Test kit and assay

Abstract

The present invention provides in vitro test kits, assays and methods useful for screening for the presence of a ligand in a test sample, the ligand being characterized by its ability, when in a cell, to form a complex with a steroid hormone receptor and cause a genomic response. Advantageously, the activity-based assays that form the basis of the test kits and methods described herein are particularly suitable for detecting the presence of ligands of unknown structure, such as designer drugs used by equine, canine and human athletes in sports doping. Different assay prototypes are disclosed, in which, for example, through the activation of a reporter, hormone receptor activation caused by ligand binding interactions can be detected. In certain instances, the present invention provides test kits, assays and methods involving aptamer:fluorophore reporter constructs for detecting ligands in samples (e.g., collected from athletes at the side of a race track).

Description

Technical Field

[0001] The present invention generally relates to assays, methods, and test kits for detecting ligands in test samples. In particular, the present invention provides assays, methods, and test kits for screening for the presence of ligands in test samples, wherein the ligands are characterized by the ability to form a complex with a steroid hormone receptor in a cell and elicit a genomic response. Background of the Invention

[0003] The detection of ligands that bind to steroid hormone receptor proteins is important in many fields, including, for example, environmental testing for organic pollutants that may affect human health, diagnostic and prognostic testing for human diseases, including (for example) the detection and / or monitoring of endocrine- and non-endocrine-cancers, and drug testing, including by professional sports organizations responsible for maintaining fair competition in (for example) the human athlete and thoroughbred horse racing industries.

[0004] A common way to detect the presence of ligands that bind to steroid hormone receptor proteins is to directly measure the ligand in the sample. However, samples are often complex mixtures of molecules and typically require complex preparation procedures for analysis. Detection of the presence of ligands in a sample typically relies on processes such as liquid or gas chromatography to separate the molecular substances from the complex mixture into relatively pure components, followed by analysis of each component using a structurally sensitive method such as mass spectrometry. Automated purification systems, gas or liquid chromatography, and mass spectrometry are expensive and technically complex laboratory instruments that must be continuously calibrated and operated by trained technicians to produce reliable results. Another disadvantage is that this method does not provide information about the biological activity of the ligand and thus cannot distinguish between bioactive and bio-inactive ligand molecules. Additionally, this structure-based method cannot distinguish between agonists and antagonists. Furthermore, due to the biometabolism of the ligand, prior knowledge of the molecular structure of the ligand and its associated metabolites is often required to obtain a reliable identification of the presence of the ligand in the sample.

[0005] In addition to spectroscopy-based detection methods, a number of cell-based assays have been developed for detecting the presence of ligands that bind to steroid hormone receptor proteins. However, there are significant limitations associated with these cell-based assays, which also require specialized equipment and expertise to maintain live cell cultures. This increases the cost of cell-based testing and reduces the widespread use of these methods. Additionally, the high level of molecular complexity of live cells makes testing difficult and reduces sensitivity and reproducibility.

[0006] In samples for analysis, it is often advantageous to detect the presence of ligand molecules that bind to steroid hormone receptors and regulate gene expression. For example, ligands that bind to androgen receptors and elicit a genomic response are associated with anabolic growth effects. Anabolic growth in animals and humans provides advantages in terms of, for example, increased muscle mass, bone remodeling, blood production, appetite and strength, regulation, endurance, and exercise recovery, and can also be an indicator of disease. For the following reasons, including: detecting doping in animals such as racehorses and dogs, as well as in humans and human athletes; detecting prohibited additives in food or food supplements; detecting the presence of prohibited ligands used to stimulate the growth of animals for food, for example, in cattle, sheep, pigs, chickens, and fish; screening drugs; assessing health status, detecting the presence of ligands that bind to androgen receptors and cause anabolic effects has particular industrial applications in monitoring biological samples.

[0007] Steroid hormone receptors contain binding domains that specifically bind to molecular ligands, which cause steroid hormone receptor-ligand complexes, triggering various cellular responses, including genomic responses, in which the expression of genes is directly regulated by the steroid hormone receptor.

[0008] The present invention specifically relates to detecting the presence and / or potency of ligands characterized by the ability to directly regulate gene expression in cells by binding to steroid hormone receptors. Summary of the Invention

[0010] The inventions described and claimed herein have many attributes and examples, including, but not limited to, those listed or described or mentioned in this summary of the invention. It is not intended to cover everything and the inventions described and claimed herein are not limited to or by the features or examples identified in this summary of the invention, including its use for illustrative purposes only and not for limitation.

