, plasmalogen levels are significantly reduced by at least 20% to 50%, and in some cases, even greater reductions can be observed in conditionally knockout non-human animals or animal models compared to levels in comparable wild-type non-human animals.

[0126] According to the embodiment, a conditionally inducible gene editing site, such as the loxP site, is introduced into a region adjacent to exon 4 of the GNPAT gene.

[0127] According to the embodiments, induction of Cre-mediated recombination of targeted genes in inducible conditional knockout non-human animal lines can be achieved by administering approximately 50 mg of tamoxifen per kg of body weight over approximately 7 consecutive days to inducible conditional knockout non-human animals containing the phlox gene and the CreERT2 gene. Other variations of the administration protocol and means for inducing Cre-mediated recombination of targeted genes are considered and remain within the scope of the teachings of the present invention.

[0128] According to the embodiment, GNPAT conditional knockout in non-human animals exhibits symptoms of a state associated with reduced plasmalogen levels, which begin approximately one month after induction of Cre-mediated recombination.

[0129] According to the embodiments, conditions associated with reduced levels of plasmalogen include neurodegenerative diseases, cataracts, respiratory diseases, myelin dysplasia, chronic inflammation, metabolic syndrome, type II diabetes, or cardiovascular diseases.

[0130] According to the embodiment, the neurodegenerative disease is Alzheimer's disease, Parkinson's disease, or multiple sclerosis.

[0131] According to the embodiment, the respiratory disease is bronchopulmonary dysplasia (BPD) or chronic obstructive pulmonary disease (COPD).

[0132] Another aspect of the present invention is a transgenic non-human animal or animal model in which a conditionally inducible gene editing site, i.e., a loxP site, is introduced, and whose genome contains genes involved in plasmalogen biosynthesis. The transgenic non-human animal or animal model further comprises a CreERT2 gene encoding a fusion protein of Cre recombinase and a mutant estrogen ligand-binding domain (ERT2), thereby Cre-mediated recombination is achieved by the CreERT2 protein following tamoxifen administration.

[0133] According to the embodiment, the genome of a transgenic non-human animal or animal model contains a loxP site introduced into exon 4 of the glyceron phosphate O-acyltransferase (GNPAT) gene.

[0134] Another aspect of the present invention is a transgenic non-human animal or animal model in which a loxP site is introduced, and whose genome contains genes involved in plasmalogen biosynthesis. The transgenic non-human animal further contains a Cre recombinase gene under the control of a tetracycline-responsive element, thereby Cre-mediated recombination is induced by the Cre recombinase protein following tetracycline administration. In some aspects of the present invention, tissue-specific induction of Cre recombinant proteins may also be possible.

[0135] According to the embodiment, the genome of a transgenic non-human animal or animal model may further contain ubiquitously expressed Cre recombinase, thereby making the transgenic non-human animal a complete knockout of the targeted gene.

[0136] Another aspect of the present invention necessarily involves a method for determining the efficacy of a compound or pharmaceutical composition in the treatment of a condition associated with reduced levels of plasmalogen in a non-human animal or animal model. The method includes the steps of administering the compound or pharmaceutical composition of test to a knockout non-human animal or animal model in which an enzyme knockout has been introduced or is planned to be introduced, and observing its effect on plasmalogen levels and clinical condition. In any aspect of the present invention, the method may include the steps of administering the compound or pharmaceutical composition of test to a knockout non-human animal or animal model in which an enzyme knockout has been introduced or is planned to be introduced, and administering a placebo to another knockout non-human animal or animal model. Subsequently, the effects on plasmalogen levels and clinical condition in both animals are compared to determine the efficacy of the compound or pharmaceutical composition.

[0137] In another aspect of the present invention, the method can be used to test the ability of a given plasmalogen-enhancing compound or pharmaceutical composition in increasing plasmalogen levels and / or mitigating any clinical, behavioral, and / or secondary biochemical or physiological effects of plasmalogen deficiency. [Examples] [Examples]

[0138] Homozygous Gnpat cKO Hemi CAGGCRE-ER mouse Mice were housed at Jackson Laboratories (Bar Harbor, ME) in positive-pressure ventilated polysulfonate cages containing HEPA-filtered air, with 3-4 mice per cage. The animal room was maintained using artificial fluorescent lighting on a 12-hour light-dark cycle (light from 6:00 am to 6:00 pm). Room temperature was maintained at 22±4°C and relative humidity at 50±15%. The animal room was ventilated 15 times every hour, and the animals were provided with ad libitum access to filtered tap water with a pH of 2.5-3.0 and standard rodent feed. This study complied with the Canadian National Research Organisation's Guide for the Care and Use of Laboratory Animals. All animal handling was approved by the Institutional Animal Care and Use Committee (IACUC) and the Institutional Biosafety Committee (IBC) under the Animal Use Summary (AUS)#:21013. Veterinary medical care was available throughout the course of the study, and animals were examined by veterinary professionals when justified by clinical signs and other changes.

[0139] Generation of homozygous Gnpat cKO hemiCAGGCRE-ER mouse strains Simultaneously, by microinjecting a CRISPR RNA target guide into the embryo, the introduction of a loxP site using dsDNA into the region adjacent to exon 4 of the Gnpat gene [Chr8:124863033~124890057 base pairs (bp), positive strand] allows for the development of Gnpat. flox / floxMice were generated. Donor plasmids with 2kb and 1.6kb homology arms adjacent to the loxP site were used for homology-driven repair. The upstream CRISPR target guide was Gnpat_in3_crRNA1:GTGAGCTCCCCCGGCCTCTC (SEQ ID NO: 1), and the downstream CRISPR target guide was Gnpat_in4_crRNA1:ATGGCAGACAGGGGCCCTTC (SEQ ID NO: 2). Six founder lines were created, however, only one line contained the correct loxP site without any detection of additional deletions, and therefore this line was selected for Gnpat flox / flox These were selected to generate colonies. The following primers were used to confirm the genotype: Gnpat_genoF2:TGCCAGCTTTCTACTTGCCA (SEQ ID NO: 18) and Gnpat_genoR2:GCAGTGACCTGACTGAGACC (SEQ ID NO: 19).

[0140] Heterozygous Gnpat cKO(Gnpat flox / WT )The mouse was first backcrossed with C57BL / 6J (stock number 00664), and a heterozygous Gnpat cKO (Gnpat flox / WT ) Another generation of mice is created and then crossed to produce homozygous Gnpat cKO (Gnpat flox / flox ) Animals were created. Heterozygous Gnpat cKO (Gnpat flox / WT)The mice were also crossed with hemizygous CAGGCre-ER™ mice (Hayashi S, McMahon AP. Efficient recombination in diverse tissues by a tamoxifen-inducible form of Cre: a tool for temporally regulated gene activation / inactivation in the mouse. Developmental biology. 2002;244(2):305-318) (C57BL / 6J background; Jackson Laboratories stock number 004682) to generate mice that carried the hemizygous CAGGCre-ER™ transgene and were heterozygous with respect to the floxed Gnpat allele. These mice were crossed with homozygous Gnpat cKO (Gnpat flox / flox )animals to generate animals that were flox / flox and hemizygous with respect to the CAGGCre-ER™ transgene, which represented a novel TMX-inducible Gnpat conditional knockout (homozygous Gnpat cKO hemizygous CAGGCRE-ER, Figure 1).

[0141] Tamoxifen administration Tamoxifen powder was dissolved in 100% ethanol (E7023, Sigma) to 50 mg / mL at 55°C and diluted 1:10 to 5 mg / mL in corn oil and stored at -20°C until the day of dosing. Vehicle preparations were identical except for the addition of TMX powder. On the day of dosing, the solution was thawed at 37°C. Sixteen- to seventeen-week-old mice were administered 50 mg / kg of TMX (or vehicle) once daily for 7 consecutive days using a standardized dosing volume of 10 mL / kg body weight. All technicians performing the experiments were blind to the animal genotype and treatment group.

[0142] Homozygous Gnpat cKO hemizygous CAGGCRE-ER characterization study design Homozygous Gnpat cKO hemiCAGGCRE-ER animals were compared one month after treatment with either TMX or the appropriate medium (3 animals per group, sex-wise). All animals were evaluated using both open-field testing (day 30) and neurotransmission assays (day 33), and serum and tissue samples were collected at euthanasia on day 35.

[0143] A second comparison was performed four months after treatment with either TMX (6 females / 8 males) or the medium (6 females / 7 males). This point also included a third group of age-matched, untreated C57BL / 6J mice (8 females / 8 males) to act as a wild-type (WT) control. All animals were evaluated by both open-field testing (day 95) and neurotransmission assays (day 125), and serum and tissue samples were subsequently collected at euthanasia on day 130.

[0144] End-point tissue recovery End-point blood collection was performed by cardiac puncture after euthanasia by carbon dioxide sedation. The blood was collected in a serum separator tube, separated at room temperature for 30-40 minutes, and then centrifuged at 10,000 rpm. The serum was stored at -80°C until analysis.

[0145] Next, the mice were perfused transcardiacally with 10 mL of phosphate-buffered saline (PBS). The brain, liver, heart, skeletal muscles (quadriceps femoris and tibialis anterior), lungs, and intestines were removed, placed in screw-on caps, rapidly frozen on dry ice, and then stored at -80°C until analysis.

[0146] Lipid quantification by FI-MS / MS Serum extraction was performed on 20 μL aliquots in 1.4 mL Thermo Matrix tubes. HPLC-grade water (20 μL) and a 0.05 μg / mL labeled internal standard were used. 9Lipids were extracted into 600 μL of ethyl acetate containing 2% water and 1% formic acid, including [D PlsEtn 18:0 / 18:1]. The sample was mixed by hand and then vortexed at 1500 rpm for 30 minutes using a Mixmate. Next, the sample was centrifuged at 2000 rcf for 5 minutes.

[0147] Tissue samples were extracted by placing approximately 50 mg of each tissue into 2 mL safe-lock Eppendorf tubes, and all weights were recorded for normalization. Two spoonfuls (approximately 300 μL) of 0.5 mm zirconium oxide beads and 600 μL of ethyl acetate containing 2% water and 1% formic acid were added to each tube, and the samples were then homogenized for 10 minutes using a Bullet Blender Storm Pro (Next Advantage). To ensure complete lipid extraction, each sample was mixed on a Mixmate at 1500 rpm for 1 hour, followed by centrifugation at 3500 rcf for 10 minutes. Based on tissue weight, aliquots of the eluent for all samples were taken from the tissue pellet and diluted to 50 mg / mL. Labeled internal standard (at 0.05 μg / mL) 9 The sample was further diluted in a tissue-specific manner in ethyl acetate containing 2% water and 1% formic acid (D PlsEtn 18:0 / 18:1) to bring the lipid levels within the range for linear quantification.

[0148] 100 μL aliquots of each extract were analyzed by flow injection tandem mass spectrometry (FI-MS / MS) on an Applied Biosystems Q-Trap mass spectrometer connected to an Agilent 1200 HPLC system. Each transition was scanned for 50 milliseconds, with a total acquisition time of 1 minute per sample. The mobile phase was an 80:15:5 ethyl acetate:methanol:water solution at a flow rate of 450 μL / min. The standards and stable isotopes used were manufactured by Avanti Polar Lipids, with a purity of over 99% achieved by TLC, and the solvent was HPLC grade. The measured transitions are reported in Table 1. The results were processed using Analyst software (version 1.5.1) as μg lipids per mg of starting tissue (μg / mg), or, in the case of serum, μg lipids per mL of serum (μg / mL). [Table 1]

[0149] Lipid changes in tamoxifen-treated homozygous Gnpat cKO hemiCAGGCRE-ER mice TMX-inducible homozygous Gnpat cKO hemi-CAGGCRE-ER mice were allowed to develop normally for 16–17 weeks postnatally and treated with TMX via IP infusion at this time. Serum and tissue samples were collected 1 month and 4 months after TMX administration and analyzed for plasmalogen levels. One month after TMX administration, total plasmalogen levels were significantly reduced compared to media-treated levels, with plasmalogen content in TMX-treated animals ranging from 50–75% of media-treated levels depending on the tissue (Figure 2). In serum, TMX-treated animals showed total plasmalogen levels of approximately 65% ​​of media levels (p=0.028). The most dramatic reductions were observed in the heart (p<0.001), intestines (p=0.0029), and liver (p=0.0009), where levels were reduced by approximately 50% compared to media-treated animals.

