Recombinant adenovirus carrying a transgene

Abstract

Disclosed herein are recombinant adenoviruses having one or more nucleotide sequences inserted between two viral transcription units, preparations comprising the recombinant adenoviruses, and methods of treatment using the recombinant adenoviruses. In some embodiments, the one or more nucleotide sequences are inserted into the IX-E2 insertion site and / or the L5-E4 insertion site.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to and the benefit of U.S. Provisional Patent Application No. 62 / 511,822, filed May 26, 2017, which is incorporated herein by reference in its entirety.

[0003] Statement concerning sequence listing

[0004] The sequence table associated with this application is provided in the form of a text file in lieu of a paper copy, which is hereby incorporated by reference into the specification. The name of the text file containing the sequence table is EPRX_002_01WO_SeqList_ST25.txt. The text file is approximately 128KB, created on May 29, 2018, and submitted electronically via EFS-Wbe. Field of the Invention

[0005] The invention described herein relates generally to the fields of virology, virotherapy, and molecular biology. Background Art

[0006] The use of viral therapy to treat diseases such as cancer includes the use of selectively replicating viruses with therapeutic genes or transgenes. Among the various infectious viral species developed as viral therapeutics, adenoviruses have become one of the most important, not only because they have minimal toxicity to normal non-transformed cells, but also because their genomes contain multiple endogenous genes and are easy to manipulate, which usually takes the form of deletion and insertion of endogenous genes. The disadvantage of this manipulation is that most endogenous gene deletions or exogenous gene additions slow down or weaken the replication and infection potential of the virus. (Larson et al., Oncotarget, 6(24): 19976-89(2015))

[0007] Reduced replication efficiency of transgene-carrying viruses in these areas (such as in the case of oncolytic viruses used to treat cancer) is undesirable, as it impairs the ability of the virus to propagate in the tumor and infect adjacent cancer cells, reduces the number of viral genome copies in infected cells, and thus potentially reduces transcription of the therapeutic transgene and increases the size of the production culture required to produce the virus. Therefore, a new approach is needed to improve the ability of recombinant adenoviruses to replicate at high levels in target cells or tissues (such as in tumors), thereby rapidly turning the target cells or tissues into "factories" for the production of specific exogenous gene products.

[0008] Generally, in order to make an oncolytic virus express two or more independent proteins or polypeptide chains, it is necessary to use more than one viral vector or use a linker between two transgenes, such as an internal ribosome entry site (IRES). Both methods have significant disadvantages. Two or more viral vectors may not be well expressed in a single cell or tissue. As is known in the art, the expression level of the sequence downstream of IRES is much lower than that of the sequence upstream (Mizuguchi et al., Mol. Ther. 1 (4): 376-82 (2000)). In addition, non-endogenous linkers are immunogenic. Therefore, more effective viral vectors are needed to express more than one peptide chain in a single virus. Summary of the invention

[0009] The present invention is based in part on the discovery that recombinant adenoviruses having one or more nucleotide sequences inserted between two viral transcription units of the viral genome can efficiently replicate and express the nucleotide sequences in target cells or tissues without significantly affecting the oncolytic activity of the virus. The vectors of the present invention can be advantageously used when the same levels of two or more transgenes are required or for expressing completely native chains from a bipartite protein.

[0010] In one aspect, the present invention provides a recombinant adenovirus comprising a nucleotide sequence inserted into an insertion site, wherein the insertion site is located between a stop codon of a first viral transcription unit and a stop codon of a second viral transcription unit, wherein the stop codon of the first viral transcription unit is closer to the stop codon of the second viral transcription unit than the start site of the first viral transcription unit is to the stop codon of the second viral transcription unit, wherein the stop codon of the second viral transcription unit is closer to the stop codon of the first viral transcription unit than the start site of the second viral transcription unit is to the stop codon of the first viral transcription unit, and wherein prior to the insertion of the nucleotide sequence, there are no viral transcription units between the first viral transcription unit and the second viral transcription unit.

[0011] In certain embodiments, the first viral transcription unit is the adenovirus IX gene and the second viral transcription unit is the adenovirus IVa2 gene. In certain embodiments, the first viral transcription unit is the adenovirus fiber gene and the second viral transcription unit is ORF6 or ORF6 / 7 of the adenovirus E4 gene. In certain embodiments, the recombinant adenovirus is adenovirus type 5 (Ad5). In certain embodiments, the recombinant adenovirus is adenovirus type 35 (Ad35).

[0012] In certain embodiments, the nucleotide sequence is inserted into the IX-E2 insertion site. In certain embodiments, the IX-E2 insertion site is located between the stop codon of the adenovirus IX gene and the stop codon of the adenovirus IVa2 gene. In certain embodiments, the nucleotide sequence is inserted between nucleotides corresponding to about 4029 to 4093 of the Ad5 genome (SEQ ID NO: 1). In certain embodiments, the nucleotide sequence is inserted between nucleotides corresponding to 4029 to 4050 of the Ad5 genome (SEQ ID NO: 1), between nucleotides corresponding to 4050 to 4070 of the Ad5 genome (SEQ ID NO: 1), or between nucleotides corresponding to 4070 to 4093 of the Ad5 genome (SEQ ID NO: 1). In certain embodiments, the nucleotide sequence is inserted between nucleotides corresponding to about 3899 to 3970 of the Ad35 genome (SEQ ID NO: 41). In certain embodiments, the nucleotide sequence is inserted between nucleotides 3899 to 3920 corresponding to the Ad35 genome (SEQ ID NO: 41), between nucleotides 3920 to 3940 corresponding to the Ad35 genome (SEQ ID NO: 41), or between nucleotides 3940 to 3970 corresponding to the Ad35 genome (SEQ ID NO: 41).

[0013] In some embodiments, the nucleotide sequence is inserted into the L5-E4 insertion site. In some embodiments, the L5-E4 insertion site is located between the stop codon of the adenoviral fiber gene and the stop codon of ORF6 or ORF6 / 7 of the adenoviral E4 gene. In some embodiments, the nucleotide sequence is inserted between nucleotides corresponding to positions 32785 to 32916 of the Ad5 genome (SEQ ID NO: 1). In certain embodiments, the nucleotide sequence is inserted between nucleotides 32785 to 32800 corresponding to the Ad5 genome (SEQ ID NO: 1), between nucleotides 32800 to 32820 of the Ad5 genome (SEQ ID NO: 1), between nucleotides 32820 to 32840 of the Ad5 genome (SEQ ID NO: 1), between nucleotides 32840 to 32860 of the Ad5 genome (SEQ ID NO: 1), between nucleotides 32860 to 32880 of the Ad5 genome (SEQ ID NO: 1), between nucleotides 32880 to 32900 of the Ad5 genome (SEQ ID NO: 1), or between nucleotides about 32901 to 32916 corresponding to the Ad5 genome (SEQ ID NO: 1). In certain embodiments, the nucleotide sequence is inserted between nucleotides about 31799 to 31821 corresponding to the Ad35 genome (SEQ ID NO: 41). In certain embodiments, the nucleotide sequence is inserted between nucleotides 31799 to 32810 corresponding to the Ad35 genome (SEQ ID NO: 41), or between nucleotides 32810 to 31821 corresponding to the Ad35 genome (SEQ ID NO: 41).

[0014] In certain embodiments, the aforementioned recombinant adenovirus further comprises a nucleotide sequence inserted into the E1b-19K insertion site, the E3 insertion site, or the E4 insertion site. In certain embodiments, the E1b-19K insertion site is located between the start site of Elb-19K and the start site of Elb-55K. In certain embodiments, the E1b-19K insertion site is located between the start site of Elb-19K and the stop codon of Elb-19K. In certain embodiments, the E3 insertion site is located between the stop codon of the adenovirus pVIII gene and the start site of the adenovirus fiber gene.

[0015] In certain embodiments, the present invention provides a recombinant adenovirus comprising a first nucleotide sequence inserted into the IX-E2 insertion site and a second nucleotide sequence inserted into the L5-E4 insertion site.

[0016] In certain embodiments, the first nucleotide sequence is inserted between nucleotides corresponding to positions 4029 to 4093 of the Ad5 genome (SEQ ID NO: 1). In certain embodiments, the first nucleotide sequence is inserted between nucleotides corresponding to positions 4029 to 4050 of the Ad5 genome (SEQ ID NO: 1), between nucleotides corresponding to positions 4050 to 4070 of the Ad5 genome (SEQ ID NO: 1), or between nucleotides corresponding to positions 4070 to 4093 of the Ad5 genome (SEQ ID NO: 1). In certain embodiments, the first nucleotide sequence is inserted between nucleotides corresponding to positions 3899 to 3970 of the Ad35 genome (SEQ ID NO: 41). In certain embodiments, the first nucleotide sequence is inserted between nucleotides corresponding to positions 3899 to 3920 of the Ad35 genome (SEQ ID NO: 41), between nucleotides corresponding to positions 3920 to 3940 of the Ad35 genome (SEQ ID NO: 41), or between nucleotides corresponding to positions 3940 to 3970 of the Ad35 genome (SEQ ID NO: 41).

[0017] In certain embodiments, the second nucleotide sequence is inserted between nucleotides corresponding to positions 32785 to 32916 of the Ad5 genome (SEQ ID NO: 1). In certain embodiments, the second nucleotide sequence is inserted between nucleotides corresponding to positions 32785 to 32800 of the Ad5 genome (SEQ ID NO: 1), between nucleotides corresponding to positions 32800 to 32820 of the Ad5 genome (SEQ ID NO: 1), between nucleotides corresponding to positions 32820 to 32840 of the Ad5 genome (SEQ ID NO: 1), between nucleotides corresponding to positions 32840 to 32860 of the Ad5 genome (SEQ ID NO: 1), between nucleotides corresponding to positions 32860 to 32880 of the Ad5 genome (SEQ ID NO: 1), between nucleotides corresponding to positions 32880 to 32900 of the Ad5 genome (SEQ ID NO: 1), or between nucleotides corresponding to positions about 32901 to 32916 of the Ad5 genome (SEQ ID NO: 1). In certain embodiments, the second nucleotide sequence is inserted between nucleotides corresponding to about 31799 to 31821 of the Ad35 genome (SEQ ID NO: 41). In certain embodiments, the second nucleotide sequence is inserted between nucleotides corresponding to 31799 to 32810 of the Ad35 genome (SEQ ID NO: 41), or between nucleotides corresponding to 32810 to 31821 of the Ad35 genome (SEQ ID NO: 41).

[0018] In certain embodiments, the nucleotide sequence, the first nucleotide sequence and / or the second nucleotide sequence comprises at least one transgene. In certain embodiments, the nucleotide sequence further comprises a promoter, wherein the transgene is operably linked to the promoter.

[0019] In certain embodiments, the recombinant adenovirus comprises, in a 5' to 3' orientation: (i) a first polyadenylation signal; (ii) a promoter; (iii) a transgene; (iv) a second polyadenylation signal; and (v) a third polyadenylation signal; wherein the transgene is operably linked to the promoter. In some embodiments, the nucleotide sequence, the first nucleotide sequence and / or the second nucleotide sequence (comprising one or more transgenes) are inserted between the first polyadenylation signal and the third polyadenylation signal. In some embodiments, one or more transgenes are inserted between the first polyadenylation signal and the third polyadenylation signal. In certain embodiments, wherein the second polyadenylation signal is in the opposite transcriptional direction of the third polyadenylation signal.

[0020] In certain embodiments, the nucleotide sequence is inserted into the L5-E4 insertion site, and the first polyadenylation signal is the polyadenylation signal of the fiber (L5) gene, the second polyadenylation signal is the polyadenylation signal of the transgene, and the third polyadenylation signal is the polyadenylation signal of ORF6 or ORF6 / 7 of the adenovirus E4 gene. In certain embodiments, the nucleotide sequence is inserted into the IX-E2 insertion site, and the first polyadenylation signal is the polyadenylation signal of the IX gene, the second polyadenylation signal is the polyadenylation signal of the transgene, and the third polyadenylation signal is the polyadenylation signal of the adenovirus IVa2 gene.

[0021] In certain embodiments, the recombinant adenovirus comprises, in a 5' to 3' orientation: (i) a first polyadenylation signal; (ii) a second polyadenylation signal; (iii) a promoter; (iv) a transgene; (v) a third polyadenylation signal; and (vi) a fourth polyadenylation signal and the transgene are operably linked to the promoter. In some embodiments, the nucleotide sequence, the first nucleotide sequence, and / or the second nucleotide sequence (comprising one or more transgenes) are inserted between the first polyadenylation signal and the fourth polyadenylation signal. In some embodiments, one or more transgenes are inserted between the first polyadenylation signal and the fourth polyadenylation signal. In certain embodiments, wherein the second polyadenylation signal is in the opposite transcriptional direction of the first polyadenylation signal. In certain embodiments, wherein the fourth polyadenylation signal is in the opposite transcriptional direction of the third polyadenylation signal.

[0022] In certain embodiments, the nucleotide sequence is inserted into the L5-E4 insertion site, and the first polyadenylation signal is the polyadenylation signal of the fiber (L5) gene, the third polyadenylation signal is the polyadenylation signal of the transgene, and the fourth polyadenylation signal is the polyadenylation signal of ORF6 or ORF6 / 7 of the adenovirus E4 gene. In certain embodiments, the nucleotide sequence is inserted into the IX-E2 insertion site, the first polyadenylation signal is the polyadenylation signal of the IX gene, the third polyadenylation signal is the polyadenylation signal of the transgene, and the fourth polyadenylation signal is the polyadenylation signal of the adenovirus IVa2 gene.

[0023] In certain embodiments, the promoter is a ubiquitin promoter, a tissue-specific promoter, or a tumor-specific promoter.

[0024] In certain embodiments, the IX-E2 insertion site comprises a deletion of about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, or 60 nucleotides. In certain embodiments, the L5-E4 insertion site comprises a deletion of about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, or 130 nucleotides.

[0025] In certain embodiments, the nucleotide sequence further comprises a consensus Kozak sequence. In certain embodiments, the recombinant adenovirus comprises a partial or complete deletion of the nucleotide sequence encoding the adenovirus death protein (ADP).

[0026] In certain embodiments, the aforementioned recombinant adenovirus further comprises a nucleotide sequence inserted into the E1b-19K insertion site, the E3 insertion site, or the E4 insertion site. In certain embodiments, the E1b-19K insertion site is located between the start site of Elb-19K and the start site of Elb-55K. In certain embodiments, the E1b-19K insertion site is located between the start site of Elb-19K and the stop codon of Elb-19K. In certain embodiments, the E3 insertion site is located between the stop codon of the adenovirus pVIII gene and the start site of the adenovirus fiber gene.

[0027] In certain embodiments, the E1b-19K insertion site comprises a deletion of about 100 to about 305, about 100 to about 300, about 100 to about 250, about 100 to about 200, about 100 to about 150, about 150 to about 305, about 150 to about 300, about 150 to about 250, or about 150 to about 200 nucleotides adjacent to the start site of E1b-19K. In certain embodiments, the E1b-19K insertion site comprises a deletion of about 200 nucleotides (e.g., 202 nucleotides) adjacent to the start site of E1b-19K. In certain embodiments, the E1b-19K insertion site comprises a deletion of nucleotides 1714-1917 corresponding to the Ad5 genome (SEQ ID NO: 1), or the first therapeutic transgene is inserted between nucleotides 1714 and 1917 corresponding to the Ad5 genome (SEQ ID NO: 1). In certain embodiments, the first therapeutic transgene is inserted between CTGACCTC (SEQ ID NO:3) and TCACCAGG (SEQ ID NO:2), for example, the recombinant adenovirus comprises CTGACCTC (SEQ ID NO:3), the first therapeutic transgene, and TCACCAGG (SEQ ID NO:2) in a 5' to 3' orientation.

[0028] In certain embodiments, the E3 insertion site comprises a deletion of about 500 to about 3185, about 500 to about 3000, about 500 to about 2500, about 500 to about 2000, about 500 to about 1500, about 500 to about 1000, about 1000 to about 3185, about 1000 to about 3000, about 1000 to about 2500, about 1000 to about 2000, about 1000 to about 1500, about 1500 to about 3185, about 1500 to about 3000, about 1500 to about 2000, about 2000 to about 3185, about 2000 to about 3000, about 2000 to about 2500, about 2500 to about 3185, about 2500 to about 3000, or about 3000 to about 3185 nucleotides. In certain embodiments, the E3 insertion site is located between the stop codon of E3-10.5K and the stop codon of E3-14.7K. In certain embodiments, the E3 insertion site comprises a deletion of about 500 to about 1551, about 500 to about 1500, about 500 to about 1000, about 1000 to about 1551, about 1000 to about 1500, or about 1500 to about 1551 nucleotides adjacent to the stop codon of E3-10.5K. In certain embodiments, the E3 insertion site comprises a deletion of about 1050 nucleotides adjacent to the stop codon of E3-10.5K, for example, the E3 insertion site comprises a deletion of 1063 nucleotides adjacent to the stop codon of E3-10.5K. In certain embodiments, the E3 insertion site comprises a deletion corresponding to the Ad5 dl309 E3 deletion. In certain embodiments, the E3 insertion site comprises a deletion corresponding to nucleotides 29773-30836 of the Ad5 genome (SEQ ID NO: 1), or the second therapeutic transgene is inserted between nucleotides 29773 to 30836 of the Ad5 genome (SEQ ID NO: 1). In certain embodiments, the E3 insertion site comprises a deletion corresponding to nucleotides 29119-30622 of the Ad35 genome (SEQ ID NO: 41).

[0029] In certain embodiments, the recombinant adenovirus comprises an E1a promoter with a deletion of a functional Pea3 binding site. For example, the virus may comprise a deletion of nucleotides corresponding to about -300 to about -250 nucleotides upstream of the E1a start site, or a deletion of nucleotides corresponding to about -305 to -255 nucleotides upstream of the E1a start site. In certain embodiments, the deletion comprises a deletion of nucleotides corresponding to 195-244 of the Ad5 genome (SEQ ID NO: 1) and / or the E1a promoter comprises the sequence GGTGTTTTGG (SEQ ID NO: 4).

[0030] In certain embodiments, the recombinant adenovirus comprises a modified TATA box-based promoter operably linked to a gene and / or a modified CAAT box-based promoter operably linked to a gene, wherein the modified TATA box-based promoter lacks a functional TATA box and allows for selective expression of the gene in hyperproliferative cells, wherein the modified CAAT box-based promoter lacks a functional CAAT box and allows for selective expression of the gene in hyperproliferative cells.

[0031] In certain embodiments, the modified TATA box-based promoter is an early gene promoter. In certain embodiments, the modified TATA box-based promoter is an E1a promoter, an E1b promoter or an E4 promoter. In certain embodiments, the modified TATA box-based promoter is an E1a promoter.

[0032] In certain embodiments, the modification contained in the modified TATA box-based promoter comprises a deletion of the entire TATA box. In certain embodiments, the recombinant adenovirus comprises a deletion of nucleotides corresponding to -27 to -24, -31 to -24, -44 to +54, or -146 to +54 of the E1a promoter. In certain embodiments, the deletion comprises a deletion of nucleotides corresponding to 472 to 475, 468 to 475, 455 to 552, or 353 to 552 of the Ad5 genome (SEQ ID NO: 1).

[0033] In certain embodiments, the recombinant adenovirus comprises a polynucleotide deletion that results in a virus comprising the following sequences: CTAGGACTG (SEQ ID NO:5), AGTGCCCG (SEQ ID NO:44), and / or TATTCCCG (SEQ ID NO:45).

[0034] In certain embodiments, the modified CAAT box-based promoter is an early gene promoter. In certain embodiments, the modified CAAT box-based promoter is an E1a promoter, an E1b promoter, or an E4 promoter. In certain embodiments, the modified CAAT box-based promoter is an E1a promoter.

[0035] In certain embodiments, the modifications comprised in the modified CAAT box-based promoter include deletion of the entire CAAT box.In certain embodiments, the recombinant adenovirus comprises a deletion of nucleotides corresponding to -76 to -68 of the E1a promoter.

[0036] In certain embodiments, the recombinant adenovirus comprises a deletion of nucleotides corresponding to 423 to 431 of the Ad5 genome (SEQ ID NO: 1). In certain embodiments, the recombinant adenovirus comprises a polynucleotide deletion resulting in a virus comprising the following sequence: TTCCGTGGCG (SEQ ID NO: 46). In certain embodiments, the recombinant adenovirus comprises a deletion of nucleotides corresponding to 477 to 484 of the Ad35 genome (SEQ ID NO: 41).

[0037] In certain embodiments, the inserted nucleotide sequence comprises a first nucleotide sequence comprising a first transgenic gene and a second nucleotide sequence comprising a second transgenic gene, wherein the first nucleotide sequence and the second nucleotide sequence are separated by a linker. In certain embodiments, the linker encodes a peptide that can be cut by one or more proteases. In certain embodiments, the linker encodes an internal ribosome entry site (IRES) or a self-cleaving 2A peptide. IRES can be, for example, selected from the group consisting of encephalomyocarditis virus IRES, hand, foot and mouth disease virus IRES and poliovirus IRES. In certain embodiments, wherein the nucleotide sequence is inserted into the IX-E2 insertion or L5-E4 insertion site, wherein the recombinant adenovirus further comprises a third nucleotide sequence, the third nucleotide sequence comprising a third transgenic inserted into the E1b-19K insertion site, the E3 insertion site or the E4 insertion site.

[0038] In certain embodiments, one or more of the nucleotide sequence, the first nucleotide sequence, the second nucleotide sequence, and the third nucleotide sequence comprises one or more transgenes.

[0039] In certain embodiments, one or more of the transgene, the first transgene, and the second transgene encodes a monomeric, dimeric, trimeric, tetrameric, or multimeric protein or portion thereof. In certain embodiments, one or more of the transgene, the first transgene, and / or the second transgene encodes an RNA having therapeutic activity. In certain embodiments, one or more of the transgene, the first transgene, and / or the second transgene encodes a fusion protein comprising at least one binding domain.

[0040] In some embodiments, one or more of the transgene, the first transgene, and the second transgene encode an immunomodulatory molecule. In some embodiments, the immunomodulatory molecule is a co-stimulatory ligand / cytokine or a cytokine receptor. In some embodiments, the immunomodulatory molecule is selected from the group consisting of IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-7, IL-10, IL-10trap, IL-10R, IL-12A / p35, IL-12B / p40, IL-15, IL-15 receptor fusion protein, IL-23A / p19, IL24, IL-27, IL-33, IL-35, IL-15, IL-15 receptor fusion protein, TGF-β, TGF-βtrap, IL-10trap, VEGF , indoleamine-2,3-dioxygenase (IDO), inducible T cell co-stimulatory ligand (ICOS-L), CD80, CD137L, TNF-α, IFN-α, IFN-β, IFN-γ or GM-CSF, GITR ligand (GITRL), OX40 ligand (OX40L), CD40 ligand (CD40L), drug-inducible CD40 (iCD40), CD154, CD70, CD86, CD137, CD137L, BORIS / CTCFL, TNFSF9, FGF, ICAM, podocalyxin, functional fragments thereof, and derivatives thereof.

[0041] In certain embodiments, one or more of the transgene, the first transgene, and the second transgene encode an antigen binding molecule. In certain embodiments, the antigen binding molecule is an anti-PD-1 antibody, an anti-TGF-β antibody, an anti-PD-L1 antibody, and an anti-CTLA-4 antibody or a functional fragment thereof.

[0042] In some embodiments, one or more of the transgene, the first transgene, and the second transgene encode an antigen or a ligand for the antigen. In some embodiments, the antigen is selected from the group consisting of CAIX, CEA, CD5, CD7, CD10, CD19, CD20, CD22, CD30, CD33, CD34, CD38, CD41, CD44, CD49f, CD56, CD74, CD80, CD133, CD138, cytomegalovirus (CMV) infected cell antigen, 4-1BB, EGP-2, EGP-40, EpCAM, erbB2, erbB3, erbB4, FBP, fetal acetylcholine receptor, KRAS, HPV E6, E7, BING-4, EphA3, calcium-activated chloride channel-2, cyclin B1, 9D7, Ep-CAM, PRAME, SSX-2, immature laminin receptor, folate receptor-a, telomerase, tyrosinase, melanin-A, NY-ESO-1, GD2, GD3, hTERT, IL13R-a2, x-light chain, KDR, LeY, LI cell adhesion molecule, MAGE-A1, MAGE-A3, MART1, MART2, MUC1, mesothelin, HER- 2 / neu, EGFRvIII, NKG2D ligand, NY-ES0-1, gp100, TRP-1 / -2, TRP-1 / -2, P polypeptide, MC1R, prostate-specific antigen, BRAF, androgen receptor, β-catenin, BRCA1 / 2, CDK4, CML66, fibronectin, p53, TGF-βRII, T cell receptor, carcinoembryonic antigen, 5T4, PSCA, PSMA, ROR1, TAG-72, VEGF-R2, WT-1, their functional fragments, and their derivatives.

[0043] In certain embodiments, one or more of the transgene, the first transgene, and the second transgene encode a toxin. In certain embodiments, the toxin is Pseudomonas exotoxin, ricin, or diphtheria toxin.

[0044] In certain embodiments, one or more of the transgene, the first transgene, and the second transgene encode an enzyme. In certain embodiments, the enzyme is selected from the group consisting of β-glucuronidase, β-galactosidase, β-glucosidase, carboxypeptidase, β-lactamase, esterase, metalloproteinase, relaxin, collagenase, streptokinase, arginase, NOS-2, fragments thereof, and derivatives thereof.

[0045] In certain embodiments, one or more of the transgene, the first transgene, and the second transgene encodes a cell cycle control agent, a growth factor, an anticoagulant, a prodrug activating gene, a tumor suppressor gene, an apoptosis gene, an antiplatelet agent, a coagulation factor, a cystic fibrosis transmembrane conductance regulator (CFTR) protein, a fragment thereof, or a derivative thereof.

[0046] In certain embodiments, one or more of the transgene, the first transgene, and the second transgene encodes angiostatin, endostatin, acetylcholine, DKK1 / Wnt, Ox40L, GITRL, secreted flagellin, thymidine kinase, a functional fragment thereof, or a derivative thereof.

[0047] In some embodiments, the recombinant adenovirus is oncolytic. In some embodiments, the recombinant adenovirus selectively replicates in hyperproliferative cells. In some embodiments, the recombinant adenovirus selectively expresses a transgene in hyperproliferative cells. In some embodiments, the hyperproliferative cells are tumor cells.

[0048] In another aspect, the present invention provides an isolated nucleotide sequence comprising any of the aforementioned recombinant adenovirus sequences, optionally wherein the nucleotide sequence is cDNA. In another aspect, the present invention provides an isolated vector comprising the adenovirus nucleotide sequence. In another aspect, the present invention provides an isolated cell comprising the adenovirus nucleotide sequence or the vector.

[0049] In another aspect, the present invention provides a method for inhibiting tumor cell proliferation, comprising exposing tumor cells to an effective amount of any of the aforementioned recombinant adenoviruses to inhibit the proliferation of tumor cells.

[0050] In another aspect, the present invention provides a method for treating a condition in a subject. In some embodiments, the condition is cancer. The method comprises administering to the subject an effective amount of a recombinant adenovirus described herein to treat the cancer disease in the subject.

[0051] In another aspect, the present invention provides a method of inhibiting tumor growth in a subject in need thereof, wherein the method comprises administering to the subject an effective amount of any of the aforementioned recombinant adenoviruses to inhibit tumor growth. In certain embodiments, the tumor is selected from the group consisting of melanoma, squamous cell carcinoma of the skin, basal cell carcinoma, head and neck tumors, breast tumors, anal tumors, cervical cancer, non-small cell lung cancer, mesothelioma, small cell lung tumors, renal cell carcinoma, prostate tumors, gastroesophageal tumors, colorectal tumors, testicular tumors, bladder tumors, ovarian tumors, hepatocellular carcinoma, bile duct cancer, brain tumors, endometrial tumors, neuroendocrine tumors, Merkel cell carcinoma, gastrointestinal stromal tumors, sarcomas, and pancreatic tumors.

[0052] In another aspect, the present invention provides a method of treating a disease or condition in a subject in need thereof, wherein the method comprises administering to the subject an effective amount of any of the aforementioned recombinant adenoviruses. In certain embodiments, the disease or condition is selected from the group consisting of infection, diabetic retinopathy, psoriasis, rheumatoid arthritis, endometriosis, macular degeneration disorders and benign growth disorders such as prostate hypertrophy and lipomas, vascular disease, cardiovascular disease, cirrhosis, connective tissue disease, tumors, vascular lesions, ulcerative lesions, inflammation, thrombosis, and neointimal formation.

[0053] In certain embodiments, the subject is a mammal. In certain embodiments, the subject is a human. In certain embodiments, the subject is a child. In certain embodiments, the subject is an adult.

[0054] In certain embodiments, the recombinant adenovirus is administered intramuscularly, intravenously, intraarterially, intratumorally, intradermally, by inhalation, transdermally, topically, by eye drops, intranasally, transmuscularly, and / or rectally.

[0055] In certain embodiments, the aforementioned method further comprises administering to the subject one or more treatments selected from the group consisting of surgery, radiotherapy, chemotherapy, immunotherapy, hormone therapy, and viral therapy.

[0056] In certain embodiments, the aforementioned method further comprises administering one or more checkpoint regulators to the subject. In certain embodiments, the immune checkpoint regulator is an inhibitor, antagonist or agonist of one or more molecules selected from the group consisting of PD-1, PD-L1, PD-L2, 2B4, TIGIT, LAG3, Tim3, BTLA, CD160, GITR, KIR, 4-1BB and CTLA4.

[0057] In another aspect, the present invention provides a pharmaceutical composition comprising any of the aforementioned recombinant adenoviruses and at least one pharmaceutically acceptable carrier or diluent.

[0058] In another aspect, the present invention provides a formulation for an adenovirus, comprising:

[0059] Any one or more of the foregoing recombinant adenoviruses;

[0060] at least one buffer;

[0061] at least one tension modifier;

[0062] at least one sugar or at least one stabilizer or both; and

[0063] wherein the pH of the formulation is within the range of about 7.0 and about 9.0.

[0064] In certain embodiments, the molar osmotic pressure concentration of any of the foregoing formulations is about 200 mOs / L to about 800 mOs / L. In certain embodiments, the recombinant adenovirus concentration of any of the foregoing formulations is about 1 x 10 7 vp / mL to 1x 10 13 vp / mL.