[0011] In one aspect of the present invention, there is provided a test kit for screening for the presence of a ligand in a test sample, the ligand being capable of forming a complex with a steroid hormone receptor in a cell and eliciting a genomic response, the test kit comprising:

[0012] (i) a steroid hormone receptor that forms a receptor-ligand complex with the ligand from the test sample; and

[0013] (ii) a nucleic acid response element that is bound by the receptor-ligand complex; and

[0014] (iii) a detection tool for detecting the binding between the receptor-ligand complex and the nucleic acid response element

[0015] Wherein, when a sample is combined with a test kit and binding between a receptor-ligand complex and a nucleic acid response element is detected, the presence of a ligand in the test sample is determined.

[0016] In an example according to this aspect of the invention, the relative content of the steroid hormone receptor to the nucleic acid response element in the test kit is x:1, where x is the content of the steroid hormone and is defined as [0.2 ≤ x ≤ 20]. In a related example, the relative content of the steroid hormone receptor to the nucleic acid response element in the test kit is x:1, where x is the content of the steroid hormone receptor and is defined as [0.3 ≤ x ≤ 7].

[0017] In an example according to this aspect of the invention, as described herein, the test kit further comprises at least one steroid hormone receptor cofactor, steroid metabolism machinery, transcription and / or translation machinery, and / or cell-free extract.

[0018] In a related example, the steroid hormone receptor cofactor is selected from one or more of heat shock proteins (HSPs) (including but not limited to heat shock protein 70, heat shock protein 40, heat shock protein 90), p23, heat shock protein-organizing protein (Hop), 48kD Hip protein, p60, and FKBP52.

[0019] In a further related example according to this aspect of the invention, the test kit further comprises HSP90.

[0020] In another example according to this aspect of the invention, the nucleic acid response element is operably linked to a reporter construct, and binding of the receptor-ligand complex to the nucleic acid response element is detected by measuring transcription or translation of the reporter construct.

[0021] In another example, the reporter gene construct consists of a promoter sequence and a reporter gene.

[0022] In a further example, when the receptor-ligand complex binds to the nucleic acid response element, transcription from the promoter sequence is activated.

[0023] In a further example, the reporter construct comprises a sequence encoding an RNA aptamer capable of binding a fluorophore. In a related example, in the case where fluorescence of the fluorophore is detected when the fluorophore binds to the RNA aptamer, binding of the receptor-ligand complex to the nucleic acid response element is detected by transcription of the RNA aptamer.

[0024] In yet another example, the reporter construct is selected from genes encoding any protein or polypeptide, genes not encoding a protein or polypeptide, and synthetic nucleic acid sequences encoding or not encoding a protein or polypeptide. In related examples, the reporter construct is selected from genes or nucleic acid sequences encoding fluorescent proteins (including, but not limited to, green fluorescent protein, red fluorescent protein, and yellow fluorescent protein), genes encoding β-galactosidase (including, but not limited to, LacZ), β-glucuronidase (GUS), alkaline phosphatase, luciferase, amino acid biosynthetic genes, such as the yeast LEU2, HIS3, or LYS2 genes, nucleic acid biosynthetic genes, such as the URA3 or ADE2 genes, the chloramphenicol acetyltransferase (CAT) gene, or any surface antigen gene for which a specific antibody is available.

[0025] In another example, the test kit further comprises translation and / or transcription machinery to facilitate transcription and / or translation of the reporter construct.

[0026] In yet another example, methods including, but not limited to, optical methods, spectroscopy, visible spectroscopy, Raman spectroscopy, UV spectroscopy, surface plasmon resonance, electrochemical methods, impedance, resistance, capacitance, mechanical sensing due to mass changes, changes in mechanical resonance, electrophoresis, gel electrophoresis, gel retardation, imaging, fluorescence, fluorescence resonance energy transfer, polymerase chain reaction (PCR), quantitative PCR (also known as real-time PCR, qPCR), reverse transcription PCR (RT-PCR), and reverse transcription qPCR (RT-qPCR) are used to detect the binding of the receptor-ligand complex to the nucleic acid resonance element.

[0027] In another aspect of the present invention, there is provided a test kit for screening for the presence of a ligand in a test sample, the ligand being capable of forming a complex with a steroid hormone receptor in a cell and eliciting a genomic response, the test kit comprising:

[0028] (i) a steroid hormone receptor that forms a receptor-ligand complex with the ligand from the test sample; and

[0029] (ii) a nucleic acid response element that is bound by the receptor-ligand complex; and

[0030] (iii) a detection tool for detecting the binding between the receptor-ligand complex and the nucleic acid response element

[0031] wherein the relative content of the steroid hormone receptor to the nucleic acid response element in the test kit is x:1, where x is the content of the steroid hormone receptor and is defined as [0.2 ≤ x ≤ 20], and wherein when the sample is combined with the test kit and the binding of the receptor-ligand complex to the nucleic acid response element is detected, the presence of the ligand in the test sample is determined.

[0032] In an example according to this aspect of the present invention, the relative content of the steroid hormone receptor to the nucleic acid response element in the test kit is x:1, where x is the content of the steroid hormone receptor and is defined as [0.3 ≤ x ≤ 7].