[0150] At plasmalogen species-specific levels (Figure 3), the knockout effect tended to broadly affect most plasmalogens, however, some exceptions and tissue-specific patterns were observed, appearing only one month after TMX. In serum, high variability was observed at individual plasmalogen levels in media with 18:1 and 18:2 side chains at sn2 and in TMX-treated plasmalogens. Interestingly, serum plasmalogens with unsaturated sn2 side chains (20:4 and 22:6) showed the most significant reduction (Figure 3, p<0.05 for corresponding plasmalogen species in media-treated animals). In the brain, heart, and liver, all eight plasmalogen species were significantly reduced in the TMX group (p<0.05) (Figure 3). The intestine showed significant reductions for four 18:0 plasmalogen species, as well as the 16:0 / 22:6 species (Figure 3). High variability was observed in the treated lung tissue, and an overall reduction in all plasmalogens was evident, although only the 16:0 / 18:2 and 18:0 / 18:2 isoforms were statistically significant (p<0.05; Figure 3).

[0151] Four months after TMX, total plasmalogen levels in serum and tissues were also significantly reduced (Figure 4), ranging from 45% to 80% of the media treatment levels. Particularly noteworthy was the further reduction in total plasmalogen levels in the brain between one month and four months, with the four-month level being only 45% of the media treatment level.

[0152] Individual plasmalogen species for each tissue are shown in Figure 5. In serum, the vast majority of plasmalogen species were significantly reduced, with the exception of 16:0 / 18:1 and 16:0 / 18:2 (p<0.05). Brain and lung tissues showed significant reductions in all eight plasmalogen species in TMX-treated animals (p<0.05). The intestine showed significant reductions in all plasmalogen species except 16:0 / 18:1 and 16:0 / 18:2, which were also the species that showed the greatest variation in the media-treated animals. The heart and liver showed similar plasmalogen species patterns, with both tissues exhibiting significant reductions in 16:0 / 18:1, 16:0 / 20:4, 18:0 / 18:1, 18:0 / 20:4, and 18:0 / 22:6 species (p<0.05; Figure 5).

[0153] Since serum plasmalogen levels are commonly used as a surrogate for levels in other parts of the body, particularly the brain, we compared plasmalogen levels between the brain and serum (Figure 6). All plasmalogens measured in serum were significantly correlated with brain levels for all plasmalogen molecular species (p<0.0001, F-statistics of 20.6–51.8). Although there was considerable variability among animals, the results indicated that a significant reduction in plasmalogen levels in the brain could be translated as a reduced serum level.

[0154] Considering all factors, novel homozygous Gnpat cKO hemiCAGGCRE-ER animals were phenotypically indistinguishable from either wild-type or media-treated animals after TMX treatment, but reduced plasmalogen levels were detectable in serum and tissues, including the brain, within one month of TMX treatment. Further reductions in the brain were particularly evident up to four months after TMX treatment. Overall, plasmalogen levels in homozygous Gnpat cKO hemiCAGGCRE-ER animals ranged from 45–75% of media levels after four months, which is more similar to what is expected in individuals with age-related neurodegenerative diseases. For example, individuals with AD have shown that levels are within the range of 50-90% of levels reported in healthy controls (Goodenowe DB, Cook LL, Liu J, et al. Peripheral ethanolamine plasmalogen deficiency: a logical causative factor in Alzheimer's disease and dementia. J Lipid Res. 2007;48(11):2485-2498, Han X, Holtzman DM, McKeel DW, Jr. Plasmalogen deficiency in early Alzheimer's disease subjects and in animal models: molecular characterization using electrospray ionization mass spectrometry. Journal of neurochemistry. 2001;77(4):1168-1180, Wood PL, Khan AM, Mankidy R, Smith T, Goodenowe D. Plasmalogen Deficit: A New and Testable Hypothesis for the Etiology of Alzheimer's Disease. In: De La Monte S). ed.Alzheimer's Disease Pathogenesis-Core Concepts, Shifting Paradigms and Therapeutic Targets. InTech; 2011; Ginsberg L, Rafique S, Xuereb JH, Rapoport SI, Gershfeld NL. Disease and anatomic specificity of ethanolamine plasmalogen deficiency in Alzheimer's disease brain. Brain research. 1995;698(1-2):223-226; Guan Z, Wang Y, Cairns NJ, Lantos PL, Dallner G, Sindelar PJ. Decrease and structural modifications of phosphatidylethanolamine plasmalogen in the brain with Alzheimer disease. Journal of neuropathology and experimental neurology. 1999;58(7):740-747), with greater reductions in individuals with more severe phenotypes and faster progression rates (Han X, Holtzman DM, McKeel DW, Jr. Plasmalogen deficiency in early Alzheimer's disease subjects and in animal models: molecular characterization using electrospray ionization mass spectrometry. Journal of neurochemistry. 2001;77(4):1168-1180, Wood PL, Mankidy R, Ritchie S, et al. Circulating plasmalogen levels and Alzheimer Disease Assessment Scale-Cognitive scores in Alzheimer patients.J Psychiatry Neurosci. 2010;35(1):59-62). Similar levels of deficiency have been reported in patients with Parkinson's disease (Fabelo N, Martin V, Santpere G, et al. Severe alterations in lipid composition of frontal cortex lipid rafts from Parkinson's disease and incidental Parkinson's disease. Mol Med. 2011;17(9-10):1107-1118; Marin R, Fabelo N, Martin V, et al. Anomalies occurring in lipid profiles and protein distribution in frontal cortex lipid rafts in dementia with Lewy bodies disclose neurochemical traits partially shared by Alzheimer's and Parkinson's diseases. Neurobiology of aging. 2017;49:52-59; Guedes LC, Chan RB, Gomes MA, et al. Serum lipid alterations in GBA-associated Parkinson's disease. Parkinsonism & related disorders. 2017). Therefore, the homozygous Gnpat cKO hemiCAGGCRE-ER animal model is considered to be the first and unique model capable of reflecting the progressive plasmalogen decline observed in human neurodegenerative diseases. The usefulness of this model is enhanced by the strong correlation observed between serum and brain plasmalogen levels, which will enable future studies to monitor PlsEtn levels in living animals, as serum samples can be easily obtained over the long term.

[0155] Open field To evaluate the behavioral consequences of plasmalogen deficiency in adult animals, adult animals were tested in open-field studies one month and four months after TMX treatment. Hyperactivity in open fields is a phenomenon that has been previously reported in various neurodegenerative mouse models (Paesler K, Xie K, Hettich MM, et al. Limited effects of an eIF2αS51A allele on neurological impairments in the 5xFAD mouse model of Alzheimer's disease. Neural plasticity. 2015;2015:825157; Bardgett ME, Davis NN, Schultheis PJ, Griffith MS. Ciproxifan, an H3 receptor antagonist, alleviates hyperactivity and cognitive deficits in the APP Tg2576 mouse model of Alzheimer's disease. Neurobiology of learning and memory. 2011;95(1):64-72; Faizi M, Bader PL, Saw N, et al. Thy1-hAPP(Lond / Swe+) mouse model of Alzheimer's disease displays broad behavioral deficits in sensorimotor, cognitive and social function). Brain and behavior. 2012;2(2):142-154).

[0156] On the day of the experiment, mice were placed in a square area (40cm x 40cm x 40cm) made of transparent plexiglass and illuminated with 100,500 ± 20 lux of light. The animals were allowed to move freely for 10 minutes, during which time their activity was recorded using a highly sensitive infrared (IR) light beam three-dimensional grid system invisible to the mice. Fusion software (Omnitech Electronics) was used to determine the distance traveled in centimeters within each 10-minute period of the trial.

[0157] Over the first month, the animals showed a trend toward increased distance traveled over the course of the study; however, neither the distance traveled per minute (Figure 7A) nor the total distance traveled (Figure 7B) reached statistical significance. By four months, the distance traveled in TMX-treated animals was significantly increased compared to wild-type and media-treated animals across all one-minute intervals and the total distance traveled in the study (Figures 7C and 7D). In fact, by four months after treatment, TMX-treated animals showed significant hyperactivity, traveling approximately twice the distance of media-treated or wild-type animals in a 10-minute study.

[0158] Since these behavioral changes are likely mediated by the central nervous system (CNS), we investigated the correlation between brain plasmalogen levels and total distance traveled (Figure 8). A robust and significant inverse correlation was observed between the measured levels of each PlsEtn and the distance traveled (p<0.0001, F-statistic of 17.9–51.0).

[0159] The strong inverse correlation between migration distance and plasmalogen levels in the brain suggests that reduced plasmalogen in the CNS is not only a contributing factor to behavior, but that the observed effect is actually dose-dependent; that is, the lower the plasmalogen level, the more severe the behavioral phenotype. Furthermore, the most robust association was with plasmalogens containing polyunsaturated fatty acids at the sn2 position. In other words, these findings suggest that four months of progressive plasmalogen deficiency is sufficient to induce CNS changes that translate to behavioral disorders.

[0160] Interestingly, the degree of hyperactivity observed in homozygous Gnpat cKO hemi-CAGGCRE-ER animals 4 months after TMX was comparable to that observed in germline knockout animals (Dorninger F, Konig T, Scholze P, et al. Disturbed Neurotransmitter Homeostasis in Ether Lipid Deficiency. Human molecular genetics. 2019; Fallatah W, Smith T, Cui W, et al. Oral administration of a synthetic vinyl-ether plasmalogen normalizes open field activity in a mouse model of Rhizomelic chondrodysplasia punctata. Disease models & mechanisms. 2019). This suggests that the behavioral effects are related to plasmalogen deficiency and not due to developmental abnormalities. Furthermore, the results demonstrate that severe plasmalogen reduction is not necessary to observe significant behavioral changes. Germline knockout animals exhibit negligible brain plasmalogen levels but show similar behavioral changes to our cKOs, which show reductions of only 50%.