[0065] These and other aspects and advantages of the present invention are illustrated by the following figures, detailed description and claims. Sequence Listing <110> EpicentRx, Inc. Larson, Christopher Oronsky, Bryan Reid, Tony R. <120> Recombinant adenovirus carrying a transgene <130> EPRX-002 / 01WO 330096-2019 <150> US 62 / 511,822 <151> 2017-05-26 <160> 46 <170> PatentIn version 3.5 <210> 1 <211> 35938 <212> DNA <213> Human adenovirus 5 <400> 1 catcatcaat aatatacctt attttggatt gaagccaata tgataatgag ggggtggagt 60 ttgtgacgtg gcgcggggcg tgggaacggg gcgggtgacg tagtagtgtg gcggaagtgt 120 gatgttgcaa gtgtggcgga acacatgtaa gcgacggatg tggcaaaagt gacgtttttg 180 gtgtgcgccg gtgtacacag gaagtgacaa ttttcgcgcg gttttaggcg gatgttgtag 240 <h2 style=";text-align:left;direction:ltr">taaatttggg cgtaaccgag taagatttgg ccattttcgc gggaaaactg aataagagga 300<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> agtgaaatct gaataatttt gtgttactca tagcgcgtaa tatttgtcta gggccgcggg 360<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> gactttgacc gtttacgtgg agactcgccc aggtgttttt ctcaggtgtt ttccgcgttc 420<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> cgggtcaaag ttggcgtttt attattatag tcagctgacg tgtagtgtat ttatacccgg 480<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> tgagttcctc aagaggccac tcttgagtgc cagcgagtag agttttctcc tccgagccgc 540<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> tccgacaccg ggactgaaaa tgagacatat tatctgccac ggaggtgtta ttaccgaaga 600<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> aatggccgcc agtcttttgg accagctgat cgaagaggta ctggctgata atcttccacc 660<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> tcctagccat tttgaaccac ctacccttca cgaactgtat gatttagacg tgacggcccc 720<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> cgaagatccc aacgaggagg cggtttcgca gatttttccc gactctgtaa tgttggcggt 780<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> gcaggaaggg attgacttac tcacttttcc gccggcgccc ggttctccgg agccgcctca 840<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> cctttcccgg cagcccgagc agccggagca gagagccttg ggtccggttt ctatgccaaa 900<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> ccttgtaccg gaggtgatcg atcttacctg ccacgaggct ggctttccac ccagtgacga 960<h2 style=";text-align:left;direction:ltr"> cgaggatgaa gagggtgagg agtttgtgtt agattgtg gagcaccccg ggcacggttg 1020 caggtcttgt cattatcacc ggaggaatac gggggaccca gatttatgt gttcgctttg 1080 ctatatgagg acctgtggca tgtttgtcta cagtaagtga aaattatggg cagtgggtga 1140 tagtggtg ggtttggtgt ggtaattttt ttttaattt tacagtttt gtggtttaaa 1200 gattttgta ttgtgatttt ttaaaggt cctgtgtctg aacctgagcc tgagcccgag 1260 ccagaaccgg agcctgcaag acctacccgc cgtcctaaaa tgcgcctgc tatcctgaga 1320 cgcccgacat cacctgtgtc tagagaatgc atagtagta cggatagctg tgactccggt 1380 ccttctaacacctcctga gatacccg gtgtcccgc tgtgcccat taaaccagtt 1440 gccgtgagag tggtgggcg tcgccaggct gtggaatgta tcgactt gcttaacgag 1500 cctgggcaac ctttggactt gagctgtaaa cgccccaggc cataggtgt aaacctgtga 1560 ttgcgtgtgt ggttaacgcc ttgtttgct gatgagttg atgtaagtttt aaaagggt 1620 gagataatgt ttaacttgca tggcgtgtta aatggggcgg ggcttaagg gtataatg 1680 cgccgtgggc taatctttggt tacatctgac ctcatggagg cttgggagtg tttggagat 1740 1800 tttctgtggg gctcatccca ggcaagtta gtctgcagaa tttaggagga ttacaagtgg 1860 gatttgaag agcttttga atcctgtggt gagctgttg attctttgaa tctggtcac 1920 caggcgcttt tccagagaa ggtcatcaag actttggatt ttccacacc ggggcgcgct 1980 gcggctgctg ttgctttt gagttttatta aaggataaat ggagcgaaga aacccatctg 2040 agcggggggt acctgctgga ttttctggcc atgcatctgt ggagagcggt tgtgagacac 2100 aagaatcgcc tgctactgtt gtcttccgtc cgcccggcga taataccgac ggaggagcag 2160 cagcagcagc agggaagc caggcggcgg cggcaggagc agagcccatg gaacccgaga 2220 gccggcctgg accctcggga atgaatgttg tacaggtggc tgaactgtat ccagaactga 2280 gacgcatttt gaattaca gaggatgggc aggggctaaa gggggtaag agggagcgggg 2340 gggcttgtga gggctacagag gaggctagga atctagcttt tagcttaatg accagacacc 2400 gtcctgagtg tattacttt ciacagatca aggatattg cgctaatgag cttgatctgc 2460 tggcgcagaa gtattccata gagcagctga ccacttactg gctgcagcca ggggatgatt 2520 ttgaggaggc tattaggta tatgcaagg tggcacttag gccagattgc aagtacaaga 2580 tcagcaact tgtaatatc aggaattgtt gctacattc tgggaacggg gccgaggtgg 2640 agatagatac ggaggatagg gtggccttta gatgtagcat gataatatg tggccgggggg 2700 tgcttggcat ggacggggtg gttattatga atgtaggtt tactggcccc aattttagcg 2760 gtacggtttt cctggccaat accacctta tcctacacgg tgtaagcttc tatggtttta 2820 acaatacctg tgtggaagcc tggaccgatg taagggttcg gggctgtgcc ttttactgct 2880 gctggaaggg gtggtgtgt cgccccaaaa gcaggctc aattaagaaa tgcctcttg 2940 aaagtgtac cttgggtatc ctgtctgagg gtactccag ggtgcgccac aatgtggcct 3000 ccgactgtgg ttgctcatg ctagtgaaaa gcgtggctgt gattaagcat aacatggtat 3060 gtggcaactg cgaggacagg gcctcaga tgctgacctg ctcggacggc aactgtcacc 3120 <h2 style=";text-align:left;direction:ltr">tgctgaagac cattcacgta gccagccact ctcgcaaggc ctggccagtg tttgagcata 3180<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> acatactgac ccgctgttcc ttgcatttgg gtaacaggg gggggtgttc ctaccttacc 3240<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> aatgcaattt gagtcacact aagatattgc ttgagcccga gagcatgtcc aaggtgaacc 3300<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> tgaacggggt gtttgacatg accatgaaga tctggaaggt gctgaggtac gatgagaccc 3360<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> gcaccaggtg cagaccctgc gagtgtggcg gtaaacatat taggaaccag cctgtgatgc 3420<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> tggatgtgac cgaggagctg aggcccgatc acttggtgct ggcctgcacc cgcgctgagt 3480<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> ttggctctag cgatgaagat acagattgag gtactgaaat gtgtgggcgt ggcttaaggg 3540<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> tgggaaagaa tatataaggt gggggtctta tgtagttttg tatctgtttt gcagcagccg 3600<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> ccgccgccat gagcaccaac tcgtttgatg gaagcattgt gagctcatat ttgacaacgc 3660<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> gcatgccccc atgggccggg gtgcgtcaga atgtgatggg ctccagcatt gatggtcgcc 3720<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> ccgtcctgcc cgcaaactct actaccttga cctacgagac cgtgtctgga acgccgttgg 3780<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> agactgcagc ctccgccgcc gcttcagccg ctgcagccac cgcccgcggg attgtgactg 3840<h2 style=";text-align:left;direction:ltr"> actttgcttt cctgagcccg cttgcaagca gtgcagcttc ccgttcatcc gcccgcgatg 3900 acaagttgac ggctcttttg gcacaattgg attctttgac ccgggaactt aatgtcgttt 3960 ctcagcagct gttggatctg cgccagcagg tttctgccct gaaggcttcc tcccctccca 4020 atgcggttta aaacataaat aaaaaaccag actctgtttg gatttggatc aagcaagtgt 4080 cttgctgtct ttatttaggg gttttgcgcg cgcggtaggc ccgggaccag cggtctcggt 4140 cgttgagggt cctgtgtatt ttttccagga cgtggtaaag gtgactctgg atgttcagat 4200 acatgggcat aagcccgtct ctggggtgga ggtagcacca ctgcagagct tcatgctgcg 4260 gggtggtgtt gtagatgatc cagtcgtagc aggagcgctg ggcgtggtgc ctaaaaatgt 4320 ctttcagtag caagctgatt gccaggggca ggcccttggt gtaagtgttt acaaagcggt 4380 taagctggga tgggtgcata cgtggggata tgagatgcat cttggactgt atttttaggt 4440 tggctatgtt cccagccata tccctccggg gattcatgtt gtgcagaacc accagcacag 4500 tgtatccggt gcacttggga aatttgtcat gtagcttaga aggaaatgcg tggaagaact 4560 tggagacgcc cttgtgacct ccaagatttt ccatgcattc gtccataatg atggcaatgg 4620 gcccacgggc ggcggcctgg gcgaagatat ttctgggatc actaacgtca tagttgtgtt 4680 ccaggatgag atcgtcatag gccattttta caaagcgcgg gcggagggtg ccagactgcg 4740 gtataatggt tccatccggc ccaggggcgt agttaccctc acagatttgc atttcccacg 4800 ctttgagttc agatgggggg atcatgtcta cctgcggggc gatgaagaaa acggtttccg 4860 gggtagggga gatcagctgg gaagaaagca ggttcctgag cagctgcgac ttaccgcagc 4920 cggtgggccc gtaaatcaca cctattaccg ggtgcaactg gtagttaaga gagctgcagc 4980 tgccgtcatc cctgagcagg ggggccactt cgttaagcat gtccctgact cgcatgtttt 5040 ccctgaccaa atccgccaga aggcgctcgc cgcccagcga tagcagttct tgcaaggaag 5100 caaagttttt caacggtttg agaccgtccg ccgtaggcat gcttttgagc gtttgaccaa 5160 gcagttccag gcggtcccac agctcggtca cctgctctac ggcatctcga tccagcatat 5220 ctcctcgttt cgcgggttgg ggcggctttc gctgtacggc agtagtcggt gctcgtccag 5280 acgggccagg gtcatgtctt tccacgggcg cagggtcctc gtcagcgtag tctgggtcac 5340 ggtgaagggg tgcgctccgg gctgcgcgct ggccagggtg cgcttgaggc tggtcctgct 5400 ggtgctgaag cgctgccggt cttcgccctg cgcgtcggcc aggtagcatt tgaccatggt 5460 gtcatagtcc agcccctccg cggcgtggcc cttggcgcgc agcttgccct tggaggaggc 5520 gccgcacgag gggcagtgca gacttttgag ggcgtagagc ttgggcgcga gaaataccga 5580 ttccggggag taggcatccg cgccgcaggc cccgcagacg gtctcgcatt ccacgagcca 5640 ggtgagctct ggccgttcgg ggtcaaaaac caggtttccc ccatgctttt tgatgcgttt 5700 cttacctctg gtttccatga gccggtgtcc acgctcggtg acgaaaaggc tgtccgtgtc 5760 cccgtataca gacttgagag gcctgtcctc gagcggtgtt ccgcggtcct cctcgtatag 5820 aaactcggac cactctgaga caaaggctcg cgtccaggcc agcacgaagg aggctaagtg 5880 ggaggggtag cggtcgttgt ccactagggg gtccactcgc tccagggtgt gaagacacat 5940 gtcgccctct tcggcatcaa ggaaggtgat tggtttgtag gtgtaggcca cgtgaccggg 6000 tgttcctgaa ggggggctat aaaagggggt gggggcgcgt tcgtcctcac tctcttccgc 6060 atcgctgtct gcgagggcca gctgttgggg tgagtactcc ctctgaaaag cgggcatgac 6120 ttctgcgcta agattgtcag tttccaaaaa cgaggaggat ttgatattca cctggcccgc 6180 ggtgatgcct ttgagggtgg ccgcatccat ctggtcagaa aagacaatct ttttgttgtc 6240 aagcttggtg gcaaacgacc cgtagagggc gttggacagc aacttggcga tggagcgcag 6300 ggtttggttt ttgtcgcgat cggcgcgctc cttggccgcg atgtttagct gcacgtattc 6360 gcgcgcaacg caccgccatt cgggaaagac ggtggtgcgc tcgtcgggca ccaggtgcac 6420 gcgccaaccg cggttgtgca gggtgacaag gtcaacgctg gtggctacct ctccgcgtag 6480 gcgctcgttg gtccagcaga ggcggccgcc cttgcgcgag cagaatggcg gtagggggtc 6540 tagctgcgtc tcgtccgggg ggtctgcgtc cacggtaaag accccgggca gcaggcgcgc 6600 gtcgaagtag tctatcttgc atccttgcaa gtctagcgcc tgctgccatg cgcgggcggc 6660 aagcgcgcgc tcgtatgggt tgagtggggg accccatggc atggggtggg tgagcgcgga 6720 ggcgtacatg ccgcaaatgt cgtaaacgta gaggggctct ctgagtattc caagatatgt 6780 agggtagcat cttccaccgc ggatgctggc gcgcacgtaa tcgtatagtt cgtgcgaggg 6840 agcgaggagg tcgggaccga ggttgctacg ggcgggctgc tctgctcgga agactatctg 6900 cctgaagatg gcatgtgagt tggatgatat ggttggacgc tggaagacgt tgaagctggc 6960 gtctgtgaga cctaccgcgt cacgcacgaa ggaggcgtag gagtcgcgca gcttgttgac 7020 cagctcggcg gtgacctgca cgtctagggc gcagtagtcc agggtttcct tgatgatgtc 7080 atacttatcc tgtccctttt ttttccacag ctcgcggttg aggacaaact cttcgcggtc 7140 tttccagtac tcttggatcg gaaacccgtc ggcctccgaa cggtaagagc ctagcatgta 7200 gaactggttg acggcctggt aggcgcagca tcccttttct acgggtagcg cgtatgcctg 7260 cgcggccttc cggagcgagg tgtgggtgag cgcaaaggtg tccctgacca tgactttgag 7320 gtactggtat ttgaagtcag tgtcgtcgca tccgccctgc tcccagagca aaaagtccgt 7380 gcgctttttg gaacgcggat ttggcagggc gaaggtgaca tcgttgaaga gtatctttcc 7440 cgcgcgaggc ataaagttgc gtgtgatgcg gaagggtccc ggcacctcgg aacggttgtt 7500 aattacctgg gcggcgagca cgatctcgtc aaagccgttg atgttgtggc ccacaatgta 7560 aagttccaag aagcgcggga tgcccttgat ggaaggcaat tttttaagtt cctcgtaggt 7620 gagctcttca ggggagctga gcccgtgctc tgaaagggcc cagtctgcaa gatgagggtt 7680 ggaagcgacg aatgagctcc acaggtcacg ggccattagc atttgcaggt ggtcgcgaaa 7740 ggtcctaaac tggcgaccta tggccatttt ttctggggtg atgcagtaga aggtaagcgg 7800 gtcttgttcc cagcggtccc atccaaggtt cgcggctagg tctcgcgcgg cagtcactag 7860 aggctcatct ccgccgaact tcatgaccag catgaagggc acgagctgct tcccaaaggc 7920 ccccatccaa gtataggtct ctacatcgta ggtgacaaag agacgctcgg tgcgaggatg 7980 cgagccgatc gggaagaact ggatctcccg ccaccaattg gaggagtggc tattgatgtg 8040 gtgaaagtag aagtccctgc gacgggccga acactcgtgc tggcttttgt aaaaacgtgc 8100 gcagtactgg cagcggtgca cgggctgtac atcctgcacg aggttgacct gacgaccgcg 8160 cacaaggaag cagagtggga atttgagccc ctcgcctggc gggtttggct ggtggtcttc 8220 tacttcggct gcttgtcctt gaccgtctgg ctgctcgagg ggagttacgg tggatcggac 8280 caccacgccg cgcgagccca aagtccagat gtccgcgcgc ggcggtcgga gcttgatgac 8340 aacatcgcgc agatgggagc tgtccatggt ctggagctcc cgcggcgtca ggtcaggcgg 8400 gagctcctgc aggtttacct cgcatagacg ggtcagggcg cgggctagat ccaggtgata 8460 cctaatttcc aggggctggt tggtggcggc gtcgatggct tgcaagaggc cgcatccccg 8520 cggcgcgact acggtaccgc gcggcgggcg gtgggccgcg ggggtgtcct tggatgatgc 8580 atctaaaagc ggtgacgcgg gcgagccccc ggaggtaggg ggggctccgg acccgccggg 8640 agagggggca ggggcacgtc ggcgccgcgc gcgggcagga gctggtgctg cgcgcgtagg 8700 ttgctggcga acgcgacgac gcggcggttg atctcctgaa tctggcgcct ctgcgtgaag 8760 acgacgggcc cggtgagctt gagcctgaaa gagagttcga cagaatcaat ttcggtgtcg 8820 ttgacggcgg cctggcgcaa aatctcctgc acgtctcctg agttgtcttg ataggcgatc 8880 tcggccatga actgctcgat ctcttctcc tggagatctc cgcgtccggc tcgctccacg 8940 gtggcggcga ggtcgttgga aatgcgggcc atgagctgcg agaaggcgtt gaggcctccc 9000 tcgttccaga cgcggctgta gaccacgcc ccttcggcat cgcgggcgcg catgaccacc 9060 tgcgcgagat tgagctccac gtgccgggcg aagacggcgt agtttcgcag gcgctgaaag 9120 aggtagttga gggtggtggc ggtgtgttct gccacgaaga agtacataac ccagcgtcgc 9180 aacgtggatt cgttgatatc ccccaaggcc tcaaggcgct ccatggcctc gtagaagtcc 9240 acggcgaagt tgaaaaactg ggagttgcgc gccgacacgg ttaactctc ctccagaaga 9300 cggatgagct cggcgacagt gtcgcgcacc tcgcgctcaa aggctacagg ggcctcttct 9360 tcttcttcaa tctctcttc cataagggcc tccccttctt cttcttctgg cggcggtggg 9420 ggagggggga cacggcggcg acgacggcgc accgggaggc ggtcgacaaa gcgctcgatc 9480 atctccccgc ggcgacggcg catggtctcg gtgacggcgc ggccgttctc gcgggggcgc 9540 agttggaaga cgccgccccgt catgtcccgg ttatgggttg gcggggggct gccatgcggc 9600 agggatacgg cgctacgat gcatctcaac aattgttgtg taggtactcc gccgccgagg 9660 gacctgagcg agtccgcatc gaccggatcg gaaaacctct cgagaaaggc gtctaaccag tcacagtcgc aaggtaggct gagcaccgtg gcggggcggca gcggggcggcg gtcggggttg 9780 tttctggcgg aggtgctgct gatgatgtaa ttaaagtagg cggtcttgag acggcggatg 9840 gtcgacagaa gcaccatgtc cttgggtccg gcctgctgaa tgcgcaggcg gtcggccatg ccccaggctt cgttttgaca tcggcgcagg tctttgtagt agtcttgcat gagcctttct accggcactt cttcttctcc ttcctcttgt cctgcatctc ttgcatctat cgctgcggcg 10020 gcggcggagt ttggccgtag gtggcgccct cttcctccca tgcgtgtgac cccgaagccc 10080 ctcatcggct gaagcagggc taggtcggcg acaacgcgct cggctatat ggcctgctgc acctgcgtga gggtagactg gaagtcatcc atgtccacaa agcggtggta tgcgcccgtg ttgatggtgt aagtgcagtt ggccataacg gaccagttaa cggtctggtg acccggctgc gagagctcgg tgtacctgag acgcgagtaa gccctcgagt caatacgta gtcgttgcaa gtccgcacca ggtactggta tcccaccaaa aagtgcggcg gcggctggcg gtagaggggc 10380 cagcgtaggg tggccggggc tccgggggcg agatcttcca acataaggcg atgatatccg 10440 tagatgtacc tggacatcca ggtgatgccg gcggcggtgg tggaggcgcg cggaaagtcg 10500 cggacgcggt tccagatgtt gcgcagcggc aaaaagtgct ccatggtcgg gacgctctgg 10560 ccggtcaggc gcgcgcaatc gttgacgctc tagaccgtgc aaaaggagag cctgtaagcg 10620 ggcactcttc cgtggtctgg tggataaatt cgcaagggta tcatggcgga cgaccggggt 10680 tcgagccccg tatccggccg tccgccgtga tccatgcggt taccgcccgc gtgtcgaacc 10740 caggtgtgcg acgtcagaca acgggggagt gctccttttg gcttccttcc aggcgcggcg 10800 gctgctgcgc tagctttttt ggccactggc cgcgcgcagc gtaagcggtt aggctggaaa 10860 gcgaaagcat taagtggctc gctccctgta gccggagggt tattttccaa gggttgagtc 10920 gcgggacccc cggttcgagt ctcggaccgg ccggactgcg gcgaacgggg gtttgcctcc 10980 ccgtcatgca agaccccgct tgcaaattcc tccggaaaca gggacgagcc ccttttttgc 11040 tttcccaga tgcatccggt gctgcggcag atgcgccccc ctcctcagca gcggcaagag 11100 caagagcagc ggcagacatg cagggcaccc tccctcctc ctaccgcgtc aggaggggcg 11160 acatccgcgg ttgacgcggc agcagatggt gattacgaac ccccgcggcg ccgggcccgg 11220 cactacctgg acttggagga gggcgagggc ctggcgcggc taggagcgcc ctctcctgag 11280 cggtacccaa gggtgcagct gaagcgtgat acgcgtgagg cgtacgtgcc gcggcagaac 11340 ctgtttcgcg accgcgaggg agaggagccc gaggagatgc gggatcgaaa gttccacgca 11400 gggcgcgagc tgcggcatgg cctgaatcgc gagcggttgc tgcgcgagga ggactttgag 11460 cccgacgcgc gaaccgggat tagtcccgcg cgcgcacacg tggcggccgc cgacctggta 11520 accgcatacg agcagacggt gaaccaggag attaactttc aaaaaagctt taacaaccac 11580 gtgcgtacgc ttgtggcgcg cgaggaggtg gctataggac tgatgcatct gtgggacttt 11640 gtaagcgcgc tggagcaaaa cccaaatagc aagccgctca tggcgcagct gttccttata 11700 gtgcagcaca gcagggacaa cgaggcattc agggatgcgc tgctaaacat agtagagccc 11760 gagggccgct ggctgctcga tttgataaac atcctgcaga gcatagtggt gcaggagcgc 11820 agcttgagcc tggctgacaa ggtggccgcc atcaactatt ccatgcttag cctgggcaag 11880 ttttacgccc gcaagatata ccatacccct tacgttccca tagacaagga ggtaaagatc 11940 gaggggttct acatgcgcat ggcgctgaag gtgcttacct tgagcgacga cctgggcgtt 12000 tatcgcaacg agcgcatcca caaggccgtg agcgtgagcc ggcggcgcga gctcagcgac 12060 cgcgagctga tgcacagcct gcaaagggcc ctggctggca cgggcagcgg cgatagagag 12120 gccgagtcct actttgacgc gggcgctgac ctgcgctggg ccccaagccg acgcgccctg 12180 gaggcagctg gggccggacc tgggctggcg gtggcacccg cgcgcgctgg caacgtcggc 12240 ggcgtggagg aatatgacga ggacgatgag tacgagccag aggacggcga gtactaagcg 12300 gtgatgtttc tgatcagatg atgcaagacg caacggaccc ggcggtgcgg gcggcgctgc 12360 agagccagcc gtccggcctt aactccacgg acgactggcg ccaggtcatg gaccgcatca 12420 tgtcgctgac tgcgcgcaat cctgacgcgt tccggcagca gccgcaggcc aaccggctct 12480 ccgcaattct ggaagcggtg gtcccggcgc gcgcaaaccc cacgcacgag aaggtgctgg 12540 cgatcgtaaa cgcgctggcc gaaaacaggg ccatccggcc cgacgaggcc ggcctggtct 12600 acgacgcgct gcttcagcgc gtggctcgtt acaacagcgg caacgtgcag accaacctgg 12660 accggctggt gggggatgtg cgcgaggccg tggcgcagcg tgagcgcgcg cagcagcagg 12720 gcaacctggg ctccatggtt gcactaaacg ccttcctgag tacacagccc gccaacgtgc 12780 cgcggggaca ggaggactac accaactttg tgagcgcact gcggctaatg gtgactgaga 12840 caccgcaaag tgaggtgtac cagtctgggc cagactattt tttccagacc agtagacaag 12900 gcctgcagac cgtaaacctg agccaggctt tcaaaaactt gcaggggctg tggggggtgc 12960 gggctcccac aggcgaccgc gcgaccgtgt ctagcttgct gacgcccaac tcgcgcctgt 13020 tgctgctgct aatagcgccc ttcacggaca gtggcagcgt gtcccgggac acatacctag 13080 gtcacttgct gacactgtac cgcgaggcca taggtcaggc gcatgtggac gagcatactt 13140 tccaggagat tacaagtgtc agccgcgcgc tggggcagga ggacacgggc agcctggagg 13200 caaccctaaa ctacctgctg accaaccggc ggcagaagat cccctcgttg cacagtttaa 13260 acagcgaga ggagcgcatt ttgcgctacg tgcagcagag cgtgagcctt aacctgatgc 13320 gcgacggggt aacgcccagc gtggcgctgg acatgaccgc gcgcaacatg gaaccgggca 13380 tgtatgcctc aaaccggccg tttatcaacc gcctaatgga ctacttgcat cgcgcggccg 13440 ccgtgaaccc cgagtatttc accaatgcca tcttgaaccc gcactggcta ccgccccctg 13500 gtttctacac cggggattc gaggtgcccg aggtaacga tggattcctc tgggacgaca 13560 tagacgacag cgtgttttcc ccgcaaccgc agaccctgct agagttgcaa cagcgcgagc 13620 aggcagaggc ggcgctgcga aaggaaagct tccgcaggcc aagcagcttg tccgatctag 13680 gcgctgcggc cccgcggtca gatgctagta gcccatttcc aagcttgata gggtctctta 13740 ccagcactcg caccacccgc ccgcgcctgc tgggcgagga ggagtaccta aacaactcgc 13800 tgctgcagcc gcagcgcgaa aaaaacctgc ctccggcatt tcccaacaac gggatagaga 13860 gcctagtgga caagatgagt agatggaaga cgtacgcgca ggagcacagg gacgtgccag 13920 gcccgcgccc gcccacccgt cgtcaaaggc acgaccgtca gcggggtctg gtgtgggagg 13980 acgatgactc ggcagacgac agcagcgtcc tggatttggg agggagtggc aacccgtttg 14040 cgcaccttcg ccccaggctg gggagaatgt tttaaaaaaa aaaaagcatg atgcaaaata 14100 aaaaactcac caaggccatg gcaccgagcg ttggttttct tgtattcccc ttagtatgcg 14160 gcgcgcggcg atgtatgagg aaggtcctcc tccctcctac gagagtgtgg tgagcgcggc 14220 gccagtggcg gcggcgctgg gttctccctt cgatgctccc ctggacccgc cgtttgtgcc 14280 tccgcggtac ctgcggccta ccggggggag aaacagcatc cgttactctg agttggcacc 14340 cctattcgac accacccgtg tgtacctggt ggacaacaag tcaacggatg tggcatccct 14400 gaactaccag aacgaccaca gcaactttct gaccacggtc attcaaaaca atgactacag 14460 cccgggggag gcaagcacac agaccatcaa tcttgacgac cggtcgcact ggggcggcga cctgaaaacc atcctgcata ccaacatgcc aaatgtgaac gagttcatgt ttaccaata gtttaaggcg cgggtgatgg tgtcgcgctt gcctactaag gacaatcagg tggagctgaa atacgagtgg gtggagttca cgctgcccga gggcaactac tccgagacca tgaccataga ccttatgaac aacgcgatcg tggagcacta cttgaaagtg ggcagacaga acggggttct ggaaagcgac atcggggtaa agtttgacac ccgcaacttc agactggggt ttgaccccgt cactggtctt gtcatgcctg gggtatatac aaacgaagcc ttccatccag acatcatttt 14880 gctgccagga tgcggggtgg acttcaccca cagccgcctg agcaacttgt tgggcatccg caagcggcaa cccttccagg agggctttag gatcacctac gatgatctgg agggtggtaa cattcccgca ctgttggatg tggacgccta ccaggcgagc ttgaaagatg acaccgaaca gggcggggggt ggcgcaggcg gcagcaacag cagtggcagc ggcgcggaag agaactccaa cgcggcagcc gcggcaatgc agccggtgga ggacatgaac gatcatgcca ttcgcggcga caccttgcc acacgggctg aggagaagcg cgctgaggcc gaagcagcgg ccgaagctgc 15240 cgcccccgct gcgcaacccg aggtcgagaa gcctcagaag aaaccggtga tcaaacccct 15300 gacagaggac agcaagaaac gcagttacaa cctaataagc aatgacagca ccttcaccca 15360 gtaccgcagc tggtaccttg catacaacta cggcgaccct cagaccggaa tccgctcatg 15420 gaccctgctt tgcactcctg acgtaacctg cggctcggag caggtctact ggtcgttgcc 15480 agacatgatg caagaccccg tgaccttccg ctccacgcgc cagatcagca actttccggt 15540 ggtgggcgcc gagctgttgc ccgtgcactc caagagcttc tacaacgacc aggccgtcta 15600 ctcccaactc atccgccagt ttacctctct gacccacgtg ttcaatcgct ttcccgagaa 15660 ccagatttg gcgcgcccgc cagcccccac catcaccacc gtcagtgaaa acgttcctgc 15720 tctcacagat cacgggacgc taccgctgcg caacagcatc ggaggagtcc agcgagtgac 15780 cattactgac gccagacgcc gcacctgccc ctacgtttac aaggccctgg gcatagtctc 15840 gccgcgcgtc ctatcgagcc gcactttttg agcaagcatg tccatcctta tatcgcccag 15900 caataacaca ggctggggcc tgcgcttccc aagcaagatg tttggcgggg ccaagaagcg 15960 ctccgaccaa cacccagtgc gcgtgcgcgg gcactaccgc gcgccctggg gcgcgcacaa 16020 acgcggccgc actgggcgca ccaccgtcga tgacgccatc gacgcggtgg tggaggaggc 16080 gcgcaactac acgcccacgc cgccaccagt gtccacagtg gacgcggcca ttcagaccgt 16140 ggtgcgcgga gcccggcgct atgctaaaat gaagagacgg cggaggcgcg tagcacgtcg 16200 ccaccgccgc cgacccggca ctgccgccca acgcgcggcg gcggccctgc ttaaccgcgc 16260 acgtcgcacc ggccgacggg cggccatgcg ggccgctcga aggctggccg cgggtattgt 16320 cactgtgccc cccaggtcca ggcgacgagc ggccgccgca gcagccgcgg ccattagtgc 16380 tatgactcag ggtcgcaggg gcaacgtgta ttgggtgcgc gactcggtta gcggcctgcg 16440 cgtgcccgtg cgcacccgcc ccccgcgcaa ctagattgca agaaaaaact acttagactc 16500 gtactgttgt atgtatccag cggcggcggc gcgcaacgaa gctatgtcca agcgcaaaat 16560 caaagaagag atgctccagg tcatcgcgcc ggagatctat ggccccccga agaaggaaga 16620 gcaggattac aagccccgaa agctaaagcg ggtcaaaaag aaaaagaaag atgatgatga 16680 tgaacttgac gacgaggtgg aactgctgca cgctaccgcg cccaggcgac gggtacagtg 16740 gaaaggtcga cgcgtaaaac gtgttttgcg acccggcacc accgtagtct ttacgcccgg 16800 tgagcgctcc acccgcacct acaagcgcgt gtatgatgag gtgtacggcg acgaggacct 16860 gcttgagcag gccaacgagc gcctcgggga gtttgcctac ggaaagcggc ataaggacat 16920 gctggcgttg ccgctggacg agggcaaccc aacacctagc ctaaagcccg taacactgca 16980 gcaggtgctg cccgcgcttg caccgtccga agaaaagcgc ggcctaaagc gcgagtctgg 17040 tgacttggca cccaccgtgc agctgatggt acccaagcgc cagcgactgg aagatgtctt 17100 ggaaaaaatg accgtggaac ctgggctgga gcccgaggtc cgcgtgcggc caatcaagca 17160 ggtggcgccg ggactgggcg tgcagaccgt ggacgttcag atacccacta ccagtagcac 17220 cagtattgcc accgccacag agggcatgga gacacaaacg tccccggttg cctcagcggt 17280 ggcggatgcc gcggtgcagg cggtcgctgc ggccgcgtcc aagacctcta cggaggtgca 17340 aacggacccg tggatgtttc gcgtttcagc cccccggcgc ccgcgcggtt cgaggaagta 17400 cggcgccgcc agcgcgctac tgcccgaata tgccctacat ccttccattg cgcctacccc 17460 cggctatcgt ggctacacct accgccccag aagacgagca actacccgac gccgaaccac 17520 cactggaacc cgccgccgcc gtcgccgtcg ccagcccgtg ctggccccga tttccgtgcg 17580 cagggtggct cgcgaaggag gcaggaccct ggtgctgcca acagcgcgct accaccccag 17640 catcgtttaa aagccggtct ttgtggttct tgcagatatg gccctcacct gccgcctccg 17700 tttcccggtg ccgggattcc gaggaagaat gcaccgtagg aggggcatgg ccggccacgg 17760 cctgacgggc ggcatgcgtc gtgcgcacca ccggcggcgg cgcgcgtcgc accgtcgcat 17820 gcgcggcggt atcctgcccc tccttattcc actgatcgcc gcggcgattg gcgccgtgcc 17880 cggaattgca tccgtggcct tgcaggcgca gagacactga ttaaaaacaa gttgcatgtg 17940 gaaaaatcaa aataaaaagt ctggactctc acgctcgctt ggtcctgtaa ctattttgta 18000 gaatggaaga catcaacttt gcgtctctgg ccccgcgaca cggctcgcgc ccgttcatgg 18060 gaaactggca agatatcggc accagcaata tgagcggtgg cgccttcagc tggggctcgc 18120 tgtggagcgg cattaaaaat ttcggttcca ccgttaagaa ctatggcagc aaggcctgga 18180 acagcagcac aggccagatg ctgagggata agttgaaaga gcaaaatttc caacaaaagg 18240 tggtagatgg cctggcctct ggcattagcg gggtggtgga cctggccaac caggcagtgc 18300 aaaataagat taacagtaag cttgatcccc gccctcccgt agaggagcct ccaccggccg 18360 tggagacagt gtctccagag gggcgtggcg aaaagcgtcc gcgccccgac agggaagaaa 18420 ctctggtgac gcaatagac gagcctccct cgtacgagga ggcactaaag caaggcctgc 18480 ccaccacccg tcccatcgcg cccatggcta ccggagtgct gggccagcac acacccgtaa 18540 cgctggacct gcctcccccc gccgacaccc agcagaaacc tgtgctgcca ggcccgaccg 18600 ccgttgttgt aacccgtcct agccgcgcgt ccctgcgccg cgccgccagc ggtccgcgat 18660 cgttgcggcc cgtagccagt ggcaactggc aaagcacact gaacagcatc gtgggtctgg 18720 gggtgcaatc cctgaagcgc cgacgatgct tctgaatagc taacgtgtcg tatgtgtgtc 18780 atgtatgcgt ccatgtcgcc gccagaggag ctgctgagcc gccgcgcgcc cgctttccaa 18840 gatggctacc ccttcgatga tgccgcagtg gtcttacatg cacatctcgg gccaggacgc 18900 ctcggagtac ctgagccccg ggctggtgca gtttgcccgc gccaccgaga cgtacttcag 18960 cctgaataac aagtttagaa accccacggt ggcgcctacg cacgacgtga ccacagaccg 19020 gtcccagcgt ttgacgctgc ggttcatccc tgtggaccgt gaggatactg cgtactcgta 19080 caaggcgcgg ttcaccctag ctgtgggtga taaccgtgtg ctggacatgg cttccacgta 19140 ctttgacatc cgcggcgtgc tggacagggg ccctactttt aagccctact ctggcactgc 19200 ctacaacgcc ctggctccca agggtgcccc aaatccttgc gaatgggatg aagctgctac 19260 tgctcttgaa ataaacctag aagaagagga cgatgacaac gaagacgaag tagacgagca 19320 agctgagcag caaaaaactc acgtatttgg gcaggcgcct tattctggta taaatattac 19380 aaaggagggt attcaaatag gtgtcgaagg tcaaacacct aaatatgccg ataaaacatt 19440 tcaacctgaa cctcaaatag gagaatctca gtggtacgaa actgaaatta atcatgcagc 19500 tgggagagtc cttaaaaaga ctaccccaat gaaaccatgt tacggttcat atgcaaaacc 19560 cacaaatgaa aatggagggc aaggcattct tgtaaagcaa caaaatggaa agctagaaag 19620 tcaagtggaa atgcaatttt tctcaactac tgaggcgacc gcaggcaatg gtgataactt 19680 gactcctaaa gtggtattgt acagtgaaga tgtagatata gaaaccccag acactcatat 19740 ttcttacatg cccactatta aggaaggtaa ctcacgagaa ctaatgggcc aacaatctat 19800 gcccaacagg cctaattaca ttgcttttag ggacaatttt attggtctaa tgtattacaa 19860 cagcacgggt aatatgggtg ttctggcggg ccaagcatcg cagttgaatg ctgttgtaga 19920 tttgcaagac agaaacacag agctttcata ccagcttttg cttgattcca ttggtgatag 19980 aaccaggtac tttctatgt ggaatcaggc tgttgacagc tatgatccag atgttagaat 20040 tattgaaaat catggaactg aagatgaact tcaaattac tgctttccac tgggaggtgt 20100 gattaataca gagactctta ccaggtaaa acctaaaaca ggtcaggaaa atggatggga 20160 aaaagatgct acagaatttt cagataaaaa tgaaataga gttggaata attttgccat 20220 ggaaatcaat ctaaatgcca acctgtggag aaatttcctg tactccaca tagcgctgta 20280 tttgcccgac aagctaaagt acagtccttc caacgtaaaa atttctgata acccaacac 20340 ctacgactac atgacaagc gagtgtggc tcccgggtta gtggactgct acattaacct 20400 tggagcacgc tggtcccttg actatatgga caacgtcaac ccatttacc accaccgcaa 20460 tgctggcctg cgctaccgct caatgttgct gggcaatggt cgctatgtgc ccttccacat 20520 ccaggtgcct cagaagttct ttgccattaa aaacctcctt ctcctgccgg gctcatacac 20580 ctacgagtgg aacttcagga aggatgttaa catggttctg cagagctccc taggaatga 20640 cctaagggtt gacggagcca gcattaagtt tgatagcatt tgcctttacg ccaccttctt 20700 ccccatggcc cacaacaccg cctccacgct tgaggccatg cttagaaacg acaccaacga 20760 ccagtccttt aacgactatc tctccgccgc caacatgctc taccctatac ccgccaacgc 20820 taccaacgtg cccatatcca tcccctcccg caactgggcg gctttccgcg gctgggcctt 20880 cacgcgcctt aagactaagg aaaccccatc actgggctcg ggctacgacc cttattacac 20940 ctactctggc tctataccct acctagatgg aaccttttac ctcaaccaca cctttaagaa 21000 ggtggccatt acctttgact cttctgtcag ctggcctggc aatgaccgcc tgcttacccc 21060 caacgagttt gaaattaagc gctcagttga cggggagggt tacaacgttg cccagtgtaa 21120 catgaccaaa gactggttcc tggtacaaat gctagctaac tacaacattg gctaccaggg 21180 cttctatatc ccagagagct acaaggaccg catgtactcc ttctttagaa acttccagcc 21240 catgagccgt caggtggtgg atgatactaa atacaaggac taccaacagg tgggcatcct 21300 acaccaacac aacaactctg gatttgttgg ctaccttgcc cccaccatgc gcgaaggaca 21360 ggcctaccct gctaacttcc cctatccgct tataggcaag accgcagttg acagcattac 21420 ccagaaaaag tttctttgcg atcgcaccct ttggcgcatc ccattctcca gtaactttat 21480 gtccatgggc gcactcacag acctgggcca aaaccttctc tacgccaact ccgcccacgc 21540 gctagacatg acttttgagg tggatcccat ggacgagccc acccttcttt atgttttgtt 21600 tgaagtcttt gacgtggtcc gtgtgcaccg gccgcaccgc ggcgtcatcg aaaccgtgta 21660 cctgcgcacg cccttctcgg ccggcaacgc cacaacataa agaagcaagc aacatcaaca 21720 acagctgccg ccatgggctc cagtgagcag gaactgaaag ccattgtcaa agatcttggt 21780 tgtgggccat attttttggg cacctatgac aagcgctttc caggctttgt ttctccacac 21840 aagctcgcct gcgccatagt caatacggcc ggtcgcgaga ctgggggcgt acactggatg 21900 gcctttgcct ggaacccgca ctcaaaaaca tgctacctct ttgagccctt tggcttttct 21960 gaccagcgac tcaagcaggt ttaccagttt gagtacgagt cactcctgcg ccgtagcgcc 22020 attgcttctt cccccgaccg ctgtataacg ctggaaaagt ccacccaaag cgtacagggg 22080 cccaactcgg ccgcctgtgg actattctgc tgcatgtttc tccacgcctt tgccaactgg 22140 ccccaaactc ccatggatca caaccccacc atgaacctta ttaccggggt acccaactcc 22200 atgctcaaca gtccccaggt acagcccacc ctgcgtcgca accaggaaca gctctacagc 22260 ttcctggagc gccactcgcc ctacttccgc agccacagtg cgcagattag gagcgccact 22320 tctttttgtc acttgaaaaa catgtaaaaa taatgtacta gagacacttt caataaaggc 22380 aaatgctttt atttgtacac tctcgggtga ttatttaccc ccacccttgc cgtctgcgcc 22440 gtttaaaaat caaaggggtt ctgccgcgca tcgctatgcg ccactggcag ggacacgttg 22500 cgatactggt gtttagtgct ccacttaaac tcaggcacaa ccatccgcgg cagctcggtg 22560 aagttttcac tccacaggct gcgcaccatc accaacgcgt ttagcaggtc gggcgccgat 22620 atcttgaagt cgcagttggg gcctccgccc tgcgcgcgcg agttgcgata cacagggttg 22680 cagcactgga acactatcag cgccgggtgg tgcacgctgg ccagcacgct cttgtcggag 22740 atcagatccg cgtccaggtc ctccgcgttg ctcagggcga acggagtcaa ctttggtagc 22800 tgccttccca aaaagggcgc gtgcccaggc tttgagttgc actcgcaccg tagtggcatc 22860 aaaaggtgac cgtgcccggt ctgggcgtta ggatacagcg cctgcataaa agccttgatc 22920 tgcttaaaag ccacctgagc ctttgcgcct tcagagaaga acatgccgca agacttgccg 22980 gaaaactgat tggccggaca ggccgcgtcg tgcacgcagc accttgcgtc ggtgttggag 23040 atctgcacca catttcggcc ccaccggttc ttcacgatct tggccttgct agactgctcc 23100 ttcagcgcgc gctgcccgtt ttcgctcgtc acatccattt caatcacgtg ctccttattt 23160 atcataatgc ttccgtgtag acacttaagc tcgccttcga tctcagcgca gcggtgcagc 23220 cacaacgcgc agcccgtggg ctcgtgatgc ttgtaggtca cctctgcaaa cgactgcagg 23280 tacgcctgca ggaatcgccc catcatcgtc acaaaggtct tgttgctggt gaaggtcagc 23340 tgcaacccgc ggtgctcctc gttcagccag gtcttgcata cggccgccag agcttccact 23400 tggtcaggca gtagtttgaa gttcgccttt agatcgttat ccacgtggta cttgtccatc 23460 agcgcgcgcg cagcctccat gcccttctcc cacgcagaca cgatcggcac actcagcggg 23520 ttcatcaccg taatttcact ttccgcttcg ctgggctctt cctcttcctc ttgcgtccgc 23580 ataccacgcg ccactgggtc gtcttcattc agccgccgca ctgtgcgctt acctcctttg 23640 ccatgcttga ttagcaccgg tgggttgctg aaacccacca tttgtagcgc cacatcttct 23700 ctttcttcct cgctgtccac gattacctct ggtgatggcg ggcgctcggg cttgggagaa 23760 gggcgcttct ttttcttctt gggcgcaatg gccaaatccg ccgccgaggt cgatggccgc 23820 gggctgggtg tgcgcggcac cagcgcgtct tgtgatgagt cttcctcgtc ctcggactcg 23880 atacgccgcc tcatccgctt ttttgggggc gcccggggag gcggcggcga cggggacggg 23940 gacgacacgt cctccatggt tgggggacgt cgcgccgcac cgcgtccgcg ctcgggggtg 24000 gtttcgcgct gctcctcttc ccgactggcc atttccttct cctataggca gaaaaagatc 24060 atggagtcag tcgagaagaa ggacagccta accgccccct ctgagttcgc caccaccgcc 24120 tccaccgatg ccgccaacgc gcctaccacc ttccccgtcg aggcaccccc gcttgaggag 24180 gaggaagtga ttatcgagca ggacccaggt tttgtaagcg aagacgacga ggaccgctca 24240 gtaccaacag aggataaaaa gcaagaccag gacaacgcag aggcaaacga ggaacaagtc 24300 gggcgggggg acgaaaggca tggcgactac ctagatgtgg gagacgacgt gctgttgaag 24360 catctgcagc gccagtgcgc cattatctgc gacgcgttgc aagagcgcag cgatgtgccc 24420 ctcgccatag cggatgtcag ccttgcctac gaacgccacc tattctcacc gcgcgtaccc 24480 cccaaacgcc aagaaaacgg cacatgcgag cccaacccgc gcctcaactt ctaccccgta 24540 tttgccgtgc cagaggtgct tgccacctat cacatctttt tccaaaactg caagataccc 24600 ctatcctgcc gtgccaaccg cagccgagcg gacaagcagc tggccttgcg gcagggcgct 24660 gtcatacctg atatcgcctc gctcaacgaa gtgccaaaaa tctttgaggg tcttggacgc 24720 gacgagaagc gcgcggcaaa cgctctgcaa caggaaaaca gcgaaaatga aagtcactct 24780 ggagtgttgg tggaactcga gggtgacaac gcgcgcctag ccgtactaaa acgcagcatc 24840 gaggtcaccc actttgccta cccggcactt aacctacccc ccaaggtcat gagcacagtc 24900 atgagtgagc tgatcgtgcg ccgtgcgcag cccctggaga gggatgcaaa tttgcaagaa 24960 caaacagagg agggcctacc cgcagttggc gacgagcagc tagcgcgctg gcttcaaacg 25020 cgcgagcctg ccgacttgga ggagcgacgc aaactaatga tggccgcagt gctcgttacc 25080 gtggagcttg agtgcatgca gcggttcttt gctgacccgg agatgcagcg caagctagag 25140 gaaacattgc actacacctt tcgacagggc tacgtacgcc aggcctgcaa gatctccaac 25200 gtggagctct gcaacctggt ctcctacctt ggaattttgc acgaaaaccg ccttgggcaa 25260 aacgtgcttc attccacgct caagggcgag gcgcgccgcg actacgtccg cgactgcgtt 25320 tacttatttc tatgctacac ctggcagacg gccatgggcg tttggcagca gtgcttggag 25380 gagtgcaacc tcaaggagct gcagaaactg ctaaagcaaa acttgaagga cctatggacg 25440 gccttcaacg agcgctccgt ggccgcgcac ctggcggaca tcattttccc cgaacgcctg 25500 cttaaaaccc tgcaacaggg tctgccagac ttcaccagtc aaagcatgtt gcagaacttt 25560 aggaacttta tcctagagcg ctcaggaatc ttgcccgcca cctgctgtgc acttcctagc 25620 gactttgtgc ccattaagta ccgcgaatgc cctccgccgc tttggggcca ctgctacctt 25680 ctgcagctag ccaactacct tgcctaccac tctgacataa tggaagacgt gagcggtgac 25740 ggtctactgg agtgtcactg tcgctgcaac ctatgcaccc cgcaccgctc cctggtttgc 25800 aattcgcagc tgcttaacga aagtcaaatt atcggtacct ttgagctgca gggtccctcg 25860 cctgacgaaa agtccgcggc tccggggttg aaactcactc cggggctgtg gacgtcggct 25920 taccttcgca aatttgtacc tgaggactac cacgcccacg agattaggtt ctacgaagac 25980 caatcccgcc cgccaaatgc ggagcttacc gcctgcgtca ttacccaggg ccacattctt 26040 ggccaattgc aagccatcaa caaagcccgc caagagtttc tgctacgaaa gggacggggg 26100 gttacttg acccccagtc cggcgaggag ctcaacccaa tccccccgcc gccgcagcc 26160 tatcagcagc agccgcgggc ccttgcttcc caggatggca cccaaaaaga agctgcagct 26220 gccgccgcca cccacggacg aggaggata ctgggacagt caggcagagg aggttttgga cgaggag gaggacatga tggagactg gagagccta gacgaggag cttccgaggt cgaagaggtg tcagacgaaa caccgtcacc ctcggtcgca ttcccctcgc cggcgcccca gaaatcggca accggttcca gcatggctac aacctccgct cctcaggcgc cgccggcact gcccgttcgc cgacccaacc gtagatggga caccactgga accagggccg gtaagtccaa gcagccgccg ccgttagccc aagagcaaca acagcgccaa ggctaccgct catggcgcgg gcacaagaac gccatagttg cttgcttgca agactgtggg ggcaacatct ccttcgcccg ccgctttctt ctctaccatc acggcgtggc cttcccccgt aacatcctgc attackccg 26700. tcatctctac agcccatact gcaccggcgg cagcggcagc ggcagcaaca gcagcggcca cacagaagca aaggcgaccg gatagcaaga ctctgacaaa gcccaagaa tccacagcgg cggcagcagc rich gcgctgcgtc tggcgcccaa cgaacccgta tcgacccgcg agcttagaaa caggattttt cccactctgt atgctatatt tcaacagagc aggggccaag 26940 aacaagagct gaaaataaaa aacaggtctc tgcgatccct cacccgcagc tgcctgtatc 27000 acaaaagcga agatcagctt cggcgcacgc tggaagacgc ggaggctctc ttcagtaaat 27060 actgcgcgct gactcttaag gactagtttc gcgccctttc tcaaatttaa gcgcgaaaac 27120 tacgtcatct ccagcggcca cacccggcgc cagcacctgt cgtcagcgcc attatgagca 27180 aggaaattcc cacgccctac atgtggagtt accagccaca aatgggactt gcggctggag 27240 ctgcccaaga ctactcaacc cgaataaact acatgagcgc gggaccccac atgatatccc 27300 gggtcaacgg aatccgcgcc caccgaaacc gaattctctt ggaacaggcg gctattacca 27360 ccacacctcg tataacctt aatccccgta gttggcccgc tgccctggtg taccaggaaa 27420 gtcccgctcc caccactgtg gtacttccca gagacgccca ggccgaagtt cagatgacta 27480 actcaggggc gcagcttgcg ggcggctttc gtcacagggt gcggtcgccc gggcagggta 27540 taactcacct gacaatcaga gggcgaggta ttcagctcaa cgacgagtcg gtgagctcct 27600 cgcttggtct ccgtccggac gggacatttc agatcggcgg cgccggccgt ccttcattca 27660 cgcctcgtca ggcaatccta actctgcaga cctcgtcctc tgagccgcgc tctggaggca 27720 ttggaactct gcaatttatt gaggagtttg tgccatcggt ctactttaac cccttctcgg 27780 gacctcccgg ccactatccg gatcaattta ttcctaactt tgacgcggta aaggactcgg 27840 cggacggcta cgactgaatg ttaagtggag aggcagagca actgcgcctg aaacacctgg 27900 tccactgtcg ccgccacaag tgctttgccc gcgactccgg tgagttttgc tactttgaat 27960 tgcccgagga tcatatcgag ggcccggcgc acggcgtccg gcttaccgcc cagggagagc 28020 ttgcccgtag cctgattcgg gagtttaccc agcgccccct gctagttgag cgggacaggg 28080 gaccctgtgt tctcactgtg atttgcaact gtcctaacct tggattacat caagatcttt 28140 gttgccatct ctgtgctgag tataataaat acagaaatta aaatatactg gggctcctat 28200 cgccatcctg taaacgccac cgtcttcacc cgcccaagca aaccaaggcg aaccttacct 28260 ggtactttta acatctctcc ctctgtgatt tacaacagtt tcaacccaga cggagtgagt 28320 ctacgagaga acctctccga gctcagctac tccatcagaa aaaacaccac cctccttacc 28380 tgccgggaac gtacgagtgc gtcaccggcc gctgcaccac acctaccgcc tgaccgtaaa 28440 ccagactttt tccggacaga cctcaataac tctgtttacc agaacaggag gtgagcttag 28500 aaaaccctta gggtattagg ccaaaggcgc agctactgtg gggtttatga acaattcaag 28560 caactctacg ggctattcta attcaggttt ctctagaatc ggggttgggg ttattctctg 28620 tcttgtgatt ctctttattc ttatactaac gcttctctgc ctaaggctcg ccgcctgctg 28680 tgtgcacatt tgcatttatt gtcagctttt taaacgctgg ggtcgccacc caagatgatt 28740 aggtacataa tcctaggttt actcaccctt gcgtcagccc acggtaccac ccaaaaggtg 28800 gattttaagg agccagcctg taatgttaca ttcgcagctg aagctaatga gtgcaccact 28860 cttataaaat gcaccacaga acatgaaaag ctgcttattc gccacaaaaa caaaattggc 28920 aagtatgctg tttatgctat ttggcagcca ggtgacacta cagagtataa tgttacagtt 28980 ttccagggta aaagtcataa aacttttatg tatacttttc cattttatga aatgtgcgac 29040 attaccatgt acatgagcaa acagtataag ttgtggcccc cacaaaattg tgtggaaaac 29100 actggcactt tctgctgcac tgctatgcta attacagtgc tcgctttggt ctgtacccta 29160 ctctatatta aatacaaaag cagacgcagc tttattgagg aaaagaaaat gccttaattt 29220 actaagttac aaagctaatg tcaccactaa ctgctttact cgctgcttgc aaaacaaatt 29280 caaaaagtta gcattataat tagatagga tttaaacccc ccggtcattt cctgctcaat 29340 accattcccc tgaacaattg actctatgtg ggatatgctc cagcgctaca accttgaagt 29400 caggcttcct ggatgtcagc atctgacttt ggccagcacc tgtcccgcgg atttgttcca 29460 gtccaactac agcgacccac cctaacagag atgaccaaca caaccaacgc ggccgccgct 29520 accggactta catctaccac aaatacaccc caagtttctg cctttgtcaa taactgggat 29580 aacttgggca tgtggtggtt ctccatagcg cttatgtttg tatgccttat tattatgtgg 29640 ctcatctgct gcctaaagcg caaacgcgcc cgaccaccca tctatagtcc catcattgtg 29700 ctacacccaa acaatgatgg aatccataga ttggacggac tgaaacacat gttcttttct 29760 cttacagtat gattaaatga gacatgattc ctcgagtttt tatattactg acccttgttg 29820 cgcttttttg tgcgtgctcc acattggctg cggtttctca catcgaagta gactgcattc 29880 cagccttcac agtctatttg ctttacggat ttgtcaccct cacgctcatc tgcagcctca 29940 tcactgtggt catcgccttt atccagtgca ttgactgggt ctgtgtgcgc tttgcatatc 30000 tcagacacca tccccagtac agggacagga ctatagctga gcttcttaga attctttaat 30060 tatgaaattt actgtgactt ttctgctgat tatttgcacc ctatctgcgt tttgttcccc 30120 gacctccaag cctcaaagac atatatcatg cagattcact cgtatatgga atattccaag 30180 ttgctacaat gaaaaaagcg atctttccga agcctggtta tatgcaatca tctctgttat 30240 ggtgttctgc agtaccatct tagccctagc tatatatccc taccttgaca ttggctggaa 30300 acgaatagat gccatgaacc acccaacttt ccccgcgccc gctatgcttc cactgcaaca 30360 agttgttgcc ggcggctttg tcccagccaa tcagcctcgc cccacttctc ccacccccac 30420 tgaaatcagc tactttaatc taacaggagg agatgactga caccctagat ctagaaatgg 30480 acggaattat tacagagcag cgcctgctag aaagacgcag ggcagcggcc gagcaacagc 30540 gcatgaatca agagctccaa gacatggtta acttgcacca gtgcaaaagg ggtatctttt 30600 gtctggtaaa gcaggccaaa gtcacctacg acagtaatac caccggacac cgccttagct 30660 acaagttgcc aaccaagcgt cagaaattgg tggtcatggt gggagaaaag cccattacca 30720 taactcagca ctcggtagaa accgaaggct gcattcactc accttgtcaa ggacctgagg 30780 atctctgcac ccttattaag accctgtgcg gtctcaaaga tcttattccc tttaactaat 30840 aaaaaaaaat aataaagcat cacttactta aaatcagtta gcaaatttct gtccagttta 30900 ttcagcagca cctccttgcc ctcctcccag ctctggtatt gcagcttcct cctggctgca 30960 aactttctcc acaatctaaa tggaatgtca gtttcctcct gttcctgtcc atccgcaccc 31020 actatcttca tgttgttgca gatgaagcgc gcaagaccgt ctgaagatac cttcaacccc gtgtatccat atgacacgga aaccggtcct ccaactgtgc cttttcttac tcctcccttt 31140 gtatccccca atgggtttca agagagtccc cctggggtac tctctttgcg cctatccgaa cctctagtta cctccaatgg catgcttgcg ctcaaaatgg gcaacggcct ctctctggac gaggccggca accttacctc ccaaaatgta accactgtga gcccacctct caaaaaaacc aagtcaaaca taaacctgga aatatctgca cccctcacag ttacctcaga agccctaact 31440. gtggctgccg ccgcacctct aatggtcgcg ggcaacacac tcaccatgca atcacaggcc ccgctaaccg tgcacgactc caaacttagc attgccaccc aaggacccct cacagtgtca gaggaagc tagccctgca aacatcaggc cccctcacca ccaccgatag cagtaccctt actatcactg cctcaccccc tctaactact gccactggta gcttgggcat tgacttgaaa 31680. gagcccattt atacacaaaa tggaaaacta