Use of yap protein in proliferation or apoptosis of vascular smooth muscle cells in response to mechanical stress stimulation

By designing siRNA and shRNA to interfere with YAP protein and regulate the proliferation or apoptosis of vascular smooth muscle cells, the problem of regulating the response of vascular smooth muscle cells to mechanical stress stimulation was solved, and effective treatment of blood diseases was achieved.

CN110257380BActive Publication Date: 2025-10-21GENERAL HOSPITAL OF PLA
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN201910597783.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2019-07-04
Publication Date
2025-10-21
Estimated Expiration
2039-07-04

AI Technical Summary

Technical Problem

Existing technologies lack in-depth research on how vascular smooth muscle cells perceive mechanical stress stimulation and convert it into biochemical signals to regulate proliferation, differentiation and migration. In particular, the role of YAP protein under stress stimulation has not been fully explored, affecting the treatment effect of blood diseases.

Method used

By designing siRNA and shRNA to interfere with the expression of YAP protein, using vectors such as plasmids, liposomes or lentiviruses, the proliferation or apoptosis of vascular smooth muscle cells can be regulated, the content and expression of YAP protein can be inhibited, and the cell response to mechanical stress can be regulated.

Benefits of technology

It effectively inhibited the proliferation of vascular smooth muscle cells under mechanical stress stimulation, provided a new research direction for the treatment of blood diseases, and opened up new ideas for the development and clinical treatment of YAP inhibitors.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN110257380B_ABST
    Figure CN110257380B_ABST
Patent Text Reader

Abstract

The application relates to the application of YAP protein in the proliferation or apoptosis of vascular smooth muscle cells under the stimulation of mechanical stress. The application relates to the correlation research of YAP protein and the Hippo pathway, and also relates to YAP inhibitors including siRNA and shRNA. After the vascular smooth muscle cells are transfected by the YAP inhibitors (siRNA and shRNA), the expression of YAP is knocked down. When YAP is knocked down, the cell proliferation of the vascular smooth muscle cells under the stimulation of mechanical stress is inhibited. The application opens up a new research prospect for the treatment of blood diseases, and provides a new idea for the deep development of the YAP inhibitors and the clinical treatment of blood diseases.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to the application of YAP protein in the proliferation or apoptosis of vascular smooth muscle cells in response to mechanical stress stimulation. Background Art

[0002] YAP (Yes-associated protein, YAP) is a major effector molecule downstream of the Hippo signaling pathway. It has a molecular weight of 65 kDa and is rich in proline. Because it binds to the Src homolog domain 3 (SH3) region of the non-receptor tyrosine kinase YES, it was named Yes-associated protein (YAP65). The human YAP gene is located on chromosome 11q22. YAP exists in two splice variants, YAP1 and YAP2. YAP1 possesses a single WW domain, while YAP2 possesses two WW domains. YAP protein is widely expressed in various tissues except peripheral blood leukocytes. YAP possesses multiple domains or specific amino acid sequences, including an N-terminal proline-rich domain, a transcription factor TEADs binding region, two WW domains, an SH3 binding motif, a C-terminal transcriptional activation domain, and a PDZ binding motif. Through these domains or amino acid sequences, YAP interacts with various proteins, participating in the regulation of multiple intracellular signaling pathways and exerting diverse biological functions. YAP is mainly located in the cell nucleus. Due to the lack of an obvious DNA binding domain, YAP is considered to be a transcriptional coactivator that needs to bind to transcription factors to initiate transcription of downstream genes.

[0003] The Hippo signaling pathway is currently reported to be the primary mechanism for regulating YAP activity. The upstream member of the Hippo pathway, Mst1 / 2, phosphorylates the other three core members of the pathway, WW45, Mob, and Lats1 / 2. Activated Lats1 / 2 phosphorylates the downstream effector molecules YAP and its paralog Taz. Phosphorylated YAP and Taz bind to 14-3-3, translocate from the nucleus to the cytoplasm, and lose their transcriptional coactivator activity. Furthermore, phosphorylation of YAP at serine 381 by Lats1 / 2 promotes phosphorylation of serines at other sites by CK1δ / ε, ultimately leading to YAP degradation through the ubiquitin-proteasome pathway.

