S-cyanol lyase and its application

Abstract

The present invention provides a highly active S-cyanol lyase and an application thereof. Specifically, the present invention performs a mutation on the amino acid residue at position 128 of the wild-type S-cyanol lyase, which can significantly improve the catalytic activity of the mutant enzyme and significantly improve its expression in Escherichia coli.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a high-activity S-cyanol lyase and an application thereof. Background Art

[0002] Cyanohydrin lyase is an industrial enzyme that is very useful in chemical production. Its natural activity is to catalyze the cleavage of cyanohydrin and release hydrocyanic acid. Cyanohydrin lyase can catalyze the reverse reaction, that is, the addition of HCN to aldehydes and ketones, to obtain optically active α-cyanohydrin products. The S-type cyanohydrin (SCMB) of m-phenoxybenzaldehyde (m-PBAld) is a key intermediate of pyrethroid pesticides. The traditional chemical method has the problem of low stereoselectivity, while the SCMB production process catalyzed by S-cyanohydrin lyase is selective.

[0003] Natural S-cyanol lyase exists in a few plant tissues such as rubber, cassava and sorghum. It has low abundance and is difficult to purify. In 1995, Wajant used a five-step purification method to isolate cassava cyanol lyase MeHNL from cassava (Plant Sci., 1995, 108, 1); White et al. extracted MeHNL from cassava leaves using a three-step method and obtained the enzyme solution by salting out and dialysis, but the stereoselectivity for chemical catalysis was not high (Plant Physiol 1998, 116, 1219). Cyanol lyase (MeHNL) from cassava (Manihot esculenta) is an S-cyanol lyase. It has been reported in the literature that MeHNL is used to catalyze the chemical synthesis of S-type chiral cyanohydrins with an ee value of >99%, which has important application value, but the enzyme activity is still not high enough to meet the requirements of practical applications.

[0004] Therefore, those skilled in the art are committed to developing S-cyanol lyase with higher activity to reduce application costs. Summary of the invention

[0005] The purpose of the present invention is to provide a highly active S-cyanol lyase and application thereof.

[0006] In a first aspect of the present invention, a mutant S-cyanol lyase is provided, wherein the 128th amino acid residue of the mutant S-cyanol lyase is mutated, and the 128th amino acid residue after mutation is N, L, V, G or Y, wherein the amino acid residue numbering adopts the numbering shown in SEQ ID NO.1.

[0007] In another preferred embodiment, the mutated amino acid residue at position 128 is N.

[0008] In another preferred embodiment, the catalytic activity of the mutant S-cyanohydrin lyase is increased by more than 30% compared with the catalytic activity of the wild-type S-cyanohydrin lyase; preferably, it is increased by more than 50%; and more preferably, it is increased by more than 80%.

[0009] In another preferred embodiment, the catalytic activity of the mutant S-cyanohydrin lyase is at least 2 times, preferably at least 3 times, and more preferably at least 5 times that of the wild-type S-cyanohydrin lyase.

[0010] In another preferred example, the amino acid sequence of the wild-type S-cyanol lyase is shown in SEQ ID NO.1.

[0011] In another preferred embodiment, the amino acid sequence of the mutant S-cyanohydrin lyase has at least 80% homology with SEQ ID NO.1; more preferably, it has at least 90% homology; most preferably, it has at least 95% homology; such as at least 96%, 97%, 98%, 99% homology.

[0012] In another preferred embodiment, the mutation site of the mutated S-cyanohydrin lyase also includes the 103rd amino acid residue; preferably, the 103rd amino acid residue mutates from H to L, I, V, M or C.

[0013] In another preferred embodiment, the number of mutation sites in the mutant S-cyanohydrin lyase is 1-3, preferably 2.

[0014] In another preferred embodiment, the mutant S-cyanohydrin lyase is selected from the specific mutant enzymes in Table 2.

[0015] In another preferred embodiment, the mutant S-cyanohydrin lyase includes the mutation sites of each specific mutant enzyme in Table 2.

[0016] In another preferred embodiment, the mutant S-cyanohydrin lyase comprises a mutation site selected from the following group:

[0017]

[0018]

[0019] The second aspect of the present invention provides a polynucleotide molecule, which encodes the mutant S-cyanohydrin lyase described in the first aspect of the present invention.

[0020] The third aspect of the present invention provides a vector, wherein the vector contains the nucleic acid molecule described in the second aspect of the present invention.

[0021] The fourth aspect of the present invention provides a host cell, wherein the host cell contains the vector described in the first aspect of the present invention or the chromosome is integrated with the nucleic acid molecule described in the second aspect of the present invention.

[0022] In another preferred embodiment, the host cell is a prokaryotic cell or a eukaryotic cell.

[0023] In another preferred embodiment, the prokaryotic cell is Escherichia coli.

[0024] The fifth aspect of the present invention provides a method for preparing the mutant S-cyanohydrin lyase according to the first aspect of the present invention, comprising the steps of:

[0025] (i) culturing the host cell according to the fourth aspect of the present invention under suitable conditions, thereby expressing the mutant cyanol lyase; and

[0026] (ii) isolating the mutant cyanohydrin lyase.

[0027] In another preferred embodiment, the temperature for culturing the host cells in step (i) is 20°C-40°C; preferably 25°C-37°C, such as 35°C.

