New use of circular RNA hsa_circ_0012152

Abstract

The application discloses application of circular RNA hsa_circ_0012152 as a therapeutic target in preparation of a medicine for treating acute myelocytic leukemia of children.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biological medicine, and particularly relates to a new use of circular RNA hsa_circ_0012152. BACKGROUND

[0002] Acute leukemia is the most common malignant tumor in children, accounting for about 35% of malignant tumors in this period. Although acute myeloid leukemia (AML) accounts for only 20% of acute leukemia, it accounts for more than 50% of deaths from childhood acute leukemia. With the application of combined chemotherapy, optimization of risk stratification and hematopoietic stem cell transplantation technology, the survival rate of AML children has been greatly improved, but the prognosis is still poor, with a relapse rate of more than 30%. This not only seriously endangers the physical and mental health of children, but also brings serious economic and psychological burdens to patient families. Therefore, it is of great significance to deeply study the molecular mechanisms of AML, explore new therapeutic targets for AML and implement individualized treatment. Moreover, for refractory AML, targeted therapy may be the only way out in the future, which will bring new hope to the treatment of childhood AML.

[0003] Circular RNA (circRNA) is a new member of the RNA family that is different from traditional linear RNA, which does not have a 5' end cap and a 3' end poly(A) tail, and is a non-coding RNA molecule with a covalent bond forming a ring structure. In recent years, scientists have found that there are tens of thousands of highly conserved circRNAs in cells, which are mainly located in the cytoplasm and widely expressed in human cells. One of its main characteristics is that the expression abundance of circRNA is high, and the expression abundance of some circRNAs is more than 10 times that of their linear isomers, and it also has obvious tissue specificity, time specificity and disease specificity. The second main feature is that it is more stable than linear RNA and is not easily degraded by exonuclease. Compared with the general half-life of mRNA of 10 hours, the half-life of circRNA in cells is as long as 48 hours. These characteristics suggest that circRNA is likely to play an important role in the life process of organisms, and elucidating its function may find new disease treatment targets.

[0004] In recent years, great breakthroughs have been made in circRNA research. Researchers have identified thousands of circRNAs, some of which have been reported to have important biological functions and may become new molecular markers or therapeutic targets for disease diagnosis and treatment. However, this is only the tip of the iceberg, especially the correlation of circRNA with leukemia and their role in leukemia is still unclear. The study of circRNA in childhood AML is even less reported. Therefore, it is necessary to study the expression, function and regulation mechanism of circRNA in childhood AML.

[0005] In the early stage, we used circRNA chip V1.0 technology to detect 5396 circRNAs in the bone marrow of 8 children with AML (1 case of M1, 2 cases of M2, 2 cases of M4, 2 cases of M5, 1 case of M7) and 5 healthy children as controls. We compared the expression level of circRNA in AML with that in the normal control group, and the results showed that there were 506 circRNAs with statistically significant expression differences, of which 382 were up-regulated and 124 were down-regulated. We selected the top 10 circRNAs with the most significant expression differences for further verification and found a circRNA with the most significant difference, hsa_circ_0012152. Hsa_circ_0012152 (chr1: 44877652-44878394) is a single circularization of the 2nd exon region of the gene RNF220 (1p34.1) and is 742 bp long. At present, the biological function and clinical significance of hsa_circ_0012152 in childhood AML are completely unknown. SUMMARY

[0006] The present application aims to study the new application of circRNA hsa_circ_0012152, and specifically relates to the application of circRNA hsa_circ_0012152 as a therapeutic target in the preparation of a drug for treating childhood acute myeloid leukemia.

[0007] In addition, the present application aims to study a new target for preparing a drug for treating childhood AML. A target site of a drug for treating childhood acute myeloid leukemia, the target site is the circularization site of circRNA hsa_circ_0012152. The target site sequence is shown as SEQ ID NO. 5.

[0008] The present application research shows that hsa_circ_0012152 is abnormally highly expressed in children AML, and is more than nearly 14 times compared with the control group. More interestingly, in the children AML patients who are completely relieved after treatment, hsa_circ_0012152 rapidly decreases, and is almost flat with the normal children bone marrow. In the children AML patients who are not relieved and relapse, the circular RNA is also up-regulated. This result implies that the circular RNA hsa_circ_0012152 can be used as a new target for the treatment of children AML, and is expected to become a new strategy for improving the treatment and survival of AML patients.