[0004] Vascular smooth muscle cells (VSMC) are the main components of the blood vessel wall. They are affected by mechanical factors such as shear stress and periodic tensile stress generated by blood flow and are stress-sensitive cells. Studies have shown that under the action of appropriate periodic stress, vascular smooth muscle cells can proliferate, differentiate and migrate, and then complete a variety of related physiological activities. However, how stress stimulation is perceived by VSMC and converted into biochemical signals to regulate the proliferation, differentiation and migration of VSMC is still lacking in-depth research. The present invention explores the role of YAP protein in vascular smooth muscle cells in response to mechanical stress stimulation. By inhibiting the content / expression of YAP, it is possible to regulate the proliferation or apoptosis of vascular smooth muscle cells in response to mechanical stress stimulation. This has opened up new research prospects for the treatment of blood diseases and provided new ideas for the in-depth development of YAP inhibitors and the clinical treatment of blood diseases. Summary of the Invention

[0005] The present invention provides an siRNA, the nucleotide sequence of which is selected from SEQ ID NO: 1-3.

[0006] The present invention provides an shRNA, the nucleotide sequence of the sense strand of which is shown in SEQ ID NO: 4, and the nucleotide sequence of the antisense strand of which is shown in SEQ ID NO: 5.

[0007] The present invention provides a vector comprising the siRNA or the shRNA.

[0008] In one aspect, the vector is selected from plasmids, liposomes, viruses or other suitable types of vectors. Preferably, the plasmid is selected from eukaryotic cell plasmids; the liposome is selected from lipofectamin; the virus is selected from lentivirus; more preferably, the lentivirus is selected from lentivirus LV3.

[0009] The present invention provides a host cell comprising the siRNA, the shRNA or the vector.

[0010] In one aspect, the host cell is selected from muscle cells; preferably, the host cell is selected from vascular smooth muscle cells.

[0011] The present invention provides a pharmaceutical composition comprising the siRNA, the shRNA, the vector or the host cell, and pharmaceutically acceptable excipients.

[0012] In one aspect, the pharmaceutical composition can be prepared as a pharmaceutical formulation according to conventional methods. During the formulation process, the siRNA, the shRNA, the vector, or the host cell is mixed with or diluted with a pharmaceutically acceptable excipient. When the excipient serves as a diluent, it can be a liquid. The formulation is selected from the form of a suspension, emulsion, solution, injectable solution, and the like.

[0013] The present invention provides use of the siRNA, the shRNA or the vector in preparing a drug for regulating proliferation or apoptosis of vascular smooth muscle cells.

[0014] In one aspect, the regulation is proliferation or apoptosis of vascular smooth muscle cells in response to mechanical stress stimulation.

[0015] In one aspect, the modulation is inhibition of proliferation / growth of vascular smooth muscle cells.

[0016] The present invention provides use of a YAP inhibitor in preparing a medicament for regulating proliferation or apoptosis of vascular smooth muscle cells.

[0017] In one aspect, the YAP inhibitor is a compound that reduces the expression of YAP nucleic acid or protein.

[0018] In one aspect, the YAP inhibitor is selected from siRNA or shRNA.

[0019] In one aspect, the siRNA has a nucleotide sequence selected from SEQ ID NOs: 1-3.

[0020] In one aspect, the shRNA sequence is as follows, the nucleotide sequence of the sense strand is shown in SEQ ID NO: 4, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 5.

[0021] In one aspect, the regulation is proliferation or apoptosis of vascular smooth muscle cells in response to mechanical stress stimulation.

[0022] In one aspect, the modulation is inhibition of proliferation / growth of vascular smooth muscle cells.

[0023] The positive effects of the present invention include: when vascular smooth muscle cells respond to mechanical stress stimulation, 10% mechanical stress stimulation activates the Hippo pathway, promotes the nuclear exit of YAP protein, and more migrates to the cytoplasm, inhibiting cell proliferation; 15% mechanical stress stimulation inhibits the Hippo pathway, promotes the nuclear entry of YAP protein, and more YAP is retained in the nucleus, which promotes cell proliferation. After YAP inhibitors (siRNA, shRNA) are transfected into vascular smooth muscle cells, the expression of YAP is knocked down. When YAP is knocked down, it inhibits the cell proliferation of vascular smooth muscle cells in response to mechanical stress stimulation. This has opened up new research prospects for the treatment of blood diseases and provided new ideas for the in-depth development of YAP inhibitors and the clinical treatment of blood diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 :Cell immunofluorescence was used to detect the localization of YAP in cells without mechanical stress stimulation.