[0028] The sixth aspect of the present invention provides an enzyme preparation, which comprises the mutant S-cyanohydrin lyase described in the first aspect of the present invention.

[0029] The seventh aspect of the present invention provides the use of the mutant S-cyanohydrin lyase described in the first aspect of the present invention and the enzyme preparation described in the sixth aspect of the present invention for preparing an optically active S-cyanohydrin product.

[0030] In another preferred embodiment, the use also includes catalyzing the addition reaction of HCN with aldehydes and ketones.

[0031] The eighth aspect of the present invention provides a method for preparing S-cyanohydrin, comprising the steps of:

[0032] (1) contacting the mutant S-cyanohydrin lyase described in the first aspect of the present invention with a reaction substrate to perform a catalytic reaction, thereby generating the S-cyanohydrin;

[0033] (2) separating and purifying the S-cyanohydrin product.

[0034] In another preferred embodiment, in step (1), the reaction substrate includes m-phenoxybenzaldehyde, HCN (or sodium cyanide / potassium cyanide), and / or acetone cyanohydrin.

[0035] In another preferred embodiment, in step (1), the temperature of the catalytic reaction is 0-20°C.

[0036] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. DETAILED DESCRIPTION

[0037] Through extensive and in-depth research, the inventors unexpectedly discovered that mutation of the amino acid residue at position 128 of the wild-type S-cyanol lyase can significantly improve the catalytic activity of the mutant enzyme and significantly improve the expression in Escherichia coli, and there is no need to lower the temperature when inducing expression, thereby significantly reducing the preparation cost of the enzyme; further, mutation of the 103rd site was performed to obtain an S-cyanol lyase with further improved catalytic activity. Experimental results show that the catalytic activity of this type of mutant S-cyanol lyase in catalyzing the addition reaction of m-phenoxybenzaldehyde (m-PBAld) and HCN is improved by more than 30% compared with the wild type, and the present invention was completed on this basis.

[0038] Before describing the present invention, it should be understood that the present invention is not limited to the specific methods and experimental conditions described, because such methods and conditions can be changed. It should also be understood that the terminology used herein is intended only to describe specific embodiments, and is not intended to be restrictive, and the scope of the present invention will be limited only by the appended claims.

[0039] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the invention belongs. As used herein, the term "about" when used in reference to a specific recited value means that the value may vary by no more than 1% from the recited value. For example, as used herein, the expression "about 100" includes 99 and 101 and all values ​​therebetween (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

[0040] Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are now described.

[0041] Cyanol lyase

[0042] Hydroxynitrile lyase is mainly derived from a few plant tissues such as rubber, cassava and sorghum, including cassava cyanol lyase (MeHNL), sumac cyanol lyase (HbHNL) and almond cyanol lyase (PaHNL).

[0043] In a preferred embodiment of the present invention, the cyanohydrin lyase is cassava cyanohydrin lyase.

[0044] In a preferred embodiment of the present invention, the wild-type sequence of cassava cyanol lyase is preferably as follows:

[0045]

[0046] SEQ ID NO.:1.

[0047] The wild-type coding gene sequence is as follows:

[0048] ATGGTTACTGCACACTTCGTTCTGATTCACACCATTTGTCACGGCGCATGGATTTGGCACAAACTGAAACCGGCCCTGGAACGTGCT

[0049] GGCCACAAAGTTACTGCACTGGACATGGCAGCCAGTGGCATTGACCCGCGTCAAATTGAACAGATCAACTCTTTCGATGAATACTCT

[0050] GAACCGCTGCTGACTTTCCTGGAAAAACTGCCGCAAGGCGAAAAGGTTATCATTGTTGGTGAAAGCTGTGCAGGCCTGAACATTGCT

[0051] ATTGCTGCTGATCGTTACGTTGACAAAATTGCAGCTGGCGTTTTCCACAACTCCCTGCTGCCGGACACCGTTCACAGCCCGTCTTAC

[0052] ACTGTTGAAAAGCTGCTGGAATCGTTCCCGGACTGGCGTGACACAGAATATTTCACGTTCACCAACATCACTGGCGAAACCATCACT

[0053] ACCATGAAACTGGGTTTCGTTCTGCTGCGTGAAAACCTGTTCACCAAATGCACTGATGGCGAATATGAACTGGCAAAAATGGTTATG

[0054] CGCAAGGGCTCTCTGTTCCAAAACGTTCTGGCTCAGCGTCCGAAGTTCACTGAAAAAGGCTACGGCTCTATCAAGAAAGTTTATATT

[0055] TGGACCGATCAAGACAAAATATTCCTGCCGGACTTCCAACGCTGGCAAATTGCAAACTACAAACCGGACAAGGTTTATCAGGTTCAA

[0056] GGCGGCGATCACAAGCTGCAGCTGACAAAAACTGAAGAAGTAGCTCACATTCTGCAAGAAGTTGCTGATGCATACGCTTAA(SEQID NO.2)

[0057] Mutated high-activity cyanohydrin lyase

[0058] The present invention develops a specific high-throughput screening method based on the reported S-cyanol lyase MeHNL from cassava, and conducts directed evolution accordingly. A cyanol lyase sequence with higher enzyme activity is obtained through further screening. Mutant enzymes are prepared in large quantities through high-density fermentation of Escherichia coli, and their catalytic performance and stereoselectivity are measured. It is found that these mutant enzymes have extremely high application value, among which the highest mutant enzyme has a specific enzyme activity of more than 10 times that of the wild type for m-PBAld, and the ee value is as high as about 99%, which is higher than all reported S-cyanol lyases. The enzyme catalytic reaction is shown in the following formula:

[0059]

[0060] Preferably, the catalytic reaction conditions are as follows:

[0061] Enzyme activity determination: 1U of enzyme activity is defined as the amount of enzyme required to catalyze the production of 1μmol of etheraldehyde per minute. The enzyme activity determination refers to the method reported by Selmar (Analytical Biochemistry 166 (1987), 208-211), 10mM m-phenoxybenzylcyanol, 20uL methanol, 20mM citric acid buffer (pH5.0), 10uL enzyme solution. The above reaction solution was incubated at 25 degrees, and the absorbance change at OD310nm was measured within 1-5min. A curve of time (min) and absorbance change was drawn, and the slope of the experimental group curve was set to △K, and the slope of the control group was zero. Under the same conditions, without adding enzyme solution, at 25℃, the change in absorbance at a wavelength of 310nm was recorded as a control group, and the control group should not have any change in absorbance.

[0062] The slope of the standard curve of m-oxybenzaldehyde concentration is K. The enzyme activity is calculated according to the formula:

[0063]

[0064] Vectors and host cells

[0065] The present invention also provides a vector comprising the optimized cyanohydrin lyase gene of the present invention, and a host cell containing the vector.

[0066] In a preferred embodiment of the present invention, the vector has the ability to be expressed in Escherichia coli (more preferably in Escherichia coli BL21 (DE3) strain).

[0067] The optimized cyanol lyase gene sequence of the present invention can be obtained by conventional methods used by a person skilled in the art, such as full artificial synthesis or PCR synthesis. A preferred synthesis method is asymmetric PCR. Asymmetric PCR is a method in which a pair of primers of unequal amounts are used to produce a large amount of single-stranded DNA (ssDNA) after PCR amplification. These primers are respectively called non-restrictive primers and restrictive primers, and their ratio is generally 50-100:1. In the first 10-15 cycles of the PCR reaction, the amplified product is mainly double-stranded DNA, but when the restrictive primer (low concentration primer) is consumed, the PCR guided by the non-restrictive primer (high concentration primer) will produce a large amount of single-stranded DNA. The primers used for PCR can be appropriately selected according to the sequence information of the present invention disclosed herein, and can be synthesized by conventional methods. The amplified DNA / RNA fragments can be separated and purified by conventional methods such as by gel electrophoresis.

[0068] The polynucleotide sequence of the present invention can be used to express or produce a target protein by conventional recombinant DNA technology, comprising the steps of:

[0069] (1) transforming or transducing a suitable host cell, preferably an Escherichia coli cell, with a polynucleotide (or variant) encoding the protein of the present invention, or with a recombinant expression vector containing the polynucleotide;

[0070] (2) culturing host cells in a suitable culture medium;

[0071] (3) Isolate and purify proteins from culture medium or cells.

[0072] Methods well known to those skilled in the art can be used to construct expression vectors containing the coding DNA sequence of the protein of the present invention and suitable transcription / translation control signals, preferably commercially available vectors: pET28. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. The DNA sequence can be effectively connected to an appropriate promoter in the expression vector to guide mRNA synthesis. The expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selecting transformed host cells.

[0073] The present invention also provides a recombinant vector comprising the optimized MeHNL DNA sequence of the present invention. In a preferred embodiment, the promoter downstream of the recombinant vector comprises a multiple cloning site or at least one restriction site. When the target gene needs to be expressed, the target gene is connected to a suitable multiple cloning site or restriction site, thereby operably connecting the target gene to the promoter.

[0074] In another preferred embodiment, the recombinant vector includes: a promoter, a target gene and a terminator in the 5' to 3' direction. If necessary, the recombinant vector may also include the following elements: a protein purification tag; a 3' polynucleotide signal; a non-translated nucleic acid sequence; a transport and targeting nucleic acid sequence; a selection marker (antibiotic resistance gene, fluorescent protein, etc.); an enhancer; or an operator.

[0075] Methods for preparing recombinant vectors are well known to those of ordinary skill in the art. Expression vectors can be bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses or other vectors. In short, any plasmid and vector can be used as long as it can replicate and be stable in the host.

[0076] Those skilled in the art can use well-known methods to construct vectors containing the promoter of the present invention and / or the target gene sequence, including in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc.

[0077] The expression vector of the present invention can be used to transform appropriate host cells so that the host transcribes the target RNA or expresses the target protein. The host cell can be a prokaryotic cell, such as Escherichia coli, Corynebacterium glutamicum, Brevibacterium flavum, Streptomyces, Agrobacterium: or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a plant cell. Those skilled in the art are aware of how to select appropriate vectors and host cells. Transformation of host cells with recombinant DNA can be carried out using conventional techniques well known to those skilled in the art. When the host is a prokaryotic organism (such as Escherichia coli), it can be treated with the CaCl2 method or electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be selected: calcium phosphate coprecipitation method, conventional mechanical methods (such as microinjection, electroporation, liposome packaging, etc.). Transformation of plants can also be carried out using methods such as Agrobacterium transformation or gene gun transformation, such as leaf disc method, young embryo transformation method, flower bud immersion method, etc. Transformed plant cells, tissues or organs can be regenerated into plants using conventional methods to obtain transgenic plants.