[0009] Due to the characteristics of circular RNA itself, the present application determines the existence and effectiveness of hsa_circ_0012152 by PCR and sequencing method. And aiming at the circularization site (target site: CGGAATGACAGATGTCTTA (SEQ ID NO. 5)) of hsa_circ_0012152, a small interfering RNA (si-0012152) which specifically interferes with the expression of hsa_circ_0012152 without affecting the expression of its parent gene RNF220 is designed. At the same time, the plasmid vector (PCD3.1-0012152) (SEQ ID NO. 6) overexpressing hsa_circ_0012152 is constructed. By transfecting si-0012152 or overexpression vector (PCD3.1-0012152) into human acute myeloid leukemia cell lines HL60, THP-1 and K562 cells, the changes of cell growth activity, differentiation and proliferation after interfering or overexpressing hsa_circ_0012152 are studied. The results show that when the expression of hsa_circ_0012152 increases, the malignant proliferation of cells is blocked; when the expression of hsa_circ_0012152 decreases, the malignant proliferation of cells is significantly reduced, the differentiation and maturation ability is enhanced, and the proportion of cancer cell death is higher. Therefore, hsa_circ_0012152 can be used as a potential target site in the preparation of drugs for treating children acute myeloid leukemia. BRIEF DESCRIPTION OF DRAWINGS

[0010] Figure 1 To identify the circularization site of hsa_circ_0012152 by sanger sequencing;

[0011] Figure 2 To detect the expression of hsa_circ_0012152 in the bone marrow of children AML at different stages by QPCR;

[0012] Figure 3 To verify the effect after transfection of overexpression plasmid and interference small molecules;

[0013] Figure 4 Effect of hsa_circ_0012152 on differentiation morphology of human myeloid leukemia cells THP-1;

[0014] Figure 5 Effect of hsa_circ_0012152 on surface differentiation-related protein molecules of human myeloid leukemia cells THP-1;

[0015] Figure 6 Effect of hsa_circ_0012152 on K562 cell apoptosis (red marker apoptotic bodies);

[0016] Figure 7 Effect of hsa_circ_0012152 on K562 cell proliferation;

[0017] Figure 8 Effect of hsa_circ_0012152 on HL60 cell proliferation after interfering with the expression of hsa_circ_0012152. DETAILED DESCRIPTION

[0018] The embodiments of the present application are described below through specific specific examples.

[0019] The technologies involved in the present application are all conventional molecular cloning techniques. The enzymes, primers, reagents and reaction conditions involved can be reasonably selected according to the experience of those skilled in the art if not otherwise specified. The reagent consumables involved are ordinary products on the market. The detection means and instruments involved are also well known and mastered by those skilled in the art.

[0020] I. Sequencing verification of the circularization site of circular RNA hsa_circ_0012152 gene

[0021] 1. Cell collection and pretreatment

[0022] Two 1ml samples of umbilical cord vein blood were collected from each of two pregnant women who delivered at Guangzhou Women and Children's Medical Center. The participants signed the informed consent form. Single nuclear cells were collected by Ficoll density gradient centrifugation. Finally, RNAiso Plus reagent (TaKaRa) was added, mixed by repeated pipetting, and stored at -80℃ for later use.

[0023] 2. RNA extraction

[0024] RNA was extracted according to the instructions of TaKaRa RNAiso Plus reagent, the RNA concentration was measured (A260 / A280 = 1.8-2.1), and stored at -80℃ for later use.

[0025] 3. cDNA reverse transcription

[0026] PrimeScript using TaKaRa TM RT reagent kit with gDNA Eraser (Perfect RealTime) for cDNA reverse transcription.

[0027] (1) Treat according to the formula in Table 1 to remove genomic DNA. Reaction program: 42°C, 2 minutes. Store at 4°C for later use.

[0028] Table 1

[0029] Reagent Amount used 5x gDNA Eraser Buffer 2.0ul gDNA Eraser 1.0ul Total RNA 1 ug RNase Free dH2O Supplement 10 ul

[0030] (2) Perform reverse transcription according to the formula in Table 2. The reaction program is 37°C for 15 minutes; 85°C for 5 seconds; 4°C for later use.