[0025] Figure 2 : Cell immunofluorescence was used to detect the localization of YAP in cells under 10% mechanical stress stimulation.

[0026] Figure 3 : Cell immunofluorescence was used to detect the localization of YAP in cells under 15% mechanical stress stimulation.

[0027] Figure 4 Western blot analysis was used to detect the phosphorylation levels of YAP, VGLL4, ccnd1, and YAP in each group. The 0% elongation control group received no stress stimulation and was cultured for 0, 0.5, 1, 2, and 6 hours. The 10% elongation group received 10% mechanical stress stimulation and was cultured for 0, 0.5, 1, 2, and 6 hours. The 15% elongation group received 15% mechanical stress stimulation and was cultured for 0, 0.5, 1, 2, and 6 hours.

[0028] Figure 5 : qRT-PCR was used to detect miR130a levels in each group. Note: *p<0.05, **p<0.01. The meanings of the 0% elongation, 10% elongation, and 15% elongation groups are consistent with those in the previous studies.

[0029] Figure 6 : Western Blot was used to detect the YAP protein levels in the cells of each group.

[0030] Figure 7 :CCK-8 assay for cell proliferation. Note: **p<0.01, ##p<0.01.

[0031] Figure 8 : Flow cytometry was used to detect cell apoptosis. Note: **p<0.01, ##p<0.01, ^p<0.05.

[0032] Figure 9 : Cell cycle status was assessed by flow cytometry. Note: **p<0.01, ##p<0.01, ^^p<0.01, @@p<0.01. DETAILED DESCRIPTION

[0033] Unless otherwise specified, the experimental materials used in the following experimental methods can be easily obtained from commercial companies. Without departing from the spirit of the present invention, those skilled in the art can make various modifications to the present invention in combination with known techniques, and such modifications also fall within the scope of protection of the present invention.

[0034] Example 1: Correlation Experiment between Hippo Pathway and VSMC in Mechanical Stress Stimulation

[0035] 1. Experimental Materials

[0036] Primary cell isolation and subculture: Male SD rats (200-220 g) were used to obtain thoracic aorta and primary smooth muscle cells (VSMCs) were obtained by tissue patch method. The cells were subcultured for 3-8 generations for subsequent experiments.

[0037] 2. Experimental Grouping

[0038] Group A: 0% elongation. Group B: 10% elongation. Group C: 15% elongation.

[0039] 3. Experimental Methods

[0040] VSMCs were mechanically stretched by FX-5000T: VSMCs were stretched at 3×10 5 VSMCs were seeded at 100 cells / mL in a Bioflex 6-well plate (previously coated with type I collagen). After adherence and growth for approximately 24 hours, the serum-free medium was replaced and cultured for another 24 hours. 10% FBSDMEM was then added to the plate. VSMCs were subjected to mechanical elongation (10% and 15% elongation) according to experimental group, with a 0% control group receiving no mechanical elongation. The elongation treatment lasted for 24 hours.

[0041] Example 2: Cellular immunofluorescence detection of Hippo pathway correlation

[0042] 1. Cell Slide: Place the coverslip into a 12-well plate and perform cell monolayer slide at an appropriate cell concentration.

[0043] 2. Fix the cells: discard the culture medium, wash with PBS, then fix with 3% formaldehyde solution at room temperature for 10-15 minutes, and then wash with PBS.

[0044] 3. Permeabilization: The specimen is perforated with 1% Triton-X 100 and incubated at room temperature for 5 to 10 minutes.

[0045] 4. Blocking: Add appropriate amount of 3% BSA blocking solution to each sample site and block at room temperature for 30 minutes.

[0046] 5. Primary antibody incubation: dilute the primary antibody to 1 μg / mL, block overnight at 4°C, and wash with PBS.

[0047] 6. Secondary antibody and DAPI nuclear staining: dilute the fluorescent secondary antibody and DAPI mixture at a concentration of 1:500, incubate at room temperature in the dark for 30-60 minutes, and then wash with PBS.

[0048] 7. Sealing and fixing: seal the slide with fluorescence quenching sealing medium and fix the slide with nail polish.

[0049] 8. Laser confocal scanning observation.