[0078] The term "operably linked" means that the target gene to be transcribed and expressed is linked to its control sequence in a conventional manner in the art so as to be expressed.

[0079] Cultivation of engineered bacteria and fermentation production of target protein

[0080] After obtaining the engineered cells, the engineered cells can be cultured under suitable conditions to express the protein encoded by the gene sequence of the present invention. Depending on the host cells, the culture medium used in the culture can be selected from various conventional culture media, and culture is carried out under conditions suitable for the growth of the host cells. When the host cells grow to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

[0081] In the present invention, conventional fermentation conditions can be used. Representative conditions include (but are not limited to):

[0082] (a) With regard to temperature, the fermentation and induction temperature of cyanohydrin lyase is maintained at 25-37°C;

[0083] (b) With regard to the pH value during the induction period, the pH value during the induction period is controlled at 3-9;

[0084] (c) As for dissolved oxygen (DO), DO is controlled at 10-90%. The maintenance of dissolved oxygen can be solved by introducing oxygen / air mixed gas;

[0085] (d) As for feed, feed types should preferably include carbon sources such as glycerol, methanol, glucose, etc., which can be fed alone or mixed;

[0086] (e) With regard to the IPTG concentration during the induction period, conventional induction concentrations can be used in the present invention, and the IPTG concentration is usually controlled at 0.1-1.5 mM;

[0087] (f) The induction time is not particularly limited, but is usually 2 to 20 hours, preferably 5 to 15 hours.

[0088] The target protein cyanohydrin lyase of the present invention is present in Escherichia coli cells, and the host cells are collected by a centrifuge, and then the host cells are broken by high pressure, machine force, enzymatic cell lysis or other cell breaking methods to release the recombinant protein, preferably the high pressure method. The host cell lysate can be preliminarily purified by flocculation, salting out, ultrafiltration and other methods and then purified by chromatography, ultrafiltration and the like, or it can be directly purified by chromatography.

[0089] Chromatographic techniques include cation exchange chromatography, anion exchange chromatography, gel filtration chromatography, hydrophobic chromatography, affinity chromatography, etc. Commonly used chromatography methods include:

[0090] 1. Anion exchange chromatography:

[0091] Anion exchange chromatography media include (but are not limited to): Q-Sepharose, DEAE-Sepharose. If the salt concentration of the fermentation sample is high and affects the binding with the ion exchange medium, the salt concentration needs to be reduced before ion exchange chromatography. The sample can be replaced with the equilibrium buffer by dilution, ultrafiltration, dialysis, gel filtration chromatography, etc. until it is similar to the corresponding ion exchange column equilibrium liquid system, and then loaded and subjected to gradient elution of salt concentration or pH.

[0092] 2. Hydrophobic chromatography:

[0093] Hydrophobic chromatography media include (but are not limited to): Phenyl-Sepharose, Butyl-Sepharose, Octyl-Sepharose. The sample is loaded with a salt concentration increased by adding NaCl, (NH4)2SO4, etc., and then eluted by reducing the salt concentration. Impure proteins with large differences in hydrophobicity are removed by hydrophobic chromatography.

[0094] 3. Gel Filtration Chromatography

[0095] Hydrophobic chromatography media include (but are not limited to): Sephacryl, Superdex, Sephadex, etc. The buffer system can be replaced or further purified by gel filtration chromatography.

[0096] 4. Affinity chromatography

[0097] Affinity chromatography media include (but are not limited to): HiTrap TM Heparin HP Columns.

[0098] 5. Membrane filtration

[0099] Ultrafiltration media include: organic membranes such as polysulfone membranes, inorganic membranes such as ceramic membranes, and metal membranes. The purpose of purification and concentration can be achieved through membrane filtration.

[0100] Preparation of enzyme preparation compositions

[0101] The present invention also provides an enzyme preparation composition, which contains the cyanohydrin lyase of the present invention.

[0102] The enzyme preparation composition of the present invention may further comprise: citric acid, tartaric acid, and / or boric acid.

[0103] Preparation method of S-cyanohydrin

[0104] The present invention also provides a method for preparing S-cyanohydrin, the method comprising the steps of:

[0105] (1) contacting the mutant cyanohydrin lyase of the present invention with a reaction substrate to perform a catalytic reaction, thereby generating the S-cyanohydrin;

[0106] (2) separating and purifying the S-cyanohydrin product.

[0107] In a preferred embodiment of the present invention, in step (1), the reaction substrate is m-phenoxybenzaldehyde and acetone cyanohydrin (or hydrocyanic acid (or sodium cyanide / potassium cyanide).

[0108] In a preferred embodiment of the present invention, in step (1), the temperature of the catalytic reaction is 0-20°C.

[0109] The main advantages of the present invention are:

[0110] (1) According to the mutant S-cyanol lyase of the present invention, the catalytic activity is significantly improved compared with the wild type;

[0111] (2) The mutant S-cyanol lyase according to the present invention can be expressed in large quantities in engineered Escherichia coli, so the preparation cost is low.