[0161] Historically, several different explanations have been proposed for the hyperactive phenotype in animal models. Impairments at both neurotransmitter levels and neurotransmitter release have been reported and suggested to underlie increased activity (Dorninger F, Konig T, Scholze P, et al. Disturbed Neurotransmitter Homeostasis in Ether Lipid Deficiency. Human molecular genetics. 2019; Bardgett ME, Davis NN, Schultheis PJ, Griffith MS. Ciproxifan, an H3 receptor antagonist, alleviates hyperactivity and cognitive deficits in the APP Tg2576 mouse model of Alzheimer's disease. Neurobiology of learning and memory. 2011;95(1):64-72). Damage or neuronal death in the hippocampus has also been suggested as a possible cause. Faizi et al. suggested that, in their animal model, damage to the hippocampus prevented mice from generating open-field context maps, thereby leading to continuous area exploration (Faizi M, Bader PL, Saw N, et al. Thy1-hAPP(Lond / Swe+) mouse model of Alzheimer's disease displays broad behavioral deficits in sensorimotor, cognitive and social function. Brain and behavior. 2012;2(2):142-154). Considering the roles that plasmalogens have been shown to play in nerve tissue, along with the strong correlations between plasmalogen molecular species containing polyunsaturated fatty acids in sn2, it is reasonable to hypothesize that neurotransmission disorders may be causing increased activity. There are two main phenomena that are expected to be impaired in plasmalogen-deficient neurons.Firstly, the change in membrane fluidity caused by the reduced plasmalogen content affects the membrane's ability to form an inverse hexagonal phase (Glaser PE, Gross RW. Plasmenylethanolamine facilitates rapid membrane fusion: a stopped-flow kinetic investigation correlating the propensity of a major plasma membrane constituent to adopt an HII phase with its ability to promote membrane fusion. Biochemistry. 1994;33(19):5805-5812), which may lead to impaired vesicle fusion (Glaser PE, Gross RW. Plasmenylethanolamine facilitates rapid membrane fusion: a stopped-flow kinetic investigation correlating the propensity of a major plasma membrane constituent to adopt an HII phase with its ability to promote membrane fusion. Biochemistry. 1994;33(19):5805-5812, Glaser PE, Gross RW. Rapid plasmenylethanolamine-selective fusion of membrane bilayers catalyzed by An isoform of glyceraldehyde-3-phosphate dehydrogenase: discrimination between glycolytic and fusogenic roles of individual isoforms. Biochemistry. 1995;34(38):12193-12203). This change would likely prevent efficient neurotransmitter release and reuptake.Additionally, plasmalogens are required for effective binding to neurotransmitter-binding proteins (Miville-Godbout E, Bourque M, Morissette M, et al. Plasmalogen Augmentation Reverses Striatal Dopamine Loss in MPTP Mice. PloS one. 2016;11(3):e0151020), and in this case, reduction would impair neurotransmitter binding and signaling, leading to cognitive effects. These impairments could result in TMX-treated animals being unable to properly map the open field, which could explain why the animals remain walking longer than wild-type or medium-treated animals. Focusing on the hippocampus, this model could be used in future studies to assess neurotransmitter levels, receptor binding, and vesicle fusion.

[0162] Compound muscle action potentials and nerve conduction velocity Considering the role of plasmalogens in neuronal structure and function, we investigated whether plasmalogen deficiency affects neurotransmission characteristics. More specifically, we characterized extracentral nervous system (CNS) functions in animal models using neurological examinations to assess motor nerve function.

[0163] Mice were anesthetized for up to 5 minutes using 2-3% isoflurane in oxygen (O2) while maintaining a constant body temperature. If necessary, the hair on the right hind leg was trimmed using electric clippers. A temperature-controlled heating pad was used to maintain normal body temperature, which was monitored using a rectal probe. The animals were secured by gently extending their bodies / limbs and taping their feet to the surface of a stand. Three platinum or stainless steel subcutaneous recording / stimulation needle electrodes (Grass F-E2, tip size 0.3 mm) were sterilized with vaporized hydrogen peroxide (VHP) before use, and the animals were wiped with 70% alcohol between them.

[0164] Stimulating electrodes were placed on each side of the sciatic nerve in the proximal femur, and the stimulation intensity was increased until the compound muscle action potential (CMAP) was maximized. The stimulation range used was 0.7–2 mA. Motor responses were recorded from intramuscular needle electrodes in the tibialis anterior muscle using a PowerLab device and Labchart software (AD Instruments).

[0165] Recording electrodes were inserted into the plantar muscles, and reference electrodes were placed in the skin between the toes. For distal stimulation, a pair of subcutaneous stimulation electrodes were placed on both sides of the ankle to stimulate the lateral plantar nerve. For proximal stimulation, electrodes were moved to the level of the ischial notch and to the depth of the sciatic nerve.

[0166] Once all electrodes were in position, current pulses were delivered at a low frequency, and the intensity was gradually increased from zero to 2 mA until a CMAP was evident on the oscilloscope in the plantar muscle. Three distally generated CMAPs were recorded using PowerLab equipment and Labchart software (AD Instruments). The procedure was repeated after moving the stimulating electrodes to the proximal stimulation site, and the current was increased until the maximum CMAP was generated by the proximal stimulation. Three proximally generated CMAPs were recorded. By averaging the three CMAP profiles, amplitude and latency were calculated, and the distance between stimulation sites was measured and used to calculate nerve conduction velocity (NCV).

[0167] Comparisons of CMAP, latency, amplitude, and NCV one month after TMX treatment showed no detectable differences between TMX-treated and media-treated controls, as observed in open-field studies (data not shown). The sample size of the one-month study did not allow for an assessment with adequate power to detect correlations between PlsEtn levels and neuronal readout values.

[0168] However, four months after TMX, a detectable increase in latency was observed compared to wild-type (p=0.014) and mediated (p=0.021) animals (Figure 9A). A slight decrease in NCV was also observed compared to wild-type (p=0.025), but not in mediated (Figure 9B), while amplitude remained unchanged (Figure 9C). This suggests that plasmalogens play a role in mediating both the speed at which nerve impulses travel and the time required for a stimulus to elicit an action potential.

[0169] Interestingly, a strong inverse correlation was observed between all serum plasmalogen levels and latency, with the exception of PlsEtn 16:0 / 18:1, where reduced plasmalogen levels were associated with increased latency (Figure 10). Less robust inverse correlations were observed between plasmalogen levels and NCV, but the trends were still clear and met statistical significance for selected plasmalogens (p<0.05) (see Figure 11). Amplitude was shown to be inversely correlated with three plasmalogen molecular species: 16:0 / 18:2 (p=0.049, F-statistic 4.1), 16:0 / 22:6 (p=0.028, F-statistic 5.2), and 18:0 / 22:6 (p=0.035, F-statistic 4.8). This suggests that under plasmalogen deficiency conditions, the latency of nerve stimulation is prolonged, resulting in an overall delay in velocity. Supporting this correlation, plasmalogen germline mutant mouse models have previously been reported to have reduced neural condition velocities (da Silva TF, Eira J, Lopes AT, et al. Peripheral nervous system plasmalogens regulate Schwann cell differentiation and myelination. The Journal of clinical investigation. 2014;124(6):2560-2570, Brites P, Ferreira AS, da Silva TF, et al. Alkyl-glycerol rescues plasmalogen levels and pathology of ether-phospholipid deficient mice. PloS one. 2011;6(12):e28539). Furthermore, a slight reduction in amplitude correlated with PlsEtn molecular isoforms containing DHA at the sn2 position, but no overall difference in amplitude was observed in the TMX-treated group. In addition, no changes were observed in overall CMAP values, and no correlation was found between these values ​​and any serum PlsEtn levels (data not shown).

[0170] Standard clinical interventions for increased latency and decreased NCV are linked to defects in myelin integrity. Considering the importance of plasmalogens in myelin structure and the reduction of myelin in the peripheral (da Silva TF, Eira J, Lopes AT, et al. Peripheral nervous system plasmalogens regulate Schwann cell differentiation and myelination. The Journal of clinical investigation. 2014;124(6):2560-2570) and central nervous system (Rodemer C, Thai TP, Brugger B, et al. Inactivation of ether lipid biosynthesis causes male infertility, defects in eye development and optic nerve hypoplasia in mice. Human molecular genetics. 2003;12(15):1881-1895) germline mouse models, it is plausible that plasmalogen deficiency in our model may affect myelin structure and / or function. The slight changes in amplitude over four months also suggest that chronic plasmalogen deficiency may lead to synaptic loss or damage. Further studies, along with detailed characterization of myelin structure, would justify determining whether amplitude is more substantially affected after longer-term deficiency.

[0171] In summary, a novel homozygous Gnpat cKO hemiCAGGCRE-ER animal model was created that is suitable for evaluating adult-onset conditions associated with plasmalogen deficiency. This novel homozygous Gnpat cKO hemiCAGGCRE-ER animal model is also suitable for evaluating age-related conditions associated with plasmalogen deficiency, such as AD. Within one month of TMX treatment, impairment of GNPAT activity was sufficient to significantly reduce PlsEtn levels in serum and tissues, and by four months, significant changes in behavior and motor neuron function were evident. The degree of plasmalogen deficiency in this model was milder compared to previously described germline mutant models, but the changes in behavior and neuron function were comparable. This first confirms that the hyperactive phenotype and impaired neuron function are directly derived from plasmalogen dysfunction and not caused by developmental differences. Furthermore, it was demonstrated that a mild reduction in plasmalogen in adulthood, comparable to that found in individuals with neurodegenerative diseases, is sufficient to impair function.

[0172] The homozygous Gnpat cKO hemi-CAGGCRE-ER exhibits a phenotype indistinguishable from the wild-type before TMX administration, enabling a range of future evaluations that would not have been possible using a complete knockout model. Furthermore, the homozygous Gnpat cKO hemi-CAGGCRE-ER model allows for the investigation of neuroprotective and dose-response studies using plasmalogen precursors provided pre-deficiency or early in the disease course. Future studies using this model will ultimately be able to address remaining questions regarding the role of plasmalogens in the onset and progression of diseases associated with postnatal plasmalogen deficiency, and to evaluate whether plasmalogen enhancement is a clinically viable treatment for these conditions.

[0173] Considering these factors, the novel inducible homozygous Gnpat cKO hemiCAGGCRE-ER mouse model represents the first animal model capable of evaluating the consequences of postnatal plasmalogen deficiency in relation to disease onset and progression. In addition, this model provides an opportunity to assess the clinical potential of plasmalogen enhancement strategies in conditions associated with postnatal plasmalogen deficiency.

[0174] While exemplary and currently preferred embodiments of the present invention have been described in detail above, it should be understood that the inventive concept can be embodied and utilized in various other ways, and that the appended claims are intended to be interpreted as including such modifications, except to the extent limited by the prior art. [Examples]

[0175] Gnpat del / flox cKO Hemi CAGGCRE-ER Mouse All mice were housed at Jackson Laboratories (Bar Harbor, ME) in positive-pressure ventilated polysulfonate cages containing HEPA-filtered air, with 3–4 mice per cage. The animal room was maintained on a 12-hour light-dark cycle (light from 6:00 am to 6:00 pm) using artificial fluorescent lighting. Room temperature was maintained at 22±4°C and relative humidity at 50±15%. The animal room was ventilated 15 times every hour, and animals were provided with ad libitum access to filtered tap water and standard rodent feed. This study adhered to the Canadian National Research Organisation's Guide for the Care and Use of Laboratory Animals. All animal handling was approved by the facility's Animal Care Committee (IACUC) and Biosafety Committee (IBC) under the Animal Care Guidelines (AUS)#:21013. Veterinary care was available throughout the course of the study, and animals were examined by veterinary professionals where justified by clinical signs and other changes. Subsequently, the animals are placed in a standard positive-pressure ventilated cage (70 in) with bio-huts fitted to automate standard nesting and air filtration and water systems. 2The mice, each containing 1–3 mice per cage, were transferred to the Research Institute of the McGill University Health Centre, Animal Resource Division (RI-MUHC ARD [subcontracted by Biospective, Montreal, and QC]). The animal rooms were maintained using artificial fluorescent lighting on a 12-hour light-dark cycle (light from 7:00 am to 7:00 pm). Room temperature was maintained at 21±3°C and relative humidity at 50±20%. The animals were provided with ad libitum access to filtered water and standard rodent feed through a fitted water system. The animals were weighed and monitored every other week, starting in the baseline behavioral assessment week, and the Pain and Distress Assessment Score (PDAS) and Body Condition Score (BCS) were assessed weekly. These studies were conducted in accordance with Canadian Council on Animal Care (CCAC) guidelines and the Animal Use Protocol (AUP).