[0050] Example 3: Western Blot Detection of Hippo Pathway Correlation

[0051] Cell samples from each group were collected and added into cell lysis buffer to extract total cell protein. BCA quantitative operation method was performed according to the instructions of BCA protein concentration determination kit, and protein expression content was analyzed by Western Blot.

[0052] Example 4: RT-PCR detection of Hippo pathway correlation

[0053] Primer Name Base sequence (5' to 3') miR-130a-F TCCCAGTGCAATGTTAAAAGGGCAT U6-F CTCGCTTCGGCAGCACA

[0054] 1. miRNA Extraction

[0055] 1. Take 200 μL of sample, add 5 times the volume of Buffer RLM, shake and mix for 30 seconds, let it stand at room temperature for 5 minutes to completely separate the protein-nucleic acid complex, centrifuge at 4°C, 12000 rpm for 5 minutes, and collect the supernatant.

[0056] 2. Add chloroform in a volume ratio of 1:1 for Buffer RLM and chloroform, shake vigorously for 15 seconds, let stand at room temperature for 5 minutes, centrifuge at 4°C and 12,000 rpm for 15 minutes, and separate the sample into three layers. Take the upper layer of colorless water.

[0057] 3. Add 1 / 3 volume of anhydrous ethanol to the obtained solution, mix well, transfer the solution and precipitate into the adsorption column RM (Spin Column RM), centrifuge at 12000 rpm for 30 seconds, and collect the effluent.

[0058] 4. Add 2 / 3 volume of anhydrous ethanol to the resulting solution, mix well, transfer the solution and precipitate to spin column RS, centrifuge at 12000 rpm for 30 seconds, and discard the effluent.

[0059] 5. Add 700 μL of Buffer RWT to the adsorption column RS, centrifuge at 12000 rpm for 30 seconds at room temperature, and discard the flow-through.

[0060] 6. Add 500 μL of Buffer RW2 to the adsorption column RS, centrifuge at 12000 rpm for 30 seconds at room temperature, and discard the flow-through.

[0061] 7. Repeat step 6; centrifuge at 12000 rpm for 1 minute and discard the flow-through.

[0062] 8. Add 30 μL of RNase-Free Water to the middle part of the adsorption column RS, let it stand at room temperature for 1 minute, centrifuge at 12000 rpm for 1 minute, collect the RNA solution, and store the obtained RNA solution at -70°C.

[0063] 2. Reverse Transcription Reaction

[0064] (1) miRNA with Poly(A) tail

[0065] 1. Dilute ATP 50-fold (1 μl of 10 mM ATP plus 49 μl of 1 mM Tris, pH 8.0).

[0066] 2. Add the reagents listed in the table below to an RNase-free reaction tube pre-cooled in an ice bath to a total volume of 25 μl.

[0067]

[0068]

[0069] 3. Gently mix the reaction solution and incubate at 37°C for 15 minutes.

[0070] (2) First-strand synthesis of modified miRNA cDNA

[0071] 1. Add the reagents listed in the table below to an RNase-free reaction tube pre-chilled in an ice bath to a final volume of 20 μL.

[0072]

[0073] 2. Gently mix the reaction solution and incubate at 42°C for 50 minutes.

[0074] 3. Incubate at 85°C for 5 minutes to terminate the reaction. The synthesized cDNA reaction solution can be directly used for fluorescence quantitative detection experiments or stored at -20°C for future use.

[0075] (3) Quantitative PCR

[0076] 1. Thaw 2× miRNA qPCR premix and reverse primer (10 μM) at room temperature.

[0077] 2. Place the reagents on ice and prepare the reaction system according to the table below.

[0078]

[0079] 3. The reaction program is set as follows

[0080]

[0081] Example 5: Analysis of Hippo pathway correlation results

[0082] 1. Cellular Immunofluorescence Detection of YAP Localization in Cells

[0083] Figure 1 、 2 Figures 3 and 4 show the effects of 0%, 10%, and 15% mechanical stress on YAP localization in cells, as detected by immunofluorescence. At 0% stress, YAP protein was expressed in both the cytoplasm and nucleus. At 10% stress, YAP protein was expressed in both the cytoplasm and nucleus at 30 minutes and 1 hour; at 2 hours, YAP protein expression in the nucleus decreased; and at 6 hours, YAP protein expression in the nucleus further decreased. At 15% stress, YAP protein was expressed in both the cytoplasm and nucleus at 30 minutes and 1 hour; at 2 hours, YAP protein expression in the nucleus increased, while cytoplasmic expression decreased; and at 6 hours, YAP protein expression in the nucleus further increased, while cytoplasmic expression further decreased.