[0112] (3) The mutant S-cyanol lyase according to the present invention can be expressed at high temperature (about 25-37°C), which greatly reduces the production cost and simplifies the fermentation process, while the wild type and some mutants are inactive or have very low activity when expressed at high temperature.

[0113] The present invention will be further described in detail below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples where detailed conditions are not specified are usually carried out according to conventional conditions such as the conditions described in "Molecular Cloning Laboratory Guide" by Sambrook.J et al. (Huang Peitang et al., Beijing: Science Press, 2002), or according to the conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are calculated by weight. The experimental materials and reagents used in the following examples can be obtained from commercial channels unless otherwise specified.

[0114] Example 1: Construction of mutant library

[0115] Taking the H103 site mutation as an example, the steps for constructing the mutant library are as follows:

[0116] Site-directed saturation mutagenesis of H103 site, primer design

[0117] H103-f:5'-GCAGCTGGCGTTTCNNNAACTCCCTGCTGCCG-3'(SEQ ID NO.3)

[0118] H103-r: 5'-CGGCAGCAGGGAGTTNNNGAAAACGCCAGCTGC-3' (SEQ ID NO. 4) Using plasmid pET21a-meHNL as a template, PCR amplification of the target band was performed using the following procedure:

[0119]

[0120] The PCR product was digested with DpnI at 37°C for 2 hours. After the reaction was completed, the competent cells E. coli BL21 (DE3) were transformed and spread on LB medium containing 100ug / mL ampicillin and cultured at 37°C overnight to obtain a mutant library.

[0121] The same method as above was used to construct mutant libraries for other sites. The primer sequences designed for the construction of mutant libraries for other sites are shown in the following table:

[0122] Table 1

[0123]

[0124]

[0125] Wherein, N in the sequence of this application represents A, T, G or C.

[0126] Example 2: High Throughput Screening

[0127] The screening was carried out according to the following experimental steps:

[0128] 1. Select clones for inoculation 96-well plate 1 (500 μL TB medium per well), cultured overnight at 30°C;

[0129] 2. Transfer to new 96-well plate 2 (800 μL TB medium per well, 0.15 mM IPTG), from 96-well plate 1 Inoculate 100 μL into 96 Orifice plate 2 , and induced culture at 30°C overnight.

[0130] 3. Collect bacteria 96-well plate 2 , add 100 μL of BugBuster Protein Extraction Reagent (Novagen), treat for 30 min, and centrifuge to obtain the supernatant.

[0131] 4. Dilute the enzyme solution to a reasonable multiple.

[0132] 5. Prepare ELISA plate, reaction system 200 μL, including 150 μL 50 mM citrate buffer (containing 15% methanol), 5 μL substrate SCMB (0.05 g / mL dissolved in methanol), 5 μL enzyme solution for 2 min, immediately add 10 μL solution I (100 mM N-chlorosuccinimide) for 2 min, then add 30 μL solution II (65 mM isonicotinic acid, 125 mM barbituric acid, dissolved in 0.2 M NaOH), and read at 600 nm wavelength after 20 min.

[0133] 6. Using the wild type as the reference, select the most positive clone with the strongest absorbance at 600nm and analyze its enzyme activity and relative enzyme activity.

[0134] Enzyme activity determination: 1U of enzyme activity is defined as the amount of enzyme required to catalyze the production of 1μmol of ether aldehyde per minute.

[0135] The enzyme activity was determined by referring to the method reported by Selmar (Analytical Biochemistry 166 (1987), 208-211), 10 mM m-phenoxybenzyl cyanol, 20 uL methanol, 20 mM citric acid buffer (pH 5.0), and 10 uL enzyme solution. The above reaction solution was incubated at 25 degrees, and the absorbance change at OD310nm was measured within 1-5 minutes. A curve of time (min) and absorbance change was drawn, and the slope of the experimental group curve was set to △K, and the slope of the control group was zero. Under the same conditions, without adding enzyme solution, at 25°C, the change in absorbance at a wavelength of 310nm was recorded as a control group, and the control group should not have any change in absorbance.

[0136] The slope of the standard curve of m-oxybenzaldehyde concentration is K. The enzyme activity is calculated according to the formula:

[0137]

[0138] Determination of protein concentration: The absorption of OD280 was measured according to the standard procedure of Nanodrop2000, and the concentration of protein in the lysate c (mg / mL) was obtained;

[0139] Calculation of specific enzyme activity: specific enzyme activity (U / mg) = enzyme activity / protein concentration.

[0140] Example 3: High density fermentation

[0141] The DNA sequence encoding the mutant enzyme was synthesized and connected to the NdeI and XhoI sites of the pET28a vector (purchased from Novagen) to obtain the E. coli plasmid pET28-MeHNL6 containing the T7 promoter. The plasmid was transformed into E. coli BL21 (DE3) (purchased from Invitrogene), and the corresponding strain was obtained on the Kana resistance plate, inoculated into LB medium, cultured at 37°C overnight, and preserved with 20% glycerol.