[0176] Gnpat del / flox Generation of the cKO Hemi CAGGCRE-ER mouse strain The Gnpat gene was targeted for the introduction of a dsDNA-based loxP site into the region adjacent to exon 4 of the Gnpat gene [Chr8: 124863033~124890057 base pairs (bp), positive strand] by microinjecting a CRISPR RNA target guide into the embryo. Donor plasmids with 2kb and 1.6kb homology arms adjacent to the loxP site were used for homology-driven repair. The upstream CRISPR target guide was Gnpat_in3_crRNA1:GTGAGCTCCCCCGGCCTCTC (SEQ ID NO: 1), and the downstream CRISPR target guide was Gnpat_in4_crRNA1:ATGGCAGACAGGGGCCCTTC (SEQ ID NO: 2). This resulted in the introduction of a single mouse strain (Gnpat) containing the correct loxP site without the detection of any additional deletions. flox / WT ) and a second line (Gnpat) exhibiting a 381bp deletion including exon 4 of the Gnpat gene, which results in a complete knockout animal line. del / WT The following genotypes were identified using the following primers: Gnpat_genoF2:TGCCAGCTTTCTACTTGCCA (SEQ ID NO: 18) and Gnpat_genoR2:GCAGTGACCTGACTGAGACC (SEQ ID NO: 19).

[0177] Heterozygous Gnpat cKO(Gnpat flox / WT ) Mice are crossbred to produce homozygous Gnpat cKO (Gnpat flox / flox ) Animals were created. Heterozygous Gnpat KO (Gnpat del / WT) Mice were crossed with hemizygous CAGGCre-ER (trademark) mice (Hayashi S, McMahon AP. Efficient recombination in diverse tissues by a tamoxifen-inducible form of Cre: a tool for temporally regulated gene activation / inactivation in the mouse. Developmental biology. 2002;244(2):305-318) (C57BL / 6J background; Jackson Laboratories stock number 004682) to create mice carrying the hemizygous CAGGCre-ER transgene and heterozygous for deletion in the Gnpat allele (heterozygous Gnpat KO hemiCAGGCRE-ER). Female heterozygous Gnpat KO hemiCAGGCRE-ER mice were then converted into male homozygous Gnpat cKO (Gnpat flox / flox ) By mating with animals, Gnpat del / flox Furthermore, it produces animals that are hemizygous with respect to the CAGGCre-ER(trademark) transgene, which is a novel TMX-inducible Gnpat conditional knockout (Gnpat del / flox He represented cKO Hemi (CAGGCRE-ER).

[0178] Tamoxifen administration Tamoxifen powder was dissolved in 100% ethanol (Sigma E7023) to a concentration of 50 mg / mL at 55°C, diluted 1:10 in corn oil to 5 mg / mL, and stored at -20°C until the day of administration. On the day of administration, the solution was thawed at 37°C. Mice aged 4–7.5 months were administered 50 mg / kg of TMX (or the medium) once daily for 7 consecutive days using a standardized dose volume of 10 mL / kg body weight. All technicians performing the experiments were blinded to the animal genotypes and treatment groups. The animals were then aged for a further 4 months. After 10 weeks, the mice were transferred to RI-MUHC ARD (McGill University Health Centre Research Facility, Animal Research Division [subcontracted by Biospective, Montreal, and QC]) for residual analysis, which was performed according to Canadian Animal Care Association (CCAC) guidelines.

[0179] Gnpat del / flox cKO Hemi CAGGCRE-ER characteristic determination Wild-type control (wild-type), Gnpat del / flox cKO hemi CAGGCRE-ER control + media (media), Gnpat del / flox Characterization studies were conducted to evaluate lipidomics, behavior, and neuroimaging comparisons between cKO hemi-CAGGCRE-ER+TMX (TMX). All animals were aged for 8 months after TMX treatment, at which point behavioral and imaging studies (discussed below) were completed. Endpoint blood samples were collected from each animal via the vena cava. The blood was transferred to EDTA-containing test tubes and kept on ice until converted to plasma. The test tubes were centrifuged at 3000×g for 15 minutes at 4°C within 30 minutes of blood collection. Subsequently, the plasma was placed in clear Eppendorf tubes and stored at -80°C until analysis.

[0180] After euthanasia, the animals were perfused with 20-40 mL of chilled phosphate-buffered saline. The liver, lungs, and intestines were dissected from the animals, collected in separate Eppendorf tubes, and immediately rapidly frozen on dry ice. The tissues were stored at -80°C until analysis.

[0181] Lipid quantification by FI-MS / MS Plasma extraction was performed on 20 μL aliquots in 1.4 mL Thermo Matrix tubes. HPLC-grade water (20 μL) and a labeled internal standard at 0.05 μg / mL were used. 9 Lipids were extracted into 600 μL of ethyl acetate containing 2% water and 1% formic acid, including [D PlsEtn 18:0 / 18:1]. The sample was mixed by hand and then vortexed at 1500 rpm for 30 minutes using a Mixmate. Next, the sample was centrifuged at 2000 rcf for 5 minutes.

[0182] Tissue samples were extracted by placing approximately 50 mg of each tissue into 2 mL safe-lock Eppendorf tubes, and all weights were recorded for normalization. Two spoonfuls (approximately 300 μL) of 0.5 mm zirconium oxide beads and 600 μL of ethyl acetate containing 2% water and 1% formic acid were added to each tube, and the samples were then homogenized for 10 minutes using a Bullet Blender Storm Pro (Next Advantage). To ensure complete lipid extraction, each sample was mixed on a Mixmate at 1500 rpm for 1 hour, followed by centrifugation at 3500 rcf for 10 minutes. Based on tissue weight, aliquots of the eluent for all samples were taken from the tissue pellet and diluted to 50 mg / mL. Labeled internal standard (at 0.05 μg / mL) 9 The sample was further diluted in a tissue-specific manner in ethyl acetate containing 2% water and 1% formic acid (D PlsEtn 18:0 / 18:1) to bring the lipid levels within the range for linear quantification.

[0183] 100 μL aliquots of each extract were analyzed by flow injection tandem mass spectrometry (FI-MS / MS) on an Applied Biosystems Q-Trap mass spectrometer connected to an Agilent 1200 HPLC system. Each transition was scanned for 50 milliseconds, with a total acquisition time of 1 minute per sample. The mobile phase was an 80:15:5 ethyl acetate:methanol:water solution at a flow rate of 450 μL / min. The standards and stable isotopes used were manufactured by Avanti Polar Lipids, with a purity of over 99% achieved by TLC, and the solvent was HPLC grade. The measured transitions are reported in Table 1. The results were processed using Analyst software (version 1.5.1) as μg lipids per mg of starting tissue (μg / mg), or, in the case of serum, μg lipids per mL of serum (μg / mL).

[0184] Tamoxifen treatment Gnpat del / flox Lipid changes in cKO hemiCAGGCRE-ER mice Tissue and plasma samples were collected eight months after TMX and analyzed for plasmalogen levels. Total plasmalogen levels, determined by summing eight individual plasmalogen molecular species measured, were significantly reduced in the intestines, liver, lungs, and plasma (p<0.001; Figure 12), confirming that tamoxifen administration resulted in chronic knockout of plasmalogen biosynthesis.

[0185] Open field behavioral assessment Animals with germline mutations in the plasmalogen biosynthesis pathway have been shown to exhibit a range of behavioral differences from healthy controls. Open-field hyperactivity is a consistent finding in animals with germline mutations in the plasmalogen biosynthesis pathway (Dorninger F, Konig T, Scholze P, et al. Disturbed Neurotransmitter Homeostasis in Ether Lipid Deficiency. Human molecular genetics. 2019; Fallatah W, Smith T, Cui W, et al. Oral administration of a synthetic vinyl-ether plasmalogen normalizes open field activity in a mouse model of Rhizomelic chondrodysplasia punctata. Disease models & mechanisms. 2019), but these studies have failed to distinguish whether these behavioral changes are caused by differences in neurodevelopment or function. Gnpat treated with TMX... del / flox Using cKO hemiCAGGCRE-ER mice, it was possible to evaluate the effect of plasmalogen deficiency in adults on activity levels in open fields.

[0186] A beige 40cm tall car with an overhead camera pointed towards the corner. 3 A mouse was placed in one corner of an open field box. Recording began approximately 2 seconds after the animal was placed, after confirming the camera detection threshold and allowing the experimenter to move out of the mouse's line of sight. The mouse was allowed to move freely inside the box, and video was recorded for 10 minutes. The recorded footage underwent manual quality control to ensure accurate detection of the mouse and its standing behavior. Subsequently, the footage was analyzed using Bioseb (automated tracking software) for distance traveled (meters), activity time (seconds), standing, and the percentage of time spent in the central area of ​​the field compared to the periphery.

[0187] Tracking data from open fields revealed clear differences between plasmalogen-deficient TMX-treated mice compared to wild-type and media-treated control groups. Total distance traveled was similar between wild-type and media-treated groups, but TMX-treated animals traveled approximately twice as far, representing a significant increase (p<0.01; Figure 13A). Similarly, TMX-treated animals exhibited increased average velocity (p<0.01; Figure 13B) and duration of activity (p<0.01; Figure 13C) in open fields compared to either wild-type or media-treated animals.

[0188] Sleep behavior assessment Sleep disorders are linked to Alzheimer's disease (Weldemichael DA, Grossberg GT. Circadian rhythm disturbances in patients with Alzheimer's disease: a review. International journal of Alzheimer's disease. 2010;2010; Lucey BP. It's complicated: The relationship between sleep and Alzheimer's disease in humans. Neurobiology of disease. 2020;144:105031) and Parkinson's disease (Dhawan V, Healy DG, Pal S, Chaudhuri KR. Sleep-related problems of Parkinson's disease. Age and ageing. 2006;35(3):220-228; Zuzuarregui JRP, During EH. Sleep Issues in Parkinson's Disease and Their Management. Neurotherapeutics: the journal of the American Society for Experimental NeuroTherapeutics). It has been shown to be an early symptom of neurodegenerative diseases, including (2020;17(4):1480-1494). To evaluate whether chronic plasmalogen deficiency in adulthood affects the quantity and quality of sleep, animals were housed in specialized PiezoSleep cages and their sleep and wake cycles during both the light and dark phases of the day were monitored.

[0189] Animals were individually housed in PiezoSleep cages for three consecutive days, approximately eight months after TMX administration, with ensured access to feed and water and careful monitoring using a 12h / 12h light-dark cycle. Data from the first 24 hours were excluded from the analysis to allow for cage adaptation, generating a total of 48 hours of data for each evaluation time. After three days, the mice were returned to their home cages. The animals' sleep and wake cycles were quantified using the fully automated PiezoSleep mouse behavior tracking system. For each animal, the percentage of sleep to wakefulness was calculated at each time point. Sleep interval data were also quantified and averaged over both light and dark periods. Sleep-to-wake data were reviewed for quality control, and animals with poor sleep-to-wake ratios were excluded from the analysis.

[0190] Compared to wild-type control animals, Gnpat del / flox Differences in sleep structure were observed in cKO hemi-CAGGCRE-ER mice, particularly those treated with TMX. While there were no significant differences between groups in the amount of time animals spent sleeping during the light phase (Figure 14A), during the dark phase, wild-type animals slept significantly more than any other group (p<0.001), while media-treated mice slept an intermediate amount, and the TMX-treated group slept significantly less (p<0.001; Figure 14B).