[0084] The results show that 10% mechanical stress stimulation promotes the nuclear export of YAP protein, and 15% mechanical stress stimulation promotes the nuclear import of YAP protein, which is the reason for the changes in cell proliferation.

[0085] 2. Western Blot Detection of the Phosphorylation Levels of YAP, VGLL4, ccnd1 Protein and YAP Protein in Each Group of Cells

[0086] Figure 4The figure shows the phosphorylation levels of YAP, VGLL4, ccnd1 proteins and YAP proteins detected by Western Blot after 0, 10, 15% mechanical stress stimulation of VSMC for 0, 0.5, 1, 2, 6 hours. Figure 4 It can be seen that at 0% stress for 0, 0.5, 1, 2, and 6 hours, there was no significant change in the phosphorylation levels of YAP, VGLL4, ccnd1, and YAP protein. At 2 and 6 hours of treatment, compared with 0% stress, the phosphorylation of YAP protein and VGLL4 protein levels in the 10% stress stimulation group increased significantly, while the levels of YAP protein and ccnd1 protein decreased significantly. At 2 and 6 hours of treatment, compared with 0% stress, the phosphorylation of YAP protein and VGLL4 protein levels in the 15% stress stimulation group decreased significantly, while the levels of YAP protein and ccnd1 protein increased significantly.

[0087] YAP, VGLL4, and ccnd1 proteins are all involved in cell proliferation and apoptosis. YAP and ccnd1 protein levels are positively correlated with cell proliferation, while YAP phosphorylation and VGLL4 protein levels are negatively correlated with cell proliferation. Results indicate that mechanical stress stimulation at 10% activated the Hippo pathway, increasing YAP phosphorylation. Phosphorylated YAP then translocated to the cytoplasm, where it bound to the cytoplasmic protein 14-3-3, promoting YAP degradation. This decreased nuclear expression of the transcription factor YAP, coupled with an increase in the antagonist VGLL4, reduced YAP binding to the transcription factor TEAD. This reduced expression of the downstream cell cycle target gene ccnd1 and inhibited cell proliferation. As stress stimulation increased to 15%, activation of the Hippo pathway was inhibited, YAP phosphorylation decreased, and more YAP remained in the nucleus. Binding to the transcription factor TEAD promoted expression of the downstream target gene ccnd1, promoting cell proliferation.

[0088] 3. qRT-PCR detection of miR130a levels in each group of cells

[0089] Figure 5 The qRT-PCR analysis shows the level of miR130a in VSMC cells stimulated by 0, 10, and 15% mechanical stress for 0, 0.5, 1, 2, and 6 hours. Figure 5 As shown, at 0 and 0.5 hours, 0, 10, and 15% mechanical stress stimulation had no significant effect on miR130a levels. At 1 and 2 hours, compared with 0% stress, miR130a levels decreased with 10% mechanical stress stimulation, while miR130a levels increased with 15% mechanical stress stimulation, but there were no significant differences (p>0.05). At 6 hours, compared with 0% stress, miR130a levels decreased with 10% mechanical stress stimulation (p<0.05), while miR130a levels were extremely significantly increased with 15% mechanical stress stimulation (p<0.01).

[0090] miR130a levels are positively correlated with cell proliferation. The results show that 10% mechanical stress inhibits miR130a expression, while miR130a reduction promotes an increase in VGLL4 protein levels. VGLL4 binds to TEAD, reducing YAP binding to TEAD, thereby inhibiting the expression of the downstream gene ccnd1 and inhibiting cell proliferation. 15% mechanical stress stimulates miR130a expression, which inhibits the increase in VGLL4 protein levels. Increased YAP binding to TEAD promotes the expression of the downstream gene ccnd1, thereby promoting cell proliferation. These findings suggest that 10% and 15% mechanical stress regulate arterial smooth muscle cell proliferation and apoptosis in two ways, with both the Hippo pathway and miR130a-VGLL4 likely involved in this process.

[0091] Example 6. Experiment of YAP siRNA transfection into VSMC

[0092] 1. Experimental Materials

[0093] Primary cell isolation and subculture: Male SD rats (200-220 g) were used to obtain thoracic aorta and primary smooth muscle cells (VSMCs) were obtained by tissue patch method. The cells were subcultured for 3-8 generations for subsequent experiments.