[0031] Table 2

[0032] Reagent Amount used Reaction solution of Step 1 10.0ul PrimeScript RT Enzyme Mix I 1.0ul RT Primer Mix 1.0ul 5x PrimeScript Buffer 2 4.0ul RNase Free dH2O 4.0ul Total 20l

[0033] 4. PCR reaction

[0034] Using TaKaRa's Premix Taq TM The enzyme was prepared according to the following formulation. A pair of reverse primers were designed for the circular RNA hsa_circ_0012152. The upstream sequence of the primers was F: 5'-TGCTGTCTCTGGCCTCATTTC (SEQ ID NO.1); the downstream sequence was R: 5'-GGGAATCATTCCCTCCTAAGAC (SEQ ID NO.2). The reaction program was 94℃ for 2 minutes of pre-denaturation; 94℃ for 30 seconds of denaturation, 60℃ for 30 seconds of annealing, and 72℃ for 2 minutes of extension, for 40 cycles; followed by 72℃ for 10 minutes. (Table 3)

[0035] Table 3

[0036] Reagent Amount used Premix Taq (Ex Taq Version 2.0 plus dye) 10ul cDNA template or gDNA 2 ug Primer F (10 uM) 0.8ul Primer R (10 uM) 0.8ul RNase Free dH2O Supplement 20 ul

[0037] 5. Ligate T vector, transform, perform colony PCR, and sequence.

[0038] The cloning was performed using TIANGEN's pGM-T cloning kit. 1 μL of the T vector was gently mixed with 1 μL of the PCR product and incubated at room temperature (20℃–37℃) for 5 min. After the reaction, the centrifuge tube was placed on ice. The T vector was transformed into competent *E. coli* cells using a heat shock transformation method (42℃ for 90 s). 50–100 μL of the transformation buffer was plated on ampicillin agar plates and incubated upside down overnight at 37℃.

[0039] At room temperature, a sterile toothpick was used to randomly pick a single colony from the transformation plate. The toothpick with the bacterial body was washed several times in a PCR tube containing the PCR mixture reaction system and then removed. The PCR reaction system and reaction program were the same as above. Positive colonies were selected for sequencing. The sequence of hsa_circ_0012152 is shown in NO. 1; the sequencing results are shown in Figure 1 : The cyclization site was clearly detected.

[0040] II. QPCR detection of hsa_circ_0012152 expression in bone marrow of children with acute myeloid leukemia at different stages of the disease

[0041] 1. Blood sample collection and processing

[0042] From January 2015 to November 2018, 52 cases of newly diagnosed children with AML bone marrow samples, 9 cases of relapsed samples, 32 cases of normal children as controls, 5 cases of paired complete remission cases were collected from Guangzhou Women and Children's Medical Center. All participants signed the informed consent form. EDTA anticoagulant tubes were used to collect bone marrow samples, and patient information was recorded. Red blood cell lysis was used to collect white blood cells. Finally, RNAiso Plus reagent (TaKaRa) was added, mixed well by repeated pipetting, and stored at -80°C for use;

[0043] 2. RNA extraction: same as above;

[0044] 3. cDNA reverse transcription: same as above;

[0045] 4. QPCR amplification experiment

[0046] QPCR was used to amplify hsa_circ_0012152 and GAPDH. TaKaRa TB GreenTM Premix ExTaqTM II (Tli RNaseH Plus) kit was used. The experimental system was completed according to Table 4.

[0047] Table 4

[0048]

[0049]

[0050] The reaction program was a two-step method: PCR amplification standard program: pre-denaturation at 95°C for 30 sec; second step: denaturation at 95°C for 5 sec, extension at 60°C for 30 sec, and this step was repeated for 40 cycles.

[0051] Ct 目的 Ct 管家 Ct 目的 Ct 管家, where represents the relative Ct value of the target gene relative to the housekeeping gene in each sample, △△Ct=(△Ct) Test -(△Ct) Control , indicating that the treatment group was normalized relative to the control group, 2 -△△Ct This represents the relative expression level of the treatment group compared to the control group, and the relative fold increase in target gene expression. The formula for calculating the relative expression level of the target gene is: 5. Results are shown below. Figure 2 The results showed that hsa_circ_0012152 was abnormally highly expressed in the bone marrow of children with newly diagnosed and relapsed AML. Figure 2 A), while its expression is reduced in the bone marrow of children who have achieved complete remission after chemotherapy. Figure 2 B). The above results indicate that hsa_circ_0012152 plays an important role in the treatment of AML in children.