[0191] Gnpat compared to wild-type and TMX-untreated animals. del / flox Overall shifts in sleep duration and sleep interval length in cKO hemi-CAGGCRE-ER mice treated with TMX suggest that chronic plasmalogen deficiency has a serious impact on sleep. This suggests that Gnpat serves as a model for understanding the effects of postnatal plasmalogen deficiency. del / flox This provides further support for the usefulness of cKO hemiCAGGCRE-ER mice. Furthermore, sleep represents a meaningful, interferable endpoint that can be evaluated in the future to determine the clinical usefulness of therapeutic protocols designed to address chronic plasmalogen deficiency.

[0192] Anatomical MRI Plasmalogens are essential components of both myelin sheaths and nerve cell membranes. Numerous studies have shown that reductions in plasmalogen levels can affect both the structure and function of brain cells, but the lack of models that allow for the induction of plasmalogen deficiency in adulthood has made it impossible to evaluate the effects of this deficiency on brain structure. Our Gnpat del / flox Using the cKO hemi-CAGGCRE-ER model, the inventors sought to evaluate whether chronic plasmalogen deficiency in adult animals resulted in measurable differences in brain structure and size using anatomical MRI with a 7T Bruker BioSpec 70 / 30 MRI system.

[0193] Each animal was anesthetized with a 4-5% isoflurane dose and fixed to an MRI-compatible bed. The animals were allowed to breathe spontaneously without medical ventilation. Respiratory rate and body temperature were continuously monitored. MRI scanning included setup, scouting, and shimming. After setup, anatomical images were acquired using a balanced steady-state free precision (b-SSFP) sequence. To minimize banding artifacts, phase cycle images were synthesized using sum-of-squares reconstruction. The total scan time was approximately 1 hour per animal.

[0194] MRI scans underwent initial image quality control (QC) based on quality control images including multi-view data, within the scan time. Scans with excessive motion or image artifacts were deemed unsuitable; failed scans were repeated. All images were processed using the NIGHTWING® software package.

[0195] Using b-SSFP images, an unbiased and symmetrical anatomical template was created. Prior to template creation, each reconstructed image volume underwent image heterogeneity correction using the N3 algorithm, brain masking, and linear spatial standardization using a 12-parameter affine transformation to map individual images from native coordinate space to a reference space. In short, the template creation process involved iterative (coarse to fine resolution) estimation of nonlinear transformations to match each MRI scan to the population evolving mean. Next, individual MRI scans were registered linearly and nonlinearly against this anatomical template (Grand'maison M, Zehntner SP, Ho MK, et al. Early cortical thickness changes predict β-amyloid deposition in a mouse model of Alzheimer's disease. Neurobiology of disease. 2013;54:59-67; Lau JC, Lerch JP, Sled JG, Henkelman RM, Evans AC, Bedell BJ. Longitudinal neuroanatomical changes determined by deformation-based morphometry in a mouse model of Alzheimer's disease. NeuroImage. 2008;42(1):19-27).

[0196] Total brain volume was measured by MRI for the left and right hemispheres. Volume was similar between wild-type and medium-control mice, but TMX-treated mice showed a reduction in total brain volume (p<0.01; Figure 15).

[0197] Regional brain volume was calculated for all major target regions of the brain. While wild-type and medium-treated control animals consistently exhibited similar regional brain volume, TMX-treated animals were consistently observed to have reduced volume. The differences between the control and TMX-treated groups were more pronounced in more posterior brain regions, including the temporoparietal cortex (Figure 16), occipital cortex (Figure 17), hippocampus (Figure 18), olfactory cortex (Figure 19), striatum (Figure 20), thalamus (Figure 21), and brainstem (Figure 22) (p<0.01).

[0198] In addition to regional differences in brain volume, white matter or myelin volume was also compared. A similar pattern was observed, with the two control groups (wild-type and medium-treated) having similar white matter volumes, while TMX-treated animals showed a significant reduction in white matter volume (p<0.01; Figure 23). Considering the high levels of plasmalogen in myelin, TMX-treated Gnpat del / flox It was expected that a lack of plasmalogen biosynthesis in cKO hemi-CAGGCRE-ER mice would result in reduced volume. These data are intended for Gnpat to study the neurodegenerative consequences of chronic plasmalogen deficiency in adulthood. del / flox This supports the usefulness of the cKO hemi CAGGCRE-ER model and further supports its usefulness in testing the clinical potential of novel therapeutic strategies.

[0199] Quantification of neurofilament light chains Neurofilament light chains (NfLs) are protein components of the neuronal cytoskeleton. Neuronal injury leads to the release of NfLs into the blood and cerebrospinal fluid (CSF), and therefore, NfL levels are considered to be a nonspecific but highly sensitive marker of neuroinflammation. NfLs are increasingly being used as a biomarker of neuroinflammation in the diagnosis and clinical monitoring of patients with Alzheimer's disease. Changes in brain structure observed in TMX-treated animals suggest neuroinflammation, and therefore, NfL levels in both plasma and CSF were evaluated.

[0200] Plasma and CSF samples were collected from all mice at the time of euthanasia. For CSF extraction, animals were deeply anesthetized with avatin (500 mg / kg) and placed prone with their heads and bodies at a 120° angle. The skin and muscles of the nape of the neck were pulled down. A 36-gauge Hamilton syringe was used to puncture the dura mater at the cisterna magna site. CSF was collected by capillary action, transferred to a 0.2 mL low-protein-binding microcentrifuge tube, centrifuged to check for blood contamination, and frozen at -80°C until analysis. Blood collection and plasma preparation followed the CSF collection described above. NfL levels were quantified by RayBiotech using the Simoa® (Quanterix®) single-molecule protein detection platform.

[0201] NfL CSF levels were similar between wild-type and media-treated mice, but levels were approximately twice as high in TMX-treated animals, representing a statistically significant increase (p<0.001; Figure 24A). Plasma levels of NfL showed a similar trend with TMX treatment, resulting in levels twice as high compared to either the wild-type or media-treated group (p<0.001, Figure 24B). Overall, these data suggest that chronic plasmalogen deficiency in adulthood can lead to neuroinflammation similar to that seen in individuals with Alzheimer's disease (Preische O, Schultz SA, Apel A, et al. Serum neurofilament dynamics predicts neurodegeneration and clinical progression in presymptomatic Alzheimer's disease. Nature medicine. 2019;25(2):277-283) or Parkinson's disease (Lin CH, Li CH, Yang KC, et al. Blood NfL: A biomarker for disease severity and progression in Parkinson disease. Neurology. 2019;93(11):e1104-e1111).

[0202] In summary, Gnpat del / flox The cKO hemi-CAGGCRE-ER animal model represents a novel model for evaluating behavioral and neurodegenerative outcomes of adult-onset conditions associated with plasmalogen deficiency, such as AD and PD. Eight months after TMX administration, significant behavioral changes were observed, as evidenced by altered sleep structure and open-field activity, as well as structural changes in the brain, as evidenced by reduced brain and white matter volume. Additionally, NfL levels in plasma and CSF suggest neuroinflammation as a result of chronic plasmalogen deficiency. Taken together, these data clearly demonstrate that mild plasmalogen reduction in adulthood, comparable to that found in individuals with neurodegenerative diseases, is sufficient to impair behavior and function. [Examples]

[0203] Gnpat for evaluating plasmalogen-targeted therapies in Alzheimer's disease del / flox Use of the cKO Hemi CAGGCRE-ER model All mice were housed at Jackson Laboratories (Bar Harbor, ME) in positive-pressure ventilated polysulfonate cages containing HEPA-filtered air, with 3–4 mice per cage. The animal room was maintained on a 12-hour light-dark cycle (light from 6:00 am to 6:00 pm) using artificial fluorescent lighting. Room temperature was maintained at 22±4°C and relative humidity at 50±15%. The animal room was ventilated 15 times every hour, and animals were provided with ad libitum access to filtered tap water and standard rodent feed. This study adhered to the Canadian National Research Organisation's Guide for the Care and Use of Laboratory Animals. All animal handling was approved by the facility's Animal Care Committee (IACUC) and Biosafety Committee (IBC) under the Animal Care Guidelines (AUS)#:21013. Veterinary care was available throughout the course of the study, and animals were examined by veterinary professionals where justified by clinical signs and other changes. Subsequently, the animals are placed in a standard positive-pressure ventilated cage (70 in) with bio-huts fitted to automate standard nesting and air filtration and water systems. 2 The mice, each containing 1–3 mice per cage, were transferred to the McGill University Health Centre Research Facility, Animal Research Division (RI-MUHC ARD [subcontracted by Biospective, Montreal, QC]). The animal rooms were maintained using artificial fluorescent lighting on a 12-hour light-dark cycle (light from 7:00 am to 7:00 pm). Room temperature was maintained at 21±3°C and relative humidity at 50±20%. The animals were provided with ad libitum access to filtered water and standard rodent feed through an installed water system. The animals were weighed and monitored every other week, starting in the baseline behavioral assessment week, and pain and distress assessment scores (PDAS) and body condition scores (BCS) were assessed weekly. These studies followed Canadian Animal Care Association (CCAC) guidelines and the Animal Use Protocol (AUP).

[0204] Gnpat del / flox Generation of the cKO Hemi CAGGCRE-ER mouse strain The Gnpat gene was targeted for the introduction of a dsDNA-based loxP site into the region adjacent to exon 4 of the Gnpat gene [Chr8: 124863033~124890057 base pairs (bp), positive strand] by microinjecting a CRISPR RNA target guide into the embryo. Donor plasmids with 2kb and 1.6kb homology arms adjacent to the loxP site were used for homology-driven repair. The upstream CRISPR target guide was Gnpat_in3_crRNA1:GTGAGCTCCCCCGGCCTCTC (SEQ ID NO: 1), and the downstream CRISPR target guide was Gnpat_in4_crRNA1:ATGGCAGACAGGGGCCCTTC (SEQ ID NO: 2). This resulted in the introduction of a single mouse strain (Gnpat) containing the correct loxP site without the detection of any additional deletions. flox / WT ) and a second line (Gnpat) exhibiting a 381bp deletion including exon 4 of the Gnpat gene, which results in a complete knockout animal line. del / WT The following genotypes were identified using the following primers: Gnpat_genoF2:TGCCAGCTTTCTACTTGCCA (SEQ ID NO: 18) and Gnpat_genoR2:GCAGTGACCTGACTGAGACC (SEQ ID NO: 19).

[0205] Heterozygous Gnpat cKO(Gnpat flox / WT ) Mice are crossbred to produce homozygous Gnpat cKO (Gnpat flox / flox ) Animals were created. Heterozygous Gnpat KO (Gnpat del / WT) Mice were crossed with hemizygous CAGGCre-ER (trademark) mice (Hayashi S, McMahon AP. Efficient recombination in diverse tissues by a tamoxifen-inducible form of Cre: a tool for temporally regulated gene activation / inactivation in the mouse. Developmental biology. 2002;244(2):305-318) (C57BL / 6J background; Jackson Laboratories stock number 004682) to create mice carrying the hemizygous CAGGCre-ER transgene and heterozygous for deletion in the Gnpat allele (heterozygous Gnpat KO hemiCAGGCRE-ER). Female heterozygous Gnpat KO hemiCAGGCRE-ER mice were then converted into male homozygous Gnpat cKO (Gnpat flox / flox ) By mating with animals, Gnpat del / flox Furthermore, it produces animals that are hemizygous with respect to the CAGGCre-ER(trademark) transgene, which is a novel TMX-inducible Gnpat conditional knockout (Gnpat del / flox He represented cKO Hemi (CAGGCRE-ER).