[0094] 2. siRNA sequence design

[0095] si YAP-1:ACAGCAGGAGTTATTTCGG (SEQ ID NO: 1)

[0096] si YAP-2: GACCTCTTCTGGTCAGAGA (SEQ ID NO: 2)

[0097] si YAP-3: ATCACAATGATCAGACAAC (SEQ ID NO: 3)

[0098] MOCK:TTCTCCGAACGTGTCACGT

[0099] 3. Experimental Methods

[0100] (1) Cell culture

[0101] VSMCs were cultured in DMEM medium containing 10% FBS, 100 U / mL penicillin and 100 U / mL streptomycin.

[0102] (2) Experimental groups

[0103] Group 1: VSMCs.

[0104] Group 2: VSMC+Mock siRNA.

[0105] Group 3: VSMC+si YAP-1.

[0106] Group 4: VSMC+si YAP-2.

[0107] Group 5: VSMC+si YAP-3.

[0108] (III) Cell processing

[0109] After the VSMCs were digested with trypsin, 20 × 10 5 Each well was inoculated into a 6-well plate and cultured overnight.

[0110] (IV) Cell transfection method

[0111] According to the number of cells per well, add 100 pmol of siRNA diluted to 250 μL of I Reduced Serum Medium; dilute 5 μL lipofectamin 2000 to 250 μL I Reduced Serum Medium, gently mix, and let it stand for 5 minutes; add the siRNA solution to the lipofectamin 2000 solution, gently mix, and let it stand for 20 minutes; aspirate the culture medium in the cell culture plate and add 1.5 mL of fresh culture medium; add the above mixed solution to the cell culture dish; and culture at 37°C, 5% CO2 for 48 hours.

[0112] Example 7: Western Blot Detection of Transfected Cells

[0113] 1. Experimental Methods

[0114] Cell samples from each group were collected and added into cell lysis buffer to extract total cell protein. BCA quantitative operation method was performed according to the instructions of BCA protein concentration determination kit, and protein expression content was analyzed by Western Blot.

[0115] 2. Experimental Results

[0116] Figure 6 The figure shows the expression of YAP protein in VSMC after transfection of YAP siRNA by Western Blot. Figure 6 It can be seen that YAPsiRNA1 has the best effect in knocking down the YAP gene.

[0117] Subsequently, YAP siRNA1 was selected to construct lentivirus.

[0118] Example 8: Changes in the Hippo pathway in VSMCs in response to mechanical stimulation after YAP knockdown

[0119] 1. Construction of Lentivirus

[0120] 1. Vector name: LV3 (H1 / GFP & Puro) - Rat

[0121] 2. Product packaging: 500ng / μL, a total of 50ug

[0122] 3. Target sequence: ACAGCAGGAGTTATTTCGG (si YAP-1)

[0123] 4. shRNA template sequence:

[0124] (1)S: GATCCGACAG CAGGAGTTAT TTCGGTTCAA GAGACCGAAA TAACTCCTGCTGTTTTTTTG (SEQ ID NO: 4)

[0125] (2)A: AATTCAAAAA AACAGCAGGA GTTATTTCGG TCTCTTGAAC CGAAATAACTCCTGCTGTCG (SEQ ID NO: 5)

[0126]

[0127] 5. Transcript product sequence structure:

[0128] ACAGCAGGAGTTATTTCGGT TCAAGAGACC GAAATAACTC CTGCTGTT

[0129]

[0130] 6. Sequencing results:

[0131] CTTTGCAGTTATAAATACTGAATAATAAGATGACATGAACTACTACTGCTAGAGATTTTCCACACTGACTGAAAGGGTCTGAGGGATCTCTAGTTACCAGAGTCACACAACAGACGGGCACACACTACTTGAAGCACTCAAGGCAAGCTTTATTGAGGCTTAAGTGGGTTCCCTAGTTAGCCAGAGAGCTCCCAGGCTCAGATCTGGTCTAACCAGAGAGACCCAGTAGAAGCAAAAAGCAGAATCGAAG AATTCAAAAAAACAGCAGGAGTTATTTCGGTCTCTTGAACCGAAATA ACTCCTGCTGTCG GATCCAAGTGGTCTCATACAGAACTTATAAGATTCCCAAATCCAAAGACATTTCACGTTTATGGTGATTTCCCAGAACACATAGCGACATGCAAATATTGCAGGGCGCCACTCCCCTGTCCCTCACAGCCATCTTCCTGCCAGGGCGCACGCGCGCTGGGTGTTCCCGCCTAGTGACACTGGGCCCGCGATTCCTTGGAGCGGGTTGATGACGTCAGCGTTCCAATTCTTGACATCGTTGGGAGTGAATTAGCCCTTCCAGTCCCCCCTTTTCTTTTAAAAAGTGGCTAAGATCTACAGCTGCCTTGTAAGTCATTGGTCTTAAAGGTACCAGGCGGGGAGGCGGCCCAAAGGGAGATCCGACTCGTCTGAGGGCGAAGGCGGAGACGCGGAAGAGGCCGCAGAGCCGGCAGCAGGCCGCGGGAAGGAAGGTCCGCTGGATTGAGGGCCGAAGGGACGTAGCAGAAGGACGTCCCGCGCAGAATCCAGGTGGCAACACAGGCGAGCAGCCAAGGAAAGGACGATGATTTCCCCGACAACACCACGGAATTGTCAGTGCCCAACAGCCGAGCCCCTGTCCAGCAGCGGGCAAGGCAGGCGGCGATGAGTTCCGCCGTGACAATAGGGAGGGGGAAAGCGAAGTCCCGGGAAAGGAGCTGACAGGTGGTGGCAATGCCCCACCAGTGGGGGGTGCGTCAGCAAACACAGTGCACACCACGCCACGTGCCTGACACGGCACACTCTCATAAGAGAAAGCACAGAATTATACAGAGAGAAATGAAGGCATACCGTAAGCCATAGCATGATACAAGCAATAAGCACGATCCATAGCGTAAAGGCACTAGGTGAGAAATACCAGGTCATCGTC

[0132] II. Experimental methods

[0133] 1. Passage 3 - 8 rat VSMCs were cultured in DMEM medium containing 10% FBS.

[0134] 2. After the VSMCs were digested with trypsin, the cells were divided into 3 × 10 5 Cells were seeded at 100 μg / mL on a Bioflex 6-well plate (previously coated with type I collagen). After adhering to the plate for about 24 hours, serum-free medium was replaced and cultured for 24 hours; 10% FBS DMEM medium was added again.

[0135] 3. Infect cells with the above viruses at an MOI of 50, and transfect the control group with a lentivirus containing a control sequence.

[0136] 4. VSMC was subjected to mechanical stretching by FX-5000T; the stretching frequency was 1 Hz, the tensile strength was divided into 0%, 10%, and 15%, and the stretching time was 24 h.

[0137] 5. Experimental Grouping

[0138] Group A: VSMC Control+0% elongation

[0139] Group B: VSMC YAP shRNA+0% elongation

[0140] Group C: VSMC Control+10% elongation

[0141] Group D: VSMC YAP shRNA+10% elongation

[0142] Group E: VSMC Control+15% elongation

[0143] Group F: VSMC YAP shRNA+15% elongation

[0144] Example 9: Detection of cell proliferation using CCK-8 after YAP knockdown

[0145] 24 hours after stretch stress, Cell Counting Kit-8 (CCK-8) and serum-free basic culture medium were mixed in a volume ratio of 1:10, 100 μL per well was added to the wells to be tested, and incubated at 37°C, 5% CO2 for 1 hour; the absorbance at a wavelength of 450 nm was measured using a microplate reader.

[0146] Example 10: Flow cytometry detection of cell cycle after YAP knockdown

[0147] 1. VSMCs were digested with trypsin at different times to prepare single cell suspensions, counted and adjusted to a cell concentration of 10 6 / mL; centrifuge and discard the supernatant, wash with PBS to remove cell debris; slowly add 1mL of cold 75% ethanol, pipette evenly, and fix at 4°C overnight.

[0148] 2. Wash with PBS and resuspend the cells in 1 mL of PI staining solution (50 μg / mL propidium iodide, 0.2 mg / mL RNase, 0.1% Triton X-100) at room temperature in the dark for 30 minutes. Detect by flow cytometry.

[0149] Example 11: Flow cytometry detection of cell apoptosis after YAP knockdown

[0150] 1. VSMCs were digested with trypsin at different times, digested, centrifuged at 1500 rpm for 5 min, supernatant discarded, and cells collected; washed with PBS, centrifuged at 1500 rpm for 5 min; and 300 μL of Binding Buffer was added to suspend the cells.