[0052] III. Construction of overexpression vector, design of interfering RNA and verification of transfection effect

[0053] 1. Construction of overexpression plasmid vector (using pcDNA3.1+CircRNAMin i Vector from Guangzhou Yongnuo Biotechnology Co., Ltd.)

[0054] An overexpression plasmid (pcDNA3.1-0012152) carrying hsa_circ_0012152 was constructed. First, primers with reverse complementary pairing at both ends were designed to amplify the linear fragment of hsa_circ_0012152. Then, the fragment was circularized, and the amplification product was transformed into the T3 vector. The purified plasmid was then collected.

[0055] 2. Interfering RNA (si-0012152) was designed targeting the circularization site of hsa_circ_0012152 to avoid affecting the parental genes.

[0056] Sense:5'-AUGACAGAUGUCUUAGGAGdTdT-3'(SEQ ID NO.3);

[0057] Antisense: 3'-dTdTUACUGUCUACAGAAUCCUC-5' (SEQ ID NO. 4).

[0058] 3. Transfection with siRNA and overexpression plasmids (Invitrogen's Lipofectamine) TM StemTransfection Reagent)

[0059] (1) The logarithmic growth of human myeloid leukemia cell line THP-1, HL60 and K562 cells (1.5 ml cell suspension) is transferred to a six-well plate, and the cell confluence is 70%-90% transfection.

[0060] (2) Add 100ul Opti-MEM and pcDNA3.1-0012152 (or si-0012152) 2ug to a sterile centrifuge tube, and mix gently, which is A liquid.

[0061] (3) Take 5μl Lipofectamine TM Stem Reagent reagent in another sterile centrifuge tube with 100ul Opti-MEM, mix gently, which is B liquid.

[0062] (4) Mix A and B liquids 1:1, incubate at room temperature for 10 minutes. Then transfer the mixture to the culture medium of THP-1, HL60 and K562 cells, mix well, and incubate at 37℃, 5% CO2 cell incubator for 60 hours to collect cells.

[0063] 4、RNA extraction: same as before.

[0064] 5、cDNA reverse transcription: same as before;

[0065] 6、QPCR amplification experiment: same as before; results are shown in Figure 3 , the results show that when transfected with pcDNA3.1-0012152, hsa_circ_0012152 expression is significantly increased Figure 3 A); while si-0012152, its expression is significantly decreased. This shows that the overexpression vector and the designed interference sequence we constructed are effective Figure 3 B).

[0066] Four, the effect of overexpression of hsa_circ_0012152 on the differentiation morphology of myeloid leukemia cell line THP-1 (Wright-Giemsa staining method)

[0067] 1、pcd3.1-0012152 plasmid transfection into THP-1 cells: same as before (put cell slides in each well before transfection). At the same time, 25ng / ml PMA is added to the culture medium for induction, and incubated at 37℃, 5% CO2 cell incubator.

[0068] 2. At four time points of 24h, 48h, 72h, and 96h, the original culture medium was aspirated, the cells were washed once with PBS, and the cell slides were removed and allowed to air dry. The slides were fixed with methanol for 3 min, and 300 μL of Wright-Giemsa working solution was added to cover the slides. After staining at room temperature for 1 min, 2 ml of phosphate buffer was added and gently blown to mix, allowing it to cover the slides for 10 min. Then, the slides were washed with distilled water and air-dried at room temperature. The slides were observed under a 100× oil immersion microscope.

[0069] 3. Results are shown below. Figure 4 The results showed that after THP-1 (under PMA stimulation) overexpression of hsa_circ_0012152, the cell morphology changes were small, the differentiation of cells into macrophages was slowed down, and the characteristics of monocytes were maintained more.

[0070] V. Detection of differentiation markers in the myeloid leukemia cell line THP-1 by overexpression of hsa_circ_0012152 (flow cytometry)

[0071] 1. Transfect the pcd3.1-0012152 plasmid into THP-1 cells: as before. Simultaneously, add 25 ng / ml PMA to the culture medium for induction, and culture at 37°C in a 5% CO2 cell culture incubator.