ggactaaagt acggggctcc tttgcatgta acagacgacc taaacacttt gaccgtagca actggtccag gtgtgactat father tccttgcaaa ctaaagttac tggagccttg ggttttgatt cacaaggcaa tatgcaactt 31800 aatgtagcag gaggactaag gattgattct caaacagac gccttatact tgatgttagt 31860 tatccgtttg atgctcaaa ccactaaat ctaagactag gandaggcccc tctttttata 31920 aactcagccc acaacttgga tattac aaaaaggcc tttactgtt tacagctca 31980 aacaattcca aaagcttga gggttaaccta agcactgcca aggggttgat gtttgacgct 32040 acagccatag ccattaatgc aggagatggg cttgaatttg gttcacctaa tgcaccaac 32100 acaaatcccc tcaaaacaa aattggccat ggcctagaat ttgatcaa caagctatg 32160 gttcctaaac taggactgg ccttagtttt gapccacag gtgccattac agtaggaac 32220 aaaaataatg ataagctaac ttgtggacc acaccagctc catctcctaa ctgtagacta 32280 aatgcagaga aagatgctaa actcactttg gtcttacaa atgtggcag tcaatactt 32340 gctacagttt cagttttggc tgttaaaggc agtttggctc caatctgg aacagttcaa 32400 agtgctcatc tttattaag atttgacgaa atggagtgc tactaaacaa ttccttcctg 32460 gacccagaat attggaactt tagaatgga gatcttactg aaggcacagc ctatacaaac 32520 gctgttggat ttatgcctaa cctatcagct tatccaaat ctcacggtaa aactgccaaa 32580 agtaacattg tcagtcaagt ttacttaac ggagacaaa ctaaacctgt aacactacc 32640 attackactaa acggtacaca ggaaacagga ccacaacc caagtgcata ctctatgtca 32700 tttcatggg actgtctgg ccacaactac attaatgaaa tatttgccac atcctcttac 32760 acttttcat acattgccca agaataaga atcgtttgtg ttatgtttca acgtgtttat 32820 ttttcaattg cagaaaattt caagtcattt ttcattcagt agtatagccc caccaccaca 32880 tagcttatac agatcaccgt accttaatca aactcacaga accctagtat tcaacctgcc 32940 acctccctcc cAcacag agtacacagt ccttctccc cggctggcct taaaagcat 33000 catatcatgg gtaacagaca tattcttagg tgttattattc cacacggttt cctgtcgagc 33060 caaacgctca tcagtgatat taatiactc cccgggcagc tcacttaagt tcatgtcgct 33120 gtccagctgc tgagccacag gctgctgtcc aacttgcggt tgcttaacgg gcggcgaagg 33180 agaagtccac gcctacatgg gggtagagtc ataatcgtgc atcaggatag ggcggtggtg 33240 ctgcagcagc gcgcgaataa actgctgccg ccgccgctcc gtcctgcagg aatacaacat 33300 ggcagtggtc tcctcagcga tgattcgcac cgcccgcagc ataaggcgcc ttgtcctccg 33360 ggcacagcag cgcaccctga tctcacttaa atcagcacag taactgcagc acagcaccac 33420 aatattgttc aaaatcccac agtgcaaggc gctgtatcca aagctcatgg cggggaccac 33480 agaacccacg tggccatcat accacaagcg caggtagatt aagtggcgac ccctcataaa 33540 cacgctggac ataaacatta cctcttttgg catgttgtaa ttcaccacct cccggtacca 33600 tataaacctc tgattaaaca tggcgccatc caccaccatc ctaaaccagc tggccaaaac 33660 ctgcccgccg gctatacact gcagggaacc gggactggaa caatgacagt ggagagccca 33720 ggactcgtaa ccatggatca tcatgctcgt catgatatca atgttggcac aacacaggca 33780 cacgtgcata cacttctcca ggattacaag ctcctcccgc gttagaacca tatcccaggg 33840 aacaacccat tcctgaatca gcgtaaatcc caactgcag ggaagacctc gcagtaact 33900 cacgttgtgc attgtcaaag tgttacattc gggcagcagc ggatgatcct ccagtatggt 33960 agcgcgggtt tctgtctcaa aaagggtag acgatcccta ctgtacggag tgcgccgaga 34020 caaccgagat cgtgttggtc gtagtgtcat gccaaatgga acgccggacg tagtcatatt 34080 tcctgaagca aaaccaggtg cgggcgtgac aaacagatct gcgtctccgg tctcgccgct 34140 tagatcgctc tgtgtagtag ttgtagtata tccactctct caaagcatcc aggcgccccc 34200 tggcttggg ttctatgtaa actcttcat gcgccgctgc cctgataaca tccaccaccg 34260 cagaataagc caacccagc caacctacac attcgttctg cgagtcacac acgggaggag 34320 cgggaagagc tggagaagaacc atgttttttt ttttattcca aaagattatc caaaacctca 34380 aaatgaagat ctattaagtg aacgcgctcc cctccggtgg cgtggtcaaa ctctacagcc 34440 aaagaacaga taatggcatt tgtaagatgt tgcacaatgg cttccaaaag gcaaacggcc 34500 ctcacgtcca agtggacgta aaggctaaac ccttcagggt gaatctcctc tataaacatt 34560 ccagcacctt caaccatgcc caaataattc tcatctcgcc accttctcaa tatatctcta 34620 agcaaatccc gaatattaag tccggccatt gtaaaaatct gctccagagc gccctccacc 34680 ttcagcctca agcagcgaat catgattgca aaaattcagg ttcctcacag acctgtataa 34740 gattcaaaag cggaacatta acaaaaatac cgcgatcccg taggtccctt cgcagggcca 34800 gctgaacata atcgtgcagg tctgcacgga ccagcgcggc cacttccccg ccaggaacca 34860 tgacaaaaga acccacactg attatgacac gcatactcgg agctatgcta accagcgtag 34920 ccccgatgta agcttgttgc atgggcggcg atataaaatg caaggtgctg ctcaaaaaat 34980 caggcaaagc ctcgcgcaaa aaagaaagca catcgtagtc atgctcatgc agataaaggc 35040 aggtaagctc cggaaccacc acagaaaaag acaccatttt tctctcaaac atgtctgcgg 35100 gtttctgcat aaacacaaaa taaaataaca aaaaaacatt taaacattag aagcctgtct 35160 tacaacagga aaaacaaccc ttataagcat aagacggact acggccatgc cggcgtgacc 35220 gtaaaaaaac tggtcaccgt gattaaaaag caccaccgac agctcctcgg tcatgtccgg 35280 agtcataatg taagactcgg taaacacatc aggttgattc acatcggtca gtgctaaaaa 35340 gcgaccgaaa tagcccgggg gaatacatac ccgcaggcgt agagacaaca tatacagcccc 35400 cataggaggt ataacaaaat taataggaga gaaaaacaca taaacacctg aaaaaccctc 35460 ctgcctaggc aaaatagcac cctcccgctc cagaacaaca tacagcgctt ccacagcggc 35520 agccataaca gtcagcctta ccagtaaaaa agaaaaaccta ttaaaaaaac accactcgac 35580 acggcaccag ctcaatcagt cacagtgtaa aaaagggcca agtgcagagc gagtatatat 35640 aggactaaaa aatgacgtaa cggttaaagt ccacaaaaaa cacccagaaa accgcacgcg 35700 aacctacgcc cagaaacgaa agccaaaaaa cccacaactt cctcaaatcg tcacttccgt 35760 tttcccacgt tacgtaactt cccattttaa gaaaactaca attcccaaca catacaagtt 35820 actccgccct aaaacctacg tcacccgccc cgttcccacg ccccgcgcca cgtcacaaac 35880 tccaccccct cattatcata ttggcttcaa tccaaaataa ggtatattat tgatgatg 35938 <210> 2 <211> 8 <212> DNA <213> Human adenovirus 5 <400> 2 tcaccagg 8 <210> 3 <211> 8 <212> DNA <213> Human adenovirus 5 <400> 3 ctgacctc 8 <210> 4 <211> 10 <212> DNA <213> Artificial sequence <220> <223> Modified Ela promoter <400> 4 ggtgttttgg 10 <210> 5 <211> 9 <212> DNA <213> Artificial sequence <220> <223> Modified Ela promoter <400> 5 ctaggactg 9 <210> 6 <211> 65 <212> DNA <213> Human adenovirus 5 <400> 6 taaaacataa ataaaaaacc agactctgtt tggatttgga tcaagcaagt gtcttgctgt 60 cttta 65 <210> 7 <211> 132 <212> DNA <213> Human adenovirus 5 <400> 7 taaagaatcg tttgtgttat gtttcaacgt gtttattttt caattgcaga aaatttcaag 60 tcatttttca ttcagtagta tagccccacc accacatagc ttatacagat caccgtacct 120 taatcaaact ca 132 <210> 8 <211> 3 <212> DNA <213> Human adenovirus 5 <400> 8 taa 3 <210> 9 <211> 3 <212> DNA <213> Human adenovirus 5 <400> 9 tta 3 <210> 10 <211> 3 <212> DNA <213> Human adenovirus 5 <400> 10 tca 3 <210> 11 <211> 8 <212> DNA <213> unknown <220> <223> SwaI restriction site <400> 11 atttaaat 8 <210> 12 <211> 6 <212> DNA <213> Human adenovirus 5 <400> 12 aataaa 6 <210> 13 <211> 6 <212> DNA <213> Human adenovirus 5 <400> 13 tttatt 6 <210> 14 <211> 530 <212> DNA <213> Artificial sequence <220> <223> L5 initial empty <400> 14 aataaagaat cgtttgtgtt atgtttcaac ctgtggaatg tgtgtcagtt agggtgtgga 60 aagtccccag gctccccagc aggcagaagt atgcaaagca tgcatctcaa ttagtcagca 120 accaggtgtg gaaagtcccc aggctcccca gcaggcagaa gtatgcaaag catgcatctc 180 aattagtcag caaccatagt cccgccccta actccgccca tcccgcccct aactccgccc 240 agttccgccc attctccgcc ccatggctga ctaatttttt ttatttatgc agaggccgag 300 gccgcctctg cctctgagct attccagaag tagtgaggag gcttttttgg aggcctaggc 360 ttttgcaaaa agctttgcaa agatttaaat aacttgttta ttgcagctta taatggttac 420 aaataaagca atagcatcac aaatttcaca aataaagcat ttttttcact gcattctagt 480 tgtggtttgt ccaaactcat caatgtatct tatcatgtct ggtgtttatt 530 <210> 15 <211> 956 <212> DNA <213> Artificial sequence <220> <223> Initial mGMCSF of L5 <400> 15 aataaagaat cgtttgtgtt atgtttcaac ctgtggaatg tgtgtcagtt agggtgtgga 60 aagtccccag gctccccagc aggcagaagt atgcaaagca tgcatctcaa ttagtcagca 120 accaggtgtg gaaagtcccc aggctcccca gcaggcagaa gtatgcaaag catgcatctc 180 aattagtcag caaccatagt cccgccccta actccgccca tcccgcccct aactccgccc 240 agttccgccc attctccgcc ccatggctga ctaatttttt ttatttatgc agaggccgag 300 gccgcctctg cctctgagct attccagaag tagtgaggag gcttttttgg aggcctaggc 360 ttttgcaaaa agctttgcaa agatttatgt ggctgcagaa cctgctgttc ctgggcatcg 420 tggtgtacag cctgagcgcc cccaccagat cccccatcac cgtgaccaga ccctggaagc 480 acgtggaagc catcaaagag gccctgaacc tgctggacga catgcccgtg accctgaacg 540 aagaggtgga agtggtgtcc aacgagttca gcttcaagaa actgacctgc gtgcagacca 600 gactgaagat cttcgagcag ggcctgagag gcaacttcac caagctgaag ggcgctctga 660 acatgaccgc cagctactac cagacctact gccctcccac acccgagaca gactgcgaga 720 cacaggtcac aacctacgcc gacttcatcg acagcctgaa aaccttcctg accgacatcc 780 ccttcgagtg caagaaaccc ggccagaagt gaaaataact tgtttattgc agcttataat 840 ggttacaaat aaagcaatag catcacaaat ttcacaaata aagcattttt ttcactgcat 900 tctagttgtg gtttgtccaa actcatcaat gtatcttatc atgtctggtg tttatt 956 <210> 16 <211> 8 <212> DNA <213> Unknown <220> <223> NotI restriction endonuclease site <400> 16 gcggccgc 8 <210> 17 <211> 858 <212> DNA <213> Artificial sequence <220> <223> IX initial empty <400> 17 aataaaaaac cagactctgt ttggatttgg atcaagcaag tgtcttgctg tcttacggta 60 aatggcccgc ctggctgacc gcccaacgac ccccgcccat tgacgtcaat aatgacgtat 120 gttcccatag taacgccaat agggactttc cattgacgtc aatgggtgga gtatttacgg 180 taaactgcc acttggcagt acatcaagtg tatcatatgc caagtacgcc ccctattgac 240 gtcaatgacg gtaaatggcc cgcctggcat tatgcccagt acatgacctt atgggacttt 300 cctacttggc agtacatcta cgtattagtc atcgctatta ccatggtgat gcggttttgg 360 cagtacatca atgggcgtgg atagcggttt gactcacggg gatttccaag tctccacccc 420 attgacgtca atgggagttt gttttggcac caaaatcaac gggactttcc aaaatgtcgt 480 aaactccg ccccattgac gcaaatgggc ggtaggcgtg tacggtggga ggtctatata 540 agcagagctc tctggctaac tagagaaccc actgcttact ggcttatcga aattaatacg 600 actcactata gggagacccg cggccgcctg tgccttctag ttgccagcca tctgttgttt 660 gccctcccc cgtgccttcc ttgaccctgg aaggtgccac tcccactgtc ctttcctaat 720 aaaatgagga aattgcatcg cattgtctga gtaggtgtca ttctattctg gggggtgggg 780 tggggcagga cagcaagggg gaggattggg aagacaatag caggcatgct ggggatgcgg 840 tgggctctat ggtttatt 858 <210> 18 <211> 500 <212> DNA <213> Artificial Sequence <220> <223> L5 mIL7 <400> 18 gctttgcaaa gatttatgtt ccatgtttct tttagatata tctttggaat tcctccactg 60 atccttgttc tgctgcctgt cacatcatct gagtgccaca ttaaagacaa agaaggtaaa 120 gcatatgaga gtgtactgat gatcagcatc gatgaattgg acaaaatgac aggaactgat 180 agtaattgcc cgaataatga accaaacttt tttagaaaac atgtatgtga tgatacaaag 240 gaagctgctt ttctaaatcg tgctgctcgc aagttgaagc aatttcttaa aatgaatatc 300 agtgaagaat tcaatgtcca cttactaaca gtatcacaag gcacacaaac actggtgaac 360 tgcacaagta aggaagaaaa aaacgtaaag gaacagaaaa agaatgatgc atgtttccta 420 aagagactac tgagagaaat aaaaacttgt tggaataaaa ttttgaaggg cagtatataa 480 aaataacttg tttattgcag 500 <210> 19 <211> 461 <212> DNA <213> Artificial Sequence <220> <223> L5 wt mGMCSF <400> 19 gctttgcaaa gatttatgtg gctgcagaat ttacttttcc tgggcattgt ggtctacagc 60 ctctcagcac ccacccgctc acccatcact gtcacccggc cttggaagca tgtagaggcc 120 atcaaagaag ccctgaacct cctggatgac atgcctgtca cgttgaatga agaggtagaa 180 gtcgtctcta acgagttctc cttcaagaag ctaacatgtg tgcagacccg cctgaagata 240 ttcgagcagg gtctacgggg caatttcacc aaactcaagg gcgccttgaa catgacagcc 300 agctactacc agacatactg ccccccaact ccggaaacgg actgtgaaac acaagttacc 360 acctatgcgg atttcataga cagccttaaa acctttctga ctgatatccc ctttgaatgc 420 aaaaaaccag gccaaaaatg aaaataactt gtttattgca g 461 <210> 20 <211> 463 <212> DNA <213> Artificial Sequence <220> <223> IX wt mGMCSF <400> 20 atagggagac ccgcggccat gtggctgcag aatttacttt tcctgggcat tgtggtctac 60 agcctctcag cacccacccg ctcacccatc actgtcaccc ggccttggaa gcatgtagag 120 gccatcaaag aagccctgaa cctcctggat gacatgcctg tcacgttgaa tgaagaggta 180 gaagtcgtct ctaacgagtt ctccttcaag aagctaacat gtgtgcagac ccgcctgaag 240 atattcgagc agggtctacg gggcaatttc accaaactca agggcgcctt gaacatgaca 300 gccagctact accagacata ctgcccccca actccggaaa cggactgtga aacacaagtt 360 accacctatg cggatttcat agacagcctt aaaacctttc tgactgatat cccctttgaa 420 tgcaaaaaac caggccaaaa atgaggccgc tgtgccttct agt 463 <210> 21 <211> 760 <212> DNA <213> Artificial Sequence <220> <223> IX Improvement Empty <400> 21 aataaaatac accttttttc gattgtacgt atttttattt acggtaaatg gcccgcctgg 60 ctgaccgccc aacgaccccc gcccattgac gtcaataatg acgtatgttc ccatagtaac 120 gccaataggg actttccatt gacgtcaatg ggtggagtat ttacggtaaa ctgcccactt 180 ggcagtacat caagtgtatc atatgccaag tacgccccct attgacgtca atgacggtaa 240 atggcccgcc tggcattatg cccagtacat gaccttatgg gactttccta cttggcagta 300 catctacgta ttagtcatcg ctattaccat ggtgatgcgg ttttggcagt acatcaatgg 360 gcgtggatag cggtttgact cacggggatt tccaagtctc caccccattg acgtcaatgg 420 gagtttgttt tggcaccaaa atcaacggga ctttccaaaa tgtcgtaaca actccgcccc 480 attgacgcaa atgggcggta ggcgtgtacg gtgggaggtc tatataagca gagctctctg 540 gctaactaga gaacccactg cttactggct tatcgaaatt aatacgactc actataggga 600 gacccgcggc cgctgtgcct tctagttgcc agccatctgt tgtttgcccc tcccccgtgc 660 cttccttgac cctggaaggt gccactccca ctgtcctttc ctaataaaaa accagactct 720 gtttggattt ggatcaagca agtgtcttgc tgtctttatt 760 <210> 22 <211> 1526 <212> DNA <213> Artificial Sequence <220> <223> IX Improved hIL12A <400> 22 aataaaatac accttttttc gattgtacgt atttttattt acggtaaatg gcccgcctgg 60 ctgaccgcc aacgacccccc gcccattgac gtcaataatg acgtatgttc ccatagtaac 120 gccaataggg actttccatt gacgtcaatg ggtggagtat ttacggtaaa ctgcccactt 180 ggcagtacat caagtgtatc atatgccaag tacgccccct attgacgtca atgacggtaa 240 atggcccgcc tggcattatg cccagtacat gaccttatgg gactttccta cttggcagta 300 catctacgta ttagtcatcg ctattaccat ggtgatgcgg ttttggcagt acatcaatgg 360 gcgtggatag cggtttgact cacggggatt tccaagtctc caccccattg acgtcaatgg 420 gagtttgttt tggcaccaaa atcaacggga ctttccaaaa tgtcgtaaca actccgcccc 480 attgacgcaa atgggcggta ggcgtgtacg gtgggaggtc tatataagca gagctctctg 540 gctaactaga gaacccactg cttactggct tatcgaaatt aatacgactc actataggga 600 gacccgcggc catgtggccc cctgggtcag cctcccagcc accgccctca cctgccgcgg 660 ccacaggtct gcatccagcg gctcgccctg tgtccctgca gtgccggctc agcatgtgtc 720 cagcgcgcag cctctccctt gtggctaccc tggtcctcct ggaccacctc agtttggcca 780 gaaacctccc cgtggccact ccagacccag gatgttccc atgccttcac cactcccaaa 840 acctgctgag ggccgtcagc aacatgctcc agaaggccag acaactcta gatttttacc 900 cttgcacttc tgagagatt gatcatgaag atatcacaa agataaaacc agcacagtgg 960 aggcctgttt accattggaa ttaaccaga atgagagttg cctaaattcc agagagacct 1020 ctttcataac taatgggagt tgcctggcct ccagaagac ctctttatg atggccctgt 1080 gccttagtag tatttatga gacttgaaga tgtaccaggt ggagttcaag accatgaatg 1140 caaagctct gatggatcct aagaggcaga tcttctga tcaaacatg ctggcagtta 1200 ttgatgagct gatgcaggcc ctgaatttca acagtgagac tgtgccacaa aaatcctccc 1260 ttgagaacc ggatttat aaaactaaaa tcaagctctg catactctt catgctttca 1320 gattcgggc agtgactatt gatagagtga tgagctatct gatgcttcc taggccgct 1380 gtgccttcta gttgccagcc atctgttgtt tgccccctcc ccgtgccttc cttgaccctg 1440 gaaggtgcca ctcccactgt cctttcctaa taaaaaacca gactgttt ggatttggat 1500 caagcaagtg tcttgctgtc tttatt 1526 <210> 23 <211> 1517 <212> DNA <213> Artificial Sequence <220> <223> L5 Initial hIL12B <400> 23 aataaagaat cgtttgtgtt atgtttcaac ctgtggaatg tgtgtcagtt agggtgtgga 60 aagtccccag gctccccagc aggcagaagt atgcaaagca tgcatctcaa ttagtcagca 120 accaggtgtg gaaagtcccc aggctcccca gcaggcagaa gtatgcaaag catgcatctc 180 aattagtcag caaccatagt cccgccccta actccgccca tcccgcccct aactccgccc 240 agttccgccc attctccgcc ccatggctga ctaatttttt ttatttatgc agaggccgag 300 gccgcctctg cctctgagct attccagaag tagtgaggag gcttttttgg aggcctaggc 360 ttttgcaaaa agctttgcaa agatttatgt gtcaccagca gttggtcatc tcttggtttt 420 ccctggtttt tctggcatct cccctcgtgg ccatatggga actgaagaaa gatgtttatg 480 tcgtagaatt ggattggtat ccggatgccc ctggagaaat ggtggtcctc acctgtgaca 540 cccctgaaga agatggtatc acctggacct tggaccagag cagtgaggtc ttaggctctg 600 gcaaaaccct gaccatccaa gtcaaagagt ttggagatgc tggccagtac acctgtcaca 660 aaagggcga ggttctaagc cattcgctcc tgctgcttca caaaaaggaa gatggaattt 720 ggtccactga tattttaaag gaccagaaag aacccaaaaa taagaccttt ctaagatgcg 780 aggccaagaa ttatctgga cgtttcacct gctggtggct gacgacaatc agtactgatt 840 tgacattcag tgtcaaaagc agcagaggct cttctgaccc ccaaggggtg acgtgcggag 900 ctgctacact ctctgcagag agagtcagag gggacaacaa ggagtatgag tactcagtgg 960 agtgccagga ggacagtgcc tgcccagctg ctgaggagag tctgcccatt gaggtcatgg 1020 tggatgccgt tcacaagctc aagtgaaa actacaccag cagcttcttc atcagggaca 1080 tcatcaaacc tgacccacc aagaacttgc agctgaagcc attaaagaat tctcggcagg 1140 tggaggtcag ctgggagtac cctgacacct ggagtactcc acattcctac ttctccctga 1200 1260 acaagacctc agccacggtc atctgccgca aaaatgccag cattagcgtg cgggcccagg 1320 accgctacta tagctcatct tggagcgaat gggcatctgt gccctgcagt tagaaataac 1380 ttgtttattg cagcttataa tggttacaaa taaagcaata gcatcacaaa tttcacaaat 1440 aaagcatttt tttcactgca ttctagttgt ggtttgtcca aactcatcaa tgtatcttat 1500 catgtctggt gtttatt 1517 <210> 24 <211> 4 <212> PRT <213> Unknown <220> <223> furin cleavage site <400> 24 Arg Ala Lys Arg 1 <210> 25 <211> 1625 <212> DNA <213> Artificial Sequence <220> <223> hIL12 furin <400> 25 atctgacctc gtcgacatgt gtcaccagca gttggtcatc tcttggtttt ccctggtttt 60 tctggcatct cccctcgtgg ccatatggga actgaagaaa gatgtttatg tcgtagaatt 120 ggattggtat ccggatgccc ctggagaaat ggtggtcctc acctgtgaca cccctgaaga 180 agatggtatc acctggacct tggaccagag cagtgaggtc ttaggctctg gcaaaaccct 240 gaccatccaa gtcaaagagt ttggagatgc tggccagtac acctgtcaca aaagggcga 300 ggttctaagc cattcgctcc tgctgcttca caaaaaggaa gatggaattt ggtccactga 360 tattttaaag gaccagaaag aacccaaaaa taagaccttt ctaagatgcg aggccaagaa 420 ttatctgga cgtttcacct gctggtggct gacgacaatc agtactgatt tgacattcag 480 tgtcaaaagc agcagaggct cttctgaccc ccaaggggtg acgtgcggag ctgctacact 540 600 ggacagtgcc tgcccagctg ctgaggagag tctgcccatt gaggtcatgg tggatgccgt 660 tcacaagctc aagtatgaaa actacaccag cagcttcttc atcagggaca tcatcaaacc 720 tgacccacc aagaacttgc agctgaagcc attaaagaat tctcggcagg tggaggtcag 780 ctgggagtac cctgacacct ggagtactcc acattcctac ttctccctga cattctgcgt 840 tcaggtccag ggcaagagca agagaaaa gaagataga gtcttcacgg acaagacctc 900 agccacggtc atctgccgca aaaatgccag cattagcgtg cgggcccagg accgctacta 960 tagctcatct tggagcgaat gggcatctgt gccctgcagt cgtgctaagc gaagaaacct 1020 ccccgtggcc actccagacc caggaatgtt cccatgcctt caccactccc aaaacctgct 1080 gagggccgtc agcaacatgc tccagaaggc cagacaaact ctagaatttt acccttgcac 1140 ttctgaagag attgatcatg aagatatcac aaaagataaa accagcacag tggaggcctg 1200 tttaccattg gaattaacca agaatgagag ttgcctaaat tccagagaga cctctttcat 1260 aactaatggg agttgcctgg cctccagaaa gacctctttt atgatggccc tgtgccttag 1320 tagtatttat gaagacttga agatgtacca ggtggagttc aagaccatga atgcaaagct 1380 tctgatggat cctaagaggc agatctttct agatcaaaac atgctggcag ttatgatga 1440 gctgatgcag gccctgaatt tcaacagtga gactgtgcca caaaaatcct cccttgaaga 1500 accggatttt tataaaacta aaatcaagct ctgcatactt cttcatgctt tcagaattcg 1560 ggcagtgact attgatagag tgatgagcta tctgaatgct tcctaataac tcgagtcacc 1620 aggcg 1625 <210> 26 <211> 445 <212> DNA <213> Artificial sequence <220> <223> L5 modified SV40 <400> 26 aataaaaggt ttattctgtg gaatgtgtgt cagttagggt gtggaaagtc cccaggctcc 60 ccagcaggca gaagtatgca aagcatgcat ctcaattagt cagcaaccag gtgtggaaag 120 tccccaggct ccccagcagg cagaagtatg caaagcatgc atctcaatta gtcagcaacc 180 atagtcccgc ccctaactcc gcccatcccg cccctaactc cgcccagttc cgcccattct 240 ccgccccatg gctgactaat tttttttatt tatgcagagg ccgaggccgc ctctgcctct 300 gagctattcc agaagtagtg aggaggcttt tttggaggcc taggcttttg caaaaagctt 360 tgcaaagatt taaataactt gtttattgca gcttataatg gttacaaata aagaatcgtt 420 tgtgttatgt ttcaacgtgt ttatt 445 <210> 27 <211> 502 <212> DNA <213> Artificial sequence <220> <223> IX mIL7 <400> 27 atagggagac ccgcggccat gttccatgtt tcttttagat atatctttgg aattcctcca 60 ctgatccttg ttctgctgcc tgtcacatca tctgagtgcc acattaaaga caaagaaggt 120 aaagcatatg agagtgtact gatgatcagc atcgatgaat tggacaaaat gacaggaact 180 gatagtaatt gcccgaataa tgaaccaaac ttttttagaa aacatgtatg tgatgataca 240 aaggaagctg cttttctaaa tcgtgctgct cgcaagttga agcaatttct taaaatgaat 300 atcagtgaag aattcaatgt ccacttacta acagtatcac aaggcacaca aacactggtg 360 aactgcacaa gtaaggaaga aaaaaacgta aaggaacaga aaaagaatga tgcatgtttc 420 ctaaagagac tactgagaga aataaaaact tgttggaata aaattttgaa gggcagtata 480 taaggccgct gtgccttcta gt 502 <210> 28 <211> 445 <212> DNA <213> Artificial Sequence <220> <223> L5 Improved SV40 wt Empty <400> 28 aataaaaggt ttattctgtg gaatgtgtgt cagttagggt gtggaaagtc cccaggctcc 60 ccagcaggca gaagtatgca aagcatgcat ctcaattagt cagcaaccag gtgtggaaag 120 tccccaggct ccccagcagg cagaagtatg caaagcatgc atctcaatta gtcagcaacc 180 atagtcccgc ccctaactcc gcccatcccg cccctaactc cgcccagttc cgcccattct 240 ccgccccatg gctgactaat tttttttatt tatgcagagg ccgaggccgc ctcggcctct 300 gagctattcc agaagtagtg aggaggcttt tttggaggcc taggcttttg caaaaagctt 360 tgcaaagatt taaataactt gtttattgca gcttataatg gttacaaata aagaatcgtt 420 tgtgttatgt ttcaacgtgt ttatt 445 <210> 29 <211> 525 <212> DNA <213> Artificial Sequence <220> <223> L5 Improved EF1A Empty <400> 29 aataaaaggt ttattaggcg gcctccccgt caccaccccc cccaacccgc cccgaccgga 60 gctgagagta attcatacaa aaggactcgc ccctgccttg gggaatccca gggaccgtcg 120 ttaaactccc actaacgtag aacccagaga tcgctgcgtt cccgccccct cacccgcccg 180 ctctcgtcat cactgaggtg gagaagagca tgcgtgaggc tccggtgccc gtcagtgggc 240 agagcgcaca tcgcccacag tccccgagaa gttgggggga ggggtcggca attgaaccgg 300 tgcctagaga aggtggcgcg gggtaaactg ggaaagtgat gtcgtgtact ggctccgcct 360 ttttcccgag ggtgggggag aaccgtatat aagtgcagta gtcgccgtga acgttctttt 420 tcgcaacggg tttgccgcca gaacacaatt taaataactt gtttattgca gcttataatg 480 gttacaaata aagaatcgtt tgtgttatgt ttcaacgtgt ttatt 525 <210> 30 <211> 502 <212> DNA <213> Artificial Sequence <220> <223> mIL7 no poly-A <400> 30 atagggagac ccgcggccat gttccatgtt tcttttagat atatctttgg aattcctcca 60 ctgatccttg ttctgctgcc tgtcacatca tctgagtgcc acattaaaga caaagaaggt 120 aaagcatatg agagtgtact gatgatcagc atcgatgaat tggacaaaat gacaggaact 180 gatagtaatt gcccgaataa tgaaccaaac ttttttagaa aacatgtatg tgatgataca 240 aaggaagctg cttttctaaa tcgtgctgct cgcaagttga agcaatttct taaaatgaat 300 atcagtgaag aattcaatgt ccacttacta acagtatcac aaggcacaca aacactggtg 360 aactgcacaa gtaaggaaga aaaaaacgta aaggaacaga aaaagaatga tgcatgtttc 420 ctaaagagac tactgagaga aatcaaaact tgttggaaca aaattttgaa gggcagtata 480 taaggccgct gtgccttcta gt 502 <210> 31 <211> 456 <212> DNA <213> Artificial Sequence <220> <223> mGMCSF Kozak <400> 31 atttgccacc atgtggctgc agaatttact tttcctgggc attgtggtct acagcctctc 60 agcacccacc cgctcaccca tcactgtcac ccggccttgg aagcatgtag aggccatcaa 120 agaagccctg aacctcctgg atgacatgcc tgtcacgttg aatgaagagg tagaagtcgt 180 ctctaacgag ttctccttca agaagctaac atgtgtgcag acccgcctga agatattcga 240 gcagggtcta cggggcaatt tcaccaaact caagggcgcc ttgaacatga cagccagcta 300 ctaccagaca tactgccccc caactccgga aacggactgt gaaacacaag ttaccaccta 360 tgcggatttc atagacagcc ttaaaacctt tctgactgat atcccctttg aatgcaaaaa 420 accaggccaa aaatgaaaat aacttgttta ttgcag 456 <210> 32 <211> 591 <212> DNA <213> Unknown <220> <223> Adenovirus death protein <400> 32 gaaaatgcct taatttacta agttacaaag ctaatgtcac cactaactgc tttactcgct 60 gcttgcaaaa caaattcaaa aagttagcat tataattaga ataggattta aaccccccgg 120 tcatttcctg ctcaatacca ttcccctgaa caattgactc tatgtgggat atgctccagc 180 gctacaacct tgaagtcagg cttcctggat gtcagcatct gactttggcc agcacctgtc 240 ccgcggattt gttccagtcc aactacagcg acccacccta acagagatga ccaacacaac 300 caacgcggcc gccgctaccg gacttacatc taccacaaat acaccccaag tttctgcctt 360 tgtcaataac tgggataact tgggcatgtg gtggttctcc atagcgctta tgtttgtatg 420 ccttattatt atgtggctca tctgctgcct aaagcgcaaa cgcgcccgac cacccatcta 480 tagtcccatc attgtgctac acccaaacaa tgatggaatc catagattgg acggactgaa 540 acacatgttc ttttctctta cagtatgata ataaaaaaaa ataataaagc a 591 <210> 33 <211> 4509 <212> DNA <213> Artificial sequence <220> <223> Costim IRES <400> 33 atctgacctc gtcgacatgg cttgcaattg tcagttgatg caggatacac cactcctcaa 60 gtttccatgt ccaaggctca ttcttctctt tgtgctgctg attcgtcttt cacaagtgtc 120 ttcagatgtt gatgaacaac tgtccaagtc agtgaaagat aaggtattgc tgccttgccg 180 ttacaactct cctcatgaag atgagtctga agaccgaatc tactggcaaa aacatgacaa 240 agtggtgctg tctgtcattg ctgggaaact aaaagtgtgg cccgagtata agaaccggac 300 tttatatgac aacactacct actctcttat catcctgggc ctggtccttt cagaccgggg 360 cacatacagc tgtgtcgttc aaaagaagga aagaggaacg tatgaagtta aacacttggc 420 tttagtaaag ttgtccatca aagctgactt cctaccccc aacataactg agtctggaaa 480 cccatctgca gacactaaaa ggattacctg ctttgcttc gggggtttcc caaagcctcg 540 cttctcttgg ttggaaaatg gaagagaatt acctggcatc aatacgacaa ttcccagga 600 tcctgaatct gaattgtaca ccattagtag ccaactagat ttcaatacga ctcgcaacca 660 caccattaag tgtctcatta aatatggaga tgctcacgtg tcagaggact tcacctggga 720 aaaaccccca gaagaccctc ctgatagcaa gaacacactt gtgctctttg gggcaggatt 780 cggcgcagta ataacgtcg tcgtcatcgt tgtcatcatc aaatgcttct gtaagcacag 840 aagctgtttc agaagaaatg aggcaagcag agaaacaaac aacagcctta cttcgggcc 900 tgaagaagca ttagctgaac agaccgtctt cctttagtaa cgttactggc cgaagccgct 960 tggaataagg ccggtgtgcg tttgtctata tgttattttc caccatattg ccgtcttttg 1020 gcaatgtgag ggcccggaaa cctggccctg tcttcttgac gagcattcct aggggtcttt 1080 cccctctcgc caaaggaatg caaggtctgt tgaatgtcgt gaaggaagca gttcctctgg 1140 aagcttcttg aagacaaaca acgtctgtag cgaccctttg caggcagcgg aaccccccac 1200 ctggcgacag gtgcctctgc ggccaaaagc cacgtgtata agatacacct gcaaaggcgg 1260 cacaacccca gtgccacgtt gtgagttgga tagttgtgga aagagtcaaa tggctctcct 1320 caagcgtatt caacaagggg ctgaaggatg cccagaaggt accccattgt atgggatctg 1380 atctggggcc tcggtgcaca tgctttacat gtgtttagtc gaggttaaaa aacgtctagg 1440 ccccccgaac cacggggacg tggttttcct ttgaaaaaca cgatgataat atggaccagc 1500 acacacttga tgtggaggat accgcggatg ccagacatcc agcaggtact tcgtgcccct 1560 cggatgcggc gctcctcaga gataccgggc tcctcgcgga cgctgcgctc ctctcagata 1620 ctgtgcgccc cacaaatgcc gcgctcccca cggatgctgc ctaccctgcg gttaatgttc 1680 gggatcgcga ggccgcgtgg ccgcctgcac tgaacttctg ttcccgccac ccaaagctct 1740 atggcctagt cgctttggtt ttgctgcttc tgatcgccgc ctgtgttcct atcttcaccc 1800 gcaccgagcc tcggccagcg ctcacaatca ccacctcgcc caacctgggt acccgagaga 1860 ataatgcaga ccaggtcacc cctgtttccc acattggctg ccccaacact acacaacagg 1920 gctctcctgt gttcgccaag ctactggcta aaaaccaagc atcgttgtgc aatacaactc 1980 tgaactggca cagccaagat ggagctggga gctcatacct atctcaaggt ctgaggtacg 2040 aagaagacaa aaaggagttg gtggtagaca gtcccgggct ctactacgta tttttggaac 2100 tgaagctcag tccaacattc acaaacacag gccacaaggt gcagggctgg gtctctcttg 2160 ttttgcaagc aaagcctcag gtagatgact ttgacaactt ggccctgaca gtggaactgt 2220 tcccttgctc catggagaac aagttagtgg accgttcctg gagtcaactg ttgctcctga 2280 aggctggcca ccgcctcagt gtgggtctga gggcttatct gcatggagcc caggatgcat 2340 acagagactg ggagctgtct tatcccaaca ccaccagctt tggactcttt cttgtgaaac 2400 ccgacaaccc atgggaatga ggtttccaca actgataaaa ctcgtgcaac ttgaaactcc 2460 gcctggtctt tccaggtcta gaggggttac actttgtact gtgctcgact ccacgcccgg 2520 tccactggcg ggtgttagta gcagcactgt tgtttcgtag cggagcatgg tggccgtggg 2580 aactcctcct tggtgacaag ggcccacggg gccgaaagcc acgtccagac ggacccacca 2640 tgtgtgcaac cccagcacgg caacttttac tgcgaacacc accttaaggt gacactggta 2700 ctggtactcg gtcactggtg acaggctaag gatgcccttc aggtaccccg aggtaacacg 2760 ggacactcgg gatctgagaa ggggattggg acttctttaa aagtgcccag tttaaaaagc 2820 ttctacgcct gaataggcga ccggaggccg gcgcctttcc attacccact actaaatcca 2880 tggcttcaac ccgtgccaag cccacgctac ctctgctcct ggccctggtc accgttgtga 2940 tccctgggcc tggtgatgct caggtatcca tccatcccag agaagccttc ctgccccagg 3000 gtgggtccgt gcaggtgaac tgttcttcct catgcaagga ggacctcagc ctgggcttgg 3060 agactcagtg gctgaaagat gagctcgaga gtggacccaa ctggaagctg ttgagctga 3120 gcgagatcgg ggaggacagc agtccgctgt gctttgagaa ctgtggcacc gtgcagtcgt 3180 ccgcttccgc taccatcacc gtgtattcgt ttccggagag tgtggagctg agacctctgc 3240 cagcctggca gcaagtaggc aaggacctca ccctgcgctg ccacgtggat ggtggagcac 3300 cgcggaccca gctctcagca gtgctgctcc gtggggagga gatactgagc cgccagccag 3360 tgggtgggca ccccaaggac cccaaggaga tcacattcac ggtgctggct agcagagggg 3420 accacggagc caatttctca tgccgcacag aactggatct caggccgcaa gggctggcat 3480 tgttctctaa tgtctccgag gccaggagcc tccggacttt cgatcttcca gctaccatcc 3540 caaagctcga cacccctgac ctcctggagg tgggcaccca gcagaagttg ttttgctccc 3600 tggaaggcct gtttcctgcc tctgaagctc ggatatacct ggagctggga ggccagatgc 3660 cgacccagga gagcacaaac agcagtgact ctgtgtcagc cactgccttg gtagaggtga 3720 ctgaggagtt cgacagaacc ctgccgctgc gctgcgtttt ggagctagcg gaccagatcc 3780 tggagacgca gaggacctta acagtctaca acttttcagc tccggtcctg accctgagcc 3840 agctggaggt ctcggaaggg agccaagtaa ctgtgaagtg tgaagcccac agtgggtcga 3900 aggtggttct tctgagcggc gtcgagccta ggccacccac cccgcaggtc caattcacac 3960 tgaatgccag ctcggaggat cacaaacgaa gcttcttttg ctctgccgct ctggaggtgg 4020 cgggaaagtt cctgtttaaa aaccagaccc tggaactgca cgtgctgtat ggtcctcggc 4080 tggacgagac ggactgcttg gggaactgga cctggcaaga ggggtctcag cagactctga 4140 aatgccaggc ctgggggaac ccatctccta agatgacctg cagacggaag gcagatggtg 4200 ccctgctgcc catcggggtg gtgaagtctg tcaaacagga gatgaatggt acatacgtgt 4260 gccatgcctt tagctcccat gggaatgtca ccaggaatgt gtacctgaca gtactgtacc 4320 actctcaaaa taactggact ataatcattc tggtgccagt actgctggtc attgtgggcc 4380 tcgtgatggc agcctcttat gtttataacc gccagagaaa gatcaggata tacaagttac 4440 agaaggctca ggaggaggcc ataaaactca agggacaagc cccacctccc tgactcgagt 4500 caccaggcg 4509 <210> 34 <211> 951 <212> DNA <213> Artificial Sequence <220> <223> 19k mCD80 <400> 34 atctgacctc atggcttgca attgtcagtt gatgcaggat acaccactcc tcaagtttcc 60 atgtccaagg ctcattcttc tctttgtgct gctgattcgt ctttcacaag tgtcttcaga 120 tgttgatgaa caactgtcca agtcagtgaa agataaggta ttgctgcctt gccgttacaa 180 ctctcctcat gaagatgagt ctgaagaccg aatctactgg caaaaacatg acaaagtggt 240 gctgtctgtc attgctggga aactaaaagt gtggcccgag tataagaacc ggactttata 300 tgacaacact acctactctc ttatcatcct gggcctggtc ctttcagacc ggggcacata 360 cagctgtgtc gttcaaaaga aggaaagagg aacgtatgaa gttaaacact tggctttagt 420 aaagttgtcc atcaaagctg acttctctac ccccaacata actgagtctg gaaacccatc 480 tgcagacact aaaaggatta cctgctttgc ttccggggt ttcccaaagc ctcgcttctc 540 ttggttggaa aatggagaag aattacctgg catcaatacg acaatttccc aggatcctga 600 atctgaattg tacaccatta gtagccaact agatttcaat acgactcgca accacaccat 660 taagtgtctc attaaatatg gagatgctca cgtgtcagag gacttcacct gggaaaaacc 720 cccagaagac cctcctgata gcaagaacac acttgtgctc tttggggcag gattcggcgc 780 agtaataaca gtcgtcgtca tcgttgtcat catcaaatgc ttctgtaagc acagaagctg 840 tttcagaaga aatgaggcaa gcagagaaac aaacaacagc cttaccttcg ggcctgaaga 900 agcattagct gaacagaccg tcttccttta gtcaggtgaa tctgggtcac c 951 <210> 35 <211> 967 <212> DNA <213> Artificial Sequence <220> <223> IX mCD137L <400> 35 atagggagac ccgcggccat ggaccagcac acacttgatg tggaggatac cgcggatgcc 60 agacatccag caggtacttc gtgcccctcg gatgcggcgc tcctcagaga taccgggctc 120 ctcgcggacg ctgcgctcct ctcagatact gtgcgcccca caaatgccgc gctccccacg 180 gatgctgcct accctgcggt taatgttcgg gatcgcgagg ccgcgtggcc gcctgcactg 240 aacttctgtt cccgccaccc aaagctctat ggcctagtcg ctttggtttt gctgcttctg 300 atcgccgcct gtgttcctat cttcacccgc accgagcctc ggccagcgct cacaatcacc 360 acctcgccca acctgggtac ccgagagaat aatgcagacc aggtcacccc tgtttcccac 420 attggctgcc ccaacactac acaacagggc tctcctgtgt tcgccaagct actggctaaa 480 aaccaagcat cgttgtgcaa tacaactctg aactggcaca gccaagatgg agctgggagc 540 tcatacctat ctcaaggtct gaggtacgaa gaagacaaaa aggagttggt ggtagacagt 600 cccgggctct actacgtatt tttggaactg aagctcagtc caacattcac aaacacaggc 660 cacaaggtgc agggctgggt ctctcttgtt ttgcaagcaa agcctcaggt agatgacttt 720 gacaacttgg ccctgacagt ggaactgttc ccttgctcca tggagaacaa gttagtggac 780 cgttcctgga gtcaactgtt gctcctgaag gctggccacc gcctcagtgt gggtctgagg 840 gcttatctgc atggagccca ggatgcatac agagactggg agctgtctta tcccaacacc 900 accagctttg gactctttct tgtgaaaccc gacaacccat gggaatgagg ccgctgtgcc 960 ttctagt 967 <210> 36 <211> 1649 <212> DNA <213> Artificial Sequence <220> <223> L5 mICAM1 <400> 36 cgccagaaca catttatggc ttcaacccgt gccaagccca cgctacctct gctcctggcc 60 ctggtcaccg ttgtgatccc tgggcctggt gatgctcagg tatccatcca tcccagagaa 120 gccttcctgc cccagggtgg gtccgtgcag gtgaactgtt cttcctcatg caaggaggac 180 ctcagcctgg gcttggagac tcagtggctg aaagatgagc tcgagagtgg acccaactgg 240 aagctgtttg agctgagcga gatcggggag gacagcagtc cgctgtgctt tgagaactgt 300 ggcaccgtgc agtcgtccgc ttccgctacc atcaccgtgt attcgtttcc ggagagtgtg 360 gagctgagac ctctgccagc ctggcagcaa gtaggcaagg acctcaccct gcgctgccac 420 gtggatggtg gagcaccgcg gacccagctc tcagcagtgc tgctccgtgg ggaggagata 480 ctgagccgcc agccagtggg tgggcacccc aaggacccca aggagatcac attcacggtg 540 ctggctagca gaggggacca cggagccaat ttctcatgcc gcacagaact ggatctcagg 600 ccgcaagggc tggcattgtt ctctaatgtc tccgaggcca ggagcctccg gactttcgat 660 cttccagcta ccatcccaaa gctcgacacc cctgacctcc tggaggtggg cacccagcag 720 aagttgtttt gctccctgga aggcctgttt cctgcctctg aagctcggat atacctggag 780 ctgggaggcc agatgccgac ccaggagagc acaaacagca gtgactctgt gtcagccact 840 gccttggtag aggtgactga ggagttcgac agaaccctgc cgctgcgctg cgttttggag 900 ctagcggacc agatcctgga gacgcagagg accttaacag tctacaactt ttcagctccg 960 gtcctgaccc tgagccagct ggaggtctcg gaagggagcc aagtaactgt gaagtgtgaa 1020 gcccacagtg ggtcgaaggt ggttcttctg agcggcgtcg agcctaggcc acccaccccg 1080 caggtccaat tcacactgaa tgccagctcg gaggatcaca aacgaagctt cttttgctct 1140 gccgctctgg aggtggcggg aaagttcctg tttaaaaacc agaccctgga actgcacgtg 1200 ctgtatggtc ctcggctgga cgagacggac tgcttgggga actggacctg gcaagagggg 1260 tctcagcaga ctctgaaatg ccaggcctgg gggaacccat ctcctaagat gacctgcaga 1320 cggaaggcag atggtgccct gctgcccatc ggggtggtga agtctgtcaa acaggagatg 1380 aatggtacat acgtgtgcca tgcctttagc tcccatggga atgtcaccag gaatgtgtac 1440 ctgacagtac tgtaccactc tcaaataac tggactataa tcattctggt gccagtactg 1500 ctggtcattg tgggcctcgt gatggcagcc tcttatgttt ataaccgcca gagaaagatc 1560 aggatataca agttacagaa ggctcaggag gaggccataa aactcaaggg acaagcccca 1620 cctccctgaa aataacttgt ttattgcag 1649 <210> 37 <211> 72 <212> DNA <213> Human adenovirus 35 <400> 37 aataaaaaaa attccagaat caatgaataa ataaacgagc ttgttgttga tttaaaatca 60 agtgttttta tt 72 <210> 38 <211> 23 <212> DNA <213> Human adenovirus 35 <400> 38 aataaagttt aagtgttttt att 23 <210> 39 <211> 789 <212> DNA <213> Artificial sequence <220> <223> Ad35 IX-E2 cassette <400> 39 tcgagatcgg tggtccaggg cataccgtgc gcgaaaaatg aaataaaata cacctttttt 60 cgattgtacg tatttttatt tacggtaaat ggcccgcctg gctgaccgcc caacgacccc 120 cgcccattga cgtcaataat gacgtatgtt cccatagtaa cgccaatagg gactttccat 180 tgacgtcaat gggtggagta tttacggtaa actgcccact tggcagtaca tcaagtgtat 240 catatgccaa gtacgccccc tattgacgtc aatgacggta aatggcccgc ctggcattat 300 gcccagtaca tgaccttatg ggactttcct acttggcagt acatctacgt attagtcatc 360 gctattacca tggtgatgcg gttttggcag tacatcaatg ggcgtggata gcggtttgac 420 tcacggggat ttccaagtct ccaccccatt gacgtcaatg ggagtttgtt ttggcaccaa 480 aatcaacggg actttccaaa atgtcgtaac aactccgccc cattgacgca aatgggcggt 540 aggcgtgtac ggtgggaggt ctatataagc agagctctct ggctaactag agaacccact 600 gcttactggc ttatcgaaat taatacgact cactataggg agacccgcgg ccgctgtgcc 660 ttctagttgc cagccatctg ttgtttgccc ctcccccgtg ccttccttga ccctggaagg 720 tgccactccc actgtccttt cctaataaaa acacttgatt ttaaatcaac aacaagctcg 780 tttatttat 789 <210> 40 <211> 560 <212> DNA <213> Artificial sequence <220> <223> Ad35 L5-E4 cassette <400> 40 tttcttttct tacattacag aagacgacaa ctaaaataaa aggtttatta ggcggcctcc 60 ccgtcaccac cccccccac ccgccccgac cggagctgag agtaattcat acaaaaggac tcgcccctgc cttggggat cccagggacc gtcgttaac tcccactaac gtagaaccca gagatcgctg cgttcccgcc ccctcacccg cccgctctcg tcatcactga ggtggagaag 240 agcatgcgtg aggctccggt gcccgtcagt gggcagagcg cacatcgccc acagtccccg 300 agaagttggg gggaggggtc ggcaattgaa ccggtgccta gagaaggtgg cgcggggtaa actgggaag tgatgtcgtg tactggctcc gccttttttcc cgagggtggg ggagaaccgt 420 atataagtgc agtaggcc gtgaacgttc tttttcgcaa cgggtttgcc gccagaacac 480 aatttaaata acttgtttat tgcagcttat aatggttaca aataagttt aagtgttttt atttaaaatc acaaattcg 560 <210> 41 <211> 34794 <212> DNA <213> Privacy Policy35 <400> 41 catcaat aatatacctt atagatgga tggtgccaat atgtaatga ggtgatttta aaaagtgtgg gccgtgtggt gattggctgt ggggttaacg gttaaaaggg gcggcgcggc 120 cgtgggaaaa tgacgtttta tgggggtgga gttttttgc aagttgtcgc gggaaatgtt 180 acgcataaaa aggcttcttt tctcacggaa ctacttagtt ttcccacggt attaacagg 240 aaatgaggta gttttgaccg gatgcaagtg aaaattgctg atttcgcgc gaaaactgaa 300 tgaggaagtg ttttctgaa taatgtggta tttatggcag ggtggagtat ttgttcaggg 360 ccaggtagac tttgacccat tacgtggagg tttcgattac cgtgtttttt acctgaattt 420 ccgcgtaccg tgtcaaagtc ttctgttttt acgtaggtgt cagctgatcg ctagggtatt 480 tatacctcag ggtttgtgtc aagaggccac tcttgagtgc cagcgagaag agttttctcc 540 tctgcgccgg cagtttaata ataaaaaaat gagagatttg cgatttctgc ctcaggaaat 600 aatctctgct gagactggaa atgaaatatt ggagcttgtg gtgcacgccc tgatgggaga 660 cgatccggag ccacctgtgc agctttttga gcctcctacg cttcaggaac tgtatgattt 720 agaggtagag ggatcggagg attctaatga ggaagctgtg aatggcttttt ttaccgattc 780 tatgctttta gctgctaatg aaggattaga attagatccg cctttggaca ctttcaatac 840 tccaggggtg attgtggaaa gcggtacagg tgtaagaaaa ttacctgatt tgagttccgt 900 ggactgtgat ttgcactgct atgaagacgg gtttcctccg agtgatgagg aggaccatga 960 aaaggagcag tccatgcaga ctgcagcggg tgagggagtg aaggctgcca atgttggttt 1020 tcagttggat tgcccggagc ttcctggaca tggctgtaag tcttgtgaat ttcacaggaa 1080 aaatactgga gtaaaggaac tgttatgttc gctttgttat atgagaacgc actgccactt 1140 tatttacagt aagtgtgttt aagttaaaat ttaaaggaat atgctgtttt tcacatgtat 1200 attgagtgtg agttttgtgc ttcttattat aggtcctgtg tctgatgctg atgaatcacc 1260 atctcctgat tctactacct cacctcctga tattcaagca cctgttcctg tggacgtgcg 1320 caagcccatt cctgtgaagc ttaagcctgg gaaacgtcca gcagtggaga aacttgagga 1380 cttgttacag ggtggggacg gacctttgga cttgagtaca cggaaacgtc caagacaata 1440 agtgttccat atccgtgttt acttaaggtg acgtcaatat ttgtgtgaga gtgcaatgta 1500 ataaaaatat gttaactgtt cactggtttt tattgctttt tgggcgggga ctcaggtata 1560 tagtagaag cagacctgtg tggttagctc ataggagctg gctttcatcc atggaggttt 1620 gggccatttt ggaagacctt aggagaacta ggcaactgtt agagagcgct tcggacggag 1680 tctccggttt ttggagattc tggttcgcta gtgaattagc tagggtagtt tttaggataa 1740 aacaggacta taacaagaa tttgaaaagt tgttggtaga ttgcccagga cttttgaag 1800 ctcttaattt gggccatcag gttcacttta aagaaaaagt tttatcagtt ttagactttt 1860 caaccccagg tagaactgct gctgctgtgg cttttcttac ttttatatta gataatgga 1920 tcccgcagac tcatttcagc aggggatacg ttttggattt catagccaca gcattgtgga 1980 gaagatgaa ggttcgcaag atgagagaa tcttaggtta ctggccagtg cagcctttgg 2040 gtgtagcggg aatcctgagg catccaccgg tcatgccagc ggttctggag gaggaacgc 2100 aaggaccaa cccgagagcc ggcctggacc ctccagtgga ggaggcggag tagctgactt 2160 gtctcctgaa ctgcaacggg tgcttactgg atctacgtcc actggacggg ataggggcgt 2220 taagagggag agggcatcca gtggtactga tgctagatct gagttggctt taagtttaat 2280 gagtcgcaga cgtcctgaaa ccattggtg gcatgaggtt cagaaagagg gaagggatga 2340 agtttctgta ttgcaggaga atattcact ggaacaggtg aaaacatgtt ggttggagcc 2400 agaggatgat tgggcggtgg ccattaaaaa ttatgccaag atagctttga ggcctgataa 2460 acagtataag atcagtagac ggattaat ccggaatgct tgttacatat ctggaatgg 2520 ggctgaggtg gtaatagata ctcaagacaa vakagttatt agatgctgca tgatgatat 2580 gtggcctgga gtagtcggta tggagcagt cactttgta aatgttaagt ttaggggaga 2640 tggttataat ggaatagtgt ttatggccaa taccaaactt gttgtagctt 2700 ttttggtttc aacaatacct gtgtagatgc ctggggacag gttagtgtac gggggtgtag 2760 tttctatgcg tgttggattg ccacagctgg cagaaccaag attcattgt ctctgaagaa 2820 atgcatattc caagatgta acctgggcat tctgaatgaa ggcgaagcaa gggtccgtca 2880 ctgcgcttct acagatactg gatgttttat tttattag ggaaatgcca gcgtaaagca 2940 taacatgatt tgtggtgctt ccgatgagag gccttatcaa atgctcactt gtgctggtgg 3000 gcattgtaat atgctggcta ctgtgcatat tgtttcccat caacgcaaaa aatggcctgt 3060 ttttgatcac aatgtgttga ccaagtgcac catgcatgca ggtgggcgta gaggaatgtt 3120 tatgccttac cagtgtaaca tgaatcatgt gaaagtgttg ttggaaccag atgccttttc 3180 cagaatgagc ctaacaggaa tctttgacat gaacacgcaa atctggaaga tcctgaggta 3240 tgatgatacg agatcgaggg tgcgcgcatg cgaatgcgga ggcaagcatg ccaggttcca 3300 gccggtgtgt gtagatgtga ccgaagatct cagaccggat catttggtta ttgcccgcac 3360 tggagcagag ttcggatcca gtggagaaga aactgactaa ggtgagtatt gggaaaactt 3420 tggggtggga ttttcagatg gacagattga gtaaaaattt gttttttctg tcttgcagct 3480 gacatgagtg gaaatgcttc ttttaagggg ggagtcttca gcccttatct gacagggcgt 3540 ctcccatcct gggcaggagt tcgtcagaat gttatgggat ctactgtgga tggaagaccc 3600 gttcaacccg ccaattcttc aacgctgacc tatgctactt taagttcttc acctttggac 3660 gcagctgcag ccgctgccgc cgcctctgtc gccgctaaca ctgtgcttgg aatgggttac 3720 tatggaagca tcgtggctaa ttccacttcc tctaataacc cttctacact gactcaggac 3780 aagttacttg tccttttggc ccagctggag gctttgaccc aacgtctggg tgaactttct 3840 cagcaggtg ccgagttgcg agtacaaact gagtctgctg tcggcacggc aaagtctaaa 3900 taaaaaaat tccagaatca atgaataaat aaacgagctt gttgttgatt taaaatcaag 3960 tgtttttatt tcatttttcg cgcacggtat gccctggacc accgatctcg atcattgaga 4020 actcggtgga