[0151] 2. Annexin V-FITC labeling: Add 5 μL of Annexin V-FITC, mix well, protect from light, and incubate at room temperature for 15 minutes. PI labeling: Add 10 μL of PI staining, mix well, protect from light, and incubate at room temperature for 10 minutes. Detect by flow cytometry and analyze with CELLQuest software.

[0152] Example 12: Analysis of results after YAP knockdown

[0153] 1. CCK-8 assay for cell proliferation

[0154] Figure 7 The cell proliferation was detected by CCK-8. Figure 7 Compared with group A, cell proliferation in groups B and C was significantly downregulated (p<0.01), while cell proliferation in group E was significantly upregulated (p<0.01). Compared with group C, cell proliferation in group D was significantly downregulated (p<0.01). Compared with group E, cell proliferation in group F was significantly downregulated (p<0.01). This indicates that knockdown of YAP inhibits VSMC cell proliferation.

[0155] 2. Flow cytometry detection of cell apoptosis

[0156] Figure 8 Figure 4 shows the flow cytometry analysis of cell apoptosis. Figure 8 Compared with group A, apoptosis was significantly upregulated in groups B and C (p < 0.01), while apoptosis was downregulated in group E, but there was no significant difference (p > 0.05). Compared with group C, apoptosis was significantly upregulated in group D (p < 0.01). Compared with group E, apoptosis was upregulated in group F (p < 0.05). This indicates that knockdown of YAP inhibits VSMC proliferation.

[0157] 3. Flow cytometry detection of cell cycle

[0158] Figure 9Figure 4 shows the flow cytometry analysis of cell apoptosis. Figure 9 It can be seen that compared with group A, the G0 / G1 phase of cells in groups B and C was significantly upregulated (p<0.01), and the G0 / G1 phase of cells in group E was significantly downregulated (p<0.01). Compared with group C, the G0 / G1 phase of cells in group D was significantly upregulated (p<0.01). Compared with group E, the G0 / G1 phase of the cell cycle in group F was significantly upregulated (p<0.01). Compared with group B, the G0 / G1 phase of the cell cycle in group D was significantly upregulated (p<0.01), and the G0 / G1 phase of the cell cycle in group F was significantly downregulated (p<0.01). This shows that when YAP is knocked down, it inhibits VSMC cell proliferation.

Claims

1. An siRNA for regulating the proliferation or apoptosis of rat vascular smooth muscle cells, wherein the nucleotide sequence of the siRNA is selected from SEQ ID NO: 1, wherein the regulation is to inhibit the proliferation of rat vascular smooth muscle cells in response to mechanical stress stimulation.

2. A shRNA for regulating the proliferation or apoptosis of rat vascular smooth muscle cells, wherein the nucleotide sequence of the sense strand is shown in SEQ ID NO: 4, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 5, wherein the regulation is to inhibit the proliferation of rat vascular smooth muscle cells in response to mechanical stress stimulation. A vector comprising the siRNA according to claim 1 or the shRNA according to claim 2. The vector according to claim 3 , wherein the vector is selected from eukaryotic cell plasmid, lipofectamin or lentivirus. The vector according to claim 4 , wherein the lentivirus is selected from lentivirus LV3. A host cell comprising the siRNA according to claim 1, the shRNA according to claim 2, or the vector according to any one of claims 3 to 5.

7. The host cell of claim 6, wherein the host cell is selected from muscle cells.

8. The host cell of claim 6 or 7, wherein the host cell is selected from vascular smooth muscle cells. 9 . A pharmaceutical composition comprising the siRNA according to claim 1 , the shRNA according to claim 2 , the vector according to any one of claims 3 to 5 or the host cell according to any one of claims 6 to 8 , and a pharmaceutically acceptable excipient.

10. Use of the siRNA according to claim 1, the shRNA according to claim 2, or the vector according to any one of claims 3 to 5 in the preparation of a medicament for regulating the proliferation or apoptosis of rat vascular smooth muscle cells; the regulation is to inhibit the proliferation of rat vascular smooth muscle cells in response to mechanical stress stimulation.

Citation Information

Patent Citations

  • Treatment of cardiac diseases with modulators of the hippo pathway

    US20160361340A1