[0072] 2. 48 h post-transfection, carefully scrape off cells using a cell scraper and collect them, then centrifuge. Discard the supernatant, add 1 ml of FACS Buffer to resuspend, mix well, centrifuge again, and add 50 μL of mixed flow cytometry antibody (containing CD11b, CD14, and CD206). Incubate at 4°C for 20 min; add 1 ml of FACS Buffer to wash away unbound antibody, centrifuge, discard the supernatant, add 200 μL of FACS Buffer, filter into a flow cytometry tube, and detect cell surface molecule expression using flow cytometry.

[0073] 3. Results are shown below. Figure 5 The results showed that overexpression of hsa_circ_0012152 in THP-1 (under PMA stimulation) altered cell surface molecular markers, with decreased expression of CD11b and CD14 compared to the control group. This indicates that hsa_circ_0012152 can inhibit leukemia cell differentiation.

[0074] VI. Effect of overexpression of hsa_circ_0012152 on apoptosis in K562 cells (using Beyotime's one-step TUNEL apoptosis detection kit)

[0075] 1. Transfect pcd3.1-0012152 plasmid into K562 cells: as before. Incubate at 37℃, 5% CO2 for 60 h.

[0076] 2, collect 10 6 cells, centrifuge, PBS wash 5 minutes. After fixing the cells with 4% paraformaldehyde for 30 minutes, wash with PBS again. Resuspend the cells in PBS containing 0.3% Triton X-100, and incubate at room temperature for 5 minutes. Wash with PBS for 5 minutes.

[0077] 3, Prepare an appropriate amount of TUNEL detection solution according to the ratio of 5 μl TdT enzyme per sample and 45 μl fluorescent labeling solution. Add 50 μl TUNEL detection solution to each sample, and incubate at 37°C in the dark for 60 minutes; after the end, wash with PBS twice, 5 minutes / time. Finally, suspend with 250 PBS.

[0078] 4, Detect with flow cytometry or observe under a fluorescence microscope after smearing. The excitation wavelength of Cy3 is 550 nm, and the emission wavelength is 570 nm (red fluorescence).

[0079] 5, There is almost no DNA breakage in normal or proliferating cells, but DNA breakage occurs in apoptotic cells, and these broken DNA can be labeled, thereby showing cells undergoing apoptosis. The results are shown in Figure 6 From the figure, it can be seen that the number of K562 cells undergoing apoptosis after overexpression of hsa_circ_0012152 is lower than that of the control group. In other words, hsa_circ_0012152 can inhibit K562 cell apoptosis to a certain extent.

[0080] Seven, the effect of overexpression of hsa_circ_0012152 on K562 cell proliferation (CCK-8 kit)

[0081] 1, Transfect the pcd3.1-0012152 plasmid into K562 cells: as before. Culture in a 37°C, 5% CO2 cell incubator. And the transfected cells are distributed into 96-well plates according to 2x10 4 cells / well (100ul cell suspension).

[0082] 2, Add CCK-8 reagent 10ul at 24h, 48h, 72h and 96h after transfection, continue to incubate the culture plate in the incubator for 2h, and measure the absorbance value at 450nm with a microplate reader, with 630nm as the reference wavelength.

[0083] 3, The results are shown in Figure 7 The results show that: after three independent experimental detections, from 24h, the activity of K562 cells transfected with pcd3.1-0012152 is significantly higher than that of the control group (PCD3.1). This suggests that overexpression of hsa_circ_0012152 has the ability to promote the malignant proliferation of tumor cells Figure 7 ).

[0084] Seven, detection of si-0012152 on myeloid leukemia cell line HL60 proliferation (CCK-8 kit)

[0085] 1, si-0012152 small RNA was transfected into HL60 cells: same as before. And the transfected cells were distributed into 96-well plates according to 2.5x10 4 / well (100ul cell suspension).

[0086] 2, add CCK-8 reagent 10ul respectively at 24h, 48h, 72h and 96h after transfection, and incubate the culture plate in the incubator for 2h, then measure the absorbance value at 450nm with microplate reader, and 630nm as reference wavelength.