[0142] Inoculate the strain into a 1L shake flask containing 200mL LB medium and culture at 37°C, 180-220rpm for 10-16h. Inoculate the above cultured seeds into 3L upper tank fermentation medium (M9) (glucose 4g / L, disodium hydrogen phosphate 12.8g / L, potassium dihydrogen phosphate 3g / L, ammonium chloride 1g / L, sodium sulfate 0.5g / L, calcium chloride 0.0152g / L, magnesium chloride hexahydrate 0.41g / L) at a ratio of 10% (v / v), and culture at 25-35°C, 300-800rpm, and air flow 2-6L / min. After 6-10h of culture, add IPTG to induce for 10-12h, and at the same time, feed medium containing 60% glycerol is added at a rate of 5-20mL / h until the end of fermentation. Feed medium is added for several hours until OD 600 When the concentration reached 80-100, the tank was opened and the cells were collected by centrifugation at 5000 rpm. The enzyme activity was determined after the cells were lysed. The gel electrophoresis test was consistent with the expectation.

[0143] Fermentation preparation for wild type and some mutants

[0144] The experiment found that under high temperature fermentation conditions (about 25-37°C), the activity of the wild type (SEQ ID NO.1) and some mutants (such as mutant 2) expressed by the engineered bacteria was extremely low, and the wild type had basically no activity.

[0145] Therefore, the fermentation method for the wild type and some mutants (such as mutant 2) is basically the same as above, except that the temperature is maintained at a low temperature (about 12-16° C.) during the fermentation process.

[0146] Example 4: Enzyme purification

[0147] The enzyme obtained by fermentation can be purified by conventional methods in the art. The enzyme obtained by fermentation can also be purified by the following methods, for example:

[0148] 1L fermentation broth containing the wild-type sequence was centrifuged to collect the cells (4000rpm) to obtain 50g of cells; the cells were resuspended in 20mM sodium phosphate buffer (pH5.5) at a ratio of 4mL buffer per gram of cells. The cells were crushed using a high-pressure homogenizer (pressure 800-1000bar), polyacrylamide was added for flocculation (1-2‰), and the supernatant was collected by centrifugation at 4000rpm. The supernatant was concentrated 8 times using an ultrafiltration membrane (protein concentration 93mg / mL), and the enzyme activity was 198U / mL.

[0149] 1L fermentation broth containing mutant 12 sequence was centrifuged to collect bacteria (4000rpm) to obtain 50g of bacteria; the bacteria were resuspended in 20mM potassium citrate buffer (pH5.5) at a ratio of 4mL buffer per gram of bacteria. The suspension was crushed with a high-pressure homogenizer (pressure 800-1000bar), polyacrylamide was added for flocculation (1-2‰), and the supernatant was collected by centrifugation at 4000rpm. The supernatant was concentrated 8 times with an ultrafiltration membrane (protein concentration 89mg / mL), and the enzyme activity was 405U / mL.

[0150] 1L fermentation broth containing mutant 23 sequence was centrifuged to collect bacteria (4000rpm) to obtain 50g of bacteria; the bacteria were resuspended in 20mM potassium phosphate buffer (pH5.5) at a ratio of 4mL buffer per gram of bacteria. The suspension was crushed with a high-pressure homogenizer (pressure 800-1000bar), polyacrylamide was added for flocculation (1-2‰), and the supernatant was collected by centrifugation at 4000rpm. The supernatant was concentrated 6 times with an ultrafiltration membrane (protein concentration 56mg / mL), and the enzyme activity was 680U / mL.

[0151] The present invention performed saturation mutations on positions 121, 122, 125, 127, 129, 147, 199 and 216 of the wild type, respectively, but the enzyme activity was not improved compared with the wild type, so the specific enzyme activity results are no longer listed one by one, and the enzyme activity test results of other mutant enzymes are now listed, as shown in Table 2 below.

[0152] Table 2

[0153]

[0154]

[0155] Note: * represents the specific enzyme activity between 0-3.0U / mg; ** represents the specific enzyme activity between 3.0-10.0U / mg; *** represents the specific enzyme activity between 10.0-18.0U / mg.

[0156] Example 5: Biocatalytic Conversion of S-Cyanhydrin and Detection Method

[0157] The method for biocatalytic conversion of S-cyanohydrin is as follows: 20 mL of cyanohydrin lyase, 10 mL of aldehyde m-PBAld, 20 mL of methyl tert-butyl ether, and 3 g of HCN are added into a 100 mL reaction bottle and stirred for reaction at 15°C.

[0158] The detection method is as follows:

[0159] The reaction was monitored by high performance liquid chromatography (HPLC): water and acetonitrile (45:55) were used as the mobile phase, the chromatographic column was an ODS-18 reverse phase column, and the Shimadzu LC-15C high performance liquid chromatography was used to detect ultraviolet absorption at 210 nm; the reaction system was diluted with water and acetonitrile (45:55), centrifuged, and filtered with a nylon membrane before sampling and detection. In the preferred reaction system of the present invention, HPLC was used to detect the progress of the reaction: after reacting for 1 hour, the detection showed that 17.3 min was m-phenoxybenzaldehyde and 17.5 min was S-configuration cyanohydrin.

[0160] The chiral purity was analyzed by Agilent 1260 liquid chromatography, and the detection conditions were: Chiralpak AD-H column, n-hexane:ethanol (0.1% DEA)=90:10, 0.8 mL / min, and the detection wavelength was 220 nm. The S-configuration product prepared by the present invention was compared with the target substance standard (purchased from Jiangxi Keyuan Biopharmaceutical Co., Ltd.).