ttttttccag aatcctatag aggtgggatt gaatgtttag atacatggggc 4080 attaggccgt ctttggggtg gagatagctc cattgaaggg attcatgctc cggggtagtg 4140 ttgtaaatca cccagtcata acaaggtcgc agtgcatggt gttgcacaat atcttttaga 4200 agtaggctga ttgccacaga taagcccttg gtgtaggtgt ttacaaaccg gttgagctgg 4260 gaggggtgca ttcgaggtga aattatgtgc atttggatt ggatttttaa gttggcaata 4320 ttgccgccaa gatcccgtct tgggttcatg ttatgaagga ctaccaagac ggtgtatccg 4380 gtacatttag gaaatttatc gtgcagcttg gatggaaaag cgtggaaaaa tttggagaca 4440 cccttgtgtc ctccgagatt ttccatgcac tcatccatga taatagcaat ggggccgtgg 4500 gcagcggcgc gggcaaacac gttccgtggg tctgacacat catagttatg ttcctgagtt 4560 aaatcatcat aagccatttt aatgaatttg gggcggagcg taccagattg gggtatgaat 4620 gttccttcgg gccccggagc atagttcccc tcacagattt gcatttccca agctttcagt 4680 tctgagggtg gaatcatgtc cacctggggg gctatgaaga acaccgtttc gggggcgggg 4740 gtgattagtt gggatgatag caagtttctg agcaattgag atttgccaca tccggtgggg 4800 ccataaataa ttccgattac aggttgcagg tggtagttta gggaacggca actgccgtct 4860 tctcgaagca agggggccac ctcgttcatc atttccctta catgcatatt ttcccgcacc 4920 aaatccatta ggaggcgctc tcctcctagt gatagaagtt cttgtagtga ggaaaagttt 4980 ttcagcggtt ttagaccgtc agccatgggc attttggaaa gagtttgctg caaaagttct 5040 agtctgttcc acagttcagt gatgtgttct atggcatctc gatccagcag acctcctcgt 5100 ttcgcgggtt tggacggctc ctggagtagg gtatgagacg atgggcgtcc agcgctgcca 5160 gggttcggtc cttccagggt ctcagtgttc gagtcagggt tgtttccgtc acagtgaagg 5220 ggtgtgcgcc tgcttgggcg cttgccaggg tgcgcttcag actcattctg ctggtggaga 5280 acttctgtcg cttggcgccc tgtatgtcgg ccaagtagca gtttaccatg agttcgtagt 5340 tgagcgctc ggctgcgtgg cctttggcgc ggagcttacc tttggaagtt ttcttgcata 5400 ccgggcagta taggcatttc agcgcataca gcttgggcgc aagaaaatg gattctgggg 5460 agtatgcatc cgcgccgcag gaggcgcaaa cagtttcaca ttccaccagc caggttaaat 5520 ccggttcatt ggggtcaaaa acaagttttc cgccatattt tttgatgcgt ttcttacctt 5580 tggtctccat aagttcgtgt cctcgttgag tgaaaacag gctgtccgta tctccgtaga 5640 ctgattttac aggcctcttc tccagtggag tgcctcggtc ttcttcgtac aggaactctg 5700 accactctga tacaaggcg cgcgtccagg ccagcacaaa ggaggctatg tgggaggggt 5760 agcgatcgtt gtcaaccagg gggtccacct tttccaaagt atgcaaacac atgtcaccct 5820 cttcaacatc caggaatgtg attggcttgt aggtgtattt cacgtgacct ggggtccccg 5880 ctggggggt ataaaagggg gcggttcttt gctcttctc actgtcttcc ggatcgctgt 5940 ccaggaacgt cagctgttgg ggtaggtatt ccctctcgaa ggcgggcatg acctctgcac 6000 tcaggttgtc agtttctaag aacgaggagg atttgatatt gacagtgccg gttgagatgc 6060 ctttcatgag gttttcgtcc atttggtcag aaaacacaat ttttttattg tcaagtttgg 6120 tggcaaatga tccatacagg gcgttggata aaagtttggc aatggatcgc atggtttggt 6180 tcttttcctt gtccgcgcgc tctttggcgg cgatgttgag ttggacatac tcgcgtgcca 6240 ggcacttcca ttcggggaag atagttgtta attcatctgg cacgattctc acttgccacc 6300 ctcgattatg caaggtaatt aaatccacac tggtggccac ctcgcctcga aggggttcat 6360 tggtccaaca gagcctacct cctttcctag aacagaaagg gggaagtggg tctagcataa 6420 gttcatcggg agggtctgca tccatggtaa agattcccgg aagtaaatcc ttatcaaaat 6480 agctgatggg agtggggtca tctaaggcca tttgccattc tcgagctgcc agtgcgcgct 6540 catatgggtt aaggggactg ccccagggca tgggatgggt gagagcagag gcatacatgc 6600 cacagatgtc atagacgtag atgggatcct caaagatgcc tatgtaggtt ggatagcatc 6660 gcccccctct gatacttgct cgcacatagt catatagttc atgtgatggc gctagcagcc 6720 ccggacccaa gttggtgcga ttgggttttt ctgttctgta gacgatctgg cgaaagatgg 6780 cgtgagaatt ggaagagatg gtgggtcttt gaaaaatgtt gaaatgggca tgaggtagac 6840 ctacagagtc tctgacaaag tgggcataag attcttgaag cttggttacc agttcggcgg 6900 tgacaagtac gtctagggcg cagtagtcaa gtgtttcttg aatgatgtca taacctggtt 6960 ggtttttctt ttcccacagt tcgcggttga gaaggtattc ttcgcgatcc ttccagtact 7020 cttctagcgg aaacccgtct ttgtctgcac ggtaagatcc tagcatgtag aactgattaa 7080 ctgccttgta agggcagcag cccttctcta cgggtagaga gtatgcttga gcagcttttc 7140 gtagcgaagc gtgagtaagg gcaaaggtgt ctctgaccat gactttgaga aattggtatt 7200 tgaagtccat gtcgtcacag gctccctgtt cccagagttg gaagtctacc cgtttcttgt 7260 aggcggggtt gggcaaagcg aaagtaacat cattgaagag aatcttaccg gctctgggca 7320 taaaattgcg agtgatgcgg aaaggctgtg gtacttccgc tcgattgttg atcacctggg 7380 cagctaggac gatttcgtcg aaaccgttga tgttgtgtcc tacgatgtat aattctatga 7440 aacgcggcgt gcctctgacg tgaggtagct tactgagctc atcaaaggtt aggtctgtgg 7500 ggtcagataa ggcgtagtgt tcgagagccc attcgtgcag gtgaggattt gcatgtagga 7560 atgatgacca aagatctacc gccagtgctg tttgtaactg gtcccgatac tgacgaaaat 7620 gccggccaat tgccattttt tctggagtga cacagtagaa ggttctgggg tcttgttgcc 7680 atcgatccca cttgagttta atggctagat cgtgggccat gttgacgaga cgctcttctc 7740 ctgagagttt catgaccagc atgaaaggaa ctagttgttt gccaaaggat cccatccagg 7800 tgtaagtttc cacatcgtag gtcaggaaga gtctttctgt gcgaggatga gagccgatcg 7860 ggaagaactg gatttcctgc caccagttgg aggattggct gttgatgtga tggaagtaga 7920 agtttctgcg gcgcgccgag cattcgtgtt tgtgcttgta cagacggccg cagtagtcgc 7980 agcgttgcac gggttgtatc tcgtgaatga gctgtacctg gcttcccttg acgagaaatt 8040 tcagtgggaa gccgaggcct ggcgattgta tctcgtgctc ttctatattc gctgtatcgg 8100 cctgttcatc ttctgtttcg atggtggtca tgctgacgag cccccgcggg aggcaagtcc 8160 agacctcggc gcgggagggg cggagctgaa ggacgagagc gcgcaggctg gagctgtcca 8220 gagtcctgag acgctgcgga ctcaggttag taggtaggga cagaagatta acttgcatga 8280 tcttttccag ggcgtgcggg aggttcagat ggtacttgat ttccacaggt tcgtttgtag 8340 agacgtcaat ggcttgcagg gttccgtgtc ctttgggcgc cactaccgta cctttgtttt 8400 ttcttttgat cggtggtggc tctcttgctt cttgcatgct cagaagcggt gacggggacg 8460 cgcgccgggc ggcagcggtt gttccggacc cgggggcatg gctggtagtg gcacgtcggc 8520 gccgcgcacg ggcaggttct ggtattgcgc tctgagaaga cttgcgtgcg ccaccacgcg 8580 tcgattgacg tcttgtatct gacgtctctg ggtgaaagct accggccccg tgagcttgaa 8640 cctgaaagag agttcaacag aatcaatttc ggtatcgtta acggcagctt gtctcagtat 8700 ttcttgtacg tcaccagagt tgtcctggta ggcgatctcc gccatgaact gctcgatttc 8760 ttcctcctga agatctccgc gacccgctct ttcgacggtg gccgcgaggt cattggagat 8820 acggcccatg agttgggaga atgcattcat gcccgcctcg ttccagacgc ggctgtaaac 8880 cacggccccc tcggagtctc ttgcgcgcat caccacctga gcgaggttaa gctccacgtg 8940 tctggtgaag accgcatagt tgcataggcg ctgaaaaagg tagttgagtg tggtggcaat 9000 gtgttcggcg acgaagaaat acatgatcca tcgtctcagc ggcatttcgc taacatcgcc 9060 cagagcttcc aagcgctcca tggcctcgta gaagtccacg gcaaaattaa aaaactggga 9120 gtttcgcgcg gacacggtca attcctcctc gagaagacgg atgagttcgg ctatggtggc 9180 ccgtacttcg cgttcgaagg ctcccgggat ctcttcttcc tcttctatct cttcttccac 9240 taacatctct tcttcgtctt caggcggggg cggagggggc acgcggcgac gtcgacggcg 9300 cacgggcaaa cggtcgatga atcgttcaat gacctctccg cggcggcggc gcatggtttc 9360 agtgacggcg cggccgttct cgcgcggtcg cagagtaaaa acaccgccgc gcatctcctt 9420 aaagtggtga ctgggaggtt ctccgtttgg gagggagagg gcgctgatta tacattttat 9480 taattggccc gtagggactg cgcgcagaga tctgatcgtg tcaagatcca cgggatctga 9540 aaacctttcg acgaaagcgt ctaaccagtc acagtcacaa ggtaggctga gtacggcttc 9600 ttgtgggcgg gggtggttat gtgttcggtc tgggtcttct gtttcttctt catctcggga 9660 aggtgagacg atgctgctgg tgatgaaatt aaagtaggca gttctaagac ggcggatggt 9720 ggcgaggagc accaggtctt tgggtccggc ttgctggata cgcaggcgat tggccattcc 9780 ccaagcatta tcctgacatc tagcaagatc tttgtagtag tcttgcatga gccgttctac 9840 gggcacttct tcctcacccg ttctgccatg catacgtgtg agtccaaatc cgcgcattgg 9900 ttgtaccagt gccaagtcag ctacgactct ttcggcgagg atggcttgct gtacttgggt 9960 aagggtggct tgaaagtcat caaaatccac aaagcggtgg taagcccctg tattaatggt 10020 gtaagcacag ttggccatga ctgaccagtt aactgtctgg tgaccagggc gcacgagctc 10080 ggtgtattta aggcgcgaat aggcgcgggt gtcaaagatg taatcgttgc aggtgcgcac 10140 cagatactgg taccctataa gaaaatgcgg cggtggttgg cggtagagag gccatcgttc 10200 tgtagctgga gcgccagggg cgaggtcttc caacataagg cggtgatagc cgtagtgta cctggacatc caggtgattc ctgcggcggt agtagcc cgaggaact cgcgtacgcg 10320 gttccaaatg ttgcgtagcg gcatgaagta gttcattgta ggcacggttt gaccagtgag gcgcgcgcag tcattgatgc tctatagaca cggagaaaat gaaagcgttc agcgactcga ctccgtagcc tggaggacg tgaacggggtt gggtcgcggt gtaccccggt tcgagacttg 10500. tactcgagcc ggccggagcc gcggctaacg tggtattggc actcccgtct cgacccagcc 10560 tacaaaaatc caggatacgg aatcgagtcg ttttgctggt ttccgaatgg caggagtg agtcctattt tttttttttt tttgccgctc agatgcatcc cgtgctgcga cagatgcgcc 10680 cccaacaaca gcccccctcg cagcagcagc agcagcaacc acaaaaggct gtccctgcaa ctactgcaac tgccgccgtg agcggtgcgg gacagcccgc ctatgatctg gacttggaag agggcgaagg actggcacgt ctaggtgcgc cttcgcccga gcggcatccg cgagttcaac 10860 tgaaaaaaga ttctcgcgag gcgtatgtgc cccaacagaa cctatttaga gacagaagcg gcgaggagcc ggaggagatg cgagcttccc gctttaacgc gggtcgtgag ctgcgtcacg 10980 gtttggaccg aagacgagtg ttgcgagacg aggatttcga agttgatgaa gtgacaggga 11040 tcagtcctgc cagggcacac gtggctgcag ccaaccttgt atcggcttac gagcagacag 11100 taaaggaaga gcgtaacttc caaaagtctt ttaataatca tgtgcgaacc ctgattgccc 11160 gcgaagaagt tacccttggt ttgatgcatt tgtgggattt gatggaagct atcattcaga 11220 accctactag caaacctctg accgcccagc tgtttctggt ggtgcaacac agcagagaca 11280 atgaggcttt cagagaggcg ctgctgaaca tcaccgaacc cgaggggaga tggttgtatg 11340 atcttatcaa cattctacag agtatcatag tgcaggagcg gagcctgggc ctggccgaga 11400 aggtagctgc catcaattac tcggttttga gcttgggaaa atattacgct cgcaaaatct 11460 acaagactcc atacgttccc atagacaagg aggtgaagat agatgggttc tacatgcgca 11520 tgacgctcaa ggtcttgacc ctgagcgatg atcttggggt gtatcgcaat gacagaatgc 11580 atcgcgcggt tagcgccagc aggaggcgcg agttagcga cagggaactg atgcacagtt 11640. tgcaaagagc tctgactgga gctggaaccg agggtgagaa ttacttcgac atgggagctg acttgcagtg gcagcctagt cgcagggctc tgagcgccgc gacggcagga tgtgagcttc 11760 cttacataga agaggcggat gaaggcgagg aggaagaggg cgagtacttg gaagactgat ggcacaaccc gtgttttttg ctagatggaa cagcaagcac cggatcccgc aatgcgggcg gcgctgcaga gccagccgtc cggcattaac tcctcggacg attggaccca ggccatgcaa cgtatcatgg cgttgacgac tcgcaacccc gaagccttta gacagcaacc ccaggccaac cgtctatcgg ccatcatgga agctgtagtg ccttcccgat ctaatcccac tcatgagaag gtcctggcca tcgtgaacgc gttggtggag aacaaagcta ttcgtccaga tgaggccgga ctggtataca acgctctctt agaacgcgtg gctcgctaca acgtagcaa tgtgcaaacc aatttggacc gtatgataac agatgtacgc gaagccgtgt ctcagcgcga aaggttccag cgtgatgcca acctgggttc gctggtggcg ttaatgctt tcttgagtac tcagcctgct aatgtgccgc gtggtcaaca ggattatact aactttttaa gtgctttgag actgatggta 12360 tcagaagtac ctcagagcga agtgtatcag tccggtcctg attacttctt tcagactagc 12420 agacagggct tgcagacggt aaatctgagc caagctttta aaaaccttaa aggtttgtgg 12480 ggagtgcatg ccccggtagg agaaagagca accgtgtcta gcttgttaac tccgaactcc 12540 cgcctgttat tactgttggt agctcctttc accgacagcg gtagcatcga ccgtaattcc 12600 tatttgggtt acctactaaa cctgtatcgc gaagccatag ggcaaagtca ggtggacgag 12660 cagacctatc aagaaattac ccaagtcagt cgcgctttgg gacaggaaga cactggcagt 12720 ttggaagcca ctctgaactt cttgcttacc aatcggtctc aaaagatccc tcctcaatat 12780 gctcttactg cggaggagga gaggatcctt agatatgtgc agcagagcgt gggattgttt 12840 ctgatgcaag agggggcaac tccgactgca gcactggaca tgacagcgcg aaatatggag 12900 cccagcatgt atgccagtaa ccgacctttc attaacaaac tgctggacta cttgcacaga 12960 gctgccgcta tgaactctga ttatttcacc aatgccatct taaacccgca ctggctgccc 13020 ccacctggtt tctacacggg cgaatatgac atgcccgacc ctaatgacgg atttctgtgg 13080 gacgacgtgg acagcgatgt tttttcacct ctttctgatc atcgcacgtg gaaaaaggaa 13140 ggcggtgata gaatgcattc ttctgcatcg ctgtccgggg tcatgggtgc taccgcggct 13200 gagcccgagt ctgcaagtcc ttttcctagt ctaccctttt ctctacacag tgtacgtagc 13260 agcgaagtgg gtagaataag tcgcccgagt ttaatgggcg aagaggagta cctaaacgat 13320 tccttgctca gaccggcaag agaaaaaaat ttcccaaaca atggaataga aagtttggtg 13380 gataaaatga gtagatggaa gacttatgct caggatcaca gagacgagcc tgggatcatg 13440 gggactacaa gtagagcgag ccgtagacgc cagcgccatg acagacagag gggtcttgtg 13500 tgggacgatg aggattcggc cgatgatagc agcgtgttgg acttgggtgg gagaggaagg 13560 ggcaacccgt ttgctcattt gcgccctcgc ttgggtggta tgttgtgaaa aaaaataaaa 13620 aagaaaaact caccaaggcc atggcgacga gcgtacgttc gttcttcttt attatctgtg 13680 tctagtataa tgaggcgagt cgtgctaggc ggagcggtgg tgtatccgga gggtcctcct 13740 ccttcgtacg agagcgtgat gcagcagcag caggcgacgg cggtgatgca atccccactg 13800 gaggctccct ttgtgcctcc gcgatacctg gcacctacgg agggcagaaa cagcattcgt 13860 tactcggaac tggcacctca gtacgatacc accaggttgt atctggtgga caacaagtcg 13920 gcggacattg cttctctgaa ctatcagaat gaccacagca acttcttgac cacggtggtg 13980 cagaacaatg actttacccc tacggaagcc agcacccaga ccattaactt tgatgaacga 14040 tcgcggtggg gcggtcagct aaagaccatc atgcatacta acatgccaaa cgtgaacgag 14100 tatatgttta gtaacaagtt caaagcgcgt gtgatggtgt ccagaaaacc tcccgacggt 14160 gctgcagttg gggatactta tgatcacaag caggatattt tggaatatga gtggttcgag 14220 tttactttgc cagaaggcaa cttttcagtt actatgacta ttgatttgat gaacaatgcc 14280 atcatagata attacttgaa agtgggtaga cagaatggag tgcttgaaag tgacattggt 14340 gttaagttcg acaccaggaa cttcaagctg ggatgggatc ccgaaaccaa gttgatcatg 14400 cctggagtgt atacgtatga agccttccat cctgacattg tcttactgcc tggctgcgga 14460 gtggatttta ccgagagtcg tttgagcaac cttcttggta tcagaaaaaa acagccattt 14520 caagagggtt ttaagatttt gtatgaagat ttagaaggtg gtaatattcc ggccctcttg 14580 gatgtagatg cctatgagaa gatagaaa gaacaaaaag ccaaaataga agctgctaca 14640 gctgctgcag aagctaaggc aaacatagtt gccagcgact ctacaagggt tgctaacgct 14700 ggagaggtca gaggagacaa ttttgcgcca acacctgttc cgactgcaga atcattattg 14760 gccgatgtgt ctgaaggaac ggacgtgaaa ctcactattc aacctgtaga aaaagatagt 14820 aagaatagaa gctataatgt gttggagac aaaatcaaca cagcctatcg cagttggtat 14880 ctttcgtaca attatggcga tcccgaaaaa ggagtgcgtt cctggacatt gctcaccacc 14940 tcagatgtca cctgcggagc agagcaggtt tactggtcgc ttccagacat gatgaaggat 15000 cctgtcactt tccgctccac tagacaagtc agtaactacc ctgtggtggg tgcagagctt 15060 atgcccgtct tctcaaagag cttctacaac gaacaagctg tgtactccca gcagctccgc 15120 cagtccacct cgcttacgca cgtcttcaac cgctttcctg agaaccagat tttaatccgt 15180 ccgccggcgc ccaccattac caccgtcagt gaaaacgttc ctgctctcac agatcacggg 15240 accctgccgt tgcgcagcag tatccgggga gtccaacgtg tgaccgttac tgacgccaga 15300 cgccgcacct gtccctacgt gtacaaggca ctgggcatag tcgcaccgcg cgtcctttca 15360 agccgcactt tctaaaaaaa aaaaatgtcc attcttatct cgcccagtaa taacaccggt 15420 tggggtctgc gcgctccaag caagatgtac ggaggcgcac gcaaacgttc tacccaacat 15480 cccgtgcgtg ttcgcggaca ttttcgcgct ccatggggtg ccctcaaggg ccgcactcgc 15540 gttcgaacca ccgtcgatga tgtaatcgat caggtggttg ccgacgcccg taattatact 15600 cctactgcgc ctacatctac tgtggatgca gttattgaca gtgtagtggc tgacgctcgc 15660 aactatgctc gacgtaagag ccggcgaagg cgcattgcca gacgccaccg agctaccact 15720 gccatgcgag ccgcaagagc tctgctacga agagctagac gcgtggggcg aagagccatg 15780 cttagggcgg ccagacgtgc agcttcgggc gccagcgccg gcaggtcccg caggcaagca 15840 gccgctgtcg cagcggcgac tattgccgac atggcccaat cgcgaagagg caatgtatac 15900 tgggtgcgtg acgctgccac cggtcaacgt gtacccgtgc gcaccgtcc ccctcgcact 15960 tagagatac tgagcagtct ccgatgttgt gtcccagcgg cgaggatgtc caagcgcaaa 16020 tacaaggaag aaatgctgca ggttatcgca cctgaagtct acggccaacc gttgaaggat 16080 gaaaaaaaac cccgcaaaat caagcgggtt aaaaaggaca aaaaaagaaga ggaagatggc 16140 gatgatgggc tggcggagtt tgtgcgcgag tttgccccac ggcgacgcgt gcaatggcgt 16200 gggcgcaaag ttcgacatgt gttgagacct ggaacttcgg tggtctttac acccggcgag 16260 cgttcaagcg ctacttttaa gcgttcctat gatgaggtgt acggggatga tgatatctt 16320 gagcaggcgg ctgaccgatt aggcgagttt gcttatggca agcgtagtag aataacttcc 16380 aggatgaga cagtgtcaat acccttggat catggaaatc ccacccctag tcttaaaccg 16440 gtcactttgc agcaagtgtt acccgtaact ccgcgaacag gtgttaaacg cgaaggtgaa 16500 gatttgtatc ccactatgca actgatggta cccaaacgcc agaagttgga ggacgttttg 16560 gagaaagtaa aagtggatcc agatattcaa cctgaggtta aagtgagacc cattaagcag 16620 gtagcgcctg gtctgggggt acaaactgta gacattaaga ttcccactga aagtatggaa 16680 gtgcaaactg aacccgcaaa gcctactgcc acctccactg aagtgcaaac ggatccatgg 16740 atgcccatgc ctattacaac tgacgccgcc ggtcccactc gaagatcccg acgaaagtac 16800 ggtccagcaa gtctgttgat gcccaattat gttgtacacc catctattat tcctactcct 16860 ggttaccgag gcactcgcta ctatcgcagc cgaaacagta cctcccgccg tcgccgcaag 16920 acacctgcaa atcgcagtcg tcgccgtaga cgcacaagca aaccgactcc cggcgccctg 16980 gtgcggcaag tgtaccgcaa tggtagtgcg gaacctttga cactgccgcg tgcgcgttac 17040 catccgagta tcatcactta atcaatgttg ccgctgcctc cttgcagata tggccctcac 17100 ttgtcgcctt cgcgttccca tcactggtta ccgagaagaa aactcgcgcc gtaagaagagg 17160 gatgttggga cgcggaatgc gacgctacag gcgacggcgt gctatccgca agcaattgcg 17220 gggtggtttt ttaccagcct taattccaat tatcgctgct gcaattggcg cgataccagg 17280 catagcttcc gtggcggttc aggcctcgca acgacattga cattggaaaa aaaacgtata 17340 aataaaaaaa aataacaatgg actctgacac tcctggtcct gtgactatgt tttcttagag 17400 atggaagaca tcaatttttc atccttggct ccgcgacacg gcacgaagcc gtacatgggc 17460 acctggagcg acatcggcac gagccaactg aacggggcg ccttcaattg gagcagtatc 17520 tggagcgggc ttaaaaattt tggctcaacc ataaaacat acgggaacaa agcttggaac 17580 agcagtacag gacaggcgct tagaaataa cttaaagacc agaacttcca acaaaaagta 17640 gtcgatggga tagcttccgg catcaatgga gtggtagatt tggctaacca ggctgtgcag 17700 aaaaagataa acagtcgttt ggacccgccg ccagcaaccc caggtgaaat gcaagtggag 17760 gaagaaattc ctccgccaga aaaacgaggc gacaagcgtc cgcgtcccga tttggaaag 17820 acgctggtga cgcgcgtaga tgaaccgcct tcttatgagg aagcaacgaa gcttggaatg 17880 cccaccacta gaccgatagc cccaatggcc accggggtga tgaaaccttc tcagttgcat 17940 cgacccgtca ccttggattt gccccctccc cctgctgcta ctgctgtacc cgcttctaag 18000 cctgtcgctg ccccgaaacc agtcgccgta gccaggtcac gtcccggggg cgctcctcgt 18060 ccaaatgcgc actggcaaaa tactctgaac agcatcgtgg gtctaggcgt gcaaagtgta 18120 aaacgccgtc gctgctttta attaaatatg gagtagcgct taacttgcct atctgtgtat 18180 atgtgtcatt acacgccgtc acagcagcag aggaaaaaag gaagaggtcg tgcgtcgacg 18240 ctgagttact ttcaagatgg ccaccccatc gatgctgccc caatgggcat acatgcacat 18300 cgccggacag gatgcttcgg agtacctgag tccgggtctg gtgcagttcg cccgcgccac 18360 agacacctac ttcaatctgg gaaataagtt tagaaatccc accgtagcgc cgacccacga 18420 tgtgaccacc gaccgtagcc agcggctcat gttgcgcttc gtgcccgttg accgggagga 18480 caatacatac tcttacaaag tgcggtacac cctggccgtg ggcgacaaca gagtgctgga 18540 tatggccagc acgttctttg acattagggg cgtgttggac agaggtccca gttcaacc 18600 ctattctggt acggcttaca actctctggc tcctaaggc gctcaatg catctcaatg 18660 gattgcaaaa ggcgtaccaa ctgcagcagc cgcaggcaat ggtgagaag aacatgaaac 18720 agaggagaaa actgctactt acactttgc caatgctcct gtaaaagccg aggctcaat 18780 tacaaagag ggcttaccaa taggtttgga gatttcagct gaaaacgaat ctaaacccat 18840 ctatgcagat aaactttac agccagacc tcaagtggga gatgaactt ggactgacct 18900 agacggaaaa accgaaggt atggaggcag ggctctaaag cctacta acatgaaacc 18960 ctgttacgggg tcctatgcga agcctactaa tttaaaaggt ggtcaggcaa aaccgaaaaa 19020 ctcggaaccg tcgagtgaa aaattgaata tgatattgac atggaattttt ttgataactc 19080 atcgcaaga acaaacttca gtcctaaaat tgtcatgtat gcagaaatg taggtttgga 19140 aacgccagac actcatgtag tgtacaacc tggacagaa gacaagtt ccgaagctaa 19200 tttgggacaa cagtctatgc ccaacagacc caactacatt ggcttcagag ataactttat 19260 tggactcatg tactataaca gtactggtaa catgggggtg ctggctggtc aagcgtctca 19320 gttaaatgca gtggttgact tgcaggacag aaacacagaa cttcttacc aactcttgct 19380 tgactctctg ggcgacagaa ccagatactt tagcatgtgg aatcaggctg tggacagtta 19440 tgatcctgat gtacgtgtta ttgaaaatca tggtgtggaa gatgaacttc ccaactattg 19500 ttttccactg gacggcatag gtgttccaac aaccagttac aaatcaatag ttccaaatgg 19560 agaagataat aataattgga aagaacctga agtaaatgga acaagtgaga tcggacaggg 19620 taatttgttt gccatggaaa ttaaccttca agccaatcta tggcgaagtt tcctttattc 19680 caatgtggct ctgtatctcc cagactcgta caaatacacc ccgtccaatg tcactcttcc 19740 agaaaacaaa aacacctacg actacatgaa cgggcgggtg gtgccgccat ctctagtaga 19800 cacctatgtg aacattggtg ccaggtggtc tctggatgcc atggacaatg tcaacccatt 19860 caaccaccac cgtaacgctg gcttgcgtta ccgatctatg cttctgggta acggacgtta 19920 tgtgccttc cacatacaag tgcctcaaaa attcttcgct gttaaaaacc tgctgcttct 19980 cccaggctcc tacacttatg agtggaactt taggaaggat gtgaacatgg ttctacagag 20040 ttccctcggt aacgacctgc gggtagatgg cgccagcatc agttcacga gcatcaacct 20100 ctatgctact ttttcccca tggctcacaa caccgcttcc acccttgaag ccatgctgcg 20160 gaatgacacc aatgatcagt cattcaacga ctacctatct gcagctaaca tgctctaccc 20220 cattcctgcc aatgcaacca atattcccat ttccattcct tctcgcaact gggcggcttt 20280 cagaggctgg tcatttacca gactgaaaac caaagaaact ccctctttgg ggtctggatt 20340 tgaccctac tttgtctatt ctggttctat tccctacctg gatggtacct tctacctgaa 20400 ccacacttt aagaaggttt ccatcatgtt tgactcttca gtgagctggc ctggaaatga 20460 caggttacta tctcctaacg aatttgaaat aaagcgcact gtggatggcg aaggctacaa 20520 cgtagcccaa tgcaacatga ccaaagactg gttcttggta cagatgctcg ccaactacaa 20580 catcggctat cagggcttct acattccaga aggatacaaa gatcgcatgt attcattttt cagaaacttc cagcccatga gcaggcaggt ggttgatgag gtcaattaca aagacttcaa ggccgtcgcc ataccctacc grandmother ctctggcttt gtgggttaca tggctccgac 20760 catgcgcca ggtcaaccct atcccgcta ctatccctat ccactcattg gacaactgc 20880. cgtaatagt gttacgcaga aaaagttctt gtgtgacaga accatgtggc gcataccgtt ctcgagcaac ttcatgtcta tgggggccct tacagacttg ggacagaata tgctctatgc caactcagct catgctctgg acatgacctt tgaggtggat cccatggatg agcccaccct gctttatctt ctcttcgaag ttttcgacgt ggtcagagtg catcagccac accgcggcat 21120. catcgaggca gtctacctgc gtacaccgtt ctcggccggt aacgctacca cgtaagaagc ttcttgcttc ttgcaaatag cagctgcaac catggcctgc ggatcccaaa acggctccag 21240. cgagcaagag ctcagagcca ttgtccaaga cctgggttgc ggaccctatt ttttgggac ctacgataag cgcttcccgg ggttcatggc ccccgataag ctcgcctgtg ccattgtaaa 21300 tacggccgga cgtgagacgg ggggagagca ctggttggct ttcggttgga acccacgttc 21360 taacacctgc tacctttttg atccttttgg attctcggat gatcgtctca aacagattta 21420 ccagtttgaa tatgagggtc tcctgcgccg cagcgctctt gctaccaagg accgctgtat 21480 tacgctggaa aaatctaccc agaccgtgca gggcccccgt tctgccgcct gcggactttt 21540 ctgctgcatg ttccttcacg cctttgtgca ctggcctgac cgtcccatgg acggaaaccc 21600 caccatgaaa ttgctaactg gagtgccaaa caacatgctt cattctccta aagtccagcc 21660 caccctgtgt gacaatcaaa aagcactcta ccattttctt aatacccatt cgccttattt 21720 tcgctctcat cgtacacaca tcgaaagggc cactgcgttc gaccgtatgg atgttcaata 21780 atgactcatg taaacaacgt gttcaataaa catcacttta tttttttaca tgtatcaagg 21840 ctctggatta cttatttatt tacaagtcga atgggttctg acgagaatca gaatgacccg 21900 caggcagtga tacgttgcgg aactgatact tgggttgcca cttgaattcg ggaatcacca 21960 acttgggaac cggtatatcg ggcaggatgt cactccacag ctttctggtc agctgcaaag 22020 ctccaagcag gtcaggagcc gaaatcttga aatcacaatt aggaccagtg ctctgagcgc 22080 gagagttgcg gtacaccgga ttgcagcact gaaacaccat cagcgacgga tgtctcacgc 22140 ttgccagcac ggtgggatct gcaatcatgc ccacatccag atcttcagca ttggcaatgc 22200 tgaacggggt catcttgcag gtctgcctac ccatggcggg cacccaatta ggcttgtggt 22260 tgcaatcgca gtgcaggggg atcagtatca tcttggcctg atcctgtctg attcctggat 22320 acacggctct catgaaagca tcatattgct tgaaagcctg ctgggcttta ctaccctcgg 22380 tataaaacat cccgcaggac ctgctcgaaa actggttagc tgcacagccg gcatcattca 22440 cacagcagcg ggcgtcattg ttggctattt gcaccacact tctgccccag cggttttggg 22500 tgattttggt tcgctcggga ttctccttta aggctcgttg tccgttctcg ctggccacat 22560 ccatctcgat aatctgctcc ttctgaatca taatattgcc atgcaggcac ttcagcttgc 22620 cctcataatc attgcagcca tgaggccaca acgcacagcc tgtacattcc caattatggt 22680 gggcgatctg agaaaaagaa tgtatcattc cctgcagaaa tcttcccatc atcgtgctca 22740 gtgtcttgtg actagtgaaa gttaactgga tgcctcggtg ctcttcgttt acgtactggt 22800 gacagatgcg cttgtattgt tcgtgttgct caggcattag tttaaaacag gttctaagtt 22860 cgttatccag cctgtacttc tccatcagca gacacatcac ttccatgcct ttctcccaag 22920 cagacaccag gggcaagcta atcggattct taacagtgca ggcagcagct cctttagcca 22980 gagggtcatc tttagcgatc ttctcaatgc ttcttttgcc atccttctca acgatgcgca 23040 cgggcgggta gctgaaaccc actgctacaa gttgcgcctc ttctctttct tcttcgctgt 23100 cttgactgat gtcttgcatg gggatatgtt tggtcttcct tggcttcttt ttggggggta 23160 tcggaggagg aggactgtcg ctccgttccg gagacaggga ggattgtgac gttcgctca 23220 ccattaccaa ctgactgtcg gtagaagaac ctgaccccac acggcgacag gtgtttttct 23280 tcgggggcag aggtggaggc gattgcgaag ggctgcggtc cgacctggaa ggcggatgac 23340 tggcagaacc ccttccgcgt tcgggggtgt gctccctgtg gcggtcgctt aactgatttc 23400 cttcgcggct ggccattgtg ttctcctagg cagagaaaca acagacatgg aaactcagcc 23460 attgctgtca acatcgccac gagtgccatc acatctcgtc ctcagcgacg aggaaaagga 23520 gcagagctta agcattccac cgcccagtcc tgccaccacc tctaccctag aagataagga 23580 ggtcgacgca tctcatgaca tgcagaataa aaaagcgaaa gagtctgaga cagacatcga 23640 gcaagacccg ggctatgtga caccggtgga acacgaggaa gagttgaaac gctttctaga 23700 gagagaggat gaaaactgcc caaaacagcg agcagataac tatcaccaag atgctgggaaa 23760 tagggatcag aacaccgact acctcatagg gcttgacggg gaagacgcgc tccttaaaca 23820 tctagcaaga cagtcgctca tagtcaagga tgcattattg gacagaactg aagtgcccat 23880 cagtgtggaa gagctcagct gcgcctacga gcttaacctt ttttcacctc gtactccccc 23940 caaacgtcag ccaaacggca cctgcgagcc aaatcctcgc ttaaactttt atccagcttt 24000 tgctgtgcca gaagtactgg ctacctatca catctttttt aaaaatcaaa aaattccagt 24060 ctcctgccgc gctaatcgca cccgcgccga tgccctactc aatctgggac ctggttcacg 24120 cttacctgat atagcttcct tggaagaggt tccaaagatc ttcgagggtc tgggcaataa 24180 tgagactcgg gccgcaaatg ctctgcaaaa gggagaaaat ggcatggatg agcatcacag 24240 cgttctggtg gaattggaag gcgataatgc cagactcgca gtactcaagc gaagcgtcga 24300 ggtcacacac ttcgcatatc ccgctgtcaa cctgccccct aaagtcatga cggcggtcat 24360 ggaccagtta ctcattaagc gcgcaagtcc cctttcagaa gacatgcatg acccagatgc 24420 ctgtgatgag ggtaaaccag tggtcagtga tgagcagcta acccgatggc tgggcaccga 24480 ctctccccgg gatttggaag agcgtcgcaa gcttatgatg gccgtggtgc tggttaccgt 24540 agaactagag tgtctccgac gtttctttac cgattcagaa accttgcgca aactcgaaga 24600 gaatctgcac tacactttta gacacggctt tgtgcggcag gcatgcaaga tatctaacgt 24660 ggaactcacc aacctggttt cctacatggg tattctgcat gagaatcgcc taggacaaag 24720 cgtgctgcac agcaccctta agggggaagc ccgccgtgat tacatccgcg attgtgtcta 24780 tctctacctg tgccacacgt ggcaaaccgg catgggtgta tggcagcaat gtttagaaga 24840 acagaacttg aaagagcttg acaagctctt acagaaatct cttaaggttc tgtggacagg 24900 gttcgacgag cgcaccgtcg cttccgacct ggcagacctc atcttcccag agcgtctcag 24960 ggttactttg cgaaacggat tgcctgactt tatgagccag agcatgctta acaattttcg 25020 ctctttcatc ctggaacgct ccggtatcct gcccgccacc tgctgcgcac tgccctccga 25080 ctttgtgcct ctcacctacc gcgagtgccc cccgccgcta tggagtcact gctacctgtt 25140 ccgtctggcc aactatctct cctaccactc ggatgtgatc gaggatgtga gcggagacgg 25200 cttgctggag tgccactgcc gctgcaatct gtgcacgccc caccggtccc tagcttgcaa 25260 cccccagttg atgagcgaaa cccagataat aggcaccttt gaattgcaag gccccagcag 25320 ccaaggcgat gggtcttctc ctgggcaaag tttaaaactg accccgggac tgtggacctc 25380 cgcctacttg cgcaagtttg ctccggaga ttaccacccc tatgaaatca agttctatga ggaccaatca cagcctccaa aggccgaact ttcggcttgc gtcatcaccc aggggcaat tctggcccaa ttgcaagcca tccaaaaatc ccgccaaaga tttctactga aaaagggtaa gggggtctac cttgaccccc agaccggcga ggaactcaac acaaggttcc ctcaggatgt cccaacgacg agaaaacaag aagttgaagg tgcagccgcc gcccccaga gatatggagg aagattggga cagtcaggca gaggaggcgg aggaggacag tctggaggac agtctggagg 25740 aagacagttt ggaggagga aacgaggagg cagaggaggt ggaggagta accgccgaca aacagttatc ctcggctgcg gagacagca acagcgctac catctccgct ccgagtcgag gaacccggcg gcgtcccagc buyggg acgagaccgg acgcttcccg aacccaacca 25920 gcgcttccaa gaccggtaag aaggatcggc aggatacaa gtcctggcgg gggcataag 25980 atgccatcat ctcctgcttg catgagtgcg ggggcaacat atccttcacg cggcgctact tgctattcca ccatggggtg aactttccgc gcaatgtttt gcattactac cgtcacctcc acagccccta ctatagccag caaatcccga cagtctcgac agtaaagac agcggcggcg acctccaaca gaaaaccagc agcggcagtt agaaaataca caacaagtgc agcaacagga ggattaaga ttacagccaa cgagccagcg caaacccgag agttaagaa tcggatcttt ccaccctgt atgccatctt ccgcagagt cggggtcaag agcaggaact gaaataaaa aaccgatctc tgcgttcgct caccagagt tgtttgtatc acaagagcga agatcaactt cagcgcactc tcgaggacgc cgaggctctc ttcaacaagt actgcgcgct gactcttaaa gagtaggcag cgaccgcgct tattcaaaaa aggcgggat tacatcatcc tcgacatgag taaagaaatt cccacgcctt acatgtggag ttatcaaccc caaatggggat tggcagcagg cgcctcccag gactactcca cccgcatgaa ttggctcagc gccgggcctt ctatgatttc tcgagttaat throwcgcg cctaccgaaa ccaaatactt ttggaacagt cagctcttac 26760. cgcgccc cgccccc ttaatcccag aaattggccc gccgccctag tgtaccagga aagtcccgct cccaccactg tattacttcc tcgagacgcc caggccgaag tccaaatgac 26820 taatgcaggt gcgcagttag ctggcggctc caccctatgt cgtcacaggc ctcggcataa 26880 tataaaacgc ctgatgatca gaggccgagg tatccagctc aacgacgagt cggtgagctc 26940 tccgcttggt ctacgaccag acggaatctt tcagattgcc ggctgcggga gatcttcctt 27000 cacccctcgt caggctgttc tgactttgga aagttcgtct tcgcaacccc gctcgggcgg 27060 aatcgggacc gttcaatttg tagaggagtt tactccctct gtctacttca accccttctc 27120 cggatctcct gggcactacc cggacgagtt cataccgaac ttcgacgcga ttagcgagtc 27180 agtggacggc tacgattgat gtctggtgac gcggctgagc tatctcggct gcgacatcta 27240 gaccactgcc gccgctttcg ctgctttgcc cgggaactta ttgagttcat ctacttcgaa 27300 ctccccaagg atcaccctca aggtccggcc cacggagtgc ggattactat cgaaggcaaa 27360 atagactctc gcctgcaacg aattttctcc cagcggcccg tgctgatcga gcgagaccag 27420 ggaaacacca cggtttccat ctactgcatt tgtaatcacc ccggattgca tgaaagcctt 27480 tgctgtctta tgtgtactga gtttaataaa aactgaatta agactctcct acggactgcc 27540 gcttcttcaa cccggatttt acaaccagaa gaacaaaact tttcctgtcg tccaggactc 27600 tgttaacttc acctttccta ctcacaaact agaagctcaa cgactacacc gcttttccag 27660 aagcattttc cctactaata ctactttcaa aaccggaggt gagctccacg gtctccctac 27720 agaaaaccct tgggtggaag cgggccttgt agtactagga attcttgcgg gtgggcttgt 27780 gattattctt tgctacctat acacaccttg cttcactttc ctagtggtgt tgtggtattg 27840 gtttaaaaaa tggggcccat actagtcttg cttgttttac tttcgctttt ggaaccgggt 27900 tctgccaatt acgatccatg tctagacttt gacccagaaa actgcacact tacttttgca 27960 cccgacacaa gccgcatctg tggagttctt attaagtgcg gatgggaatg caggtccgtt 28020 gaaattacac acaataacaa aacctggaac aataccttat ccaccacatg ggagccagga 28080 gttcccgagt ggtacactgt ctctgtccga ggtcctgacg gttccatccg cattagtaac 28140 aacactttca ttttttctga aatgtgcgat ctggccatgt tcatgagcaa acagtattct 28200 ctatggcctc ctagcaagga caacatcgta acgttctcca ttgcttattg cttgtgcgct 28260 tgccttctta ctgctttact gtgcgtatgc atacacctgc ttgtaaccac tcgcatcaaa 28320 aacgccaata acaaagaaaa aatgccttaa cctctttctg tttacagaca tggcttctct 28380 tacatctctc atatttgtca gcattgtcac tgccgctcac ggacaaacag tcgtctctat 28440 cccactagga cataattaca ctctcatagg acccccaatc acttcagagg tcatctggac 28500 caaactggga agcgttgatt actttgatat aatctgtaac aaaacaaaac caataatagt 28560 aacttgcaac atacaaaatc ttacattgat taatgttagc aaagtttaca gcggttacta 28620 ttatggttat gacagataca gtagtcaata tagaaattac ttggttcgtg ttacccagtt 28680 gaaaaccacg aaaatgccaa atatggcaaa gattcgatcc gatgacaatt ctctagaaac 28740 ttttacatct cccaccacac ccgacgaaaa aaacatccca gattcaatga ttgcaattgt 28800 tgcagcggtg gcagtggtga tggcactaat aataatatgc atgcttttat atgcttgtcg 28860 ctacaaaaaag tttcatccta aaaaacaaga tctcctacta aggcttaaca tttaatttct 28920 ttttatacag ccatggtttc cactaccaca ttccttatgc ttactagtct cgcaactctg 28980 acttctgctc gctcacacct cactgtaact ataggctcaa actgcacact aaaaggacct 29040 caaggtggtc atgtcttttg gtggagaata tatgacaatg gatggtttac aaaaccatgt 29100 gaccaacctg gtagattttt ctgcaacggc agagacctaa ccattatcaa cgtgacagca 29160 aatgacaaag gcttctatta tggaaccgac tataaaaagta gtttagatta taacattat 29220 gtactgccat ctaccactcc agcaccccgc acaactactt tctctagcag cagtgtcgct 29280 aacaatacaa tttccaatcc aacctttgcc gcgcttttaa aacgcactgt gaataattct 29340 acaacttcac atacaacaat ttccacttca acaatcagca tcatcgctgc agtgacaatt 29400 ggaatatcta ttcttgttt taccataacc tactacgcct gctgctatag aaaagacaaa 29460 cataaaggtg atccattact tagatttgat atttaatttg ttctttttt ttatttacag 29520 tatggtgaac accaatcatg gtacctagaa atttcttctt caccatactc atctgtgctt 29580 ttaatgtttg cgctactttc acagcagtag ccacagcaac cccagactgt ataggagcat 29640 ttgcttccta tgcacttttt gcttttgtta cttgcatctg cgtatgtagc atagtctgcc 29700 tggttattaa ttttttccaa cttctagact ggatccttgt gcgaattgcc tacctgcgcc 29760 accatcccga ataccgcaac caaaatatcg cggcacttct tagactcatc taaaaccatg 29820 caggctatac taccaatatt tttgcttcta ttgcttccct acgctgtctc aaccccagct 29880 gcctatagta ctccaccaga acaccttaga aaatgcaaat tccaacaacc gtggtcattt 29940 cttgcttgct atcgagaaaa atcagaaatc cccccaaatt taataatgat tgctggaata 30000 attaatataa tctgttgcac cataatttca tttttgatat accccctatt tgattttggc 30060 tggaatgctc ccaatgcaca tgatcatcca caagacccag aggaacacat tcccccacaa 30120 aacatgcaac atccaatagc gctaatagat tacgaaagtg aaccacaacc cccactactc 30180 cctgctatta gttacttcaa cctaaccggc ggagatgact gaaacactca ccacctccaa 30240 ttccgccgag gatctgctcg atatggacgg ccgcgtctca gaacaacgac ttgcccaact 30300 acgcatccgc cagcagcagg aacgcgtggc caaagagctc agagatgtca tccaaattca 30360 ccaatgcaaa aaaggcatat tctgtttggt aaaacaagcc aagatatcct acgagatcac 30420 cgctactgac catcgcctct cttacgaact tggcccccaa cgacaaaaat ttacctgcat 30480 ggtgggaatc aaccccatag ttatcaccca acaaagtgga gatactaagg gttgcattca 30540 ctgctcctgc gattccatcg agtgcaccta caccctgctg aagaccctat gcggcctaag 30600 agacctgcta ccaatgaatt aaaaaaaaat gattaataaa aaatcactta cttgaaatca 30660 gcaataaggt ctctgttgaa attttctccc agcagcacct cacttccctc ttcccaactc 30720 tggtattcta aaccccgttc agcggcatac tttctccata ctttaaaggg gatgtcaaat 30780 tttagctcct ctcctgtacc cacaatcttc atgtctttct tcccagatga ccaagagagt 30840 ccggctcagt gactccttca accctgtcta cccctatgaa gatgaaagca cctcccaaca 30900 cccctttata aacccagggt ttatttcccc aaatggcttc acacaaagcc cagacggagt 30960 tcttacttta aaatgtttaa ccccactaac aaccacaggc ggatctctac agctaaaagt 31020 gggaggggga cttacagtgg atgacactga tggtacctta caagaaaaca tacgtgctac 31080 agcacccatt actaaaaata atcactctgt agaactatcc attggaaatg gattagaaac 31140 tcaaaacaat aaactatgtg ccaaattggg aaatgggtta aaatttaaca acggtgacat 31200 ttgtataaag gatagtatta acaccttatg gactggaata aaccctccac ctaactgtca 31260 aattgtggaa aacactaata caaatgatgg caaacttact ttagtattag taaaaaatgg 31320 agggcttgtt aatggctacg tgtctctagt tggtgtatca gacactgtga accaaatgtt 31380 cacacaaaag acagcaaaca tccaattaag attatatttt gactcttctg gaaatctatt 31440 aactgaggaa tcagacttaa aaattccact taaaaataaa tcttctacag cgaccagtga 31500 aactgtagcc agcagcaaag cctttatgcc aagtactaca gcttatccct tcaacaccac 31560 tactagggat agtgaaaact acattcatgg aatatgttac tacatgacta gttatgatag 31620 aagtctattt cccttgaaca tttctataat gctaaacagc cgtatgattt cttccaatgt 31680 tgcctatgcc atacaatttg aatggaatct aaatgcaagt gaatctccag aaagcaacat 31740 agctacgctg accacatccc cctttttctt ttcttacatt acagaagacg acaactaaaa 31800 taaagtttaa gtgtttttat ttaaaatcac aaaattcgag tagttatttt gcctccacct 31860 tcccatttga cagaatacac caatctctcc ccacgcacag ctttaaacat ttggatacca 31920 ttagagatag acattgtttt agattccaca ttccaaacag tttcagagcg agccaatctg 31980 gggtcagtga tagataaaaa tccatcgcga tagtctttta aagcgctttc acagtccaac 32040 tgctgcggat gcgactccgg agtttggatc acggtcatct ggaagaagaa cgatgggaat 32100 cataatccga aaacggtatc ggacgattgt gtctcatcaa acccacaagc agccgctgtc 32160 tgcgtcgctc cgtgcgactg ctgtttatgg gatcagggtc cacagtttcc tgaagcatga 32220 ttttaatagc ccttaacatc aactttctgg tgcgatgcgc gcagcaacgc attctgattt 32280 cactcaaatc tttgcagtag gtacaacaca ttattacaat attgtttaat aaaccataat 32340 taaaagcgct ccagccaaaa ctcatatctg atataatcgc ccctgcatga ccatcatacc 32400 aaagtttaat ataaattaaa tgacgttccc tcaaaaacac actacccaca tacatgatct 32460 cttttggcat gtgcatatta acaatctgtc tgtaccatgg acaacgttgg ttaatcatgc 32520 aacccaatat aaccttccgg aaccacactg ccaacaccgc tcccccagcc atgcattgaa 32580 gtgaaccctg ctgattacaa tgacaatgaa gaacccaatt ctctcgaccg tgaatcactt 32640 gagaatgaaa aatatctata gtggcacaac atagacataa atgcatgcat cttctcataa 32700 tttttaactc ctcaggattt agaaacatat cccagggaat aggaagctct tgcagaacag 32760 taaagctggc agaacaagga agaccacgaa cacaacttac actatgcata gtcatagtat 32820 cacaatctgg caacagcggg tggtcttcag tcatagaagc tcgggtttca ttttcctcac 32880 aacgtggtaa ctgggctctg gtgtaagggt gatgtctggc gcatgatgtc gagcgtgcgc 32940 gcaaccttgt cataatggag ttgcttcctg acattctcgt attttgtata gcaaaacgcg 33000 gccctggcag aacacactct tcttcgcctt ctatcctgcc gcttagcgtg ttccgtgtga 33060 tagttcaagt acagccacac tcttaagttg gtcaaaagaa tgctggcttc agttgtaatc 33120 aaaactccat cgcatctaat tgttctgagg aaatcatcca cggtagcata tgcaaatccc 33180 aaccaagcaa tgcaactgga ttgcgtttca agcaggagag gagagggaag agacggaaga 33240 accatgttaa tttttattcc aaacgatctc gcagtacttc aaattgtaga tcgcgcagat 33300 ggcatctctc gcccccactg tgttggtgaa aaagcacagc taaatcaaaa gaaatgcgat 33360 tttcaaggtg ctcaacggtg gcttccaaca aagcctccac gcgcacatcc aagaacaaaa 33420 gaataccaaa agaaggagca ttttctaact cctcaatcat catattacat tcctgcacca 33480 ttcccagata attttcagct ttccagcctt gaattattcg tgtcagttct tgtggtaaat 33540 ccaatccaca cattacaaac aggtcccgga gggcgccctc caccaccatt cttaaacaca 33600 ccctcataat gacaaaatat cttgctcctg tgtcacctgt agcgaattga gaatggcaac 33660 atcaattgac atgcccttgg ctctaagttc ttcttagt tctagttgta aaaactctct 33720 catattatca ccaactgct tagccagag ccccccggga acagagcag gggacgctac 33780 agtgcagtac aagcgcagac ctcccaatt ggctccagca aaaaaacagat tggataagc 33840 atattgggaa ccaccagtaa tatcatcgaa gttgctggaa ataatcag gcagagtttc 33900 ttgtagaaat tgataaaag aaaaatttgc caaaaaaaa ttcaaacct ctgggatgca 33960 aatgcaatag gttaccgcgc tgcgctccaa cattgttagt ttgaattag tctgcaaaaa 34020 taaaaaaaaa acagcgtca tatcatagta gcctgacgaa caggtgata atcagctt 34080 tccatcacaa gatagccac agggtctcca gctcgaccct cgtaaaacct gtcatcgtga 34140 ttaaacaca gcaccgaag ttcctcgcgg tgaccagcat gaataagtct tgatgaagca 34200 tacaatccag acatgttagc atcagttag gagaaaaaac agccacata gccttttggggt 34260 ataattatgc ttaatcgtaa gtatagcaa gccaccccctc gcggataca agtaaaaggc 34320 acaggagaat aaaaaata attattctc tgctgctgtt taggcacgt cgcccccggt 34380 ccctctaaat acacatacaa agcctcatca gccatggctt accagagaaa gtacagcggg 34440 cacacaaacc acaagctcta aagtcactct ccaacctctc cacaatat atacacaagc 34500 cctaaactga cgtaatggga ctaaagtgta aaaaatcccg ccaaacccaa cacacacccc 34560 gaaactgcgt caccagggaa aagtacagtt tcacttccgc aatcccaaca agcgtcactt 34620 cctctttctc acggtacgtc acatcccatt aacttacaac gtcattttcc cacggccgcg 34680 ccgccccttt taaccgttaa ccccacagcc aatcaccaca cggcccacac tttttaaaat 34740 cacctcattt acatattggc accattccat ctataaggta tattattgat gatg 34794 <210> 42 <211> 688 <212> DNA <213> Artificial sequence <220> <223> Cloning into the NotI restriction endonuclease with the improved IX-E2 site of the expression cassette Restrictive endonuclease sites in mouse IL12A <400> 42 ctatagggag acccgcggcc atgtgtcaat cacgctacct cctctttttg gccacccttg 60 ccctcctaaa ccacctcagt ttggccaggg tcattccagt ctctggacct gccaggtgtc 120 ttagccagtc ccgaaacctg ctgaagacca cagatgacat ggtgaagacg gccagagaaa 180 aactgaaaca ttattcctgc actgctgaag acatcgatca tgaagacatc acacgggacc 240 aaaccagcac attgaagacc tgtttaccac tggaactaca caagaacgag agttgcctgg 300 ctactagaga gacttcttcc acaacaagag ggagctgcct gcccccacag aagacgtctt 360 tgatgatgac cctgtgcctt ggtagcatct atgaggactt gaagatgtac cagacagagt 420 tccaggccat caacgcagca cttcagaatc acaaccatca gcagatcatt ctagacaagg 480 gcatgctggt ggccatcgat gagctgatgc agtctctgaa tcataatggc gagactctgc 540 gccagaaacc tcctgtggga gaagcagacc cttacagagt gaaaatgaag ctctgcatcc 600 tgcttcacgc cttcagcacc cgcgtcgtga ccatcaacag ggtgatgggc tatctgagct 660 ccgcctgagg ccgctgtgcc ttctagtt 688 <210> 43 <211> 1048 <212> DNA <213> Artificial sequence <220> <223> Cloning into the L5-E4 site with an expression cassette using the EF1A promoter SwaI restriction site of mouse IL12Br <400> 43 ttgccgccag aacacaattt atgtgtcctc agaagctaac catctcctgg tttgccatcg 60 ttttgctggt gtctccactc atggccatgt gggagctgga gaaagacgtt tatgttgtag 120 aggtggactg gactcccgat gcccctggag aaacagtgaa cctcacctgt gacacgcctg 180 aagaagatga catcacctgg acctcagacc agagacatgg agtcataggc tctggaaaga 240 ccctgaccat cactgtcaaa gagtttctag atgctggcca gtacacctgc cacaaaggag 300 gcgagactct gagccactca catctgctgc tccacaagaa ggaaaatgga atttggtcca 360 ctgaaatttt aaaaaatttc aaaaacaaga ctttcctgaa gtgtgaagca ccaaattact 420 ccggacggtt cacgtgctca tggctggtgc aaagaaacat ggacttgaag ttcaacatca 480 agagcagtag cagttcccct gactctcggg cagtgacatg tggaatggcg tctctgtctg 540 cagagaaggt cacactggac caaagggact atgagaagta ttcagtgtcc tgccaggagg 600 atgtcacctg cccaactgcc gaggagaccc tgcccattga actggcgttg gaagcacggc 660 agcagaataa atatgagaac tacagcacca gcttcttcat cagggacatc atcaaaccag 720 acccgcccaa gaacttgcag atgaagcctt tgaagaactc acaggtggag gtcagctggg 780 agtaccctga ctcctggagc actccccatt cctacttctc cctcaagttc tttgttcgaa 840 tccagcgcaa gaaagaaaag atgaaggaga cagaggaggg gtgtaaccag aaaggtgcgt 900 tcctcgtaga gaagacatct accgaagtcc aatgcaaagg cgggaatgtc tgcgtgcaag 960 ctcaggatcg ctattacaat tcctcatgca gcaagtgggc atgtgttccc tgcagggtcc 1020 gatcctagaa ataacttgtttattgcag 1048 <210> 44 <211> 8 <212> DNA <213> Artificial sequence <220> <223> Modified TATA box <400> 44 agtgcccg 8 <210> 45 <211> 8 <212> DNA <213> Artificial sequence <220> <223> Modified TATA box <400> 45 tattcccg 8 <210> 46 <211> 10 <212> DNA <213> Artificial sequence <220> <223> Modified CAAT box <400> 46 ttccgtggcg 10 BRIEF DESCRIPTION OF THE DRAWINGS