[0087] 3, the results are shown in Figure 8 , the results show that: after three independent experiments, our results show that the growth state of each group of cells after transfection gradually appears difference, from 24h, HL60 cells transfected with si-0012152 have significantly decreased activity compared with the control group (si-NC), and the inhibitory effect on proliferation is also significantly increased with time. This suggests that after targeting interference hsa_circ_0012152, it has the ability to inhibit cancer cell proliferation. SEQUENCE LISTING <110> Guangzhou Women and Children's Medical Center <120> New use of circular RNA hsa_circ_0012152 <141> 2019-02-25 <160> 6 <170> SIPOSequenceListing 1.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence (ABC) <400> 1 tgctgtctct ggcctcattt c 21 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence (ABC) <400> 2 gggaatcatt ccctcctaag ac 22 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence (ABC) <400> 3 augacagaug ucuuaggagt t 21 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence (ABC) <400> 4 ttuacugucu acagaauccu c 21 <210> 5 <211> 19 <212> DNA <213> Artificial Sequence (ABC) <400> 5 cggaatgaca gatgtctta 19 <210> 6 <211> 6244 <212> DNA <213> Artificial Sequence (ABC) <400> 6 gacggatcgg gagatctccc gatcccctat ggtgcactct cagtacaatc tgctctgatg 60 ccgcatagtt aagccagtat ctgctccctg cttgtgtgtt ggaggtcgct gagtagtgcg 120 cgagcaaaat ttaagctaca acaaggcaag gcttgaccga caattgcatg aagaatctgc 180 ttagggttag gcgttttgcg ctgcttcgcg atgtacgggc cagatatacg cgttgacatt 240 gattattgac tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata 300 tggagttccg cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc 360 ccggcccatt gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc 420 attgacgtca atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt 480 atcatatgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt 540 atgcccagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca 600 tcgctattac catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg 660 actcacgggg atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc 720 aaaatcaacg ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg 780 gtaggcgtgt acggtgggag gtctatataa gcagagctct ctggctaact agagaaccca 840 ctgcttactg gcttatcgaa attaatacga ctcactatag ggagacccaa gctggctagc 900 gtttaaactt aagcttggta ccgagctcgg atccactagt ccagtgtggt ggaattccaa 960 agtgctgaga ttacaggcgt gagccaccac ccccggccca ctttttgtaa aggtacgtac 1020 taatgacttt ttttttatac ttcaggatat cgtcttagga gggaatgatt ccccagtaat 1080 attccctgcc ctgacccaaa gtgctggttg gcctccctcc cagggaagac tgcttcttgc 1140 gtaacgccgg ccacagaaag agactccgat ggacttacac cgggcagcct tcaagatgga 1200 gaactcatcc taccttccca accctctggc atccccagca ctgatggtcc tggcatccac 1260 ggctgaggcc agccgtgatg cttccatccc ttgtcagcag ccacgaccct ttggtgtacc 1320 tgtctcagtt gacaaggacg tgcatattcc tttcaccaac ggttcctata cctttgcctc 1380 tatgtaccat cggcaaggtg gggtgccagg cacttttgcc aatcgtgatt tccccccttc 1440 tctactacac ctccaccctc aatttgctcc cccaaatcta gattgcaccc caatcagtat 1500 gctgaatcat agtggtgtgg gggctttccg