[0206] Tamoxifen and PPI-1011 treatment Tamoxifen (TMX) powder was dissolved in 100% ethanol (Sigma E7023) at 55°C to a concentration of 50 mg / mL, then diluted 1:10 in corn oil to a concentration of 5 mg / mL and stored at -20°C until the day of administration. On the day of administration (4 months of age), the solution was thawed at 37°C, and 50 mg / kg of TMX (or the medium) was administered once daily for 7 consecutive days using a standardized dose volume of 10 mL / kg body weight. PPI-1011, a synthetic 16:0 / 22:6 / lipoic acid (sn1 / sn2 / sn3) ether precursor, or the medium (lipid coconut oil containing 0.1% thioglycerol) was administered orally every other day for 4 months, starting 4 months after TMX administration, at a dose of 200 mg / kg.

[0207] [Table 2]

[0208] Plasmalogen analysis Plasma extraction was performed on 20 μL aliquots in 1.4 mL Thermo Matrix tubes. HPLC-grade water (20 μL) and a labeled internal standard at 0.05 μg / mL were used. 9 Lipids were extracted into 600 μL of ethyl acetate containing 2% water and 1% formic acid, including [D PlsEtn 18:0 / 18:1]. The samples were mixed by hand and then vortexed at 1500 rpm for 30 minutes using a Mixmate. Next, the samples were centrifuged at 2000 rcf for 5 minutes. 100 μL aliquots of each extract were analyzed by flow injection tandem mass spectrometry (FI-MS / MS) on an Applied Biosystems Q-Trap mass spectrometer connected to an Agilent 1200 HPLC system. The results were processed using Analyst software (version 1.5.1) as μg lipid per mL of plasma (μg / mL).

[0209] PPI-1011 treatment is tamoxifen treatment Gnpat del / flox To normalize plasmalogen levels in cKO hemi CAGGCRE-ER mice. Plasma samples were collected and analyzed for levels of 16:0 / 22:6 plasmalogen, the major metabolite of PPI-1011. Plasma levels of PlsEtn 16:0 / 22:6 were significantly reduced in the cKO TMX group compared to the wild-type and cKO media groups (p<0.001; Figure 25), confirming chronic knockout of plasmalogen biosynthesis. The cKO 1011 group had significantly increased plasma PlsEtn 16:0 / 22:6 levels compared to cKO TMX animals (p<0.001; Figure 25). In fact, plasma concentrations in cKO 1011 animals were comparable to those in cKO control animals, confirming PPI-1011's ability to normalize plasma plasmalogen levels. Furthermore, the ability to correct plasmalogen levels is useful for evaluating Gnpat therapeutic interventions targeting underlying plasmalogen deficiency. del / flox The usefulness of the cKO hemi CAGGCRE-ER mouse model was demonstrated.

[0210] Anatomical MRI The inventors' Gnpat del / flox Using the cKO hemi-CAGGCRE-ER model, the inventors sought to evaluate whether treatment with PPI-1011 could rescue the brain volume reduction observed after induction of chronic plasmalogen deficiency in adult animals treated with tamoxifen. Brain volume was assessed using anatomical MRI with a 7T Bruker BioSpec 70 / 30 MRI system.

[0211] Each animal was anesthetized with a 4-5% isoflurane dose and fixed to an MRI-compatible bed. The animals were allowed to breathe spontaneously without medical ventilation. Respiratory rate and body temperature were continuously monitored. MRI scanning included setup, scouting, and shimming. After setup, anatomical images were acquired using a 3D equilibrium steady-state free precession (b-SSFP) sequence. To minimize banding artifacts, phase cycle images were synthesized using sum-of-squares reconstruction. The total scan time was approximately 1 hour per animal.

[0212] MRI scans underwent initial image quality control (QC) based on quality control images including multi-view data, within the scan time. Scans with excessive motion or image artifacts were deemed unsuitable; failed scans were repeated. All images were processed using the NIGHTWING® software package.

[0213] Using b-SSFP images, an unbiased and symmetrical anatomical template was created. Prior to template creation, each reconstructed image volume underwent image heterogeneity correction using the N3 algorithm, brain masking, and linear spatial standardization using a 12-parameter affine transformation to map individual images from native coordinate space to a reference space. In short, the template creation process involved iterative (coarse to fine resolution) estimation of nonlinear transformations to match each MRI scan to the population's evolving mean. Next, individual MRI scans were registered linearly and nonlinearly against this anatomical template (Grand'maison M, Zehntner SP, Ho MK, et al. Early cortical thickness changes predict β-amyloid deposition in a mouse model of Alzheimer's disease. Neurobiology of disease. 2013;54:59-67; Lau JC, Lerch JP, Sled JG, Henkelman RM, Evans AC, Bedell BJ. Longitudinal neuroanatomical changes determined by deformation-based morphometry in a mouse model of Alzheimer's disease. NeuroImage. 2008;42(1):19-27).

[0214] Brain volume increased with PPI-1011 treatment. Anatomical MRI was performed on all animals, and brain volumes were calculated for the left and right hemispheres. The cKO TMX group, which is known to have chronic plasmalogen deficiency, showed significant reductions in total brain, white matter, and hippocampal volumes. This was predicted due to the extremely important role that plasmalogens play in maintaining brain structure and myelin composition. The cKO 1011 group showed increased volumes in the total brain, white matter, and hippocampus, but only the increases in total brain and hippocampal volumes reached significance (p < 0.05; Figure 26). These results confirm that an increase in plasmalogen levels in deficient animals results in obvious physiological changes, and Gnpat for evaluating the clinical usefulness of plasmalogen-targeted therapies del / flox Further demonstrate the usefulness of the cKO hemiCAGGCRE-ER mouse model.

[0215] Mass spectrometry imaging Brains from the study animals were rapidly frozen in liquid nitrogen and maintained at -80 °C until analysis. Each brain was sectioned sagittally, the sections were sublimated using a 1,5-DAN matrix, analyzed by MALDI-MSI (negative ionization mode), and resolved at a spatial resolution of 125 μM (University of Montreal).

[0216] PPP-1011 increased plasmalogen levels as shown by mass spectrometry imaging Each brain slice was analyzed using mass spectrometry imaging (MSI) for the levels of the 16:0 / 22:6 plasmalogen, known to be the major metabolite of PPI-1011, and the 16:0 / 18:1 plasmalogen molecular species, the major plasmalogen component in myelin. MSI clearly illustrates that different plasmalogen molecular species appear to have different localizations than DHA-containing molecular species, for example, preferentially localized in the cortex and non-myelin regions of the cerebellum, while plasmalogens containing more saturated fatty acids, such as 16:0 / 18:1, appear to be preferentially enriched in myelin bundles (arrows in Figure 27). cKO TMX animals showed reduced levels of both PlsEtn 16:0 / 22:6 and PlsEtn 16:0 / 18:1 in the brain compared to cKO control animals. This was expected given the plasmalogen deficiency recorded in the plasma, but it confirmed the specificity and usefulness of the MSI method for measuring brain plasmalogen levels. Mice treated with PPI-1011 for 4 months showed increased levels of PlsEtn 16:0 / 22:6 and PlsEtn 16:0 / 18:1 in the brain (Figure 27). This data not only confirmed the ability of plasmalogens resulting from PPI-1011 treatment to cross the blood-brain barrier, but also provides a basis for evaluating plasmalogen-targeted therapies as a treatment for central nervous system-based consequences of chronic plasmalogen deficiency. del / flox The usefulness of the cKO Hemi CAGGCRE-ER model was also proven.

[0217] In summary, Gnpat del / flox The cKO Hemi-CAGGCRE-ER model represents a novel model for studying the consequences of chronic plasmalogen deficiency in adulthood, as well as for evaluating therapies designed to correct plasmalogen deficiency, or any biochemical or functional changes resulting from it.

[0218] While exemplary and currently preferred embodiments of the present invention have been described in detail above, it should be understood that the inventive concept can be embodied and utilized in various other ways, and that the appended claims are intended to be interpreted as including such modifications, except to the extent limited by the prior art.