[0066] The invention may be more fully understood with reference to the following drawings.

[0067] Figure 1 is a diagram depicting the structure of the human Ad5 genome. Above the figure, the genome is represented by a straight line with its length marked in kbp from the conventional left end. Thick arrows represent early and late transcription units (black and gray, respectively). Open boxes represent major introns. The E4 gene is magnified on a linear scale with a length of bp. Primary transcripts are shown as black arrows in the 5' to 3' direction, and each possible encoded protein is shown as an open box; proteins whose coding regions are separated by intron sequences are shown as boxes connected by lines.

[0068] Figure 2 Depicted are mouse GMCSF expression levels of A549, ADS-12, and WI-38 cells infected with the viruses TAV-(E1B-19K)mGMCSF or TAV-(L5-E4)mGMCSF or maintained as uninfected controls. Mouse GMCSF expression was measured in its conditioned medium.

[0069] Figure 3 Depicts the GMCSF expression levels of A549 cells infected with the viruses TAV IX-WT L5-empty, TAV IX-WT L5-IL7, TAV IX-WT L5-GMCSF or TAV IX-GMCSF L5-IL7. GMCSF expression was measured in conditioned medium. Higher expression was seen when GMCSF was expressed from the IX-E2 expression cassette compared to expression and expression from L5-E4.

[0070] Figure 4 The initial and revised designs of the IX-E2 insertion site are depicted.

[0071] Figure 5 Virus (TAV-Δ19k, TAV-hIL12-Furin, TAV-TAV-IXrL5-Empty, WT-IXrL5-hIL12, or TAV-IXrL5-hIL12) infected A549 cells in triplicate and stained with crystal violet 4 days post-infection (stains live cells purple) are depicted.

[0072] Figure 6 Depicted are IL-12 expression levels of A549 cells infected with virus (TAV-Δ19k, TAV-hIL12-furin, TAV-TAV-IXrL5-empty, WT-IXrL5-hIL12, or TAV-IXrL5-hIL12). A549 cells were infected with the indicated viruses in triplicate, and IL12 in the conditioned medium was measured by ELISA 4 days after infection.

[0073] Figure 7 Depicted are the IL-17 and GMCSF expression levels of A549 cells infected with TAV-(IXr)mIL7noPA-(L5SV40wt)KozakmGMCSF (labeled as SV40wt) or TAV-(IXr)mIL7noPA-(L5EF1A)KozakmGMCSF (labeled as hEF1A).

[0074] Figure 8 Depicted are the expression levels of IL-17 and GMCSF in A549 cells infected with either the ADP gene intact [TAV-(IXr)mIL7noPA-(L5EF1A)KozakmGMCSF, labeled as +ADP] or deleted [TAV-(IXr)mIL7noPA-(L5EF1A)KozakmGMCSF-ΔADP, labeled as ΔADP]. Conditioned media were collected at the indicated times post-infection and GMCSF was measured by ELISAs.

[0075] Figure 9 Depicted are CD80, CD137L, and ICAM1 staining in A549 cells infected with the following viruses: [TAV-mCD80(IRES)mCD137L(IRES)mICAM1, labeled as IRES], [TAV-(19k)mCD80-(IX)mCD137L-(L5)mICAM1, labeled as 19K-IX-5], or control virus [TAV-(19k)Empty-(IX)Empty-(L5)Empty, labeled as Empty].

[0076] Figure 10 Depicted are CD80, CD137L, and ICAM1 staining in HT29 cells infected with the following viruses: [TAV-mCD80(IRES)mCD137L(IRES)mICAM1, labeled as IRES], [TAV-(19k)mCD80-(IX)mCD137L-(L5)mICAM1, labeled as 19K-IX-5], or control virus [TAV-(19k)Empty-(IX)Empty-(L5)Empty, labeled as Empty].

[0077] Figure 11 Depicted are CD80, CD137L, and ICAM1 staining in ADS12 cells infected with the following viruses: [TAV-mCD80(IRES)mCD137L(IRES)mICAM1, labeled as IRES], [TAV-(19k)mCD80-(IX)mCD137L-(L5)mICAM1, labeled as 19K-IX-5], or control virus [TAV-(19k)Empty-(IX)Empty-(L5)Empty, labeled as Empty].

[0078] Figure 12 Depicted are CD80, CD137L, and ICAM1 staining in F244 cells infected with the following viruses: [TAV-mCD80(IRES)mCD137L(IRES)mICAM1, labeled as IRES], [TAV-(19k)mCD80-(IX)mCD137L-(L5)mICAM1, labeled as 19K-IX-5], or control virus [TAV-(19k)Empty-(IX)Empty-(L5)Empty, labeled as Empty].

[0079] Figure 13 Depicted are the oncolytic activities of the viruses TAV-IX5-empty (labeled "empty") and TAV-IX5-mIL12 (labeled "mIL12") in A549 cells at an MOI of 5. The wells were stained with crystal violet on the indicated days after infection.

[0080] Figure 14 It is the transgenic expression of virus TAV-IX5-mIL12. A549 cells were infected with TAV-IX5-empty (labeled as "empty") or TAV-IX5-mIL12 (labeled as "mIL12") at an MOI of 5, and conditioned medium was collected 5 days after infection and used in ELISA to measure heterodimeric mouse IL-12. High levels of mouse IL-12 were expressed using TAV-IX5-mIL12 virus, while control TAV-IX5-empty virus was not. The bar graph represents the meIL-12 levels of triplicate samples, and the error bars represent the standard deviation.

[0081] Detailed Description

[0082] The present invention is based, in part, on the discovery that recombinant adenoviruses having one or more nucleotide sequences inserted between two viral transcription units of the viral genome can efficiently replicate and express the nucleotide sequences in target cells or tissues.

[0083] I. Recombinant Adenovirus

[0084] Adenovirus is a non-enveloped icosahedral virus consisting of a nucleocapsid and a double-stranded linear DNA genome. Adenovirus replicates in the nucleus of mammalian cells using the host's replication machinery. The term "adenovirus" refers to any virus in the genus Adenovirus, including but not limited to human, bovine, ovine, equine, canine, porcine, murine and simian adenovirus subgenus. In particular, human adenovirus includes subgenus AF and its individual serotypes, and individual serotypes and subgenus AF include, but are not limited to, human adenovirus types 1, 2, 3, 4, 4a, 5, 6, 7, 8, 9, 10, 11 (Ad11a and Ad11p), 12, 13, 14, 15, 16, 17, 18, 19, 19a, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 34a, 35, 35p, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, and 91. The term bovine adenovirus includes, but is not limited to, bovine adenovirus types 1, 2, 3, 4, 7, and 10. The term canine adenovirus includes, but is not limited to, canine 1 (strains CLL, Glaxo, RI261, Utrect, Toronto 26-61) and 2. The term equine adenovirus includes, but is not limited to, equine types 1 and 2. The term porcine adenovirus includes, but is not limited to, porcine types 3 and 4.

[0085] In some embodiments, provided are recombinant viruses derived from human adenovirus types 5 and 35. The terms "viral vector" and "virus" are used interchangeably herein to refer to any obligate intracellular parasite that does not possess protein synthesis or energy production machinery.

[0086] There are two phases in the adenovirus replication cycle: the early phase, during which transcription units E1A, E1B, E2A, E2B, E3 and E4 are expressed. The proteins encoded by the genes within these transcription units are mainly involved in viral transcription regulation, viral DNA replication, and inhibition of host responses to infection. The L1-L5 transcription units are transcribed in the late phase of the viral replication cycle and mainly encode proteins that constitute components of the viral capsid or participate in capsid assembly. The L1-L5 transcription units are mainly expressed by the major late promoter.

[0087] The general structure of mature adenovirions is conserved between different adenovirus species. The adenovirus capsid is composed of three major proteins (II, III and IV) and five minor proteins (VI, VIII, IX, IIIa and IVa2). As used herein, "IVa2 gene" refers to a gene encoding IVa2 protein, a modified form thereof and / or a fragment thereof. As used herein, "IX gene" refers to a gene encoding IX protein, a modified form thereof and / or a fragment thereof.

[0088] exist Figure 1A schematic diagram of the Ad5 genome and details of the E4 gene are shown in . The primary transcript from E4 undergoes alternative splicing events and is expected to encode seven different polypeptides: ORF1, ORF2, ORF3, ORF3 / 4, ORF4, ORF5, ORF6, and ORF6 / 7. (Leppard et al., Journal of general Virology, 78: 2131–8 (1997)) "ORF" is used herein to refer to a polypeptide or a nucleotide sequence encoding a polypeptide, a modified form and / or a fragment thereof.

[0089] In addition, fiber protein (also known as protein IV or SPIKE) forms spikes that extend from each specific point of the icosahedral capsid. "Fiber gene" as used herein refers to the gene encoding fiber protein (also known as the L5 gene), modified forms and / or fragments thereof.

[0090] A. Insertion site

[0091] In one aspect, the present invention provides a recombinant adenovirus comprising a nucleotide sequence inserted into an insertion site, wherein the insertion site is located between a stop codon of a first viral transcription unit and a stop codon of a second viral transcription unit, wherein the stop codon of the first viral transcription unit is closer to the stop codon of the second viral transcription unit than the start site of the first viral transcription unit is to the stop codon of the second viral transcription unit, wherein the stop codon of the second viral transcription unit is closer to the stop codon of the first viral transcription unit than the start site of the second viral transcription unit is to the stop codon of the first viral transcription unit. In some embodiments, the first viral transcription unit and the second viral transcription unit are adjacent to each other in the adenoviral genome, for example, prior to the insertion of the nucleotide sequence, there are no viral transcription units between the first viral transcription unit and the second viral transcription unit.

[0092] The term "viral transcription unit" as used herein refers to a linear sequence of nucleotide sequences extending from the transcription start site to the transcription stop site in the viral genome. The viral transcription unit may be natural, modified, or a fragment thereof. The terms "viral transcription unit" and "viral gene" are used interchangeably herein.

[0093] In certain embodiments, the recombinant adenovirus is a human adenovirus. In some embodiments, the recombinant adenovirus is a human adenovirus 1, 2, 3, 4, 4a, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 19a, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 34a, 35, 35p, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 91. In some embodiments, the recombinant adenovirus is adenovirus type 5 (Ad5) or adenovirus type 35 (Ad35).

[0094] In certain embodiments, the first viral transcription unit is the adenovirus IX gene and the second viral transcription unit is the adenovirus IVa2 gene. In certain embodiments, the first viral transcription unit is the adenovirus fiber gene and the second viral transcription unit is ORF6 or ORF6 / 7 of the adenovirus E4 gene.

[0095] In certain embodiments, the insertion site is the IX-E2 insertion site. In certain embodiments, the IX-E2 insertion site is located between the stop codon of the adenovirus IX gene and the stop codon of the adenovirus IVa2 gene. In certain embodiments, the nucleotide sequence is inserted between nucleotides corresponding to positions 4029 to 4093 of the Ad5 genome (SEQ ID NO: 1). In certain embodiments, the nucleotide sequence is inserted between nucleotides corresponding to positions 4029 to 4050 of the Ad5 genome (SEQ ID NO: 1), between nucleotides corresponding to positions 4051 to 4070 of the Ad5 genome (SEQ ID NO: 1), or between nucleotides corresponding to positions 4071 to 4093 of the Ad5 genome (SEQ ID NO: 1). In certain embodiments, the nucleotide sequence is inserted between nucleotides corresponding to positions 3899 to 3970 of the Ad35 genome (SEQ ID NO: 41). In certain embodiments, the nucleotide sequence is inserted between nucleotides 3899 to 3920 corresponding to the Ad35 genome (SEQ ID NO: 41), between nucleotides 3920 to 3940 corresponding to the Ad35 genome (SEQ ID NO: 41), or between nucleotides 3940 to 3970 corresponding to the Ad35 genome (SEQ ID NO: 41).

[0096] In some embodiments, the IX-E2 insertion site is at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to nucleotides 4029 to 4093 of the Ad5 genome (SEQ ID NO: 1). In some embodiments, the IX-E2 insertion site is at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to nucleotides 3899 to 3970 of the Ad35 genome (SEQ ID NO: 41).

[0097] In some embodiments, the insertion site is the L5-E4 insertion site. In some embodiments, the L5-E4 insertion site is located between the stop codon of the adenoviral fiber gene and the stop codon of ORF6 or ORF6 / 7 of the adenoviral E4 gene. In some embodiments, the nucleotide sequence is inserted between nucleotides corresponding to positions 32785 to 32916 of the Ad5 genome (SEQ ID NO: 1). In certain embodiments, the nucleotide sequence is inserted between nucleotides 32785 to 32800 corresponding to the Ad5 genome (SEQ ID NO: 1), between nucleotides 32801 to 32820 corresponding to the Ad5 genome (SEQ ID NO: 1), between nucleotides 32821 to 32840 corresponding to the Ad5 genome (SEQ ID NO: 1), between nucleotides 32841 to 32860 corresponding to the Ad5 genome (SEQ ID NO: 1), between nucleotides 32861 to 32880 corresponding to the Ad5 genome (SEQ ID NO: 1), between nucleotides 32881 to 32900 corresponding to the Ad5 genome (SEQ ID NO: 1), or between nucleotides 32901 to 32916 corresponding to the Ad5 genome (SEQ ID NO: 1). In certain embodiments, the nucleotide sequence is inserted between nucleotides 31799 to 31821 corresponding to the Ad35 genome (SEQ ID NO: 41). In certain embodiments, the nucleotide sequence is inserted between nucleotides corresponding to positions 31799 to 32810 of the Ad35 genome (SEQ ID NO: 41), or between nucleotides corresponding to positions 32810 to 31821 of the Ad35 genome (SEQ ID NO: 41).

[0098] In some embodiments, the L5-E4 insertion site is at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to nucleotides 32785 to 32916 of the Ad5 genome (SEQ ID NO: 1). In some embodiments, the L5-E4 insertion site is at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to nucleotides 31799 to 31821 of the Ad35 genome (SEQ ID NO: 41).

[0099] Recombinant adenoviruses with exogenous amino acid sequences inserted in the IX-E2 insertion site and / or the L5-E4 insertion site have not been previously described. Such recombinant adenoviruses unexpectedly show excellent tumor-selective expression in tumor cells compared to normal cells. In one aspect, the present invention provides a method for expressing a natural protein. In another aspect, the present invention provides a method for expressing a natural structure such as a dimeric or multimeric protein.

[0100] In another aspect, the present invention provides a method for expressing two or more therapeutic transgenes in a target cell. The method comprises exposing the cell to an effective amount of a recombinant virus described herein to express the target transgene.

[0101] In certain embodiments, the nucleotide sequence comprises at least one transgene. In certain embodiments, the nucleotide sequence further comprises a promoter, wherein the transgene is operably linked to the promoter.

[0102] In certain embodiments, the recombinant adenovirus comprises, in a 5' to 3' direction: (i) a first polyadenylation signal; (ii) a promoter; (iii) a transgene; (iv) a second polyadenylation signal; and (v) a third polyadenylation signal; wherein the transgene is operably linked to the promoter. In some embodiments, the nucleotide sequence, the first nucleotide sequence and / or the second nucleotide sequence is inserted between the first polyadenylation signal and the third polyadenylation signal. In certain embodiments, wherein the second polyadenylation signal is in the opposite transcriptional direction of the third polyadenylation signal. In certain embodiments, the nucleotide sequence is inserted into the L5-E4 insertion site, and the first polyadenylation signal is the polyadenylation signal of the fiber (L5) gene, the second polyadenylation signal is the polyadenylation signal of the transgene, and the third polyadenylation signal is the polyadenylation signal of ORF6 or ORF6 / 7 of the adenovirus E4 gene. In certain embodiments, the nucleotide sequence is inserted into the IX-E2 insertion site and the first polyadenylation signal is the polyadenylation signal of the IX gene, the second polyadenylation signal is the polyadenylation signal of the transgene, and the third polyadenylation signal is the polyadenylation signal of the adenovirus IVa2 gene.

[0103] In certain embodiments, the recombinant adenovirus comprises, in a 5' to 3' orientation: (i) a first polyadenylation signal; (ii) a second polyadenylation signal; (iii) a promoter; (iv) a transgene; (v) a third polyadenylation signal; and (vi) a fourth polyadenylation signal and the transgene are operably linked to the promoter. In some embodiments, the nucleotide sequence, the first nucleotide sequence and / or the second nucleotide sequence is inserted between the first polyadenylation signal and the fourth polyadenylation signal. In certain embodiments, wherein the second polyadenylation signal is in the opposite transcriptional orientation of the first polyadenylation signal. In certain embodiments, wherein the fourth polyadenylation signal is in the opposite transcriptional orientation of the third polyadenylation signal. In certain embodiments, the nucleotide sequence is inserted into the L5-E4 insertion site, and the first polyadenylation signal is the polyadenylation signal of the fiber (L5) gene, the third polyadenylation signal is the polyadenylation signal of the transgene, and the fourth polyadenylation signal is the polyadenylation signal of ORF6 or ORF6 / 7 of the adenovirus E4 gene. In certain embodiments, the nucleotide sequence is inserted into the IX-E2 insertion site, and the first polyadenylation signal is the polyadenylation signal of the IX gene, the third polyadenylation signal is the polyadenylation signal of the transgene, and the fourth polyadenylation signal is the polyadenylation signal of the adenovirus IVa2 gene.

[0104] The term "promoter" is used herein in its general sense to refer to a nucleotide region comprising a DNA regulatory sequence derived from a gene that is capable of binding RNA polymerase and initiating transcription of a downstream (3'-direction) coding sequence.

[0105] "Operably linked" refers to an arrangement of elements wherein the components are configured so as to perform their usual functions. Thus, a control element operably linked to a coding sequence is capable of affecting the expression of the coding sequence. The control element need not be continuous with the coding sequence, as long as it serves to direct expression. Thus, for example, there may be an interrupted, untranslated, but still transcribed sequence between the promoter sequence and the coding sequence, and the promoter sequence may still be considered "operably linked" to the coding sequence.

[0106] In certain embodiments, the promoter is a ubiquitin promoter, a tissue-specific promoter, or a tumor-specific promoter.