[0161] Typical catalytic reactions and test results involved in the present invention are listed below:

[0162] 1. Wild type

[0163] In a 100 mL reaction bottle, 20 mL cyanol lyase (50 mg / mL, wild type SEQ ID NO.1), 10 mL aldehyde m-PBAld, 20 mL methyl tert-butyl ether, and 3 g HCN were added. The mixture was stirred at 15°C for 2 hours. Samples were taken every 30 minutes to monitor the reaction progress. The ee value was 95.9%.

[0164] 2. Mutant 12

[0165] In a 100 mL reaction bottle, add 20 mL of cyanohydrin lyase concentrate (50 mg / mL), 10 mL of aldehyde m-PBAld, 20 mL of methyl tert-butyl ether, and 3 g of HCN. Stir and react at 15°C for 2 hours. Samples are taken every 30 minutes to monitor the reaction progress. The ee value is 98.6%.

[0166] 3. Mutant 23

[0167] In a 100 mL reaction bottle, add 20 mL of cyanohydrin lyase concentrate (50 mg / mL), 10 mL of aldehyde m-PBAld, 20 mL of methyl tert-butyl ether, and 3 g of HCN. Stir and react at 15°C for 2 hours. Samples are taken every 30 minutes to monitor the reaction progress. The ee value is 99.1%.

[0168] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application. Sequence Listing <110> Yikelai Biotechnology (Group) Co., Ltd. <120> S-cyanol lyase and its application <130> P2017-0398 <150> CN201710011396.3 <151> 2017-01-06 <160> twenty two <170> PatentIn version 3.5 <210> 1 <211> 258 <212> PRT <213> Cassava (Manihot esculenta) <400> 1 Met Val Thr Ala His Phe Val Leu Ile His Thr Ile Cys His Gly Ala 1 5 10 15 Trp Ile Trp His Lys Leu Lys Pro Ala Leu Glu Arg Ala Gly His Lys 20 25 30 Val Thr Ala Leu Asp Met Ala Ala Ser Gly Ile Asp Pro Arg Gln Ile 35 40 45 Glu Gln Ile Asn Ser Phe Asp Glu Tyr Ser Glu Pro Leu Leu Thr Phe 50 55 60 Leu Glu Lys Leu Pro Gln Gly Glu Lys Val Ile Ile Val Gly Glu Ser 65 70 75 80 Cys Ala Gly Leu Asn Ile Ala Ile Ala Ala Asp Arg Tyr Val Asp Lys 85 90 95 Ile Ala Ala Gly Val Phe His Asn Ser Leu Leu Pro Asp Thr Val His 100 105 110 Ser Pro Ser Tyr Thr Val Glu Lys Leu Leu Glu Ser Phe Pro Asp Trp 115 120 125 Arg Asp Thr Glu Tyr Phe Thr Phe Thr Asn Ile Thr Gly Glu Thr Ile 130 135 140 Thr Thr Met Lys Leu Gly Phe Val Leu Leu Arg Glu Asn Leu Phe Thr 145 150 155 160 Lys Cys Thr Asp Gly Glu Tyr Glu Leu Ala Lys Met Val Met Arg Lys 165 170 175 Gly Ser Leu Phe Gln Asn Val Leu Ala Gln Arg Pro Lys Phe Thr Glu 180 185 190 Lys Gly Tyr Gly Ser Ile Lys Lys Val Tyr Ile Trp Thr Asp Gln Asp 195 200 205 Lys Ile Phe Leu Pro Asp Phe Gln Arg Trp Gln Ile Ala Asn Tyr Lys 210 215 220 Pro Asp Lys Val Tyr Gln Val Gln Gly Gly Asp His Lys Leu Gln Leu 225 230 235 240 Thr Lys Thr Glu Glu Val Ala His Ile Leu Gln Glu Val Ala Asp Ala 245 250 255 Tyr Ala <210> 2 <211> 777 <212> DNA <213> Cassava (Manihot esculenta) <400> 2 atggttactg cacacttcgt tctgattcac accatttgtc acggcgcatg gatttggcac 60 aaactgaaac cggccctgga acgtgctggc cacaaagtta ctgcactgga catggcagcc 120 agtggcattg acccgcgtca aattgaacag atcaactctt tcgatgaata ctctgaaccg 180 ctgctgactt tcctggaaaa actgccgcaa ggcgaaaagg ttatcattgt tggtgaaagc 240 tgtgcaggcc tgaacattgc tattgctgct gatcgttacg ttgacaaaat tgcagctggc 300 gttttccaca actccctgct gccggacacc gttcacagcc cgtcttacac tgttgaaaag 360 ctgctggaat cgttcccgga ctggcgtgac acagaatatt tcacgttcac caacatcact 420 ggcgaaacca tcactaccat gaaactgggt ttcgttctgc tgcgtgaaaa cctgttcacc 480 540. aaatgcactg atggcgaata tgaactggca aaaatggtta tgcgcaaggg ctctctgttc caaaacgttc tggctcagcg tccgaagttc actgaaaaag gctacggctc tatcaagaaa gttatattt ggaccgatca agacaaaata ttcctgccgg acttccaacg ctggcaaatt 720. gcaaactaca aaccggacaa ggtttatcag gttcaaggcg gcgatcacaa gctgcagctg acaaaaactg aagaagtagc tcacattctg caagaagttg ctgatgcata cgcttaa <210> 3 <211> 33 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (16)..(18) <223> n is a, c, g, or t <400> 3 gcagctggcg ttttcnnnaa ctccctgctg ccg <210> 4 <211> 33 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (16)..(18) <223> n is a, c, g, or t <400> 4 cggcagcagg gagttnnnga aaacgccagc tgc <210> 5 <211> 33 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (16)..(18) <223> n is a, c, g, or t <400> 5 gaatcgttcc cggacnnncg tgacacagaa tat 33 <210> 6 <211> 33 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (16)..(18) <223> n is a, c, g, or t <400> 6 atattctgtg tcacgnnngt ccgggaacga ttc 33 <210> 7 <211> 35 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (18)..(20) <223> n is a, c, g, or t <400> 7 cttacactgt tgaaaagnnn ctggaatcgt tcccg 35 <210> 8 <211> 35 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (16)..(18) <223> n is a, c, g, or t <400> 8 cgggacgat tccagnnnct tttcaacagt gtaag <210> 9 <211> 33 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (16)..(18) <223> n is a, c, g, or t <400> 9 actgttgaaa agctgnnnga atcgttcccg gac <210> 10 <211> 33 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (16)..(18) <223> n is a, c, g, or t <400> 10 gtccgggaac gattcnnnca gcttttcaac agt <210> 11 <211> 33 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (16)..(18) <223> n is a, c, g, or t <400> 11 aagctgctgg aatcgnnncc ggactggcgt gac <210> 12 <211> 33 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (16)..(18) <223> n is a, c, g, or t <400> 12 gtcacgccag tccggnnncg attccagcag ctt <210> 13 <211> 33 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (16)..(18) <223> n is a, c, g, or t <400> 13 ctggaatcgt tcccgnnngc acgtgacaca about <210> 14 <211> 33 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (16)..(18) <223> n is a, c, g, or t <400> 14 ttctgtgtca cgtgcnnncg ggacgattc cag <210> 15 <211> 33 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (16)..(18) <223> n is a, c, g, or t <400> 15 tcgttcccgg acgcannnga cacagaatatttc 33 <210> 16 <211> 33 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (16)..(18) <223> n is a, c, g, or t <400> 16 gaaatattct gtgtcnnntg cgtccgggaa cga 33 <210> 17 <211> 33 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (16)..(18) <223> n is a, c, g, or t <400> 17 gaaaccatca ctaccnnnaa actgggtttc gtt 33 <210> 18 <211> 33 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (16)..(18) <223> n is a, c, g, or t <400> 18 aacgaaaccc agtttnnngg tagtgatggt ttc <210> 19 <211> 33 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (16)..(18) <223> n is a, c, g, or t <400> 19 ggctacggct ctatcnnnaa agtttatatt tgg <210> 20 <211> 33 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (16)..(18) <223> n is a, c, g, or t <400> 20 ccaat the actttnn of the tagccgta gcc <210> 21 <211> 33 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (16)..(18) <223> n is a, c, g, or t <400> 21 ttcctgccgg acttcnnncg ctggcaaatt gca <210> 22 <211> 33 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (16)..(18) <223> n is a, c, g, or t <400> 22 tgcaatttgc cagcgnnnga agtccggcag gaa