[0219] (References) 1. Braverman NE, Moser AB. Functions of plasmalogen lipids in health and disease. Biochim Biophys Acta. 2012;1822(9):1442-1452. 2. Glaser PE, Gross RW. Plasmenylethanolamine facilitates rapid membrane fusion: a stopped-flow kinetic investigation correlating the propensity of a major plasma membrane constituent to adopt an HII phase with its ability to promote membrane fusion. Biochemistry. 1994;33(19):5805-5812. 3. Dorninger F, Herbst R, Kravic B, et al. Reduced muscle strength in ether lipid-deficient mice is accompanied by altered development and function of the neuromuscular junction. Journal of neurochemistry. 2017;143(5):569-583. 4. Dorninger F, Konig T, Scholze P, et al. Disturbed Neurotransmitter Homeostasis in Ether Lipid Deficiency. Human molecular genetics. 2019. 5. da Silva TF, Eira J, Lopes AT, et al. Peripheral nervous system plasmalogens regulate Schwann cell differentiation and myelination. The Journal of clinical investigation. 2014;124(6):2560-2570. 6. Wood PL, Khan MA, Smith T, Goodenowe DB. Cellular diamine levels in cancer chemoprevention: modulation by ibuprofen and membrane plasmalogens. Lipids Health Dis. 2011;10:214. 7. Farooqui AA, Horrocks LA. Plasmalogens: workhorse lipids of membranes in normal and injured neurons and glia. The Neuroscientist : a review journal bringing neurobiology, neurology and psychiatry. 2001;7(3):232-245. 8. Luoma AM, Kuo F, Cakici O, et al. Plasmalogen phospholipids protect internodal myelin from oxidative damage. Free radical biology & medicine. 2015;84:296-310. 9. Kuczynski B, Reo NV. Evidence that plasmalogen is protective against oxidative stress in the rat brain. Neurochemical research. 2006;31(5):639-656. 10. Han X. Lipid alterations in the earliest clinically recognizable stage of Alzheimer's disease: implication of the role of lipids in the pathogenesis of Alzheimer's disease. Current Alzheimer research. 2005;2(1):65-77. 11. Goodenowe DB, Cook LL, Liu J, et al. Peripheral ethanolamine plasmalogen deficiency: a logical causative factor in Alzheimer's disease and dementia. J Lipid Res. 2007;48(11):2485-2498. 12. Fabelo N, Martin V, Santpere G, et al. Severe alterations in lipid composition of frontal cortex lipid rafts from Parkinson's disease and incidental Parkinson's disease. Mol Med. 2011;17(9-10):1107-1118. 13. Dragonas C, Bertsch T, Sieber CC, Brosche T. Plasmalogens as a marker of elevated systemic oxidative stress in Parkinson's disease. Clinical chemistry and laboratory medicine : CCLM / FESCC. 2009;47(7):894-897. 14. Kaddurah-Daouk R, McEvoy J, Baillie R, et al. Impaired plasmalogens in patients with schizophrenia. Psychiatry research. 2012;198(3):347-352. 15. Murphy EJ, Schapiro MB, Rapoport SI, Shetty HU. Phospholipid composition and levels are altered in Down syndrome brain. Brain research. 2000;867(1-2):9-18. 16. Moraitou M, Dimitriou E, Dekker N, Monopolis I, Aerts J, Michelakakis H. Gaucher disease: plasmalogen levels in relation to primary lipid abnormalities and oxidative stress. Blood cells, molecules & diseases. 2014;53(1-2):30-33. 17. Duker AL, Niiler T, Kinderman D, et al. Rhizomelic chondrodysplasia punctata morbidity and mortality, an update. American journal of medical genetics Part A. 2020;182(3):579-583. 18. Duker AL, Niiler T, Eldridge G, Brereton NH, Braverman NE, Bober MB. Growth charts for individuals with rhizomelic chondrodysplasia punctata. American journal of medical genetics Part A. 2017;173(1):108-113. 19. Duker AL, Eldridge G, Braverman NE, Bober MB. Congenital heart defects common in rhizomelic chondrodysplasia punctata. American journal of medical genetics Part A. 2016;170A(1):270-272. 20. White AL, Modaff P, Holland-Morris F, Pauli RM. Natural history of rhizomelic chondrodysplasia punctata. American journal of medical genetics Part A. 2003;118A(4):332-342. 21. Brites P, Motley AM, Gressens P, et al. Impaired neuronal migration and endochondral ossification in Pex7 knockout mice: a model for rhizomelic chondrodysplasia punctata. Human molecular genetics. 2003;12(18):2255-2267. 22. Brodde A, Teigler A, Brugger B, et al. Impaired neurotransmission in ether lipid-deficient nerve terminals. Human molecular genetics. 2012;21(12):2713-2724. 23. Teigler A, Komljenovic D, Draguhn A, Gorgas K, Just WW. Defects in myelination, paranode organization and Purkinje cell innervation in the ether lipid-deficient mouse cerebellum. Human molecular genetics. 2009;18(11):1897-1908. 24. Hossain MS, Mawatari S, Fujino T. Plasmalogens, the Vinyl Ether-Linked Glycerophospholipids, Enhance Learning and Memory by Regulating Brain-Derived Neurotrophic Factor. Front Cell Dev Biol. 2022;10:828282. 25. Hayashi S, McMahon AP. Efficient recombination in diverse tissues by a tamoxifen-inducible form of Cre: a tool for temporally regulated gene activation / inactivation in the mouse. Developmental biology. 2002;244(2):305-318. 26. Han X, Holtzman DM, McKeel DW, Jr. Plasmalogen deficiency in early Alzheimer's disease subjects and in animal models: molecular characterization using electrospray ionization mass spectrometry. Journal of neurochemistry. 2001;77(4):1168-1180. 27. Wood PL, Khan AM, Mankidy R, Smith T, Goodenowe D. Plasmalogen Deficit: A New and Testable Hypothesis for the Etiology of Alzheimer's Disease. In: De La Monte S, ed. Alzheimer's Disease Pathogenesis-Core Concepts, Shifting Paradigms and Therapeutic Targets. InTech; 2011. 28. Ginsberg L, Rafique S, Xuereb JH, Rapoport SI, Gershfeld NL. Disease and anatomic specificity of ethanolamine plasmalogen deficiency in Alzheimer's disease brain. Brain research. 1995;698(1-2):223-226. 29. Guan Z, Wang Y, Cairns NJ, Lantos PL, Dallner G, Sindelar PJ. Decrease and structural modifications of phosphatidylethanolamine plasmalogen in the brain with Alzheimer disease. Journal of neuropathology and experimental neurology. 1999;58(7):740-747. 30. Wood PL, Mankidy R, Ritchie S, et al. Circulating plasmalogen levels and Alzheimer Disease Assessment Scale-Cognitive scores in Alzheimer patients. J Psychiatry Neurosci. 2010;35(1):59-62. 31. Marin R, Fabelo N, Martin V, et al. Anomalies occurring in lipid profiles and protein distribution in frontal cortex lipid rafts in dementia with Lewy bodies disclose neurochemical traits partially shared by Alzheimer's and Parkinson's diseases. Neurobiology of aging. 2017;49:52-59. 32. Guedes LC, Chan RB, Gomes MA, et al. Serum lipid alterations in GBA-associated Parkinson's disease. Parkinsonism & related disorders. 2017. 33. Paesler K, Xie K, Hettich MM, et al. Limited effects of an eIF2αS51A allele on neurological impairments in the 5xFAD mouse model of Alzheimer's disease. Neural plasticity. 2015;2015:825157. 34. Bardgett ME, Davis NN, Schultheis PJ, Griffith MS. Ciproxifan, an H3 receptor antagonist, alleviates hyperactivity and cognitive deficits in the APP Tg2576 mouse model of Alzheimer's disease. Neurobiology of learning and memory. 2011;95(1):64-72. 35. Faizi M, Bader PL, Saw N, et al. Thy1-hAPP(Lond / Swe+) mouse model of Alzheimer's disease displays broad behavioral deficits in sensorimotor, cognitive and social function. Brain and behavior. 2012;2(2):142-154. 36. Fallatah W, Smith T, Cui W, et al. Oral administration of a synthetic vinyl-ether plasmalogen normalizes open field activity in a mouse model of Rhizomelic chondrodysplasia punctata. Disease models & mechanisms. 2019. 37. Glaser PE, Gross RW. Rapid plasmenylethanolamine-selective fusion of membrane bilayers catalyzed by an isoform of glyceraldehyde-3-phosphate dehydrogenase: discrimination between glycolytic and fusogenic roles of individual isoforms. Biochemistry. 1995;34(38):12193-12203. 38. Miville-Godbout E, Bourque M, Morissette M, et al. Plasmalogen Augmentation Reverses Striatal Dopamine Loss in MPTP Mice. PloS one. 2016;11(3):e0151020. 39. Brites P, Ferreira AS, da Silva TF, et al. Alkyl-glycerol rescues plasmalogen levels and pathology of ether-phospholipid deficient mice. PloS one. 2011;6(12):e28539. 40. Rodemer C, Thai TP, Brugger B, et al. Inactivation of ether lipid biosynthesis causes male infertility, defects in eye development and optic nerve hypoplasia in mice. Human molecular genetics. 2003;12(15):1881-1895. 41. Weldemichael DA, Grossberg GT. Circadian rhythm disturbances in patients with Alzheimer's disease: a review. International journal of Alzheimer's disease. 2010;2010. 42. Lucey BP. It's complicated: The relationship between sleep and Alzheimer's disease in humans. Neurobiology of disease. 2020;144:105031. 43. Dhawan V, Healy DG, Pal S, Chaudhuri KR. Sleep-related problems of Parkinson's disease. Age and ageing. 2006;35(3):220-228. 44. Zuzuarregui JRP, During EH. Sleep Issues in Parkinson's Disease and Their Management. Neurotherapeutics : the journal of the American Society for Experimental NeuroTherapeutics. 2020;17(4):1480-1494. 45. Grand'maison M, Zehntner SP, Ho MK, et al. Early cortical thickness changes predict β-amyloid deposition in a mouse model of Alzheimer's disease. Neurobiology of disease. 2013;54:59-67. 46. Lau JC, Lerch JP, Sled JG, Henkelman RM, Evans AC, Bedell BJ. Longitudinal neuroanatomical changes determined by deformation-based morphometry in a mouse model of Alzheimer's disease. NeuroImage. 2008;42(1):19-27. 47. Preische O, Schultz SA, Apel A, et al. Serum neurofilament dynamics predicts neurodegeneration and clinical progression in presymptomatic Alzheimer's disease. Nature medicine. 2019;25(2):277-283. 48. Lin CH, Li CH, Yang KC, et al. Blood NfL: A biomarker for disease severity and progression in Parkinson disease. Neurology. 2019;93(11):e1104-e1111.

Claims

1. a) A gene comprising at least one regulatory region, wherein the gene is capable of regulating the plasmalogen biosynthesis pathway; b) The at least one regulatory region comprising at least one conditionally inducible gene editing site capable of blocking gene expression when edited; and c) At least one nucleic acid editing sequence incorporated into a gene locus separate from the gene, which, when conditionally induced, edits the at least one gene editing site and thereby encodes a gene product capable of downregulating or disrupting the plasmalogen biosynthesis pathway; A transgenic non-human animal model of postnatal conditionally inducible plasmalogen deficiency containing a genome.

2. The transgenic non-human animal model according to claim 1, wherein the conditionally inducible gene editing site includes an exogenous nucleic acid sequence and an endogenous nucleic acid sequence.

3. The transgenic non-human animal model according to claim 1 or 2, wherein the animal model is a rodent.

4. A transgenic non-human animal model according to any one of claims 1 to 3, wherein at least one conditionally inducible gene editing site further comprises a second conditionally inducible gene editing site, the second gene editing site comprises an exogenous nucleic acid sequence or an endogenous nucleic acid sequence, and at least one nucleic acid editing sequence encodes a second gene product capable of editing the second gene editing site.

5. A transgenic non-human animal model according to any one of claims 1 to 4, wherein at least one conditionally inducible gene editing site is a LoxP site, a flippase recognition target (FRT) site, attP and attB sites, an sgRNA binding site, a FokI site, a zinc finger nuclease site, or any combination thereof.

6. A transgenic non-human animal model according to any one of claims 1 to 5, wherein the gene product is Cre, flippase, PhiC31, Cas9, sgRNA, crRNA, transcription activator-like effector nuclease (TALEN), zinc finger nuclease (ZFN), any variant thereof, or any combination thereof.

7. A transgenic non-human animal model according to any one of claims 1 to 4, wherein at least one conditionally inducible gene editing site is a LoxP site and the gene product is Cre or a variant thereof.

8. The transgenic non-human animal model according to claim 7, wherein the Cre gene product is a fusion protein further comprising a mutant estrogen ligand-binding domain (ERT2).

9. The transgenic non-human animal model according to claim 7, wherein the Cre gene product is operably linked to a promoter element containing a tetracycline-responsive element capable of inducing gene expression in response to the addition or removal of tetracycline from the transgenic animal.

10. A transgenic non-human animal model according to any one of claims 1 to 4, wherein at least one conditionally inducible gene editing site is an FRT site and the gene product is a flippase or a variant thereof.

11. A transgenic non-human animal model according to any one of claims 1 to 4, wherein at least one conditionally inducible gene editing site is an attP site and an attB site, and the gene product is PhiC31 or a variant thereof.

12. A transgenic non-human animal model according to any one of claims 1 to 4, wherein at least one conditionally inducible gene editing site is a FokI site and the gene product is TALEN or a variant thereof.

13. A transgenic non-human animal model according to any one of claims 1 to 4, wherein at least one conditionally inducible gene editing site is a zinc finger nuclease site and the gene product is a zinc finger nuclease.

14. A transgenic non-human animal model according to any one of claims 1 to 4, wherein at least one conditionally inducible gene editing site is an sgRNA-binding site, and the gene product is Cas9 or a variant thereof, and / or an sgRNA, crRNA, or both capable of binding to the sgRNA-binding site.

15. A transgenic non-human animal model according to any one of claims 1 to 14, wherein at least one regulatory region is an exon, an element required for gene transcription, an element required for gene translation, an element required for the function of a protein encoded by a genome sequence containing a gene, or any combination thereof.

16. A transgenic non-human animal model according to any one of claims 1 to 15, wherein at least one regulatory region is an exon.

17. A transgenic non-human animal model according to any one of claims 1 to 16, wherein the expression of the gene product is conditionally inducible.

18. The transgenic non-human animal model according to claim 17, wherein the expression of a gene product is conditionally induced by the addition of an exogenous compound, an exogenous stimulus, or both.

19. The transgenic non-human animal model according to claim 17 or 18, wherein the expression of a gene product is conditionally induced by the addition of tamoxifen, 4-hydroxytamoxifen (4-OHT), mifepristone, tetracycline, doxycycline, light, temperature, or any combination thereof.

20. A transgenic non-human animal model according to any one of claims 1 to 19, wherein the gene that regulates the plasmalogen biosynthesis pathway is fatty acid reductase 1 (FAR1), glyceron phosphate O-acyltransferase (GNPAT), alkylglyceron phosphate synthase (AGPS), acyl / alkyl-DHAP reductase, alkyl / acyl-GPA acyltransferase, phosphatidic acid phosphatase, ethanolamine phosphotransferase, plasmanylethanolamine desaturase, choline phosphotransferase, or any combination thereof.