[0107] In some embodiments, the transgene is operably linked to a ubiquitin promoter, such as the βAct promoter, EF1 promoter, EGR1 promoter, eIF4A1 promoter, FerH promoter, FerL promoter, GAPDH promoter, GRP78 promoter, GRP94 promoter, HSP70 promoter, β-Kin promoter, PGK-1 promoter, ROSA promoter, ubiquitin B promoter, SV40 promoter, or CMV promoter. In one embodiment, high levels of constitutive expression would be desirable. Examples of useful constitutive promoters include, but are not limited to, the retroviral Rous sarcoma virus (RSV) LTR promoter (optionally with an RSV enhancer), the cytomegalovirus (CMV) promoter (optionally with a CMV enhancer) (see, e.g., Boshart et al, Cell, 41:521-530 (1985)), the SV40 promoter, the dihydrofolate reductase promoter, the β-actin promoter, the phosphoglycerol kinase (PGK) promoter, and the EF1α promoter (Invitrogen). Inducible promoters regulated by exogenously supplied compounds are also useful and include, the zinc-inducible sheep metallothionein (MT) promoter, the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter, the T7 polymerase promoter system (WO 98 / 10088); insect ecdysone promoter (No et al. Proc. Natl. Acad. Sci. USA, 93:3346-3351 (1996)), tetracycline-repressible system (Gossen et al, Proc. Natl. Acad Sci. USA, 89:5547-5551 (1992)), tetracycline-inducible system (Gossen et al, Science. 268:1766-1769 (1995), see also Harvey et al. al, Curr. Opin. Chem. Biol., 2: 512-518 (1998)), RU486-inducible system (Wang et al, Nat. Biotech., 15: 239-243 (1997) and Wang et al, Gene Ther., 4: 432-441 (1997)), and rapamycin-inducible system (Magari et al, J. Clin. Invest., 100: 2865-2872 (1997)). Other types of inducible promoters useful in this context are those that are regulated by specific physiological states (e.g., temperature, acute phase, specific differentiation states of cells, or only in replicating cells).

[0108] In another embodiment, the natural promoter for the transgene will be used. When it is desirable that the expression of the transgene should mimic natural expression, a natural promoter may be preferred. When it is necessary to regulate the expression of the transgene either temporarily or developmentally in a tissue-specific manner or in response to a specific transcriptional stimulus, a natural promoter may be used. In further embodiments, other natural expression control elements (such as enhancer elements, polyadenylation sites or Kozak consensus sequences) may also be used to mimic natural expression.

[0109] Another embodiment of the transgene includes a transgene operably linked to a tissue-specific promoter, such as the B29 promoter (B cells), the CD14 promoter (monocytes), the CD43 promoter (leukocytes and platelets), the CD45 promoter (hematopoietic cells), the CD68 promoter (macrophages), the desmin promoter (muscle), the elastase-1 promoter (pancreatic acinar cells), the endoglin promoter (endothelial cells), the Flt-1 promoter ( The promoter of the invention can be a promoter of a tissue-specific promoter. The promoter of the invention can be a promoter of a tissue-specific promoter. The promoter of the invention can be a promoter of a tissue-specific promoter. The promoter of the invention can be a promoter of a tissue-specific promoter. The promoter of the invention can be a promoter of a tissue-specific promoter. The promoter of the invention can be a promoter of a tissue-specific promoter. The promoter of the invention can be a promoter of a tissue-specific promoter. The promoter of the invention can be a promoter of a tissue-specific promoter. The promoter of the invention can be a promoter of a tissue-specific promoter. The promoter of the invention can be a promoter of a tissue-specific promoter. The promoter of the invention can be a promoter of a tissue-specific promoter. The promoter of the invention can be a promoter of a tissue-specific promoter. The promoter of the invention can be a promoter of a tissue-specific promoter. The promoter of the invention can be a promoter of a tissue-specific promoter. The promoter of the invention can be a promoter of a tissue-specific promoter. The promoter of the invention can be a promoter of a tissue-specific promoter. The promoter of the invention can be a promoter of a tissue-specific promoter. These include promoters from genes encoding skeletal muscle α-actin, myosin light chain 2A, dystrophin, muscle creatine kinase, and synthetic muscle promoters that have greater activity than the native promoter (see Li et al., Nat. Biotech., 17:241-245 (1999)).Examples of tissue-specific promoters are known for the following: liver (albumin, Miyatake et al. J. Virol. 71:5124-32 (1997); hepatitis B virus core promoter, Sandig et al., Gene Ther., 3:1002-9 (1996); alpha-fetoprotein (AFP), Arbuthnot et al., Hum. Gene Ther., 7:1503-14 (1996)), osteocalcin (Stein et al., Mol. Biol. Rep., 24:185-96 (1997)), bone sialoprotein (Chen et al., J. Bone Miner. Rep., 11:654-64 (1996)), lymphocytes (CD2, Hansal et al., al., J.Immumnol., 161: 1063-8 (1998); immunoglobulin heavy chain; T cell receptor chain), neurons such as neuron-specific enolase (NSE) promoter (Andersen et al., Cell. Mol. Neurobiol., 13: 503-15 (1993)), neurofilament light chain gene (Piccioli et al., Proc. Natl. Acad. Sci. USA, 88: 5611-5 (1991)), and neural-specific vgf gene (Piccioli et al., Neuron. 15: 373-84 (1995)), etc.

[0110] Another example of a transgene includes a transgene operably linked to a tumor-specific promoter, such as the AFP promoter (hepatocellular carcinoma), the CCKAR promoter (pancreatic cancer), the CEA promoter (epithelial cancer), the c-erbB2 promoter (breast cancer and pancreatic cancer), the COX-2 promoter (tumor), the E2F-1 promoter (tumor), the HE4 promoter (tumor), the LP promoter (tumor), the MUC1 promoter (cancer cells), the PSA promoter (prostate and prostate cancer), the survivin promoter (tumor), the TRP1 promoter (melanocytes and melanoma), the Tyr promoter (melanocytes and melanoma), the CXCR4 promoter (tumor), or the AFP / hAFP promoter (hepatocellular carcinoma). Tumor-specific promoters are specifically active in tumor cells.

[0111] In certain embodiments, the nucleotide sequence further comprises a consensus Kozak sequence. In certain embodiments, the recombinant adenovirus comprises a partial or complete deletion of the nucleotide sequence encoding the adenovirus death protein (ADP).

[0112] In certain embodiments, the present invention provides a recombinant adenovirus comprising a first nucleotide sequence inserted into the IX-E2 insertion site and a second nucleotide sequence inserted into the L5-E4 insertion site. These embodiments allow the adenovirus to express two or more independent exogenous transgenes. This approach has certain advantages over adenoviruses expressing a fusion protein comprising two transgenes linked together by a self-cleaving linker, because the cleaved linker may be potentially immunogenic.

[0113] In certain embodiments, the recombinant adenovirus comprises, in a 5' to 3' orientation: (i) a first polyadenylation signal; (ii) a promoter; (iii) a first nucleotide sequence comprising a first transgene; (iv) a linker; (v) a second nucleotide sequence comprising a second transgene; (vi) a second polyadenylation signal; and (vii) a third polyadenylation signal; wherein the transgene is operably linked to the promoter. In certain embodiments, wherein the second polyadenylation signal is in the opposite transcriptional orientation of the third polyadenylation signal. In certain embodiments, the recombinant adenovirus comprises, in a 5' to 3' orientation: (i) a first polyadenylation signal; (ii) a second polyadenylation signal; (iii) a promoter; (iv) a first nucleotide sequence comprising a first transgene; (v) a linker; (vi) a second nucleotide sequence comprising a second transgene; (vii) a third polyadenylation signal; and (viii) a fourth polyadenylation signal; wherein the transgene is operably linked to the promoter. In certain embodiments, wherein the second polyadenylation signal is in the opposite transcriptional orientation of the first polyadenylation signal. In certain embodiments, the fourth polyadenylation signal is in the opposite transcriptional orientation of the third polyadenylation signal.

[0114] In certain embodiments, the IX-E2 insertion site comprises a deletion of about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, or 60 nucleotides. In certain embodiments, the L5-E4 insertion site comprises a deletion of about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, or 130 nucleotides.

[0115] In certain embodiments, the recombinant adenovirus further comprises a nucleotide sequence inserted into the E1b-19K insertion site, the E3 insertion site, or the E4 insertion site. In certain embodiments, the E1b-19K insertion site is located between the start site of Elb-19K and the start site of Elb-55K. In certain embodiments, the E3 insertion site is located between the stop codon of the adenovirus pVIII gene and the start site of the adenovirus fiber gene (L5). In certain embodiments, the E4 insertion site is located between the start codon of ORF1 of the adenovirus E4 gene and the stop codon of ORF6 / 7.

[0116] In certain embodiments, the recombinant adenovirus further comprises a first nucleotide sequence inserted into the IX-E2 insertion site and a second nucleotide sequence inserted into the E1b-19K insertion site. In certain embodiments, the recombinant adenovirus further comprises a first nucleotide sequence inserted into the IX-E2 insertion site and a second nucleotide sequence inserted into the E3 insertion site. In certain embodiments, the recombinant adenovirus further comprises a first nucleotide sequence inserted into the IX-E2 insertion site and a second nucleotide sequence inserted into the E4 insertion site.

[0117] In certain embodiments, the recombinant adenovirus further comprises a first nucleotide sequence inserted into the L5-E4 insertion site and a second nucleotide sequence inserted into the E1b-19K insertion site. In certain embodiments, the recombinant adenovirus further comprises a first nucleotide sequence inserted into the L5-E4 insertion site and a second nucleotide sequence inserted into the E3 insertion site. In certain embodiments, the recombinant adenovirus further comprises a first nucleotide sequence inserted into the L5-E4 insertion site and a second nucleotide sequence inserted into the E4 insertion site. In certain embodiments, the recombinant adenovirus further comprises a first nucleotide sequence inserted into the IX-E2 insertion site and a second nucleotide sequence inserted into the L5-E4 insertion site and a third nucleotide sequence inserted into the E1b-19K insertion site, the E3 insertion site, or the E4 insertion site.

[0118] The adenovirus Elb-19k gene is mainly used as an anti-apoptotic gene and is a homologue of the cell anti-apoptotic gene BCL2-2. Since host cell death will limit viral replication before the progeny virus particles mature, Elb-19k is expressed as part of the El box to prevent pre-mature cell death, thereby allowing infection to proceed and obtaining mature virions. Therefore, in certain embodiments, a recombinant virus comprising an Elb-19K insertion site is provided, for example, an adenovirus having an exogenous nucleotide sequence inserted into the Elb-19K insertion site. In certain embodiments, the insertion site is located between the start site of Elb-19K and the stop codon of Elb-19K.

[0119] In certain embodiments, the E1b-19K insertion site comprises a deletion of about 100 to about 305, about 100 to about 300, about 100 to about 250, about 100 to about 200, about 100 to about 150, about 150 to about 305, about 150 to about 300, about 150 to about 250, or about 150 to about 200 nucleotides adjacent to the start site of E1b-19K. In certain embodiments, the E1b-19K insertion site comprises a deletion of about 200 nucleotides (e.g., 202 nucleotides) adjacent to the start site of E1b-19K. In certain embodiments, the E1b-19K insertion site comprises a deletion of nucleotides 1714-1917 corresponding to the Ad5 genome (SEQ ID NO: 1), or an exogenous nucleotide sequence encoding a transgene is inserted between nucleotides 1714 and 1917 corresponding to the Ad5 genome (SEQ ID NO: 1). In certain embodiments, the exogenous nucleotide sequence encoding the transgene is inserted between CTGACCTC (SEQ ID NO: 3) and TCACCAGG (SEQ ID NO: 2), for example, the recombinant adenovirus comprises CTGACCTC (SEQ ID NO: 3), the exogenous nucleotide sequence encoding the transgene, and TCACCAGG (SEQ ID NO: 2) in a 5' to 3' direction. In certain embodiments, the E1b-19K insertion site comprises a deletion corresponding to nucleotides 1611-2153 or 1611-1915 of the Ad35 genome (SEQ ID NO: 41).

[0120] In certain embodiments, the E1b-19K insertion site comprises a deletion of about 100 to about 305, about 100 to about 300, about 100 to about 250, about 100 to about 200, about 100 to about 150, about 150 to about 305, about 150 to about 300, about 150 to about 250, or about 150 to about 200 nucleotides adjacent to the start site of E1b-19K. In certain embodiments, the E1b-19K insertion site comprises a deletion of about 200 nucleotides (e.g., 202 nucleotides) adjacent to the start site of E1b-19K. In certain embodiments, the E1b-19K insertion site comprises a deletion of nucleotides 1714-1917 corresponding to the Ad5 genome (SEQ ID NO: 1), or the first therapeutic transgene is inserted between nucleotides corresponding to positions 1714 and 1917 of the Ad5 genome (SEQ ID NO: 1). In certain embodiments, the first therapeutic transgene is inserted between CTGACCTC (SEQ ID NO:3) and TCACCAGG (SEQ ID NO:2), for example, the recombinant adenovirus comprises, in a 5' to 3' orientation, CTGACCTC (SEQ ID NO:3), the first therapeutic transgene, and TCACCAGG (SEQ ID NO:2).

[0121] In certain embodiments, the E3 insertion site comprises a deletion of about 500 to about 3185, about 500 to about 3000, about 500 to about 2500, about 500 to about 2000, about 500 to about 1500, about 500 to about 1000, about 1000 to about 3185, about 1000 to about 3000, about 1000 to about 2500, about 1000 to about 2000, about 1000 to about 1500, about 1500 to about 3185, about 1500 to about 3000, about 1500 to about 2000, about 2000 to about 3185, about 2000 to about 3000, about 2000 to about 2500, about 2500 to about 3185, about 2500 to about 3000, or about 3000 to about 3185 nucleotides. In certain embodiments, the E3 insertion site is located between the stop codon of E3-10.5K and the stop codon of E3-14.7K. In certain embodiments, the E3 insertion site comprises a deletion of about 500 to about 1551, about 500 to about 1500, about 500 to about 1000, about 1000 to about 1551, about 1000 to about 1500, or about 1500 to about 1551 nucleotides adjacent to the stop codon of E3-10.5K. In certain embodiments, the E3 insertion site comprises a deletion of about 1050 nucleotides adjacent to the stop codon of E3-10.5K, for example, the E3 insertion site comprises a deletion of 1063 nucleotides adjacent to the stop codon of E3-10.5K. In certain embodiments, the E3 insertion site comprises a deletion corresponding to the Ad5 dl309 E3 deletion. In certain embodiments, the E3 insertion site comprises a deletion of nucleotides 29773-30836 corresponding to the Ad5 genome (SEQ ID NO: 1), or the second therapeutic transgene is inserted between nucleotides 29773 to 30836 corresponding to the Ad5 genome (SEQ ID NO: 1). In certain embodiments, the E3 insertion site comprises a deletion of nucleotides 27199-30622 corresponding to the Ad35 genome (SEQ ID NO: 41).

[0122] In certain embodiments, the E4 insertion site comprises any ORF of the E4 gene, i.e., between the start codon of ORF1 and the stop codon of ORF6 / 7. For example, the nucleotide sequence may be inserted into E4 ORF1 and / or E4 ORF2. In certain embodiments, part or all of the E4 region may be deleted. In certain embodiments, in any of the aforementioned viruses, the recombinant adenovirus further comprises an E4 deletion. In certain embodiments, the E4 deletion is located between the start site of E4-ORF6 / 7 (i.e., the nucleotide sequence encoding the start codon of E4-ORF6 / 7, e.g., nucleotides 34075-34077 corresponding to SEQ ID NO: 1) and the right inverted terminal repeat sequence (ITR; e.g., nucleotides 35836-35938 corresponding to SEQ ID NO: 1). In certain embodiments, the E4 deletion is located between the start site of E4-ORF6 / 7 and the start site of E4-ORF1 (i.e., the nucleotide sequence encoding the start codon of E4-ORF1, e.g., corresponding to nucleotides 35524-35526 of SEQ ID NO: 1). In certain embodiments, the E4 deletion comprises a deletion of the nucleotide sequence located between the start site of E4-ORF6 / 7 and the start site of E4-ORF1. In certain embodiments, the E4 deletion comprises a deletion of about 500 to about 2500, about 500 to about 2000, about 500 to about 1500, about 500 to about 1000, about 1000 to about 2500, about 1000 to about 2000, about 1000 to about 1500, about 1500 to about 2500, about 1500 to about 2000, or about 2000 to about 2500 nucleotides. In certain embodiments, the E4 deletion comprises a deletion of about 250 to about 1500, about 250 to about 1250, about 250 to about 1000, about 250 to about 750, about 250 to about 500, from 500 to about 1500, about 500 to about 1250, about 500 to about 1000, about 500 to about 750, from 750 to about 1500, about 750 to about 1250, about 750 to about 1000, about 1000 to about 1500, or about 1000 to about 1250 nucleotides adjacent to the start site of E4-ORF6 / 7. In certain embodiments, the E4 deletion comprises a deletion of about 1450 nucleotides adjacent to the start site of E4-ORF6 / 7, for example, the E4 deletion comprises a deletion of about 1449 nucleotides adjacent to the start site of E4-ORF6 / 7. In certain embodiments, the E4 deletion comprises a deletion corresponding to nucleotides 34078-35526 or 34083-35541 of the Ad5 genome (SEQ ID NO: 1).In certain embodiments, the E4 deletion comprises a deletion corresponding to nucleotides 33004-34422 or 31827-34415 of the Ad35 genome (SEQ ID NO:41).

[0123] B. Modified transcriptional control regions

[0124] Previously developed oncolytic viruses include oncolytic serotype 5 adenovirus (Ad5) referred to as TAV-255 in PCT Publication No. WO2010 / 101921, which is transcriptionally attenuated in normal cells but transcriptionally active in cancer cells. It is believed that the mechanism by which the TAV-255 vector achieves this tumor selection is through targeted deletion of three transcription factor (TF) binding sites for transcription factors Pea3 and E2F, which are proteins that regulate E1a adenovirus expression, and E1a is the earliest gene transcribed by binding to a specific DNA sequence after the virus enters the host cell. These three Pea3 and E2F deletions weaken replication in normal cells with growth arrest, but not in malignant cells, indicating that these DNA sequences can only be used for cancer cell transcriptional regulation and growth.

[0125] In certain embodiments, any of the foregoing recombinant adenoviruses comprises a modified E1a regulatory sequence. In certain embodiments, the recombinant adenovirus comprises an E1a promoter having a deletion of a functional Pea3 binding site. For example, the virus may comprise a deletion of nucleotides corresponding to about -300 to about -250 upstream of the E1a start site or a deletion of nucleotides corresponding to -305 to -255 upstream of the E1a start site. In certain embodiments, the deletion comprises a deletion of nucleotides corresponding to 195-244 of the Ad5 genome (SEQ ID NO: 1), and / or the E1a promoter comprises the sequence GGTGTTTTGG (SEQ ID NO: 4).

[0126] In certain embodiments, the recombinant adenovirus comprises a modified TATA box-based promoter operably linked to a gene and / or a modified CAAT box-based promoter operably linked to a gene, wherein the modified TATA box-based promoter lacks a functional TATA box and allows for selective expression of the gene in hyperproliferative cells, wherein the modified CAAT box-based promoter lacks a functional CAAT box and allows for selective expression of the gene in hyperproliferative cells.

[0127] In certain embodiments, the modified TATA box-based promoter is an early gene promoter. In certain embodiments, the modified TATA box-based promoter is an E1a promoter, an E1b promoter or an E4 promoter. In certain embodiments, the modified TATA box-based promoter is an E1a promoter.

[0128] In certain embodiments, the modification contained in the modified TATA box-based promoter comprises a deletion of the entire TATA box. In certain embodiments, the recombinant adenovirus comprises a deletion of nucleotides corresponding to -27 to -24, -31 to -24, -44 to +54, or -146 to +54 of the E1a promoter. In certain embodiments, the deletion comprises a deletion of nucleotides corresponding to 472 to 475, 468 to 475, 455 to 552, or 353 to 552 of the Ad5 genome (SEQ ID NO: 1). In certain embodiments, the deletion comprises a deletion of nucleotides corresponding to 477 to 484 of the Ad35 genome (SEQ ID NO: 41).

[0129] In certain embodiments, the recombinant adenovirus comprises a polynucleotide deletion that results in a virus comprising the following sequences: CTAGGACTG (SEQ ID NO:5), AGTGCCCG (SEQ ID NO:44), and / or TATTCCCG (SEQ ID NO:45).

[0130] In certain embodiments, the modified CAAT box-based promoter is an early gene promoter. In certain embodiments, the modified CAAT box-based promoter is an E1a promoter, an E1b promoter, or an E4 promoter. In certain embodiments, the modified CAAT box-based promoter is an E1a promoter.

[0131] In certain embodiments, the modifications comprised in the modified CAAT box-based promoter include deletion of the entire CAAT box.In certain embodiments, the recombinant adenovirus comprises a deletion of nucleotides corresponding to -76 to -68 of the E1a promoter.

[0132] In certain embodiments, the recombinant adenovirus comprises a deletion of nucleotides corresponding to 423 to 431 of the Ad5 genome (SEQ ID NO: 1). In certain embodiments, the recombinant adenovirus comprises a polynucleotide deletion resulting in a virus comprising the following sequence: TTCCGTGGCG (SEQ ID NO: 46). In certain embodiments, the recombinant adenovirus comprises a deletion of nucleotides corresponding to 477 to 484 of the Ad35 genome (SEQ ID NO: 41).

[0133] In certain embodiments, the present invention provides a method for expressing two therapeutic transgenes, when expressed, a single polypeptide chain is produced, which is cleaved into two polypeptide chains after transcription. In certain embodiments, the recombinant adenovirus further comprises the following nucleotide sequence: it comprises a first nucleotide sequence containing a first transgene and a second nucleotide sequence containing a second transgene, wherein the first nucleotide sequence and the second nucleotide sequence are separated by a linker. In certain embodiments, the linker encodes a peptide that can be cut by one or more proteases. In certain embodiments, the linker encodes an internal ribosome entry site (IRES). IRES can be, for example, selected from the group consisting of encephalomyocarditis virus IRES, hand, foot and mouth disease virus IRES, and poliovirus IRES. In certain embodiments, the nucleotide sequence is inserted into the IX-E2 insertion site or the L5-E4 insertion site, wherein the recombinant adenovirus further comprises a third nucleotide sequence inserted into the E1b-19K insertion site, the E3 insertion site, or the E4 insertion site.

[0134] In certain embodiments, the virus has one or more modifications to a regulatory sequence or promoter. The modification to a regulatory sequence or promoter comprises one or more nucleotides deleted, substituted or added compared to the wild-type sequence of the regulatory sequence or promoter.

[0135] In one embodiment, the modification of the regulatory sequence or promoter includes modifying the sequence of the transcription factor binding site to reduce the affinity for the transcription factor, for example, by deleting a portion thereof or inserting a single point mutation into the binding site. In certain embodiments, the additional modified regulatory sequence enhances expression in cancer cells but reduces expression in normal cells.

[0136] The Ela regulatory sequence contains five binding sites for the transcription factor Pea3, referred to as Pea3 I, Pea3 II, Pea3 III, Pea3 IV, and Pea3 V, where Pea3 I is the Pea3 binding site closest to the Ela start site and Pea3 V is the furthest. The Ela regulatory sequence also contains binding sites for the transcription factor E2F, referred to here as E2F I and E2F II, where E2F I is the E2F binding site closest to the Ela start site and E2F II is further away. From the Ela start site, the binding sites are arranged as follows: Pea3 I, E2F I, Pea3 II, E2F II, Pea3 III, Pea3 IV, and Pea3 V.

[0137] In one embodiment, at least one of the seven binding sites or functional binding sites is missing. As used herein, a "functional binding site" refers to a binding site that is capable of binding to a corresponding binding partner (e.g., a transcription factor), for example, a binding site with at least 100%, at least 90%, at least 80%, at least 70%, at least 60%, at least 50%, or at least 40% of the binding activity of the corresponding wild-type binding site sequence. As used herein, a "non-functional binding site" refers to a binding site with, for example, less than 30%, less than 20%, less than 10%, or 0% of the binding activity of the corresponding wild-type binding site sequence.

[0138] In certain embodiments, the recombinant adenovirus comprises an E1a promoter with a deletion of a functional Pea3 binding site, e.g., the entire Pea3 binding site is deleted. As used herein, a "functional Pea3 binding site" refers to a Pea3 binding site that is capable of binding to its corresponding transcription factor (e.g., Pea3), e.g., a Pea3 binding site that has at least 100%, at least 90%, at least 80%, at least 70%, at least 60%, at least 50%, or at least 40% of the Pea3 binding activity of the corresponding wild-type Pea3 binding site sequence. As used herein, a "non-functional Pea3 binding site" refers to a Pea3 binding site that has, e.g., less than 30%, less than 20%, less than 10%, or 0% of the Pea3 binding activity of the corresponding wild-type Pea3 binding site sequence. Detection methods for determining whether a Pea3 binding site binds to Pea3 are known in the art. Exemplary binding detection methods include electrophoretic mobility shift assays, chromatin immunoprecipitation assays, and DNA enzyme footprinting assays.

[0139] In one embodiment, at least one Pea3 binding site or functional Pea3 binding site is deleted. The deleted Pea3 binding site can be Pea3 I, Pea3 II, Pea3 III, Pea3 IV, and / or Pea3 V. In one embodiment, the deleted Pea3 binding site is Pea3 II, Pea3 III, Pea3 IV, and / or Pea3 V. In another embodiment, the deleted Pea3 binding site is Pea3 IV and / or Pea3 V. In another embodiment, the deleted Pea3 binding site is Pea3 II and / or Pea3 III. In another embodiment, the deleted Pea3 binding site is Pea3 II and Pea3 III. In another embodiment, the Pea3 I binding site or functional Pea3 I binding site is retained.

[0140] In one embodiment, at least one E2F binding site or functional E2F binding site is deleted. In another embodiment, at least one E2F binding site or functional E2F binding site is retained. In one embodiment, the retained E2F binding site is E2F I and / or E2F II. In another embodiment, the retained E2F binding site is E2F II. In another embodiment, the total deletion consists essentially of one or more of Pea3 II, Pea3 III, Pea3 IV, and / or Pea3 V. In one embodiment, the virus has a deletion of a 50 base pair region located from -305 to -255 upstream of the E1a start site, for example, corresponding to 195-244 of the Ad5 genome (SEQ ID NO: 1), hereinafter referred to as the TAV-255 deletion. In certain embodiments, the TAV-255 deletion results in a promoter comprising the sequence GGTGTTTTGG (SEQ ID NO: 4).

[0141] In one embodiment, the recombinant adenovirus has an E1a modification identical or similar to that in an oncolytic serotype 5 adenovirus (Ad5), which is referred to as TAV-255 in PCT Publication No. WO2010101921 and U.S. Publication No. 20160017294A1, each of which is incorporated herein by reference in its entirety. It is believed that the mechanism by which the TAV-255 vector achieves this tumor selection is through targeted deletion of three transcription factor (TF) binding sites for transcription factors Pea3 and E2F, which are proteins that regulate E1a adenovirus expression, and E1a is the earliest gene transcribed by binding to a specific DNA sequence after the virus enters the host cell. These three Pea3 and E2F deletions attenuate replication in normal cells with growth arrest, but not in malignant cells, indicating that these DNA sequences can only be used for cancer cell transcriptional regulation and growth.

[0142] In certain embodiments, the recombinant adenovirus comprises an E1a promoter having one or more functional Pea3 binding site deletions. In certain embodiments, the deletion comprises a deletion of nucleotides corresponding to about -300 to about -250 upstream of the E1a start site. In certain embodiments, wherein the deletion comprises a deletion of nucleotides corresponding to -305 to -255 upstream of the E1a start site. In certain embodiments, the deletion comprises a deletion of nucleotides corresponding to 195-244 of the Ad5 genome (SEQ ID NO: 1). In certain embodiments, the E1a promoter comprises the sequence GGTGTTTTGG (SEQ ID NO: 4).

[0143] In one embodiment, the recombinant adenovirus comprises one or more deletions of the Pea3 transcriptional binding site, but does not have one or more deletions of the E2F transcriptional binding site in the E1A region. In other embodiments, the recombinant adenovirus comprises one or more deletions of the E2F transcriptional binding site, but does not have one or more deletions of the Pea3 transcriptional binding site in the E1A region.

[0144] In certain embodiments, the recombinant oncolytic adenovirus comprises a modified TATA box-based promoter operably linked to a gene, wherein the modified TATA box-based promoter lacks a functional TATA box and allows selective expression of genes in overproliferation and / or non-growth arrested cells. As used herein, a "functional TATA box" refers to a TATA box capable of binding to a TATA box binding protein (TBP), for example, at least 100%, at least 90%, at least 80%, at least 70%, at least 60%, at least 50%, or at least 40% of the TBP binding activity with a corresponding wild-type TATA box sequence. As used herein, a "non-functional TATA box" refers to, for example, less than 30%, less than 20%, less than 10%, or 0% of the TBP binding activity with a corresponding wild-type TATA box sequence. Detection methods for detecting whether TBP is bound to a TATA box are known in the art. Exemplary binding detection methods include electrophoretic mobility shift analysis, chromosome immunoprecipitation analysis, and DNA enzyme footprint analysis.

[0145] As used herein, a "modified TATA box" refers to a TATA box having one or more nucleotides deleted, substituted or added relative to the wild-type TATA box sequence.

[0146] For example, the virus may comprise a deletion corresponding to nucleotides -29 to -26, -33 to -26, -44 to +52, or -148 to +52 upstream of the E1a start site. In certain embodiments, the deletion comprises a deletion corresponding to nucleotides 353-552 of the Ad5 genome (SEQ ID NO: 1). In certain embodiments, the TATA box deletion results in an E1a promoter comprising the following sequences: CTAGGACTG (SEQ ID NO: 5), AGTGCCCG (SEQ ID NO: 44), and / or TATTCCCG (SEQ ID NO: 45).

[0147] In certain embodiments, the recombinant oncolytic adenovirus comprises a modified CAAT box-based promoter operably linked to a gene, wherein the modified CAAT box-based promoter lacks a functional CAAT box and allows selective expression of the gene in hyperproliferative and / or non-growth-arrested cells. The TATA box-based promoter and the CAAT box-based promoter can be the same promoter (e.g., Ad5 E1a promoter) or can be different promoters.

[0148] As used herein, "CAAT box" refers to a nucleotide sequence that is capable of binding to C / EBP or NF-Y protein. The CAAT box typically comprises the consensus sequence GG(T / C)CAATCT.

[0149] As used herein, a "modified CAAT box" refers to a CAAT box having one or more nucleotides deleted, substituted, or added relative to the wild-type CAAT box sequence.

[0150] As used herein, a "functional CAAT box" refers to a CAAT box that is capable of binding to a C / EBP or NF-Y protein, for example, a CAAT box that has at least 100%, at least 90%, at least 80%, at least 70%, at least 60%, at least 50%, or at least 40% of the C / EBP or NF-Y binding activity of the corresponding wild-type CAAT box sequence. As used herein, a "non-functional CAAT box" refers to a CAAT box that has, for example, less than 30%, less than 20%, less than 10%, or 0% of the C / EBP or NF-Y binding activity of the corresponding wild-type CAAT box sequence. Spike methods for detecting whether a C / EBP or NF-Y protein binds to a CAAT box are known in the art. Exemplary binding detection methods include electrophoretic mobility shift assays, chromatin immunoprecipitation assays, and DNA enzyme footprinting assays.

[0151] As used herein, "CAAT box-based promoter" refers to any gene promoter that contains a CAAT box.

[0152] As used herein, "modified CAAT box-based promoter" refers to a CAAT box-based promoter that is modified by deleting, substituting or adding one or more nucleotides relative to a wild-type CAAT box-based promoter. In certain embodiments, the modification contained in the modified CAAT box-based promoter includes the deletion of one or more nucleotides of the wild-type CAAT box-based promoter sequence. In certain embodiments, the modification contained in the modified CAAT box-based promoter consists of the deletion of one or more nucleotides of the wild-type CAAT box-based promoter sequence. In certain embodiments, the modification contained in the modified CAAT box-based promoter includes the deletion of the entire CAAT box of the wild-type CAAT box-based promoter sequence. In certain embodiments, the modification contained in the modified CAAT box-based promoter consists of the deletion of the entire CAAT box of the wild-type CAAT box-based promoter sequence. In certain embodiments, the modification contained in the modified CAAT box-based promoter includes the deletion of the entire CAAT box of the wild-type CAAT box-based promoter sequence. In certain embodiments, the modification contained in the modified CAAT box-based promoter includes the deletion of the entire CAAT box-based promoter. In certain embodiments, the modifications comprised in the modified CAAT box-based promoter consist of deletion of the entire CAAT box-based promoter. In certain embodiments, the modifications comprised in the modified CAAT box-based promoter do not comprise addition or substitution of a separate functional promoter sequence.

[0153] Nucleic acids encoding viral genes can be added to plasmids and introduced into host cells by conventional transfection or transformation techniques. Specific production and purification conditions will vary depending on the virus and production system used. For adenovirus, the traditional method of producing viral particles is co-transfection, followed by in vivo recombination of a subsequent shuttle plasmid (usually containing a small part of the adenoviral genome and optionally containing a potential transgenic expression cassette) with an adenoviral helper plasmid (containing most of the entire adenoviral genome). Another technology for producing adenovirus includes the use of a bacterial artificial chromosome (BAC) system, using two plasmids containing complementary adenoviral sequences to perform in vivo bacterial recombination in a recA+ bacterial strain, and a yeast artificial chromosome system (YAC) system.

[0154] In certain embodiments, the recombinant adenovirus of the present invention is an oncolytic virus, for example, a virus showing tumor selective replication and / or virus-mediated dissolution. In certain embodiments, the recombinant adenovirus of the present invention shows selective expression of therapeutic transgenes in hyperproliferative cells (e.g., cancer cells, tumor cells) relative to non-hyperproliferative cells. In certain embodiments, the expression of therapeutic transgenes in non-hyperproliferative cells is about 90%, about 80%, about 70%, about 60%, about 50%, about 40%, about 30%, about 20%, about 10%, or about 5% of the expression of genes in hyperproliferative cells. In certain embodiments, the virus shows that there is no detectable expression of therapeutic transgenes in non-hyperproliferative cells. Therapeutic transgenic expression can be determined by any suitable method known in the art, for example, our stern blot or ELISA. The hyperproliferative cell can be a cancer cell, e.g., a carcinoma, sarcoma, leukemia, lymphoma, prostate cancer, lung cancer, gastrointestinal cancer, colorectal cancer, pancreatic cancer, breast cancer, ovarian cancer, cervical cancer, gastric cancer, thyroid cancer, mesothelioma, liver cancer, kidney cancer, skin cancer, head and neck cancer, or brain cancer cell.

[0155] C. Transgenic

[0156] The recombinant adenoviruses disclosed herein include one or more exogenous nucleotide sequences inserted into any of the aforementioned insertion sites (eg, the IX-E2 insertion site, the L5-E4 insertion site, the E1b-19K insertion site, the E3 insertion site, or the E4 insertion site).

[0157] In certain embodiments, the nucleotide sequence comprises at least one transgene. In certain embodiments, the nucleotide sequence further comprises a promoter, wherein the transgene is operably linked to the promoter.

[0158] In certain embodiments, the recombinant adenovirus comprises, in a 5' to 3' orientation: (i) a first polyadenylation signal; (ii) a promoter; (iii) a transgene; (iv) a second polyadenylation signal; and (v) a third polyadenylation signal; wherein the transgene is operably linked to the promoter. In some embodiments, the nucleotide sequence, the first nucleotide sequence and / or the second nucleotide sequence is inserted between the first polyadenylation signal and the third polyadenylation signal. In certain embodiments, wherein the second polyadenylation signal is in the opposite transcriptional direction of the third polyadenylation signal. In certain embodiments, the nucleotide sequence is inserted into the L5-E4 insertion site, and the first polyadenylation signal is the polyadenylation signal of the L5 transcription unit, the second polyadenylation signal is the polyadenylation signal of the transgene, and the third polyadenylation signal is the polyadenylation signal of the E4 transcription unit. In certain embodiments, the nucleotide sequence is inserted into the IX-E2 insertion site and the first polyadenylation signal is the polyadenylation signal of the IX transcription unit, the second polyadenylation signal is the polyadenylation signal of the transgene, and the third polyadenylation signal is the polyadenylation signal of the adenovirus IVa2 gene.

[0159] In certain embodiments, the recombinant adenovirus comprises, in a 5' to 3' orientation: (i) a first polyadenylation signal; (ii) a second polyadenylation signal; (iii) a promoter; (iv) a transgene; (v) a third polyadenylation signal; and (vi) a fourth polyadenylation signal and the transgene are operably linked to the promoter. In some embodiments, the nucleotide sequence, the first nucleotide sequence, and / or the second nucleotide sequence are inserted between the first polyadenylation signal and the fourth polyadenylation signal. In certain embodiments, wherein the second polyadenylation signal is in the opposite transcriptional orientation of the first polyadenylation signal. In certain embodiments, wherein the fourth polyadenylation signal is in the opposite transcriptional orientation of the third polyadenylation signal. In certain embodiments, the nucleotide sequence is inserted into the L5-E4 insertion site, and the first polyadenylation signal is the polyadenylation signal of the L5 transcription unit, the third polyadenylation signal is the polyadenylation signal of the transgene, and the fourth polyadenylation signal is the polyadenylation signal of the E4 transcription unit. In certain embodiments, the nucleotide sequence is inserted into the IX-E2 insertion site and the first polyadenylation signal is the polyadenylation signal of the IX transcription unit, the third polyadenylation signal is the polyadenylation signal of the transgene, and the fourth polyadenylation signal is the polyadenylation signal of the adenovirus IVa2 gene.

[0160] In certain embodiments, the recombinant adenovirus further comprises a nucleotide sequence comprising a first nucleotide sequence comprising a first transgene and a second nucleotide sequence comprising a second transgene, wherein the first nucleotide sequence and the second nucleotide sequence are separated by a linker.

[0161] In certain embodiments, the nucleotide sequence comprises, in a 5' to 3' orientation: (i) a first polyadenylation signal; (ii) a promoter; (iii) a first nucleotide sequence comprising a first transgene; (iv) a linker; (v) a second nucleotide sequence comprising a second transgene; (vi) a second polyadenylation signal; and (vii) a third polyadenylation signal; wherein the transgene is operably linked to the promoter. In certain embodiments, wherein the second polyadenylation signal is in the opposite transcriptional orientation of the third polyadenylation signal. In certain embodiments, the nucleotide sequence comprises, in a 5' to 3' orientation: (i) a first polyadenylation signal; (ii) a second polyadenylation signal; (iii) a promoter; (iv) a first nucleotide sequence comprising a first transgene; (v) a linker; (vi) a second nucleotide sequence comprising a second transgene; (vii) a third polyadenylation signal; and (viii) a fourth polyadenylation signal; wherein the transgene is operably linked to the promoter. In certain embodiments, wherein the second polyadenylation signal is in the opposite transcriptional orientation of the first polyadenylation signal. In certain embodiments, the fourth polyadenylation signal is in the opposite transcriptional orientation of the third polyadenylation signal.

[0162] In some embodiments, the linker encodes a peptide that can be cleaved by one or more proteases. In some embodiments, the linker encodes an internal ribosome entry site (IRES) or a self-cleaving 2A peptide. IRES can be selected from the group consisting of encephalomyocarditis virus IRES, hand, foot and mouth disease virus IRES and poliovirus IRES. In some embodiments, the nucleotide sequence is inserted into the IX-E2 insertion site or the L5-E4 insertion site, wherein the recombinant adenovirus further comprises a third nucleotide sequence inserted into the E1b-19K insertion site, the E3 insertion site or the E4 insertion site.

[0163] In certain embodiments, one or more of the nucleotide sequence, the first nucleotide sequence, the second nucleotide sequence, and the third nucleotide sequence comprises one or more transgenes.

[0164] In certain embodiments, one or more of the nucleotide sequence, the first nucleotide sequence, the second nucleotide sequence, and the third nucleotide sequence comprises:

[0165] a) transcription initiation region;

[0166] b) a nucleotide sequence comprising a transgene, wherein the transgene is under the transcriptional control of the transcription initiation region; and

[0167] c) Transcription planting area.

[0168] In some embodiments, the transcription initiation region comprises a promoter.

[0169] In certain embodiments, one or more of the transgene, the first transgene, and the second transgene encode a monomeric, dimeric, trimeric, tetrameric, or multimeric protein or portion thereof. In certain embodiments, one or more of the transgene, the first transgene, and the second transgene encode an RNA having therapeutic activity. In certain embodiments, one or more of the transgene, the first transgene, and the second transgene encode a fusion protein comprising at least one binding domain.

[0170] In some embodiments, one or more of the transgene, the first transgene, and the second transgene encode an immunomodulatory molecule. In some embodiments, the immunomodulatory molecule is a co-stimulatory ligand, a cytokine, or a cytokine receptor. In some embodiments, the immunomodulatory molecule is selected from the group consisting of IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-7, IL-10, IL-10trap, IL-10R, IL-12A / p35, IL-12B / p40, IL-15, IL-23A / p19, IL-24, IL-27, IL-33, IL-35, IL-15, IL-15 receptor fusion protein, TGF-β, TGF-βtrap, IL-10t rap, VEGF, VEGFtrap, indoleamine-2,3-dioxygenase (IDO), inducible T-cell co-stimulatory ligand (ICOS-L), CD80, CD137L, TNF-α, IFN-α, IFN-β, IFN-γ, GM-CSF, GITR ligand (GITRL), OX40 ligand (OX40L), CD40 ligand (CD40L) / CD154, CD70, CD86, CD137, CD137L, BORIS / CTCFL, bone morphogenetic protein (BMP), TNFSF9, FGF, ICAM, podocalyxin, their functional fragments, and their derivatives.

[0171] In certain embodiments, the transgene encodes a fusion protein comprising the following parts in the N-terminal to C-terminal direction: a soluble portion of the extracellular domain of a cytokine receptor; an amino acid linker; an immunoglobulin (Ig) hinge region; and an immunoglobulin (Ig) Fc domain. In some embodiments, the cytokine receptor is a TGFβ type II (TβRII) receptor.

[0172] In certain embodiments, the nucleotide sequence encoding CD80 or a functional fragment thereof is inserted into the IX-E2 insertion site, and the nucleotide sequence encoding CD137L or a functional fragment thereof is inserted into the L5-E4 insertion site. In certain embodiments, the nucleotide sequence encoding CD137L or a functional fragment thereof is inserted into the IX-E2 insertion site, and the nucleotide sequence encoding CD80 or a functional fragment thereof is inserted into the L5-E4 insertion site.

[0173] In certain embodiments, the recombinant adenovirus comprises a nucleotide sequence encoding IL-12A / p35 or a functional fragment thereof, a nucleotide sequence encoding IL-12B / p40 or a functional fragment thereof, and a nucleotide sequence encoding IFN-α or a functional fragment thereof. These nucleotide sequences can be inserted into the IX-E2 insertion site, the L5-E4 insertion site, the E1b-19K insertion site, the E3 insertion site, and / or the E4 insertion site.

[0174] In certain embodiments, one or more of the transgene, the first transgene, and / or the second transgene encodes an antigen binding molecule. In certain embodiments, the antigen binding molecule is an anti-PD-1 antibody, an anti-TGF-β antibody, an anti-PD-L1 antibody, and an anti-CTLA-4 antibody or a functional fragment thereof. Exemplary anti-PD-1 antibodies include nivolumab (Bristol-Myers Squibb Co.), pembrolizumab ( Merck & Co.) and atezolizumab (formerly MPDL3280A), MEDI4736, avelumab, and PDR001.

[0175] In some embodiments, one or more of the transgene, the first transgene, and the second transgene encode an antigen or a ligand for the antigen. In some embodiments, the antigen is selected from the group consisting of CAIX, CEA, CD5, CD7, CD10, CD19, CD20, CD22, CD30, CD33, CD34, CD38, CD41, CD44, CD49f, CD56, CD74, CD80, CD133, CD135 (Flt3), Flt3I, CD138, cytomegalovirus (CMV) infected cell antigen, 4-1BB, EGP-2, EGP-40, EpCAM, erbB2, erbB3, erbB4, FBP, fetal acetylcholine receptor, KRAS, HPV E6, E7, BING-4, EphA3, calcium-activated chloride channel-2, cyclin B1, 9D7, SAP-1, PRAME, SSX-2, immature laminin receptor, folate receptor-a, telomerase, tyrosinase, melanin-A, NY-ESO-1, GD2, GD3, hTERT, IL13R-a2, x-light chain, KDR, LeY, LI cell adhesion molecule, MAGE-A1, MAGE-A3, MART1, MART2, MUC1, mesothelin, HER-2 / neu, EGFRvIII, NKG2D ligand, NY-ES0-1, gp100, TRP-1 / -2, TRP-1 / -2, P polypeptide, MC1R, prostate-specific antigen, BRAF, androgen receptor, β-catenin, BRCA1 / 2, CDK4, CML66, fibronectin, p53, TGF-βRII, T cell receptor, carcinoembryonic antigen, 5T4, PSCA, PSMA, ROR1, TAG-72, VEGF-R2, WT-1, their functional fragments, and their derivatives.

[0176] In certain embodiments, one or more of the transgene, the first transgene, and the second transgene encode a toxin. In certain embodiments, the toxin is Pseudomonas exotoxin, ricin, or diphtheria toxin.