Claims

1. A mutant S-cyanol lyase, characterized in that The mutant S-cyanol lyase is mutated using the wild-type S-cyanol lyase with an amino acid sequence as shown in SEQ ID NO.1 as a template, the 128th amino acid residue is mutated, and the 128th amino acid residue after mutation is N, L, V, G or Y, and the 103rd amino acid residue of the mutant S-cyanol lyase is mutated from H to L, I, M or C, wherein the amino acid residue numbering adopts the numbering shown in SEQ ID NO.1; Furthermore, the mutation site of the mutated S-cyanohydrin lyase is as follows:

2. The mutant S-cyanol lyase according to claim 1, characterized in that The mutated amino acid residue at position 128 is N.

3. A polynucleotide molecule, characterized in that The polynucleotide molecule encodes the mutant S-cyanohydrin lyase according to claim 1.

4. A carrier, characterized in that The vector contains the polynucleotide molecule according to claim 3.

5. A host cell, characterized in that The host cell contains the vector of claim 4 or the polynucleotide molecule of claim 3 is integrated into the chromosome.

6. A method for preparing the mutant S-cyanol lyase according to claim 1, characterized in that: Includes steps: (i) culturing the host cell according to claim 5 under suitable conditions to express the mutant cyanol lyase; and (ii) isolating the mutant cyanohydrin lyase.

7. An enzyme preparation, characterized in that The enzyme preparation comprises the mutant S-cyanohydrin lyase according to claim 1.

8. Use of the mutant S-cyanohydrin lyase according to claim 1 and the enzyme preparation according to claim 7 for preparing an optically active S-cyanohydrin product.

9. A method for preparing S-cyanohydrin, characterized in that: Includes steps: (1) contacting the mutant S-cyanohydrin lyase according to claim 1 with a reaction substrate to carry out a catalytic reaction, thereby producing the S-cyanohydrin; (2) separating and purifying the S-cyanohydrin product.

10. The method according to claim 9, characterized in that In the step (1), the reaction substrates include m-phenoxybenzaldehyde and HCN.

Images