21. A transgenic non-human animal model according to any one of claims 1 to 20, wherein the gene is glyceron phosphate O-acyltransferase (GNPAT).

22. A transgenic non-human animal model according to any one of claims 1 to 21, wherein at least one conditionally inducible gene editing site is not edited by the gene product at or before the birth of the animal.

23. a) One or more additional genes, each comprising at least one regulatory region, that regulate the plasmalogen biosynthesis pathway; and b) The at least one regulatory region comprising additional conditionally inducible gene editing sites, wherein the additional gene editing sites comprise a first additional conditionally inducible gene editing site and / or a second additional conditionally inducible gene editing site, and the first additional gene editing site and / or the second additional gene editing site comprise an exogenous nucleic acid sequence or an endogenous nucleic acid sequence; A transgenic non-human animal model according to any one of claims 1 to 22, further comprising:

24. c) A second conditionally inducible nucleic acid editing sequence, which is incorporated into a locus separate from the gene editing site, the first nucleic acid editing sequence, the gene, and one or more additional genes, and which encodes a second gene product capable of editing the one or more additional genes; The transgenic non-human animal model according to claim 23, further comprising:

25. The transgenic non-human animal model according to claim 24, wherein the gene product and the second gene product are different.

26. Including rodents, the genome of the said rodents The glyceron phosphate O-acyltransferase (GNPAT) gene containing the loxP site; and A gene encoding a fusion protein of Cre recombinase and mutant estrogen ligand-binding domain (ERT2); A transgenic non-human animal model according to any one of claims 1 to 22, including the above.

27. Including rodents, the genome of the said rodents The glyceron phosphate O-acyltransferase (GNPAT) gene containing the loxP site; and Cre-encoding Cre recombinase gene under the control of a tetracycline-responsive element; A transgenic non-human animal model according to any one of claims 1 to 22, including the above.

28. Including rodents, the genome of the said rodents A glyceron phosphate O-acyltransferase (GNPAT) gene containing one or more sites capable of binding to sgRNA; A promoter operably connected to at least one sgRNA capable of binding to one or more sites capable of binding to the sgRNA; and A gene that codes for Cas9 or its variants; A transgenic non-human animal model according to any one of claims 1 to 22, including the above.

29. Including rodents, the genome of the said rodents a) the first LoxP site upstream of exon 4 of the gene encoding glyceron phosphate O-acyltransferase (GNPAT) and the second LoxP site downstream of exon 4 of the gene encoding glyceron phosphate O-acyltransferase (GNPAT); and b) CAGGCre-ER T2 nucleic acid sequence encoding; A transgenic non-human animal model according to any one of claims 1 to 22, including the above.

30. Including rodents, the genome of the said rodents a) A first sgRNA site upstream of exon 4 of a gene encoding glyceron phosphate O-acyltransferase (GNPAT) capable of binding to the sgRNA of GTGAGCTCCCCCGGCCTCTC (SEQ ID NO: 1), and a second sgRNA site downstream of exon 4 of the same gene encoding glyceron phosphate O-acyltransferase (GNPAT) capable of binding to the sgRNA of ATGGCAGACAGGGGCCCTTC (SEQ ID NO: 2); and b) A first nucleic acid sequence operably ligated to a sequence encoding the sgRNA of GTGAGCTCCCCCGGCCTCTC (SEQ ID NO: 1), a second nucleic acid sequence operably ligated to a sequence encoding the sgRNA of GTGAGCTCCCCCGGCCTCTC (SEQ ID NO: 1), and a third nucleic acid sequence encoding Cas9 or a variant thereof, wherein the Cas9 or variant thereof is operably ligated to an inducible regulatory element; A transgenic non-human animal model according to any one of claims 1 to 22, including the above.

31. A transgenic non-human animal model according to any one of claims 1 to 30, wherein at least one genome of the transgenic animal model comprises a genome.

32. A transgenic non-human animal model according to any one of claims 1 to 30, wherein the entire genome of the transgenic animal model is a genome.

33. Cells derived from a non-human transgenic animal model according to any one of claims 1 to 32.

34. A method for reducing plasmalogen levels after birth in non-human animals, A step of providing a non-human transgenic animal model according to any one of claims 1 to 32; and A step of inducing the expression of a nucleic acid editing sequence encoding a gene product capable of editing at least one conditionally inducible gene editing site, wherein editing of the at least one conditionally inducible gene editing site reduces the expression of a gene that regulates the plasmalogen biosynthesis pathway; The method, including the method described above.

35. Use of a non-human transgenic animal model according to any one of claims 1 to 32 for reducing postnatal plasmalogen levels in a non-human animal, wherein the non-human transgenic animal model is for inducing the expression of a nucleic acid editing sequence encoding a gene product capable of editing at least one conditionally inducible gene editing site, and the editing of the at least one conditionally inducible gene editing site is for reducing the expression of a gene that regulates the plasmalogen biosynthesis pathway.

36. A non-human transgenic animal model according to any one of claims 1 to 33 for use in reducing postnatal plasmalogen levels in non-human animals, wherein the transgenic animal induces the expression of a nucleic acid editing sequence encoding a gene product capable of editing at least one conditionally inducible gene editing site, and the editing of the at least one conditionally inducible gene editing site reduces the expression of a gene that regulates the plasmalogen biosynthesis pathway.

37. A method for inducing a condition or disease in a non-human animal associated with reduced postnatal plasmalogen levels, A step of providing a non-human transgenic animal model according to any one of claims 1 to 32; A step of inducing the expression of a nucleic acid editing sequence encoding a gene product capable of editing at least one conditionally inducible gene editing site, wherein editing of the at least one conditionally inducible gene editing site reduces the expression of a gene that regulates the plasmalogen biosynthesis pathway; and A step of monitoring the non-human transgenic animal model with respect to the symptoms of the aforementioned condition or disease; The method, including the method described above.

38. Use of a non-human transgenic animal model according to any one of claims 1 to 32 for inducing a condition or disease in a non-human animal associated with reduced postnatal plasmalogen levels, The aforementioned non-human transgenic animal model, For inducing the expression of a nucleic acid editing sequence encoding a gene product capable of editing at least one conditionally inducible gene editing site; and This is for monitoring the non-human transgenic animal model with respect to the symptoms of the aforementioned condition or disease; The editing of at least one conditionally inducible gene editing site is intended to reduce the expression of a gene that regulates the plasmalogen biosynthesis pathway. The aforementioned use.

39. A non-human transgenic animal model according to any one of claims 1 to 32 for use in inducing a condition or disease in a non-human animal associated with reduced postnatal plasmalogen levels, The aforementioned non-human transgenic animal model, For inducing the expression of a nucleic acid editing sequence encoding a gene product capable of editing at least one conditionally inducible gene editing site; and This is for monitoring transgenic animals with respect to the symptoms of the aforementioned condition or disease; The editing of at least one conditionally inducible gene editing site is intended to reduce the expression of a gene that regulates the plasmalogen biosynthesis pathway. , the aforementioned non-human transgenic animal model.

40. A method for determining the efficacy of a compound or composition for treating a condition or disease associated with reduced plasmalogen levels, A step of providing a non-human transgenic animal model according to any one of claims 1 to 32; A1) Step A1) in which the expression of a nucleic acid editing sequence encoding a gene product capable of editing at least one conditionally inducible gene editing site is to reduce the expression of a gene that regulates the plasmalogen biosynthesis pathway; B1) The step of administering the compound or composition to the non-human transgenic animal model; and C1) A step of monitoring the non-human transgenic animal model with respect to the symptoms of a condition or disease; or A2) The step of administering the compound or composition to the non-human transgenic animal model; B2) Step B2) in which the expression of a nucleic acid editing sequence encoding a gene product capable of editing at least one conditionally inducible gene editing site is to reduce the expression of a gene that regulates the plasmalogen biosynthesis pathway; and C2) A step of monitoring the non-human transgenic animal model with respect to the symptoms of a condition or disease; or A3) Step A3) in which a compound or composition is administered to the non-human transgenic animal model to induce the expression of a nucleic acid editing sequence encoding a gene product capable of editing at least one conditionally inducible gene editing site, wherein the editing of the at least one conditionally inducible gene editing site is for reducing the expression of a gene that regulates the plasmalogen biosynthesis pathway; and B3) A step of monitoring the non-human transgenic animal model with respect to the symptoms of a condition or disease; The method, including the method described above.

41. Use of a non-human transgenic animal model according to any one of claims 1 to 32 for determining the efficacy of a compound or composition for the treatment of a condition or disease associated with reduced plasmalogen levels.

42. A non-human transgenic animal model according to any one of claims 1 to 32 for use in determining the efficacy of a compound or composition for the treatment of a condition or disease associated with reduced plasmalogen levels.

43. A non-human transgenic animal model for the use described in any of claims 34, 37, and 40, wherein inducing the expression of a nucleic acid editing sequence encoding a gene product capable of editing at least one conditionally inducible gene editing site is used to excise or modify at least a portion of the gene, the use described in any of claims 35, 38, and 41, or the use described in any of claims 36, 39, and 42.

44. A non-human transgenic animal model for the method according to claim 37 or 40, the use according to claim 38 or 41, or the use according to claim 39 or 42, wherein the condition or disease associated with reduced plasmalogen levels is a neurodegenerative disease, the presence of cataracts, respiratory disease, chronic inflammation, myelin dysplasia, metabolic syndrome, type 2 diabetes, or cardiovascular disease.

45. The method, use, or transgenic animal for use according to claim 44, wherein the neurodegenerative disease is Alzheimer's disease, Parkinson's disease, or multiple sclerosis.

46. The method, use, or transgenic animal for use according to claim 44, wherein the respiratory disease is bronchopulmonary dysplasia (BPD) or chronic obstructive pulmonary disease (COPD).

47. A non-human transgenic animal model for the method of claim 40, the use described in claim 41, or the use described in claim 42, wherein the symptoms of the condition or disease include: reduced plasmalogen levels, and / or one or more of the one or more symptoms associated with the disease and / or condition as defined in claim 44 or 45.

48. A method for generating a non-human transgenic animal model according to any one of claims 1 to 32, A step of providing at least one non-human animal; A step of generating a first edited gene in a non-human animal by introducing at least one conditionally inducible gene editing sequence into a gene, a portion thereof, or a regulatory element involved in the biosynthesis of plasmalogens; The steps of generating a non-human transgenic animal model by crossing a non-human animal having the first edited gene with a second non-human animal containing a nucleic acid editing sequence at a separate gene locus encoding a gene product; and A step of editing the first edited gene by inducing the expression of the gene product in the non-human transgenic animal model, wherein the editing of the first edited gene results in a decrease in the level of the gene product of the first edited gene, a reduced activity of the first edited gene product of the first edited gene, a reduced plasmalogen level in the transgenic animal, or any combination thereof; The method, including the method described above.

49. A method according to any one of claims 34, 37, 40, and 48, a use according to any one of claims 35, 38, and 41, a non-human transgenic animal model for use according to any one of claims 36, 39, and 42, or a method, use, or non-human transgenic animal model for use according to any one of claims 43 to 47.

50. A method according to any one of claims 34, 37, 40, and 48, a use according to any one of claims 35, 38, and 41, a non-human transgenic animal model for use according to any one of claims 36, 39, and 42, wherein the expression of a gene product is induced by the addition of tamoxifen, 4-hydroxytamoxifen (4-OHT), mifepristone, tetracycline, light, temperature, or any combination thereof, or a method, use, or non-human transgenic animal model for use according to any one of claims 43 to 47 and 49.