[0177] In certain embodiments, one or more of the transgene, the first transgene, and the second transgene encode an enzyme. In certain embodiments, the enzyme is selected from the group consisting of β-glucuronidase, β-galactosidase, β-glucosidase, carboxypeptidase, β-lactamase, esterase, metalloproteinase, relaxin, collagenase, streptokinase, arginase, NOS-2, fragments thereof, and derivatives thereof.

[0178] In certain embodiments, one or more of the transgene, the first transgene, and the second transgene encodes a cell cycle controller, a growth factor, an anticoagulant, a prodrug activating gene, a tumor suppressor gene, an apoptosis gene, an antiplatelet agent, a coagulation factor, a cystic fibrosis transmembrane conductance regulator (CFTR) protein, a fragment thereof, or a derivative thereof.

[0179] In certain embodiments, one or more of the transgene, the first transgene, and the second transgene encodes angiostatin, endostatin, acetylcholine, DKK1 / Wnt, Ox40L, GITRL, secreted flagellin, thymidine kinase, a functional fragment thereof, or a derivative thereof.

[0180] II. Treatment Methods

[0181] In another aspect, the present invention provides a method for inhibiting tumor cell proliferation, comprising exposing tumor cells to an effective amount of any of the aforementioned recombinant adenoviruses to inhibit the proliferation of tumor cells.

[0182] In another aspect, the present invention provides a method of inhibiting tumor growth in a subject in need thereof, wherein the method comprises administering to the subject an effective amount of any of the aforementioned recombinant adenoviruses to inhibit tumor growth. In some embodiments, the tumor is a HER2 / neu positive tumor, and wherein the recombinant adenovirus comprises an E1a promoter having no more than one functional Pea3 binding site deleted. In some embodiments, the HER2 / neu positive tumor is selected from breast cancer, gastric cancer, ovarian cancer, bladder cancer, salivary gland cancer, endometrial cancer, pancreatic cancer or non-small cell lung cancer (NSCLC).

[0183] In certain embodiments, the tumor is selected from the group consisting of melanoma, squamous cell carcinoma of the skin, basal cell carcinoma, head and neck tumors, breast tumors, anal tumors, cervical cancer, non-small cell lung cancer, mesothelioma, small cell lung tumors, renal cell carcinoma, prostate tumors, gastroesophageal tumors, colorectal tumors, testicular tumors, bladder tumors, ovarian tumors, hepatocellular carcinoma, bile duct cancer, brain tumors, endometrial tumors, neuroendocrine tumors, Merkel cell carcinoma, gastrointestinal stromal tumors, sarcomas, and pancreatic tumors.

[0184] The recombinant adenovirus disclosed herein can be used to treat a variety of medical indications, for example, cancer. As used herein, "treat, treating and treatment" refer to the treatment of a disease in a subject (e.g., a human). This includes: (a) inhibiting the disease, that is, stagnating its development; and (b) alleviating the disease, that is, causing the reversal of the disease state. As used herein, the terms "subject" and "patient" refer to an organism treated by the methods and compositions described herein. Such organisms preferably include, but are not limited to, mammals (e.g., mice, monkeys, horses, cattle, pigs, dogs, cats, etc.), more preferably humans.

[0185] In one aspect, the present invention provides a method for treating a hyperproliferative disease in a subject. The method comprises administering to the subject an effective amount of a recombinant virus as described herein to treat the hyperproliferative disease in the subject. In certain embodiments, the hyperproliferative disease in the subject is selected from the group consisting of cancer, arteriosclerosis, rheumatoid arthritis, psoriasis, lupus, idiopathic pulmonary fibrosis, scleroderma, and sclerosis. In certain embodiments, the hyperproliferative disease is cancer.

[0186] In some embodiments, the present invention provides a method for treating cancer in a subject. The method comprises administering to the subject an effective amount of the recombinant adenovirus described herein to treat the cancer in the subject.

[0187] Examples of cancer include solid tumors, soft tissue tumors, hematopoietic tumors, and metastatic lesions. Examples of hematopoietic tumors include: leukemias, acute leukemias, acute lymphoblastic leukemia (ALL), B-cell, T-cell or FABALL, acute myeloid leukemia (AML), chronic myeloid leukemia (CML), chronic lymphocytic leukemia (CLL), e.g., transformed CLL, diffuse large B-cell lymphoma (DLBCL), follicular lymphoma, hairy cell leukemia, myelodysplastic syndrome (MDS), lymphoma, Hodgkin's disease, malignant lymphoma, non-Hodgkin's lymphoma, Burkitt's lymphoma, multiple myeloma, or Richter's syndrome (Richter's transformation). Examples of solid tumors include malignancies, e.g., sarcomas, adenocarcinomas, and cancers of various organ systems, such as those affecting the head and neck (including the pharynx), thyroid, non (small cell or non-small cell lung cancer (NSCLC)), breast, lymphoid, gastrointestinal tract (e.g., mouth, esophagus, stomach, liver, pancreas, small intestine, colon and rectum, anal canal), genital and genitourinary tracts (e.g., kidney, urothelium, bladder, ovary, uterus, cervix, endometrium, prostate, testis), CNS (e.g., neural or glial cells, e.g., neuroblastoma or glioma), or skin (e.g., melanoma).

[0188] In certain embodiments, the cancer is selected from melanoma, squamous cell carcinoma of the skin, basal cell carcinoma, head and neck cancer, breast cancer, anal tumors, cervical cancer, non-small cell lung cancer, mesothelioma, small cell lung cancer, renal cell carcinoma, prostate cancer, gastroesophageal cancer, colorectal cancer, testicular cancer, bladder cancer, ovarian cancer, hepatocellular carcinoma, bile duct cancer, brain cancer, endometrial cancer, neuroendocrine cancer, and pancreatic cancer.

[0189] In certain embodiments, the cancer is selected from the group consisting of rhinitis cancer, basal cell carcinoma, synovial cancer, hepatocellular carcinoma, kidney cancer, connective tissue cancer, melanoma, lung cancer, intestinal cancer, colon cancer, rectal cancer, colorectal cancer, brain cancer, laryngeal cancer, oral cancer, liver cancer, bone cancer, pancreatic cancer, choriocarcinoma, gastrinoma, neuroendocrine tumor, pheochromocytoma, prolactinoma, T-cell leukemia / lymphoma, neuroma, Hippel-Lindau disease, Zollinger-Ellison syndrome, adrenal cancer, anal tumor, bile duct cancer, bladder cancer, ureteral cancer, brain cancer, oligodendroglioma, neuroblastoma, meningioma, age tumor, bone cancer, osteochondroma, chondrosarcoma, Ewing's sarcoma, cancer of unknown primary, benign tumor, benign tumor of the gastrointestinal tract, fibrosarcoma, breast cancer, Paget's disease, cervical cancer, colorectal cancer, rectal cancer, Esophageal cancer, Gallbladder cancer, Head tumors, Pharyngeal tumors, Neck tumors, Kidney cancer, Wilm's tumor, Liver cancer, Kaposi's sarcoma, Prostate cancer, Lung cancer, Testicular cancer, Hodgkin's disease, Non-Hodgkin's lymphoma, Oral cancer, Skin cancer, Mesothelioma, Multiple myeloma, Ovarian cancer, Endocrine pancreatic cancer, Glucagonoma, Pancreatic cancer, Parathyroid cancer, Penile cancer, Pituitary tumors, Soft tissue sarcoma, Retinoblastoma, Small intestine cancer, Gastric cancer, Thymus cancer, Thyroid cancer, Trophoblastic carcinoma, Hydatidiform mole, Uterine cancer, Endometrial cancer, Vaginal cancer, Vulvar cancer, Acoustic neuroma, Mycosis fungoides, Insuloma, Carcinoid syndrome, Somatostatinoma, Gum cancer, Heart cancer, Lip cancer, Meningeal cancer, Oral cancer, Nerve cancer, Jaw cancer, Parotid gland cancer, Peritoneal cancer, Glossopharyngeal cancer, Pleural cancer, Salivary gland cancer, Tongue cancer, and Tonsilla cancer.

[0190] In some aspects, the present invention provides a method of inhibiting tumor cell proliferation, comprising exposing the tumor cells to an effective amount of any of the aforementioned recombinant adenoviruses.

[0191] In another aspect, the present invention provides a method of inhibiting tumor growth in a subject in need thereof, wherein the method comprises administering to the subject an effective amount of any of the aforementioned recombinant adenoviruses. In certain embodiments, the tumor is selected from the group consisting of melanoma, squamous cell carcinoma of the skin, basal cell carcinoma, head and neck tumors, breast tumors, anal tumors, cervical cancer, non-small cell lung cancer, mesothelioma, small cell lung tumors, renal cell carcinoma, prostate tumors, gastroesophageal tumors, colorectal tumors, testicular tumors, bladder tumors, ovarian tumors, hepatocellular carcinoma, bile duct cancer, brain tumors, endometrial tumors, neuroendocrine tumors, Merkel cell carcinoma, gastrointestinal stromal tumors, sarcomas, and pancreatic tumors.

[0192] In another aspect, the present invention provides a method of treating a disease or condition in a subject in need thereof, wherein the method comprises administering to the subject an effective amount of any of the aforementioned recombinant adenoviruses. In certain embodiments, the disease or condition is selected from the group consisting of infection, diabetic retinopathy, psoriasis, rheumatoid arthritis, endometriosis, macular degeneration disorders and benign growth disorders such as prostate hypertrophy and lipomas, vascular disease, cardiovascular disease, infection, cirrhosis, connective tissue disease, tumors, vascular lesions, ulcerative lesions, inflammation, thrombosis, and neointimal formation.

[0193] In certain embodiments, the subject is a mammal. In certain embodiments, the subject is a human. In certain embodiments, the subject is a child. In certain embodiments, the subject is an adult.

[0194] In certain embodiments, the recombinant adenovirus is administered by intramuscular, intravenous, intraarterial or intratumoral injection. In certain embodiments, the recombinant adenovirus is administered by intradermal, inhalation, transdermal, topical, eye drops, intranasal, transmucosal and rectal administration.

[0195] In certain embodiments, the aforementioned recombinant adenovirus is administered to a subject in combination with one or more treatments selected from the group consisting of surgery, radiotherapy, chemotherapy, immunotherapy, hormone therapy, and viral therapy.

[0196] In certain embodiments, the recombinant adenovirus of the invention is administered in combination with a tyrosine kinase inhibitor (eg, erlotinib).

[0197] In certain embodiments, the recombinant adenovirus of the present invention is administered in combination with one or more checkpoint regulators. In certain embodiments, the immune checkpoint regulator is an inhibitor, antagonist or agonist of one or more molecules selected from the group consisting of PD-1, PD-L1, PD-L2, 2B4, TIGIT, LAG3, Tim3, BTLA, CD160, GITR, KIR, 4-1BB, and CTLA4. In some embodiments, the immune checkpoint regulator is an antibody to: PD-1, PD-L1, PD-L2, 2B4, TIGIT, LAG3, Tim3, BTLA, CD160, GITR, KIR, 4-1BB, and / or CTLA4. Exemplary anti-PD-1 antibodies include nivolumab (Bristol-Myers Squibb Co.), pembrolizumab ( Merck & Co.) and atezolizumab (formerly MPDL3280A), MEDI4736, avelumab, and PDR001.

[0198] The pharmaceutical preparation is preferably sterile. Sterilization can be performed by any suitable method, such as by infusion, filtration through a sterile filtration membrane. When the composition is lyophilized, filtration sterilization can be performed before or after lyophilization and reconstitution.

[0199] As used herein, the term "effective amount" refers to an amount of an active ingredient (e.g., an amount of a recombinant virus of the invention) sufficient to cause a beneficial or desired result. An effective amount can be administered in one or more administrations, applications or dosages, and is not intended to be limited to a particular formulation or route of administration.

[0200] In certain embodiments, the therapeutically effective amount of the active ingredient is in the range of 0.1 mg / kg to 100 mg / kg, for example, 1 mg / kg to 100 mg / kg, 1 mg / kg to 10 mg / kg. In certain embodiments, the therapeutically effective amount of the recombinant virus is in the range of: 10 2 -10 15 Plaque forming units (pfus), e.g., 10 2 -10 10 , 10 2 -10 5 , 10 5 -10 15 , 10 5 -10 10 or 10 10 -10 15 Plaque forming units. The dosage will depend on variables such as the type and extent of the disease or indication to be treated, the patient's overall health, the in vivo efficacy of the antibody, the pharmaceutical formulation, and the route of administration. The initial dose may be increased beyond the upper limit level to quickly reach the desired blood level or tissue level. Alternatively, the initial dose may be less than the optimal dose, and the daily dose may be gradually increased during the treatment. The dose for a person may be optimized, for example, in a conventional phase I dose escalation study designed to proceed from 0.5 mg / kg to 20 mg / kg. The frequency of administration may vary according to factors such as route of administration, dosage, serum half-life of the virus, and the disease to be treated. Exemplary dosing frequencies are once a day, once a week, and once every two weeks. One route of administration is parenteral, for example, intravenous infusion. The preparation of virus-based drugs is within the general technical scope of the art. In certain embodiments, the recombinant virus is lyophilized and then reconstituted in buffered saline when administered.

[0201] As used herein, the term "combination" administration is understood to mean delivering two (or more) different treatments to a subject during the course of the subject's illness so that the therapeutic effects on the patient overlap at a certain point in time. In certain embodiments, when the delivery of the second treatment begins, the delivery of the first treatment is still occurring so that there is overlap in the administration. This is sometimes referred to as "simultaneous" or "parallel delivery" in this article. In other embodiments, the delivery of one treatment ends before the delivery of another treatment begins. In some embodiments of either case, due to combined administration, the treatment is more effective. For example, compared to what would be seen if the second treatment were administered in the absence of the first treatment, or compared to a similar situation seen with the first treatment, the second treatment is more effective, for example, the same effect can be seen with less second treatment, or the second treatment reduces symptoms to a greater extent. In certain embodiments, delivery reduces symptoms or other parameters associated with the disease more than what is seen when delivering one treatment without the presence of another. The effects of the two treatments may be partially additive, fully additive, or greater than additive. Delivery may make the effect of the first treatment delivered still detectable when the second is delivered.

[0202] III. Pharmaceutical Compositions / Formulations

[0203] The present disclosure also provides a pharmaceutical composition comprising any of the aforementioned recombinant adenoviruses and at least one pharmaceutically acceptable carrier or diluent. As used herein, "pharmaceutically acceptable carrier" means a buffer, carrier and excipient that is suitable for contact with human and animal tissues without excessive toxicity, irritation, allergic reaction or other problems or indications, commensurate with a reasonable benefit / risk ratio. The carrier should be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not harmful to the recipient. Pharmaceutically acceptable carriers include buffers, solvents, dispersion media, coatings, isotonic and absorption-delaying agents, etc. that are compatible with drug administration. .

[0204] Pharmaceutical compositions and formulations comprising the recombinant adenovirus disclosed herein can be formulated to be compatible with the route by which it is intended to be administered. Examples of routes of administration are intramuscular, intravenous, intraarterial or intratumoral, intradermal, inhalation, transdermal, topical, transmucosal, and rectal administration.

[0205] In one aspect, the present disclosure provides an adenovirus preparation for stabilizing and storing a recombinant adenovirus. In some embodiments, the present invention provides a preparation for an adenovirus, comprising:

[0206] One or more of any of the foregoing recombinant adenoviruses;

[0207] at least one buffer;

[0208] at least one tension modifier;

[0209] at least one sugar or at least one stabilizer or both; and

[0210] wherein the pH of the formulation is between about 7.0 and about 9.0.

[0211] In certain embodiments, the stabilizer is glycerol. In certain embodiments, the stabilizer is about 2% to about 5% (v / v).

[0212] In certain embodiments, the buffer is Tris (including Tris-HCl and / or mono-Tris), TES, HEPES, strychnine tetrahydrate, EPPS, trimethylglycine or histidine. In certain embodiments, the concentration of the buffer is about 1 mM to about 30 mM.

[0213] In some embodiments, the tonicity modifier is MgCl 2 、MnCl 2 , CaCl 2 、ZnCl 2 , NaCl or KCl. In one embodiment, the tension modifier is NaCl. In one embodiment, the concentration of the tension modifier is about 0.1 mM to about 5 mM. In one embodiment, the concentration of the tension modifier is about 10 mM to about 250 mM. In one embodiment, the concentration of the tension modifier is about 25 mM to about 100 mM. In one embodiment, the concentration of the tension modifier is about 25 mM.

[0214] In certain embodiments, the formulation comprises a first tension modifier and a second tension modifier, wherein the first tension modifier is a monovalent cation, and wherein the second tension modifier is a divalent cation. In certain embodiments, the monovalent cation is NaCl or KCl. In certain embodiments, the divalent cation is MgCl 2 、MnCl 2 , CaCl 2 or ZnCl 2 In certain embodiments, the concentration of the tonicity modifier or divalent cation is from about 0.1 mM to about 5 mM.

[0215] In some embodiments, the sugar is sucrose or trehalose. In one embodiment, the sugar is sucrose. In one embodiment, the weight to volume percentage of the sugar is about 2% to about 8%. In one embodiment, the weight to volume percentage of the sugar is about 3% to about 5%. In one embodiment, the weight to volume percentage of the sugar is about 5%.

[0216] In certain embodiments, any of the foregoing formulations further comprises at least one nonionic surfactant. In certain embodiments, the nonionic surfactant is polysorbate-80 or polysorbate-40. In one embodiment, the concentration of the nonionic surfactant is about 0.001% to about 1%. In one embodiment, the concentration of the nonionic surfactant is about 0.02%.

[0217] In certain embodiments, any of the foregoing formulations further comprises at least one free radical oxidation inhibitor. In certain embodiments, the free radical oxidation inhibitor is EDTA. In one embodiment, the concentration of the free radical oxidation inhibitor is about 0.01mM to about 5mM. In one embodiment, the concentration of the free radical oxidation inhibitor is about 0.05mM to about 2mM. In one embodiment, the concentration of the free radical oxidation inhibitor is about 0.1mM.

[0218] In certain embodiments, any of the foregoing formulations further comprises at least one cryoprotectant. In certain embodiments, the cryoprotectant is EtOH. In some embodiments, the concentration of the cryoprotectant is about 0.01% to 5%. In some embodiments, the concentration of the cryoprotectant is about 0.1% to 2%. In one embodiment, the concentration of the cryoprotectant is about 0.5%.

[0219] In some embodiments, the osmotic pressure concentration of the formulation is about 200mOs / L to about 800mOs / L. In some embodiments, the osmotic pressure concentration of the formulation is about 300mOs / L to about 600mOs / L. In some embodiments, the osmotic pressure concentration of the formulation is about 400mOs / L to about 500mOs / L.

[0220] In certain embodiments, the concentration of the recombinant oncolytic adenovirus in any of the foregoing formulations is about 1×10 7 vp / mL to 1x 10 13 vp / mL.

[0221] In certain embodiments, the formulation comprises about 20 mM Tris, about 25 mM NaCl, about 2.5% glycerol, and wherein the pH of the formulation is about 8.0. In certain embodiments, the formulation comprises about 20 mM Tris, about 25 mM NaCl, about 3-5% sucrose, and wherein the pH of the formulation is about 8.0. In certain embodiments, the formulation comprises about 10 mM Tris, about 75 mM NaCl, about 5% sucrose, about 0.02% polysorbate-80, about 1 mM MgCl2, about 0.1 mM EDTA, about 0.5% EtOH, and wherein the pH of the formulation is about 8.0.

[0222] In certain embodiments, any of the foregoing formulations further comprises at least one immunoadjuvant. In certain embodiments, the immunoadjuvant is selected from: 1) alum, 2) saponin, 3) nonionic polymer surfactants, 4) monophosphoryl lipid A, 5) muramyl dipeptide, and 6) cytokines.

[0223] In certain embodiments, any of the aforementioned preparations further comprises at least one dye. In certain embodiments, any of the aforementioned preparations further comprises at least one reversible protease inhibitor. In certain embodiments, the reversible protease inhibitor is an inhibitor of L3 / p23 cysteine ​​protease. In certain embodiments, any of the aforementioned preparations further comprises an antioxidant. In certain embodiments, the antioxidant is vitamin A, vitamin C, vitamin E, vitamin B6, vitamin B12, folic acid or folate.

[0224] It should be understood that the expression "at least one" independently includes each of the objects described after the expression and various combinations of two or more of the objects, unless otherwise understood from the context and usage. Unless otherwise understood from the context, the expression "and / or" associated with three or more objects should be understood to have the same meaning.

[0225] Unless otherwise understood from the context, the use of the terms "include, includes, including", "has, having", or "contain, contain, containing", including their grammatical equivalents, should generally be understood as open and non-limiting, for example, not excluding other undescribed elements or steps.

[0226] Unless otherwise stated, when the term "about" is used before a quantitative value, the present invention also includes the specific quantitative value itself. As used herein, unless otherwise stated or inferred, the term "about" refers to a difference of ±10% from the nominal value.

[0227] It should be understood that the order of steps or the order in which certain actions are performed is not important as long as the present invention remains operable. Moreover, two or more steps or actions may be performed simultaneously.

[0228] The use of any and all examples or exemplary language herein, for example, "such as" or "including" is intended only to better illustrate the present invention and does not limit the scope of the present invention unless required. No language in the specification should be construed as indicating that any non-claimed element is essential to the practice of the present invention. Example

[0229] The following working examples are illustrative and not intended to be limiting, and one skilled in the art will readily appreciate that other embodiments may be practiced.

[0230] Example 1

[0231] The nucleotide sequence of an exemplary IX-E2 insertion site (numbered according to nucleotides 4029 to 4093 of the NCBI reference sequence AC_000008.1 (SEQ ID NO: 1)) is as follows. The stop codon of the adenovirus IX gene ("TAA" on the left; SEQ ID NO: 8) and the stop codon of the adenovirus IVa2 gene ("TTA" on the right; SEQ ID NO: 9) are shown underlined.

[0232] TAA AACATAAATAAAAAACCAGACTCTGTTTGGATTTGGATCAAGCAAGTGTCTTGCTGTCT TTA (SEQ ID NO:6)

[0233] Example 2

[0234] The nucleotide sequence of an exemplary L5-E4 insertion site (numbered according to nucleotides 32785 to 32916 of NCBI reference sequence AC_000008.1 (SEQ ID NO: 1)) is as follows. The stop codon of the adenovirus fiber gene ("TAA" on the left; SEQ ID NO: 8) and the stop codon of ORF6 / 7 of the adenovirus E4 gene ("TCA" on the right; SEQ ID NO: 10) are shown underlined.

[0235] TAA AGAATCGTTTGTGTTATGTTTCAACGTGTTTATTTTTCAATTGCAGAAAATTTCAAGTCATTTTTCATTCAGTAGTATAGCCCCACCACCACATAGCTTATACAGATCACCGTACCTTAATCAAAC TCA (SEQ ID NO:7)

[0236] Example 3

[0237] To generate a virus with a transgene cloned into an expression cassette in the L5-E4 site, a plasmid carrying an adenoviral nucleotide sequence containing a deletion of the RIDα, RIDβ and 14.7k genes in the E3 region and the ORF1-ORF4 genes in the E4 region was modified by inserting an expression cassette with an SV40 promoter and a terminator with an inserted SwaI restriction site ("ATTTAAAT" SEQ ID NO: 11) into the L5-E4 site. The modified nucleotide sequence from the polyadenylation signal of the L5 transcription unit ("AATAAA" SEQ ID NO: 12) to the polyadenylation signal of the E4 transcription unit ("TTTATT" SEQ ID NO: 13) is:

[0238] SEQ ID NO:14[L5 initial empty]

[0239] AATAAA GAATCGTTTGTGTTATGTTTCAACCTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAAC CATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCTGCCTTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTTTGCAAAG ATTTAAAT AACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGTG TTTATT

[0240] In SEQ ID NO: 14, the nucleotides for the polyadenylation signals and the SwaI restriction site of the L5 and E4 transcription units are underlined.

[0241] The transgene encoding mouse GMCSF was then cloned into the SwaI site, resulting in the following sequence:

[0242] SEQ ID NO:15[L5 initial mGMCSF]

[0243]

[0244] In SEQ ID NO: 15, the polyadenylation signals and the residual nucleotides of the SwaI restriction site of the L5 and E4 transcription units are underlined and the transgene encoding mouse GMCSF is shown in bold.

[0245] The virus TAV-(L5-E4)mGMCSF was generated with the following modifications (compared to the dl309 strain of adenovirus type 5): TAV-255 deletion of the Ela promoter to provide selective replication in cancer cells, deletion of the 5' end of the viral E1B-19K gene (which does not extend into the viral E1B-55K gene), deletion of the E3 RIDα, RIDβ and 14.7k genes (SEQ ID NO: 15 sequence) and deletion of the E4 ORF1-ORF4 genes.

[0246] To detect mGMCSF expression: A549 cells (human cancer cell line), ADS-12 cells (mouse cancer cell line) and WI38 cells (human normal cell line) were infected with TAV-(L5-E4)mGMCSF at an MOI (multiplicity of infection) of 5. As a control, additional cells were cultured without infection or infected with the virus TAV-(E1B-19K)mGMCSF, which carries the following modifications compared to the dl309 strain of adenovirus type 5: TAV-255 deletion of the Ela promoter and duplication of the 5' end of the E1B-19K gene without disrupting the mGMCSF gene of the E1B-55K gene. Four days after infection, the conditioned medium was used in an ELISA to measure mouse GMCSF expression. The results are shown in Table 1. Figure 2 The figure shows that both viruses expressed at high levels in A549 cells, at medium levels in ADS-12 cells, and at low levels in WI38 cells.

[0247] Example 4

[0248] To study the insertion of the expression cassette at the IX-E2 site, initially, we inserted an expression cassette with the cytomegalovirus immediate early promoter (CMV promoter) and the bovine growth hormone transcription terminator (BGH terminator), which contained a NotI restriction site ("GCGGCCGC" SEQ ID NO: 16) between the promoter and the terminator to facilitate the insertion of the transgene. The nucleotide sequence from the IX polyadenylation signal ("AATAAA" SEQ ID NO: 12) to the polyadenylation signal of the E2 transcription unit ("TTTATT" SEQ ID NO: 13) is:

[0249] SEQ ID NO:17[IX initial empty]

[0250] AATAAA AAACCAGACTCTGTTTGGATTTGGATCAAGCAAGTGTCTTGCTGTCTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGT CAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAG TACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGGCGTGGATAGCGGTTTGACTCACGGGGGATTTCCAAGTCTCCACCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGAC TTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCTCTGGCTAACTAGAGAACCCACTGCTTACTGGCTTATCGAAATTAATACGACTCACTATAGGGAGACCC GCGGCCGCCTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCGGTGGGCTCTATGG TTTATT

[0251] The polyadenylation signals and NotI restriction site for the IX and E2 transcripts are underlined.

[0252] Virus TAV IX-WT L5-Empty carries TAV-255 deletion of the Ela promoter, wild-type viral sequence in the IX-E2 site, and sequence SEQ ID NO: 14 (empty expression cassette in the L5-E4 site). Virus TAV IX-WT L5-IL7 carries TAV-255 deletion of the Ela promoter cloned into the L5-E4 cassette of SEQ ID NO: 14, wild-type viral sequence in the IX-E2 site, and sequence SEQ ID NO: 18 (see below, capital letters represent the mouse IL-7 gene, lowercase letters represent the flanking nucleotides from the L5-E4 expression cassette, the L5-E4 expression cassette including the residual nucleotides from the SwaI restriction site underlined).

[0253] SEQ ID NO:18[L5 mIL7]

[0254] gctttgcaaag atttATGTTCCATGTTTCTTTTAGATATATCTTTGGAATTCCTCCACTGATCCTTGTTCTGCTGCCTGTCACATCATCTGAGTGCCACATTAAAGACAAAGAAGGTAAAGCATATGAGAGTGTACTGATGATCAGCATCGATGAATTGGACAAAATGACAGGAACTGATAGTAATTGCCCGAATAATGAACCAAACTTTTTTAGAAAACATGTATGTGATGATACAAAGGAAGCTG CTTTTCTAAATCGTGCTGCTCGCAAGTTGAAGCAATTTCTTAAAATGAATATCAGTGAAGAATTCAATGTCCACTTACTAACAGTATCACAAGGCACACAAACACTGGTGAACTGCACAAGTAAGGAAGAAAAAAACGTAAAGGAACAGAAAAAGAATGATGCATGTTTCCTAAAGAGACTACTGAGAGAAATAAAAACTTGTTGGAATAAAATTTTGAAGGGCAGTATATAA aaat aacttgtttattgcag

[0255] The virus TAV IX-WT L5-GMCSF carries the TAV-255 deletion of the Ela promoter, the wild-type viral sequence in the IX-E2 site, and the sequence SEQ ID NO: 19 cloned into the L5-E4 cassette of SEQ ID NO: 14 (capital letters represent the mouse GMCSF gene, lowercase letters represent the flanking nucleotides from the L5-E4 expression cassette, and the nucleotides from the SwaI restriction site of the L5-E4 expression cassette are underlined). This virus carries the wild-type mouse GMCSF and is not the codon-optimized form of the mouse GMCSF used in the virus TAV-(L5-E4)mGMCSF shown in SEQ ID NO: 15.

[0256] SEQ ID NO:19 [L5 wt mGMCSF]

[0257] gctttgcaaag atttATGTGGCTGCAGAATTTACTTTTCCTGGGCATTGTGGTCTACAGCCTCTCAGCACCCACCCGCTCACCCATCACTGTCACCCGGCTTTGGAAGCATGTAGAGGCCATCAAAGAAGCCCTGAACCTCCTGGATGACATGCCTGTCACGTTGAATGAAGAGGTAGAAGTCGTCTCTAACGAGTTCTCCTTCAAGAAGCTAACATGTGTGCAGACC CGCCTGAAGATATTCGAGCAGGGTCTACGGGGCAATTTCACCAAACTCAAGGGCGCCTTGAACATGACAGCCAGCTACTACCAGACATACTGCCCCCCAACTCCGGAAACGGACTGTGAAACACAAGTTACCACCTATGCGGATTTCATAGACAGCCTTAAAACCTTTCTGACTGATATCCCCTTTGAATGCAAAAAACCAGGCCAAAAATGA aaat aacttgtttattgcag

[0258] The virus TAV IX-GMCSF L5-IL7 carries the TAV-255 deletion of the Ela promoter, the sequence SEQ ID NO: 20 cloned into the IX-E2 cassette of SEQ ID NO: 17 (uppercase letters represent the mouse GMCSF gene, lowercase letters represent the flanking nucleotides of the IX-E2 expression cassette, which contains the residual nucleotides from the NotI restriction site underlined), and mouse IL-7 cloned into the L5-E4 cassette as depicted in SEQ ID NO: 18 and SEQ ID NO: 14. The mouse GMCSF sequence is identical in the viruses TAV IX-WT L5-GMCSF and TAV IX-GMCSF L5-IL7, but is inserted into the IX-E2 expression cassette of one virus and the L5-E4 expression cassette of the other virus.

[0259] SEQ ID NO:20[IX wt mGMCSF]

[0260] atagggagaccc gcggccATGTGGCTGCAGAATTTACTTTTCCTGGGCATTGTGGTCTACAGCCTCTCAGCACCCACCCGCTCACCCATCACTGTCACCCGGCTTTGGAAGCATGTAGAGGCCATCAAAGAAGCCCTGAACCTCCTGGATGACATGCCTGTCACGTTGAATGAAGAGGTAGAAGTCGTCTCTAACGAGTTCTCCTTCAAGAAGCTAACATGTGTGCAGACC CGCCTGAAGATATTCGAGCAGGGTCTACGGGGCAATTTCACCAAACTCAAGGGCGCCTTGAACATGACAGCCAGCTACTACCAGACATACTGCCCCCCAACTCCGGAAACGGACTGTGAAACACAAGTTACCACCTATGCGGATTTCATAGACAGCCTTAAAACCTTTCTGACTGATATCCCCTTTGAATGCAAAAAACCAGGCCAAAAATGA ggcc gc tgtgccttctagt

[0261] To test the transgene expression of these viruses, A549 cells were infected with the viruses at an MOI of 5, and the conditioned media was collected 4 days later and used in ELISAs for IL-7 and GMCSF. The ELISA for GMCSF showed that the expression in the cassette at the IX-E2 site driven by the CMV promoter was significantly higher than that in the cassette at the L5-E4 site driven by SV40, as shown in Figure 2. Figure 3 shown.

[0262] Example 5

[0263] In the initial IX-E2 designed virus ( Figure 4 ), we hypothesized that viral growth could be further optimized by blocking any possibility that the CMV promoter would drive transcription in the opposite direction to that expected (Seila et al., Science. (2008) 322(5909):1849-51). We therefore modified the insert in this site so that both the 5' and 3' ends of the insert contained polyadenylation signals that directed polyadenylated transcripts both into the insert from normal viral genes and extending from the insert toward normal viral genes. See Figure 4 Improved IX-E2 design.

[0264] The nucleotide sequence of the improved insert from the polyadenylation signal of the IX transcript to the polyadenylation signal of the E2 transcript is:

[0265] SEQ ID NO:21 [IX improvement space]

[0266] AATAAA ATACACCTTTTTTCGATTGTACGTATT TTTATT TACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCTCTGGCTAACTAGAGAACCCACTGCTTACTGGCTTATCGAAATTAATACGACTCACTATAGGGAGACCC GCG GCCGC TGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCT AATAAA AAACCAGACTCTGTTTGGATTTGGATCAAGCAAGTGTCTTGCTGTC TTTATT

[0267] Each forward polyadenylation signal ("AATAAA" SEQ ID NO: 12) and reverse adenylation signal ("TTTATT" SEQ ID NO: 13) and NotI site ("GCGGCCGC" SEQ ID NO: 16) are shown underlined. Viruses carrying expression cassettes with improved IX-E2 designs grow more efficiently than viruses with the original IX-E2 design.

[0268] Example 6

[0269] The virus TAV-IXrL5-empty carries a TAV-255 deletion in the viral E1A promoter, SEQ ID NO: 21 (empty expression cassette of the improved IX-E2 design), and SEQ ID NO: 14 (empty expression cassette in the L5-E4 site). The virus TAV-IXrL5-hIL12 carries a TAV-255 deletion in the viral E1A promoter, a gene encoding the human IL12A chain in the improved IX-E2 expression cassette (depicted in SEQ ID NO: 22), and a gene encoding the human IL12B chain in the L5-E4 expression cassette (depicted in SEQ ID NO: 23). In SEQ ID NO: 22, the residual nucleotides of each forward polyadenylation signal ("AATAAA" SEQ ID NO: 12) and reverse polyadenylation signal ("TTTATT" SEQ ID NO: 13) and NotI site are underlined, and the gene encoding the human IL12A chain is shown in bold. In SEQ ID NO:23, the polyadenylation signals of the L5 and E4 transcription units and the residual nucleotides of the SwaI restriction site are underlined, and the gene encoding the human IL12B chain is shown in bold. SEQ ID NO:22 [IX Improved hIL12A]

[0270]

[0271]

[0272] SEQ ID NO:23[L5 initial hIL12B]

[0273]

[0274] The virus WT-IXrL5-hIL12 was generated with the same genomic structure as TAV-IXrL5-hIL12, except that it carried the wild-type E1A promoter instead of the TAV-255 deletion carrying the Ela promoter. Each of these viruses also had a deletion of the E3 RIDα, RIDβ, and 14.7k genes and a deletion of the E4 ORF1-ORF4 genes.

[0275] To compare this design approach with another strategy for integrating IL12 into an oncolytic adenovirus, we tested an adenovirus carrying a gene encoding human IL12A and IL12B chains connected by a furin cleavage site carried in the E1B-19K site (amino acids RAKR; SEQ ID NO: 24). When the fusion protein is synthesized by cells, the furin site is cleaved by furin in Golgi between the last R and the next amino acid (the first amino acid of mature IL12A) of the RAKR sequence. We previously found that the use of the furin cleavage site as a linker resulted in high levels of expression of heterodimeric IL12 proteins. The nucleotide sequence of the fusion gene (capital letters), the flanking SalI and XhoI restriction sites for cloning (underlined), and the adenoviral nucleotides (lowercase letters) indicating the insertion site in the adenoviral genome are:

[0276] SEQ ID NO:25 [hIL12 furin]

[0277] atctgacctc gtcgacATGTGTCACCAGCAGTTGGTCATCTCTTGGTTTTCCCTGGTTTTTCTGGCATCTCCCCTCGTGGCCATATGGGAACTGAAGAAAGATGTTTATGTCGTAGAATTGGATTGGTATCCGGATGCCCCTGGAGAAATGGTGGTCCTCACCTGTGACACCCCTGAAGAAGATGGTATCACCTGGACCTTGGACCAGAGCAGTGAGGTCTTAGGCTCTGGCAAAACCCTGACCATCCAAGTCAAAGAGTTTGGAGATGCTGGCCAGTACACCTGTCACAAAGGAGGCGAGGTTCTAAGCCATTCGCTCCTGCTGCTTCACAAAAAGGAAGATGGAATTTGGTCCACTGATATTTTAAAGGACCAGAAAGAACCCAAAAATAAGACCTTTCTAAGATGCGAGGCCAAGAATTATTCTGGACGTTTCACCTGCTGGTGGCTGACGACAATCAGTACTGATTTGACATTCAGTGTCAAAAGCAGCAGAGGCTCTTCTGACCCCCAAGGGGTGACGTGCGGAGCTGCTACACTCTCTGCAGAGAGAGTCAGAGGGGACAACAAGGAGTATGAGTACTCAGTGGAGTGCCAGGAGGACAGTGCCTGCCCAGCTGCTGAGGAGAGTCTGCCCATTGAGGTCATGGTGGATGCCGTTCACAAGCTCAAGTATGAAAACTACACCAGCAGCTTCTTCATCAGGGACATCATCAAACCTGACCCACCCAAGAACTTGCAGCTGAAGCCATTAAAGAATTCTCGGCAGGTGGAGGTCAGCTGGGAGTACCCTGACACCTGGAGTACTCCACATTCCTACTTCTCCCTGACATTCTGCGTTCAGGTCCAGGGCAAGAGCAAGAGAGAAAAGAAAGATAGAGTCTTCACGGACAAGACCTCAGCCACGGTCATCTGCCGCAAAAATGCCAGCATTAGCGTGCGGGCCCAGGACCGCTACTATAGCTCATCTTGGAGCGAATGGGCATCTGTGCCCTGCAGT CGTGCTAAGCGAAGAAACCTCCCCGTGGCCACTCCAGACCCAGGAATGTTCCCATGCCTTCACCACTCCCAAAACCTGCTGAGGGCCGTCAGCAACATGCTCCAGAAGGCCAGACAAACTCTAGAATTTTACCCTTGCACTTCTGAAGAGATTGATCATGA AGATATCACAAAAGATAAAACCAGCACAGTGGAGGCCTGTTTACCATTGGAATTAACCAAGAATGAGAGTTGCCTAAATTCCAGAGAGACCTCTTTCATAACTAATGGGAGTTGCCTGGCCTCCAGAAAGACCTCTTTTATGATGGCCC TGTGCCTTAGTAGTATTTATGAAGACTTGAAGATGTACCAGGTGGAGTTCAAGACCATGAATGCAAAGCTTCTGATGGATCCTAAGAGGCAGATCTTTCTAGATCAAAACATGCTGGCAGTTATTGATGAGCTGATGCAGGCCCTGAAT TTCAACAGTGAGACTGTGCCACAAAAATCCTCCCTTGAAGAACCGGATTTTTATAAAACTAAAATCAAGCTCTGCATACTTCTTCATGCTTTCAGAATTCGGGGCAGTGACTATTGATAGAGTGATGAGCTATCTGAATGCTTCCTAATAA ctcgag tcaccaggcg

[0278] The virus TAV-hIL12-Furin carries a deletion of TAV-255 of the Ela promoter and SEQ ID NO: 25 in the E1B-19K region. The control virus TAV-Δ19k carries a deletion of TAV-255 of the Ela promoter and a deletion of the E1B-19K region.

[0279] To detect oncolytic activity and IL12 expression, A549 cells were infected in triplicate with TAV-Δ19k, TAV-hIL12-furin, TAV-TAV-IXrL5-empty, and TAV-IXrL5-hIL12 at an MOI of 5. Four days after infection, conditioned media were collected and IL12 was measured in an ELISA that detects only assembled IL12A-IL12B heterodimers, and the remaining cells were stained with crystal violet. Figure 5As shown in the Figure 3, TAV-hIL12-furin lysis was slightly less than the corresponding control virus TAV-Δ19k, which is consistent with our general experience when the transgene is inserted into the E1B-19K region, while TAV-IXrL5-hIL12 lysis was the same as TAV-IXrL5-empty and TAV-Δ19k. This demonstrates that insertion of the expression cassette in the IX-E2 and L5-E4 regions has minimal impact on viral fitness and in this regard may be due to the insertion of the transgene into the E1B-19K region.

[0280] like Figure 6 As shown, TAV-hIL12-furin expresses higher levels of IL12 than viruses using IX-E2 and L5-E4 boxes. This indicates that at least one of the two expression boxes may not be optimal, and further research is prompted to improve the design. However, the IL12 protein produced from TAV-hIL12-furin contains a non-natural RAKR sequence (remaining furin recognition site) at the C-terminus of the IL12B chain, which may lead to undesirable in vivo effects, such as for transgenic or for the immunogenicity of natural IL12, but the advantage of IL12 produced by TAV-IXrL5-hIL12 is that it is all-natural.

[0281] Example 7

[0282] Based on the observed relatively low expression of the L5-E4 cassette compared to the IX-E2 cassette, we hypothesized that the L5-E4 cassette was responsible for the low expression of IL-12 heterodimers. We modified the L5-E4 region to include bidirectional polyadenylation signals at both ends, similar to the approach used for the IX-E2 region.

[0283] The nucleotide sequence SEQ ID NO: 26 was cloned into the L5-E4 region, showing the polyadenylation signals at the 5' and 3' ends of the L5 and E4 transcripts, all polyadenylation signals and the SwaI restriction site are underlined.

[0284] SEQ ID NO:26 [L5 improved SV40]

[0285] AATAAA AGG TTTATTCTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCC CCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTTGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTTTGCAAAG ATTTAAAT AACTTGTTTATTGCAGCTTATAATGGTTACA AATAAA GAATCGTTTGTGTTATGTTTCAACGTG TTTATT

[0286] The virus TAV-(IXr) Empty-(L5r) Empty was prepared to carry the TAV-255 deletion in the E1a promoter, an improved IX-E2 cassette without a transgene in the IX-E2 region as shown in SEQ ID NO:21, and an improved L5-E4 cassette without a transgene in the L5-E4 region as shown in SEQ ID NO:26.

[0287] The virus TAV-(IXr)mIL7-(L5r)mGMCSF comprises: TAV-255 deletion of the Ela promoter, an improved IX-E2 cassette as shown in SEQ ID NO:21 with the mouse GMCSF gene as shown in SEQ ID NO:20 cloned into the NotI site, and an improved L5-E4 cassette as shown in SEQ ID NO:18 with the mouse IL-7 gene as shown in SEQ ID NO:19 cloned into the SwaI site.

[0288] The virus TAV-(IXr)mGMCSF-(L5r)mIL7 comprises: a TAV-255 deletion of the Ela promoter, a modified IX-E2 cassette as shown in SEQ ID NO:21 with the mouse IL-7 gene as shown in SEQ ID NO:27 cloned into the NotI site, and a modified L5-E4 cassette as shown in SEQ ID NO:26 with the mouse GMCSF gene as shown in SEQ ID NO:19 cloned into the SwaI site. Thus, the viruses TAV-(IXr)mGMCSF-(L5r)mIL7 and TAV-(IXr)mIL7-(L5r)mGMCSF differ only in which site the genes for IL-7 and GMCSF are inserted: the modified IX-E2 or the modified L5-E4 site.

[0289] SEQ ID NO:27[IX mIL7]

[0290] atagggagaccc gcggcc ATGTTCCATGTTTCTTTTAGATATATCTTTGGAATTCCTCCACTGATCCTTGTTCTGCTGCCTGTCACATCATCTGAGTGCCACATTAAAGACAAAGAAGGTAAAGCATATGAGAGTGTACTGATGATCAGCATCGATGAATTGGACAAAATGACAGGAACTGATAGTAATTGCCCGAATAATGAACCAAACTTTTTTAGAAAACATGTATGTGATGATACAAAGGAAGCTG CTTTTCTAAATCGTGCTGCTCGCAAGTTGAAGCAATTTCTTAAAATGAATATCAGTGAAGAATTCAATGTCCACTTACTAACAGTATCACAAGGCACACAAACACTGGTGAACTGCACAAGTAAGGAAGAAAAAAACGTAAAGGAACAGAAAAAGAATGATGCATGTTTCCTAAAGAGACTACTGAGAGAAATAAAAACTTGTTGGAATAAAATTTTGAAGGGCAGTATATAA ggccgc tgtgccttctagt

[0291] To test transgene expression of these viruses, A549 cells were infected in triplicate with each virus at an MOI of 5. Conditioned media was collected 4 days later and GMCSF and IL-7 were measured in ELISAs. For both IL-7 and GMCSF, expression was higher with viruses carrying genes in the modified IX-E2 site than with genes in the modified L5-E4 site. This confirms previous findings that expression cassettes using the CMV promoter at IX-E2 expressed higher levels than expression cassettes using the SV40 promoter at L5-E4, which was not affected by modifying the L5-E4 site to include a bidirectional polyadenylation signal.