gccctttgcc tccaccgagg accgggagag 1560 ctatcagtca gcctttacgc cggccaagcg acttaagaac tgccatgaca cagagtctcc 1620 ccacttgcgc ttctcagatg cagatggcaa ggaatatgac tttgggacac agctgccatc 1680 tagctccccc ggttcactaa aggttgatga cactgggaag aagatttttg ctgtctctgg 1740 cctcatttct gatcgggaag cctcatctag cccagaggat cggaatgaca gatgcggccg 1800 ctcgagtcta gagggcccgt ttaaacccgc tgatcagcct cgactgtgcc ttctagttgc 1860 cagccatctg ttgtttgccc ctcccccgtg ccttccttga ccctggaagg tgccactccc 1920 actgtccttt cctaataaaa tgaggaaatt gcatcgcatt gtctgagtag gtgtcattct 1980 attctggggg gtggggtggg gcaggacagc aagggggagg attgggaaga caatagcagg 2040 catgctgggg atgcggtggg ctctatggct tctgaggcgg aaagaaccag ctggggctct 2100 agggggtatc cccacgcgcc ctgtagcggc gcattaagcg cggcgggtgt ggtggttacg 2160 cgcagcgtga ccgctacact tgccagcgcc ctagcgcccg ctcctttcgc tttcttccct 2220 tcctttctcg ccacgttcgc cggctttccc cgtcaagctc taaatcgggg gctcccttta 2280 gggttccgat ttagtgcttt acggcacctc gaccccaaaa aacttgatta gggtgatggt 2340 tcacgtagtg ggccatcgcc ctgatagacg gtttttcgcc ctttgacgtt ggagtccacg 2400 ttctttaata gtggactctt gttccaaact ggaacaacac tcaaccctat ctcggtctat 2460 tcttttgatt tataagggat tttgccgatt tcggcctatt ggttaaaaaa tgagctgatt 2520 taacaaaaat ttaacgcgaa ttaattctgt ggaatgtgtg tcagttaggg tgtggaaagt 2580 ccccaggctc cccagcaggc agaagtatgc aaagcatgca tctcaattag tcagcaacca 2640 ggtgtggaaa gtccccaggc tccccagcag gcagaagtat gcaaagcatg catctcaatt 2700 agtcagcaac catagtcccg cccctaactc cgcccatccc gcccctaact ccgcccagtt 2760 ccgcccattc tccgccccat ggctgactaa ttttttttat ttatgcagag gccgaggccg 2820 cctctgcctc tgagctattc cagaagtagt gaggaggctt ttttggaggc ctaggctttt 2880 gcaaaaagct cccgggagct tgtatatcca ttttcggatc tgatcaagag acaggatgag 2940 gatcgtttcg catgattgaa caagatggat tgcacgcagg ttctccggcc gcttgggtgg 3000 agaggctatt cggctatgac tgggcacaac agacaatcgg ctgctctgat gccgccgtgt 3060 tccggctgtc agcgcagggg cgcccggttc tttttgtcaa gaccgacctg tccggtgccc 3120 tgaatgaact gcaggacgag gcagcgcggc tatcgtggct ggccacgacg ggcgttcctt 3180 gcgcagctgt gctcgacgtt gtcactgaag cgggaaggga ctggctgcta ttgggcgaag 3240 TGCCGGGGCAGGATCTCCTGT CATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGG 3300 CTGATGC AATGC GGC GGCTGC ATACGCTT GATCCGGCTACCTGCCCATTCGACCACC AAG 3360 CGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCG GTCTTGTCGATCAGGATG 3420 ATCTGGACG AAGAGCATCAGGGGCTCGCGCCAGCCGAAC TGTTCGCCAGGCTCAAGGC GC 3480 GCA TGCCC GACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTT GCCGAATATCA 3540 TG GTGGAAAA TGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACC 3600 GCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGC GAATGGG 3660 CTGACC GCTT CCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCT 3720 ATCGCCTTCTTGACGAGTTCTTCTGAGCGGGACTCTGGGGTTCGAAATGACC GACCAAGC 3780 GACGCCCAACCTGCCATCACGAGATTTCGATTCCACCGCCGCCTTCTATGAAAG GTTGGG 3840 CTTCGGAATCGTTTTCCGGGACGCCGGCTGGATGATCCTCCAGCGG GGATCTCATGCT 3900 GGAGTTCTTCGCCCACCCC AACTTGTTATTGCAGCTTATAATGGTTACAAATAAAGCAA 3960 TAGCATCACAAATTTCACAAATAAAGCATTTTTTTC ACTGCATTCTAGTTGTG GTTTGTC 4020 CAAAC T CAT CAATGTATCTT ATCATGTCTGTATACCGTCGACCTCTAGCT AGAGCTTGGC 4080 GTAATCATGGT CATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAA 4140 CATA CGAGCCGGAAGCAT AAAGTGTA AAGCCTGGGGTGCC TAATGA GTAGCTA ACTCAC 4200 ATTAATTGCGTTGCGCTCAC TGCCCGCTTT CCAGTCGGGAAACCTGT CGTGCCAGCTGCA 4260 T TAATGAA TCGGCCAACGC GC GGGAGAGGC GTTTGC GTATTGGGC GCTCTTCCGCTTC 4320 CTCGCTC ACTGACTCGCTGC GCTCGGTCGTTCGGCTGC GGC GAGCGGTATC AGCTC ACTC 4380 AAAGGC GGT AATACGGTTAT CCACAGAATC AGGGGATAAC GCAGGA AAGAAC ATGTGAGC 4440 AAAAGGCCAGCAAAGGCCAGGAACC GTA AAA GGC CGC GT GCTGGCGTTTTTCC ATAG 4500 GCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCC 4560 GACAGGACTA TAAAGATACC AGGC GTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGT 4620 TCCGACCC TGCCTTACCGGATACTGTCCGCCTTTCTC CCTTCGGGAAGC GTGGCGCT 4680 ttctcatagc tcacgctgta ggtatctcag ttcggtgtag gtcgttcgct ccaagctggg 4740 ctgtgtgcac gaaccccccg ttcagcccga ccgctgcgcc ttatccggta actatcgtct 4800 tgagtccaac ccggtaagac acgacttatc gccactggca gcagccactg gtaacaggat 4860 tagcagagcg aggtatgtag gcggtgctac agagttcttg aagtggtggc ctaactacgg 4920 ctacactaga agaacagtat ttggtatctg cgctctgctg aagccagtta ccttcggaaa 4980 aagagttggt agctcttgat ccggcaaaca aaccaccgct ggtagcggtt tttttgtttg 5040 caagcagcag attacgcgca gaaaaaaagg atctcaagaa gatcctttga tcttttctac 5100 ggggtctgac gctcagtgga acgaaaactc acgttaaggg attttggtca tgagattatc 5160 aaaaaggatc ttcacctaga tccttttaaa ttaaaaatga agttttaaat caatctaaag 5220 tatatatgag taaacttggt ctgacagtta ccaatgctta atcagtgagg cacctatctc 5280 agcgatctgt ctatttcgtt catccatagt tgcctgactc cccgtcgtgt agataactac 5340 gatacgggag ggcttaccat ctggccccag tgctgcaatg ataccgcgag acccacgctc 5400 accggctcca gatttatcag caataaacca gccagccgga agggccgagc gcagaagtgg 5460 tcctgcaact ttatccgcct ccatccagtc tattaattgt tgccgggaag ctagagtaag 5520 tagttcgcca gttaatagtt tgcgcaacgt tgttgccatt gctacaggca tcgtggtgtc 5580 acgctcgtcg tttggtatgg cttcattcag ctccggttcc caacgatcaa ggcgagttac 5640 atgatcccccc atgttgtgca aaaaagcggt tagctccttc ggtcctccga tcgttgtcag 5700 aagtaagttg gccgcagtgt tatcactcat ggttatggca gcactgcata attctcttac 5760 tgtcatgcca tccgtaagat gcttttctgt gactggtgag tactcaacca agtcattctg 5820 agaatagtgt atgcggcgac cgagttgctc ttgcccggcg tcaatacggg samaaccgc 5880 gccacatagc agaactttaa aagtgctcat cattggaaaa cgttcttcgg ggcgaaaact 5940 ctcaaggatc ttaccgctgt tgagatccag ttcgatgtaa cccactcgtg cacccaactg 6000 atcttcagca tcttttactt tcaccagcgt ttctgggtga gcaaaaacag gaaggcaaaa 6060 tgccgcaaaa aagggaataa gggcgacacg gaaatgttga atactcatac tcttccttt 6120 tcaatattat tgaagcattt atcagggtta ttgtctcatg agcggataca tatttgaatg 6180 tatttagaaa aataaacaaa taggggttcc gcgcacattt ccccgaaaag tgccacctga 6240 cgtc 6244

Claims

1. A drug for treating acute myeloid leukemia in children, wherein the drug is an inhibitor of circular RNA hsa_circ_0012152, the inhibitor is an siRNA of the circular RNA hsa_circ_0012152, and the nucleotide sequences of the sense strand and the antisense strand of the siRNA are shown as SEQ ID NO. 3 and SEQ ID NO.

4.

2. The medicament for treating childhood acute myeloid leukemia according to claim 1, wherein The sequence near the circularization site of the circular RNA hsa_circ_0012152 is shown as SEQ ID NO. 5.

Images