[0292] Example 8

[0293] We next investigated further improving the promoter in the L5-E4 site. The SV40 promoter originally used had a point mutation in the major transcription start site from G (in the wild-type SV40 sequence) to T (in the L5-E4 insert), from which we generated an L5-E4 insert with the nucleotide changed back to wild-type G as shown in SEQ ID NO:28, with the previously mutated nucleotide, polyadenylation signal, and SwaI restriction site underlined. We also investigated using different promoters and generated an L5-E4 insert using the human EF1A promoter instead of the SV40 promoter. SEQ ID NO:29 shows an L5-E4 insert using the human EF1A promoter, showing the polyadenylation signal from the L5 transcript to the polyadenylation signal of E4, with the polyadenylation signal and SwaI restriction site underlined.

[0294] SEQ ID NO:28 [L5 improved SV40 wt empty]

[0295] AATAAA AGG TTTATT CTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAA GCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTC GGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTTTGCAAAG ATTTAAAT AACTTGTTTATTGCAGCTTATAATGGTTACA AATAAA GAATCGTTTGTGTTATGTTTCAACGTG TTTATT

[0296] SEQ ID NO:29[L5 improved EF1A empty]

[0297] AATAAA AGG TTTATT AGGCGGCCTCCCCGTCACCACCCCCCCCAACCCGCCCCGACCGGAGCTGAGAGTAATTCATACAAAAGGACTCGCCCCTGCCTTGGGGAATCCCAGGGACCGTCGTTAAACTCCCACTAACGTAGAACCCAGAGATCGCTGCGTTCCCGCCCCCTCACCCGCCCGCTCTCGTCATCACTGAGGTGGAGAAGAGCATGCGTGAGGCTCCGGTGCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGAACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACA ATTTAAA T AACTTGTTTATTGCAGCTTATAATGGTTACA AATAAA GAATCGTTTGTGTTATGTTTCAACGTG TTTATT

[0298] To test these improved expression cassettes in L5-E4, we generated viruses carrying the mouse IL-7 gene in the IX-E2 site and the mouse GMCSF gene in the new L5-E4 site. The mouse IL-7 gene used in the IX-E2 site was modified by introducing silent mutations in two regions near the 3' end of the gene with the sequence AATAAA that can be processed as a polyadenylation signal to result in reduced expression, replacing synonymous sequences that do not change the encoded protein sequence but will eliminate the internal AATAAA sequence; SEQ ID NO: 30 shows the nucleotide sequence with nucleotides encoding IL-7 (uppercase) and mutations (underlined), and the flanking nucleotides of the IX-E2 cassette (lowercase letters) with residual nucleotides from NotI (underlined). In an attempt to improve the expression of the mouse GMCSF gene in the L5-E4 site, a consensus Kozak sequence (nucleotides GCCACC) was included between the residual nucleotides of the SwaI site and the start codon of the GMCSF gene; SEQ ID NO:31 shows the nucleotide sequence of the mouse GMCSF gene and the Kozak sequence (uppercase), the Kozak sequence is underlined, and the flanking nucleotides of the L5-E4 box (lowercase) with the residual nucleotides from the SwaI site are underlined.

[0299] SEQ ID NO:30[mIL7 no poly-A]

[0300] atagggagaccc gcggcc ATGTTCCATGTTTCTTTTAGATATATCTTTGGAATTCCTCCACTGATCCTTGTTCTGCTGCCTGTCACATCATCTGAGTGCCACATTAAAGACAAAGAAGGTAAAGCATATGAGAGTGTACTGATGATCAGCATCGATGAATTGGACAAAATGACAGGAACTGATAGTAATTGCCCGAATAATGAACCAAAACTTTTTTAGAAAACATGTATG TGATGATACAAAGGAAGCTGCTTTTCTAAATCGTGCTGCTCGCAAGTTGAAGCAATTTCTTAAAATGAATATCAGTGAAGAATTCAATGTCCACTTACTAACAGTATCACAAGGCACACAAACACTGGTGAACTGCACAAGTAAGGAAGAAAAAAACGTAAAGGAACAGAAAAAGAATGATGCATGTTTCCTAAAGAGACTACTGAGAGAAAT CAAAACTTGTTGGAA C AAAATTTTGAAGGGCAGTATATAA ggccgc tgtgccttctagt

[0301] SEQ ID NO:31[mGMCSF Kozak]

[0302] atttGCCACC ATGTGGCTGCAGAATTTACTTTTCCTGGGCATTGTGGTCTACAGCCTCTCAGCACCCACCCGCTCACCCATCACTGTCACCCGGCCTTGGAAGCATGTAGAGGCCATCAAAGAAGCCCTGAACCTCCTGGATGACATGCCTGTCACGTTGAATGAAGAGGTAGAAGTCGTCTCTAACGAGTTCTCCTTCAAGAAGCTAACATGTGTGCAGACCCGCCTGAAGATATTCGAGCAGGGTCTACGGGGCAATTTCACCAAACTCAAGGGCGCCTTGAACATGACAGCCAGCTACTACCAGACATACTGCCCCCCAACTCCGGAAACGGACTGTGAAACACAAGTTACCACCTATGCGGATTTCATAGACAGCCTTAAAACCTTTCTGACTGATATCCCCTTTGAATGCAAAAAACCAGGCCAAAAATGA aaat aacttgtttattgcag

[0303] The virus TAV-(IXr)mIL7noPA-(L5SV40wt)KozakmGMCSF contains: TAV-255 deletion of the Ela promoter, an improved IX-E2 insert as shown in SEQ ID NO:21 (which has a mouse IL-7 gene cloned into the NotI site as shown in SEQ ID NO:30, wherein the mouse IL-7 has a synonymous mutation at a possible internal polyadenylation site), and an L5-E4 insert with a wild-type SV40 promoter (which has a mouse GMCSF gene containing a consensus Kozak sequence cloned into the SwaI site as shown in SEQ ID NO:28). The virus TAV-(IXr)mIL7noPA-(L5EF1A)KozakmGMCSF contains: TAV-255 deletion of the Ela promoter, an improved IX-E2 insert as shown in SEQ ID NO:21 (which has a mouse IL-7 gene cloned into the NotI site as shown in SEQ ID NO:3, and the mouse IL-7 gene has a synonymous mutation at a possible internal polyadenylation site), and an L5-E4 insert with a human EF1A promoter as shown in SEQ ID NO:29 (which has a mouse GMCSF gene containing a consensus Kozak sequence cloned into the SwaI site as shown in SEQ ID NO:31).

[0304] To test transgene expression of these viruses, A549 cells were infected in triplicate with both viruses at an MOI of 5. After 4 days, conditioned media were collected and used in ELISAs to measure IL-7 and GMCSF expression. Figure 7 The human EF1A promoter had moderately high expression and was selected for further development. The virus TAV-(IXr)mIL7noPA-(L5EF1A)KozakmGMCSF was prepared as a pharmaceutical agent for mouse experiments by multiplying the virus in serum-free suspension culture of SF-BMAdR281 cells (derived from A549 cells), lysing the cells, purifying the virus by chromatography, and dialyzing it in a buffer (containing 25 mM NaCl, 20 mM Tris, 2.5% glycerol, pH 8). The virus thus prepared had a virion concentration of 5.8 x 10 11 vp / ml, the infection titer is 3.0 x 10 10 IU / ml.

[0305] Example 9

[0306] We further investigated whether deletion of the adenoviral death protein (ADP) could improve transgene expression. ADP is expressed late in viral replication and lyses host cells to release progeny virions, so its removal allows cells to survive and express the transgene longer before they are killed. The nucleotide sequence of the ADP gene in the context of the E3 RIDα, RIDβ, and 14.7K deletion in the TAV-(IXr)mIL7noPA-(L5EF1A)KozakmGMCSF virus is shown in SEQ ID NO:32, where the nucleotides encoding ADP are capitalized, the sites of the E3 RIDα, RIDβ, and 14.7K deletions are shown as hyphens, and the flanking adenoviral nucleotides are lowercase. To generate the ΔADP deletion, the underlined nucleotides in SEQ ID NO:32 were deleted.

[0307] SEQ ID NO:32[ADP]

[0308] Gaaaatgccttaa tttactaagttacaaagctaatgtcaccactaactgctttactcgctgcttgcaa aacaaattcaaaaagttagcattataattagaataggatttaaaccccccggtcatttcctgctcaataccattcc cctgaacaattgactctatgtgggatatgctccagcgctacaaccttgaagtcaggcttcctggatgtcagcatct gactttggccagcacctgtcccgcggatttgttccagtccaactacagcgacccaccctaacagagATGACCAACA CAACCAACGCGGCCGCCGCTACCGGACTTACATCTACCACAAATACACCCCAAGTTTCTGCCTTTGTCAATAACTG GGATAACTTGGGCATGTGGTGGTTCTCCATAGCGCTTATGTTTGTATGCCTTATTATTATGTGGCTCATCTGCTGC CTAAAGCGCAAACGCGCCCGACCACCCATCTATAGTCCCATCATTGTGCTACACCCAAACAATGATGGAATCCATA GATTGGACGGACTGAAACACATGTTCTTTTCTCTTACAGTATGA taataaaaaaaaaataataaagca

[0309] The virus TAV-(IXr)mIL7noPA-(L5EF1A)KozakmGMCSF-ΔADP was created with the same genome as TAV-(IXr)mIL7noPA-(L5EF1A)KozakmGMCSF, except that it also contained a nucleotide deletion of the ADP gene, as underlined in SEQ ID NO:32.

[0310] To test whether ADP depletion leads to longer-term and higher transgene expression, A549 cells were infected with TAV-(IXr)mIL7noPA-(L5EF1A)KozakmGMCSF and TAV-(IXr)mIL7noPA-(L5EF1A)KozakmGMCSF-ΔADP at an MOI of 5, and conditioned media were collected every three days after infection to measure IL-7 and GMCSF in ELISA. Figure 8There was no convincing difference in transgene expression levels between the two viruses, although cells were observed during the experiment and cell death was delayed from about 3 days (after infection with TAV-(IXr)mIL7noPA-(L5EF1A)KozakmGMCSF) to about 9 days (after infection with TAV-(IXr)mIL7noPA-(L5EF1A)KozakmGMCSF-ΔADP). Therefore, although the expression of soluble cytokines was not enhanced in this experiment, for some applications (such as expressing costimulatory molecules on the surface of infected cells), the absence of ADP may be advantageous because the cells can survive longer and the costimulatory molecules on their surface can activate target cells for a long time.

[0311] Example 10

[0312] We then used the IX-E2 and L5-E4 sites as part of the design of a virus expressing three transgenes: the co-stimulatory molecules CD80 and CD137L and the adhesion molecule ICAM1. We previously created a virus carrying all three of these transgenes instead of the 5' end of the viral E1B-19K gene, and with an IRES between each of the three transgenes. The nucleotide sequence of this virus in the E1B-19K region is shown in SEQ ID NO:33, which has a 5' flanking adenoviral nucleotide sequence and a SalI restriction site for cloning (lower case), mouse CD80 (upper case), an IRES from encephalomyocarditis virus (lower case), mouse CD137L (upper case), an IRES from hand, foot and mouth disease virus (lower case), mouse ICAM1 (upper case) and a 3' flanking adenoviral nucleotide sequence including an XhoI restriction site for cloning. The virus, TAV-mCD80(IRES)mCD137L(IRES)mICAM1, contains: TAV-255 deletion of the Ela promoter, SEQ ID NO:33 in the E1B-19K site, and deletion of the ADP, RIDα, RIDβ and 14.7K genes in the E3 region and the ORF1-4 genes in the E4 region.

[0313] SEQ ID NO:33 [Costim IRES]

[0314]

[0315] We found that genes following an IRES were generally poorly expressed compared to genes whose translation was not initiated by the IRES, so we investigated the use of IX-E2 and L5-E4 sites as alternative strategies. We generated the virus TAV-(19k)mCD80-(IX)mCD137L-(L5)mICAM1, which carries mouse CD80 (as shown in SEQ ID NO:34) in the E1B-19K loci (the CD80 gene is capitalized, the flanking adenovirus sequences and restriction sites are lowercase) (it uses the Bsu36I restriction site instead of the SalI and XhoI restriction sites used in other viruses), the mouse CD137L gene in the IX-E2 loci of SEQ ID NO:21 (which carries the CD137L gene inserted into the NotI site, as shown in SEQ ID NO:35) (the CD137L gene is capitalized, the flanking expression cassette sequences and the residual NotI restriction site are lowercase), and the mouse ICAM1 gene in the L5-E4 loci of SEQ ID NO:29 (which carries the ICAM1 gene inserted into the SwaI site, as shown in SEQ ID NO:36) (ICAM1 gene is capitalized, flanking expression cassette sequence and residual SwaI site are lowercase). The virus also contains: TAV-255 deletion of Ela promoter, deletion of ADP, RIDα, RIDβ and 14.7K genes in E3 region, and deletion of ORF1-4 genes in E4 region.

[0316] SEQ ID NO:34[19k mCD80]

[0317] atctgacctcATGGCTTGCAATTGTCAGTTGATGCAGGATACACCACTCCTCAAGTTTCCATGTCCAAGGCTCATTCTTCTCTTTGTGCTGCTGATTCGTCTTTCACAAAGTGTCTTCAGATGTTGATGAACAACTGTCCAAGTCAGTGAAAGATAAGGTATTGCTGCCTTGCCGTTACAACTCTCCTCATGAAGATGAGTCTGAAGACCGAATCTACTGGCAAAAACATGACAAAGTGGTGCTGTCTGTCATTGCTGGGAAACTAAAAGTGTGGCCCGAGTATAAGAACCGGACTTTATATGACAACACTACCTACTCTCTTATCATCCTGGGCCTGGTCCTTTCAGACCGGGGCACATACAGCTGTGTCGTTCAAAAGAAGGAAAGAGGAACGTATGAAGTTAAACACTTGGCTTTAGTAAAGTTGTCCATCAAAGCTGACTTCTCTACCCCCAACATAACTGAGTCTGGAAAC CCATCTGCAGACACTAAAAGGATTACCTGCTTTGCTTCCGGGGGTTTCCCAAAGCCTCGCTTCTCTTGGTTGGAAAATGGAAGAGAATTACCTGGCATCAATACGACAATTTCCCAGGATCCTGAATCTGAATTGTACACCATTAGTAGCCAACTAGATTTCAATACGACTCGCAACCACACCATTAAGTGTCTCATTAAATATGGAGATGCTCACGTGTCAGAGGACTTCACCTGGG AAAAACCCCCAGAAGACCCTCCTGATAGCAAGAACACACTTGTGCTCTTTGGGGCAGGATTCGGCGCAGTAATAACAGTCGTCGTCATCGTTGTCATCATCAAATGCTTCTGTAAGCACAGAAGCTGTTTCAGAAGAAATGAGGCAAGCAGAGAAACAAACAACAGCCTTACCTTCGGGCCTGAAGAAGCATTAGCTGAACAGACCGTCTTCCTTTAGtcaggtgaatctgggtcacc

[0318] SEQ ID NO:35[IX mCD137L]

[0319] atagggagacccgcggccATGGACCAGCACACACTTGATGTGGAGGATACCGCGGATGCCAGACATCCAGCAGGTACTTCGTGCCCCTCGGATGCGGCGCTCCTCAGAGATACCGGGCTCCTCGCGGACGCTGCGCTCCTCTCAGATACTGTGCGCCCCACAAATGCCGCGCTCCCCACGGATGCTGCCTACCCTGCGGTTAATGTTCGGGATCGCGAGGCCGCGTGGCCGCCTGCACTGAACTTCTGTTCCCGCCACCCAAAGCTCTATGGCCTAGTCGCTTTGGTTTTGCTGCTTCTGATCGCCGCCTGTGTTCCTATCTTCACCCGCACCGAGCCTCGGCCAGCGCTCACAATCACCACCTCGCCCAACCTGGGTACCCGAGAGAATAATGCAGACCAGGTCACCCCTGTTTCCCACATTGGCTGCCCCAACACTACACAACAGGGCTCTCCTGTGTTCGCCAAGCTACTGGCTAAAAACCAAGCATCGTTGTGCAATACAACTCTGAACTGGCACAGCCAAGATGGAGCTGGGAGCTCATACCTATCTCAAGGTCTGAGGTACGAAGAAGACAAAAAGGAGTTGGTGGTAGACAGTCCCGGGCTCTACTACGTATTTTTGGAACTGAAGCTCAGTCCAACATTCACAAACACAGGCCACAAGGTGCAGGGCTGGGTCTCTCTTGTTTTGCAAGCAAAGCCTCAGGTAGATGACTTTGACAACTTGGCCCTGACAGTGGAACTGTTCCCTTGCTCCATGGAGAACAAGTTAGTGGACCGTTCCTGGAGTCAACTGTTGCTCCTGAAGGCTGGCCACCGCCTCAGTGTGGGTCTGAGGGCTTATCTGCATGGAGCCCAGGATGCATACAGAGACTGGGAGCTGTCTTATCCCAACACCACCAGCTTTGGACTCTTTCTTGTGAAACCCGACAACCCATGGGAATGAggccgctgtgccttctagt

[0320] SEQ ID NO:36[L5 mICAM1]

[0321]

[0322] To test the expression of these two viruses: A549 cells, HT29 cells, ADS12 cells and F244 cells were infected with TAV-mCD80(IRES)mCD137L(IRES)mICAM1, TAV-(19k)mCD80-(IX)mCD137L-(L5)mICAM1 or the control virus TAV-(19k)empty-(IX)empty-(L5)empty (which has the same structure as TAV-(19k)mCD80-(IX)mCD137L-(L5)mICAM1 but without the transgene) at an MOI of 3. After 2 days, cells were stained for CD80, CD137L and ICAM1, and the results are shown in Table 1. Figures 9 - 12 Although the expression of CD137L and ICAM1 genes was poor when expressed in TAV-mCD80(IRES)mCD137L(IRES)mICAM1 after IRESes, the IX-E2 and L5-E4 sites with TAV-(19k)mCD80-(IX)mCD137L-(L5)mICAM1 robustly expressed those genes.

[0323] Embodiment 11

[0324] Although the above experiments used adenoviruses based on human adenovirus type 5, other adenoviruses have similar structures and have clearly identifiable sites identical to the IX-E2 and L5-E4 sites described above. For example, human adenovirus type 35 has a sequence in the IX-E2 site as shown in SEQ ID NO:37 and has a sequence in the L5-E4 site as shown in SEQ ID NO:38, wherein the polyadenylation signal is underlined in each sequence.

[0325] SEQ ID NO:37 [Ad35 wt IX-E2]

[0326] AATAAA AAAAATTCCAGAATCAATGAATAAATAAACGAGCTTGTTGTTGATTTAAAATCAAGTGTT TTT ATT

[0327] SEQ ID NO:38 [Ad35 wt L5-E4]

[0328] AATAAA GTTTAAGTGTT TTTATT

[0329] To determine whether expression cassettes can be inserted into these sites, the IX-E2 site was modified with the same sequence as the modified IX-E2 site of adenovirus type 5 shown in SEQ ID NO:39 (the expression cassette was inserted in the opposite direction of adenovirus type 5, so the flanking viral sequences in lower case letters are conventionally marked with reverse complements, as shown in SEQ ID NO:37), and the L5-E4 site was modified with the same sequence used in adenovirus type 5 with the EF1A promoter shown in SEQ ID NO:40. Adenovirus type 35 carrying both expression cassettes in sites IX-E2 and L5-E4 and lacking the E3 RIDα, RIDβ and 14.7K genes and the E4 ORF1-4 genes was rescued, demonstrating that these sites can be used to insert expression cassettes of other serotypes of adenovirus. The species of inserting expression cassettes into two adjacent transcription units with polynucleotide sites facing each other is in principle not limited to adenoviruses and may also be applied to other viruses.

[0330] SEQ ID NO:39 [Ad35 IX-E2 cassette]

[0331] tcgagatcggtggtccagggcataccgtgcgcgaaaaatgaaataaaATACACCTTTTTTCGATTGTACGTATTTTTATTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCTCTGGCTAACTAGAGAACCCACTGCTTACTGGCTTATCGAAATTAATACGACTCACTATAGGGAGACCCGCGGCCGCTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAaacacttgattttaaatcaacaacaagctcgtttatttat

[0332] SEQ ID NO:40 [Ad35 L5-E4 cassette]

[0333] tttcttttcttacattacagaagacgacaactaaaataaaAGGTTTATTAGGCGGCCTCCCCGTCACCACCCCCCCCAACCCGCCCCGACCGGAGCTGAGAGTAATTCATACAAAAGGACTCGCCCCTGCCTTGGGGAAT CCCAGGGACCGTCGTTAAACTCCCACTAACGTAGAACCCAGAGATCGCTGCGTTCCCGCCCCCTCACCCGCCCGCTCTCGTCATCACTGAGGTGGAGAAGAGCATGCGTGAGGCTCCGGTGCCCGTCAGTGGGCAGAGCG CACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGAACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGT ATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAATTTAAATAACTTGTTTATTGCAGCTTATAATGGTTACAaataaagtttaagtgtttttatttaaaatcacaaaattcg

[0334] Example 12

[0335] We used the improved IX-E2 and L5-E4 sites to generate viruses carrying mouse IL12A and IL12B genes for use as models in preclinical trials. The gene for mouse IL12A was cloned into the NotI restriction site with the improved IX-E2 site as shown in SEQ ID NO:21 to generate the sequence of SEQ ID NO:42, with the remaining nucleotides of the NotI restriction site underlined. The gene for mouse IL12B was cloned into the SwaI restriction site of the L5-E4 site of the expression cassette with the EF1A promoter shown in SEQ ID NO:29 to generate the sequence of SEQ ID NO:43, with the remaining nucleotides of the SwaI restriction site underlined.

[0336] SEQ ID NO:42

[0337] CTATAGGGAGACCC GCGGCCATGTGTCAATCACGCTACCTCCTCTTTTTGGCCACCCTTGCCCTCCTAAACCACCTCAGTTTGGCCAGGGTCATTCCAGTCTCTGGACCTGCCAGGTGTCTTAGCCAGTCCCGAAACCTGCTGAAGACCACAGATGACATGGTGAAGACGGCCAGAGAAAAACTGAAACATTATTCCTGCACTGCTGAAGACATCGATCATGAAGACATCACACGGGACCAAACCAGCACATTGAAGACCTGTTTACCACTGGAACTACACAAGAACGAGAGTTGCCTGGCTACTAGAGAGACTTCTTCCACAACAAGAGGGAGCTGCCTGCCCCCACAGAAGACGTCTTTGATGATGACCCTGTGCCTTGGTAGCATCTATGAGGACTTGAAGATGTACCAGACAGAGTTCCAGGCCATCAACGCAGCACTTCAGAATCACAACCATCAGCAGATCATTCTAGACAAGGGCATGCTGGTGGCCATCGATGAGCTGATGCAGTCTCTGAATCATAATGGCGAGACTCTGCGCCAGAAACCTCCTGTGGGAGAAGCAGACCCTTACAGAGTGAAAATGAAGCTCTGCATCCTGCTTCACGCCTTCAGCACCCGCGTCGTGACCATCAACAGGGTGATGGGCTATCTGAGCTCCGCCTGA GGCCGC TGTGCCTTCTAGTT

[0338] SEQ ID NO:43

[0339] TTGCCGCCAGAACACA ATTTAAAT AACTTGTTTATTGCAG

[0340] A virus TAV-IX5-empty was generated carrying: TAV-255 deletion of the Ela promoter, the IX-E2 expression cassette without the transgene shown in SEQ ID NO: 21, and the L5-E4 expression cassette without the transgene shown in SEQ ID NO: 29. A virus TAV-IX5-mIL12 was generated carrying: TAV-255 deletion of the Ela promoter, the IX-E2 expression cassette containing the mouse IL12A gene of SEQ ID NO: 42, and the L5-E4 expression cassette containing the mouse IL12B gene of SEQ ID NO: 43.

[0341] To test the oncolytic effect of these viruses, A549 cells were infected with TAV-IX5-empty or TAV-IX5-mIL12 viruses at an MOI of 5 or kept as uninfected controls, and the wells were visualized with crystal violet every 2 days after infection. Figure 13 As shown, both the empty control virus and the virus carrying mouse IL-12 lysed within 4-6 days.

[0342] To detect transgene expression, A549 cells were infected with TAV-IX5-empty or TAV-IX5-mIL12 virus at an MOI of 5 in triplicate, and conditioned media were collected 4 days after infection to measure mouse IL-12 using an ELISA that detects only heterodimers with both mouse IL12A and mouse IL12B chains. Figure 14 As shown, TAV-IX5-mIL12 induced high-level expression of IL-12 heterodimers.

[0343] Human adenovirus 5, complete genome

[0344] NCBI reference sequence: AC_000008.1 (SEQ ID NO: 1)

[0345] >AC_000008.1 Human adenovirus 5, complete genome

[0346]

[0347] Human adenovirus 35, complete genome

[0348] NCBI reference sequence: AC_000019.1 (SEQ ID NO:41)

[0349]

[0350] References

[0351] Each of the patent documents and scientific articles mentioned herein is incorporated by reference in its entirety for all purposes.

[0352] Equivalent range

[0353] The present invention may be implemented in other specific forms without departing from its spirit or essential characteristics. The foregoing embodiments are therefore considered to be illustrative in all respects, rather than limiting the invention described herein. The scope of the present invention is therefore indicated by the appended claims rather than the foregoing description, and all changes within the meaning and equivalent range of the claims are intended to be included therein.

Claims

1. A recombinant adenovirus, comprising: a nucleotide sequence inserted into an IX-E2 insertion site, wherein the IX-E2 insertion site is located between the stop codon of an adenovirus IX gene and the stop codon of an adenovirus IVa2 gene, The nucleotide sequence inserted into the IX-E2 insertion site comprises in the 5' to 3' direction: (i) first IX-E2 polyadenylation signal; (ii) promoter; (iii) genetically modified organisms; (iv) a second IX-E2 polyadenylation signal; and (v) third IX-E2 polyadenylation signal; wherein the first IX-E2 polyadenylation signal is the polyadenylation signal of the IX gene, the second IX-E2 polyadenylation signal is the polyadenylation signal of the transgene, and the third IX-E2 polyadenylation signal is the polyadenylation signal of the adenovirus IVa2 gene, wherein the nucleotide sequence is inserted between nucleotides corresponding to positions 4029 and 4093 of the Ad5 genome: SEQ ID NO: 1, or the nucleotide sequence is inserted between nucleotides corresponding to positions 3899 and 3970 of the Ad35 genome: SEQ ID NO:

41.

2. The recombinant adenovirus of claim 1, wherein the nucleotide sequence is inserted between nucleotides 4029 and 4050 corresponding to the Ad5 genome: SEQ ID NO: 1, between nucleotides 4050 and 4070 corresponding to the Ad5 genome, or between nucleotides 4070 and 4093 corresponding to the Ad5 genome.

3. The recombinant adenovirus of claim 1, wherein the nucleotide sequence is inserted between nucleotides at positions 3899 and 3920 corresponding to the Ad35 genome: SEQ ID NO: 41, between nucleotides at positions 3920 and 3940 corresponding to the Ad35 genome, or between nucleotides at positions 3940 and 3970 corresponding to the Ad35 genome.

4. The recombinant adenovirus of claim 1, further comprising: a second nucleotide sequence inserted into the L5-E4 insertion site, wherein the L5-E4 insertion site is located between the stop codon of the adenovirus fiber gene and the stop codon of ORF6 of the adenovirus E4 gene.

5. The recombinant adenovirus according to claim 4, wherein the second nucleotide sequence is inserted between nucleotides 32785 to 32916 corresponding to the Ad5 genome: SEQ ID NO:

1.

6. The recombinant adenovirus of claim 4, wherein the second nucleotide sequence is inserted between nucleotides 32785 and 32800 of SEQ ID NO: 1 corresponding to the Ad5 genome, between nucleotides 32801 and 32820 corresponding to the Ad5 genome, between nucleotides 32821 and 32840 corresponding to the Ad5 genome, between nucleotides 32841 and 32860 corresponding to the Ad5 genome, between nucleotides 32861 and 32880 corresponding to the Ad5 genome, between nucleotides 32881 and 32900 corresponding to the Ad5 genome, or between nucleotides 32901 and 32916 corresponding to the Ad5 genome.

7. The recombinant adenovirus according to claim 4, wherein the second nucleotide sequence is inserted between nucleotides at positions 31799 and 31821 corresponding to the Ad5 genome: SEQ ID NO:

41.

8. The recombinant adenovirus of claim 4, wherein the second nucleotide sequence is inserted between nucleotides corresponding to positions 31799 and 32810 of SEQ ID NO:41 in the Ad35 genome or between nucleotides corresponding to positions 32810 and 31821 in the Ad35 genome.

9. The recombinant adenovirus of claim 1, wherein the IX-E2 insertion site comprises a deletion of 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55 or 60 nucleotides.

10. The recombinant adenovirus of claim 4, wherein the L5-E4 insertion site comprises a deletion of 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, or 130 nucleotides.

11. The recombinant adenovirus of claim 4, wherein the second nucleotide sequence comprises a second transgene.

12. The recombinant adenovirus of claim 11, wherein the second nucleotide sequence further comprises a second promoter, wherein the second transgene is operably linked to the second promoter.

13. The recombinant adenovirus of claim 4, wherein the second nucleotide sequence inserted into the L5-E4 insertion site comprises, in a 5' to 3' direction: (i) first L5-E4 polyadenylation signal; (ii) a second promoter; (iii) a second transgene; (iv) a second L5-E4 polyadenylation signal; and (v) a third L5-E4 polyadenylation signal; wherein the second transgene is operably linked to the second promoter, wherein the second transgene is inserted between the first L5-E4 polyadenylation signal and the third L5-E4 polyadenylation signal.

14. The recombinant adenovirus of claim 13, wherein the first L5-E4 polyadenylation signal is the polyadenylation signal of the fiber (L5) gene, the second L5-E4 polyadenylation signal is the polyadenylation signal of the second transgene, and the third L5-E polyadenylation signal is the polyadenylation signal of ORF6 of the adenoviral E4 gene.

15. The recombinant adenovirus of claim 1, further comprising a fourth IX-E2 polyadenylation sequence between the first IX-E2 polyadenylation signal and the IX-E2 promoter, wherein the fourth IX-E2 polyadenylation sequence is transcribed in the opposite direction to the first IX-E2 polyadenylation signal.

16. The recombinant adenovirus of claim 13, further comprising a fourth L5-E4 polyadenylation sequence between the first L5-E4 polyadenylation signal and the L5-E4 promoter, wherein the fourth L5-E4 polyadenylation sequence is transcribed in the opposite direction to the first L5-E4 polyadenylation signal.

17. The recombinant adenovirus of claim 1, wherein the promoter is a ubiquitin promoter, a tissue-specific promoter or a tumor-specific promoter.

18. The recombinant adenovirus of claim 1, wherein the recombinant adenovirus further comprises a nucleotide sequence inserted into the E1b-19K insertion site, the E3 insertion site, or the E4 insertion site.

19. The recombinant adenovirus of claim 1, wherein the nucleotide sequence comprises a first nucleotide sequence comprising a first transgene and a second nucleotide sequence comprising a second transgene, wherein the first nucleotide sequence and the second nucleotide sequence are separated by a linker.

20. The recombinant adenovirus of claim 19, wherein the linker encodes a peptide cleaved by one or more proteases.

21. The recombinant adenovirus of claim 18, wherein the E3 insertion site is located between the stop codon of the adenovirus pVIII gene and the start site of the adenovirus fiber gene.

22. The recombinant adenovirus of claim 18 or claim 21, wherein the E3 insertion site is located between the stop codon of E3-10.5K and the stop codon of E3-14.7K.

23. The recombinant adenovirus of claim 1, wherein the recombinant adenovirus comprises an E1a promoter having one or more deleted functional Pea3 binding sites.

24. The recombinant adenovirus of claim 23, wherein the deletion comprises a deletion of nucleotides corresponding to -300 to -250 upstream of the Ela start site.

25. The recombinant adenovirus of claim 23, wherein the deletion comprises a deletion of nucleotides corresponding to -305 to -255 upstream of the Ela start site.

26. The recombinant adenovirus of claim 23, wherein the deletion comprises a deletion of nucleotides corresponding to 195-244 of the Ad5 genome: SEQ ID NO:

1.

27. The recombinant adenovirus of claim 1, wherein the recombinant adenovirus comprises one or more deletions of Pea3 transcription binding sites in the E1A region without one or more deletions of E2F transcription binding sites.

28. The recombinant adenovirus of claim 1, wherein the recombinant adenovirus comprises one or more deletions of E2F transcription binding sites in the E1A region without one or more deletions of Pea3 transcription binding sites.

29. The recombinant adenovirus of claim 1, wherein the recombinant adenovirus comprises a modified E1a promoter operably linked to a gene, wherein the modified E1a promoter lacks a functional TATA box and allows for selective expression of the gene in hyperproliferative cells, and / or wherein the modified E1a promoter lacks a functional CAAT box and allows for selective expression of the gene in hyperproliferative cells.

30. The recombinant adenovirus of claim 29, wherein the modification contained in the modified E1a promoter comprises a deletion of the entire TATA box.

31. The recombinant adenovirus of claim 29, wherein the recombinant adenovirus comprises a deletion of nucleotides corresponding to -27 to -24 of the E1a promoter.

32. The recombinant adenovirus of claim 29, wherein the modification contained in the modified E1a promoter comprises a deletion of the entire CAAT box.

33. The recombinant adenovirus of claim 1, wherein the transgene encodes a monomeric, dimeric, trimeric, tetrameric or multimeric protein.

34. The recombinant adenovirus of claim 1, wherein the transgene encodes RNA having therapeutic activity.

35. The recombinant adenovirus of claim 1, wherein the transgene encodes a fusion protein comprising at least one binding domain.

36. The recombinant adenovirus of claim 1, wherein the transgene encodes an immunomodulatory molecule.

37. The recombinant adenovirus of claim 36, wherein the immunomodulatory molecule is a co-stimulatory ligand, a cytokine, or a cytokine receptor.

38. The recombinant adenovirus of claim 36, wherein the immunomodulatory molecule is selected from the group consisting of IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-10trap, IL-10R, IL-12A / p35, IL-12B / p40, IL-15, IL-23A / p19, IL24, IL-27, IL-33, IL-35, IL-15, IL-15 receptor fusion protein, TGF-β, TGF-βtrap, VEGF, indoleamine -2,3-dioxygenase (IDO), inducible T-cell co-stimulatory ligand (ICOS-L), CD80, CD137L, TNF-α, IFN-α, IFN-β, IFN-γ, GM-CSF, GITR ligand (GITRL), OX40 ligand (OX40L), CD40 ligand (CD40L), drug-inducible CD40 (iCD40), CD154, CD70, CD86, CD137, BORIS / CTCFL, bone morphogenetic protein (BMP), TNFSF9, FGF, ICAM and podocalyxin.

39. The recombinant adenovirus of claim 1, wherein the transgene encodes an antigen binding molecule.

40. The recombinant adenovirus of claim 39, wherein the antigen binding molecule is an anti-PD-1 antibody, an anti-TGF-β antibody, an anti-PD-L1 antibody or an anti-CTLA-4 antibody.

41. The recombinant adenovirus of claim 1, wherein the transgene encodes an antigen or a ligand of the antigen.

42. The recombinant adenovirus of claim 41, wherein the antigen is selected from the group consisting of CAIX, CD5, CD7, CD10, CD19, CD20, CD22, CD30, CD33, CD34, CD38, CD41, CD44, CD49f, CD56, CD74, CD80, CD133, CD135, FMS-like tyrosine kinase 3 ligand, CD138, 4-1BB, EGP-2, EGP-40, EpCAM, erbB2, erbB3, erbB4, FBP, KRAS, HPV E6, HPV E7, BING-4, EphA3, cyclin B1, Ep-CAM, SAP-1, PRAME, folate receptor-a, telomerase, tyrosinase, melanin-A, NY-ESO-1, hTERT, IL13R-a2, KDR, L1 cell adhesion molecule, MAGE-A1, MAGE-A3, MART1, MART2, MUC1, mesothelin, HER2 / neu, EGFRvIII, NY-ES0-1, TRP-1, TRP-2, MC1R, BRAF, β-catenin, BRCA1 / 2, CDK4, CML66, fibronectin, p53, TGF-βRII, carcinoembryonic antigen, PSCA, PSMA, ROR1, TAG-72, and VEGF-R2.

43. The recombinant adenovirus of claim 1, wherein the transgene encodes a toxin.

44. The recombinant adenovirus of claim 43, wherein the toxin is Pseudomonas exotoxin, ricin or diphtheria toxin.

45. The recombinant adenovirus of claim 1, wherein the transgene encodes an enzyme.

46. ​​The recombinant adenovirus of claim 45, wherein the enzyme is selected from the group consisting of β-glucuronidase, β-galactosidase, β-glucosidase, carboxypeptidase, β-lactamase, esterase, metalloproteinase, relaxin, collagenase, streptokinase, arginase, and NOS-2.

47. The recombinant adenovirus of claim 1, wherein the transgene encodes a cell cycle controller, a growth factor, an anticoagulant, a prodrug activating gene, a tumor suppressor gene, an apoptosis gene, an antiplatelet agent, a coagulation factor, or a cystic fibrosis transmembrane conductance regulator (CFTR) protein.

48. The recombinant adenovirus of claim 1, wherein the transgene encodes angiostatin, endostatin, acetylcholine, DKK1 / Wnt, Ox40L, GITRL, secreted flagellin, or thymidine kinase.

49. The recombinant adenovirus of claim 1, wherein the recombinant adenovirus is adenovirus type 5 (Ad5) or adenovirus type 35 (Ad35).

50. The recombinant adenovirus of claim 1, wherein the recombinant adenovirus is oncolytic.

51. The recombinant adenovirus of claim 1, wherein the recombinant adenovirus selectively replicates in hyperproliferative cells.

52. The recombinant adenovirus of claim 1, wherein the recombinant adenovirus selectively expresses a transgene in hyperproliferating cells.

53. The recombinant adenovirus of claim 51, wherein the hyperproliferative cells are tumor cells.

54. An isolated nucleotide sequence comprising the recombinant adenovirus of any one of claims 1-53.

55. An isolated vector comprising the nucleotide sequence of claim 54.

56. An isolated cell comprising the nucleotide sequence of claim 54.

57. Use of the recombinant adenovirus according to any one of claims 1 to 53 in the preparation of a medicament for inhibiting tumor cell proliferation.

58. Use of the recombinant adenovirus of any one of claims 1 to 53 in the preparation of a medicament for inhibiting tumor growth in a subject in need thereof.

59. The use of claim 58, wherein the tumor is a HER2 / neu positive tumor and wherein the recombinant adenovirus comprises an E1a promoter with no more than one functional Pea3 binding site deleted.

60. The use according to claim 59, wherein the HER2 / neu positive tumor is selected from breast cancer, gastric cancer, ovarian cancer, bladder cancer, salivary gland cancer, endometrial cancer, pancreatic cancer or non-small cell lung cancer (NSCLC).

61. The method of claim 58, wherein the tumor is selected from the group consisting of squamous cell carcinoma of the skin, basal cell carcinoma, head and neck tumors, breast tumors, anal cancer, cervical cancer, non-small cell lung cancer, small cell lung tumors, renal cell carcinoma, prostate tumors, gastroesophageal tumors, colorectal tumors, testicular tumors, bladder tumors, ovarian tumors, hepatocellular carcinoma, bile duct cancer, brain tumors, endometrial tumors, neuroendocrine tumors, sarcomas, and pancreatic tumors.

62. Use of the recombinant adenovirus of any one of claims 1 to 53 in the preparation of a medicament for treating cancer in a subject in need thereof.

63. The method of claim 62, wherein the cancer is selected from the group consisting of squamous cell carcinoma of the skin, basal cell carcinoma, head and neck cancer, breast cancer, anal cancer, cervical cancer, non-small cell lung cancer, small cell lung cancer, renal cell carcinoma, gastroesophageal cancer, colorectal cancer, testicular cancer, bladder cancer, ovarian cancer, hepatocellular carcinoma, bile duct cancer, brain cancer, endometrial cancer, neuroendocrine cancer, sarcoma, prostate cancer, leukemia, lymphoma and pancreatic cancer.

64. Use of the recombinant adenovirus of any one of claims 1-53 in the preparation of a medicament for treating a disease or condition in a subject in need thereof, wherein the disease or condition is selected from the group consisting of infection, diabetic retinopathy, psoriasis, rheumatoid arthritis, endometriosis, macular degeneration, benign growth disorders, vascular disease, cirrhosis, connective tissue disease, tumors and ulcerative lesions.

65. The use of claim 58, wherein the recombinant adenovirus is administered by intramuscular, intravenous, intraarterial, intratumoral, intradermal, inhalation, transdermal or rectal administration.

66. A pharmaceutical composition comprising the recombinant adenovirus of any one of claims 1-53 and at least one pharmaceutically acceptable carrier or diluent.

67. A preparation for an adenovirus, comprising: (a) the recombinant adenovirus according to any one of claims 1 to 53; (b) at least one buffer; (c) at least one tonicity modifier; (d) at least one sugar or at least one stabilizer, or at least one sugar and at least one stabilizer; and wherein the pH of the formulation is in the range of 7.0 to 9.

0.

68. The formulation of claim 67, wherein the stabilizer is glycerol.

69. The formulation of claim 67, wherein the stabilizer is 2% to 5% (v / v).

70. The formulation of claim 67, wherein the buffer is Tris.

71. The formulation of claim 67, wherein the buffer is at a concentration of 1 mM to 30 mM.

72. The formulation of claim 67, wherein the tonicity modifier is NaCl.

73. The formulation of claim 67, wherein the concentration of the tonicity modifier is 10 mM to 250 mM.

74. The formulation of claim 67, wherein the formulation comprises a first tonicity modifier and a second tonicity modifier, wherein the first tonicity modifier is a monovalent cation and wherein the second tonicity modifier is a divalent cation.

75. The formulation of claim 67, wherein the tonicity modifier or divalent cation is MgCl 2 .

76. The formulation of claim 67, wherein the concentration of the tonicity modifier or divalent cation is 0.1 mM to 5 mM.

77. The formulation of claim 67, wherein the sugar is sucrose.

78. The formulation of claim 67, wherein the sugar is present in an amount of 2% to 8% by weight by volume.

79. The formulation of claim 67, further comprising at least one nonionic surfactant.

80. The formulation of claim 79, wherein the nonionic surfactant is polysorbate-80 or polysorbate-40.

81. The formulation of claim 79, wherein the concentration of the nonionic surfactant is 0.001% to 1%.

82. The formulation of claim 67, further comprising at least one free radical oxidation inhibitor.

83. The formulation of claim 82, wherein the free radical oxidation inhibitor is EDTA.

84. The formulation of claim 82, wherein the free radical oxidation inhibitor is present at a concentration of 0.01 mM to 5 mM.

85. The formulation of claim 67, further comprising at least one cryoprotectant.

86. The formulation of claim 85, wherein the cryoprotectant is EtOH.

87. The formulation of claim 85, wherein the concentration of the cryoprotectant is 0.5%.

88. The formulation of claim 67, wherein the formulation has an osmolarity of 200 to 800 mOs / L.

89. The formulation of claim 67, wherein the concentration of the recombinant adenovirus is 1 x 10 7 vp / mL to 1x 10 13 vp / mL.

90. The formulation of claim 67, wherein the formulation comprises 20 mM Tris, 25 mM NaCl, 2.5% glycerol, and wherein the pH of the formulation is 8.

0.

91. The formulation of claim 67, wherein the formulation comprises 20 mM Tris, 25 mM NaCl, 3-5% sucrose, and wherein the pH of the formulation is 8.

0.

92. The formulation of claim 67, wherein the formulation comprises 10 mM Tris, 75 mM NaCl, 5% sucrose, 0.02% polysorbate-80, 1 mM MgCl 2 , 0.1 mM EDTA, 0.5% EtOH and wherein the pH of the formulation was 8.

0.

93. The formulation of claim 67, wherein the formulation further comprises at least one immunoadjuvant.

94. The formulation of claim 93, wherein the immunoadjuvant is selected from the group consisting of: 1) alum, 2) saponin, 3) nonionic polymer surfactants, 4) monophosphoryl lipid A, 5) muramyl dipeptide, and 6) cytokines.

95. The formulation of claim 67, wherein the formulation further comprises at least one dye.

96. The formulation of claim 67, wherein the formulation further comprises at least one reversible protease inhibitor.

97. The formulation of claim 96, wherein the reversible protease inhibitor is a L3 / p23 cysteine ​​protease inhibitor.

98. The formulation of claim 67, wherein the formulation further comprises at least one antioxidant.

99. The formulation of claim 98, wherein the antioxidant is vitamin A, vitamin C, vitamin E, vitamin B6, vitamin B12, folic acid, or folate.

Images