[0033] In yet another aspect of the present invention, there is provided a test kit for screening for the presence of a ligand in a test sample, the ligand being capable of forming a complex with a steroid hormone receptor in a cell and triggering a genomic response, the test kit comprising:

[0034] (i) A steroid hormone receptor that forms a receptor-ligand complex with the ligand from the test sample; and

[0035] (ii) A nucleic acid response element bound by the receptor-ligand complex; and

[0036] (iii) A detection tool for detecting the binding between the receptor-ligand complex and the nucleic acid response element; and

[0037] (iv) At least one steroid hormone receptor cofactor selected from heat shock protein 90, heat shock protein 70, heat shock protein 40, p23, heat shock protein-organizing protein (Hop), 48kD Hip protein, p60, and FKBP52

[0038] Wherein when the sample is combined with the test kit and the binding between the receptor-ligand complex and the nucleic acid response element is detected, the presence of the ligand in the test sample is determined.

[0039] In yet another aspect of the present invention, there is provided a test kit for screening for the presence of a ligand in a test sample, the ligand being capable of forming a complex with a steroid hormone receptor in a cell and triggering a genomic response, the test kit comprising:

[0040] (i) A steroid hormone receptor that forms a receptor-ligand complex with the ligand from the test sample; and

[0041] (ii) A nucleic acid response element bound by the receptor-ligand complex; and

[0042] (iii) A detection tool for detecting the binding between the receptor-ligand complex and the nucleic acid response element; and

[0043] (iv) At least one steroid hormone receptor cofactor selected from heat shock protein 90, heat shock protein 70, heat shock protein 40, p23, heat shock protein-organizing protein (Hop), 48kD Hip protein, p60, and FKBP52

[0044] In the test kit, the relative content of the steroid hormone receptor to the nucleic acid response element is x:1, where x is the content of the steroid hormone receptor and is defined as [0.2 ≤ x ≤ 20], and when the sample is combined with the test kit and the binding of the receptor-ligand complex to the nucleic acid response element is detected, the presence of the ligand in the test sample is determined.

[0045] In an example according to this aspect of the invention, the relative content of the steroid hormone receptor to the nucleic acid response element in the test kit is x:1, where x is the content of the steroid hormone receptor and is defined as [0.3 ≤ x ≤ 7].

[0046] In another aspect of the invention, there is provided a test kit for screening for the presence of a ligand in a test sample, the ligand being capable of forming a complex with a steroid hormone receptor in a cell and triggering a genomic response, the test kit comprising:

[0047] (i) A steroid hormone receptor that forms a receptor-ligand complex with the ligand from the test sample; and

[0048] (ii) A nucleic acid response element bound by the receptor-ligand complex;

[0049] (iii) A reporter construct operably linked to the nucleic acid response element

[0050] wherein when the receptor-ligand complex binds to the nucleic acid response element, the reporter construct is activated

[0051] and wherein when the sample is combined with the test kit and the transcription of the reporter construct is detected, the presence of the ligand in the test sample is determined.

[0052] In an example according to this aspect of the invention, the relative content of the steroid hormone receptor to the nucleic acid response element in the test kit is x:1, where x is the content of the steroid hormone and is defined as [0.2 ≤ x ≤ 20]. In a related example, the relative content of the steroid hormone receptor to the nucleic acid response element in the test kit is x:1, where x is the content of the steroid hormone receptor and is defined as [0.3 ≤ x ≤ 7].

[0053] In another example according to this aspect of the invention, the test kit further comprises steroid hormone receptor cofactors, including, but not limited to, heat shock protein 90, heat shock protein 70, heat shock protein 40, p23, heat shock protein-organizing protein (Hop), 48kD Hip protein, p60, and FKBP52.

[0054] In yet another example according to this aspect of the invention, as described herein, the test kit further comprises, either combined or separately, a steroid metabolism mechanism, a transcription and / or translation mechanism, and / or a cell-free extract.

[0055] In another example according to this aspect of the invention, the reporter construct comprises a fluorophore-binding RNA aptamer.

[0056] In another example according to this aspect of the invention, the RNA aptamer is selected from Spinach, iSpinach, and Broccoli, and the fluorophore that binds to the RNA aptamer to thereby generate a fluorescent signal is 3,5-difluoro-4-hydroxybenzylidene imidazolinone (DFHBI).

[0057] In another example according to this aspect of the invention, the RNA aptamer is Mango, and the fluorophore that binds to the RNA aptamer to thereby generate a fluorescent signal is a derivative of thiazole orange (TO).

[0058] In another example according to this aspect of the invention, the nucleic acid response element and the reporter construct are contained on the same nucleic acid sequence. In a related example, the nucleic acid sequence containing the nucleic acid response element and the reporter construct is defined by SEQ ID NO: 19.

[0059] In another example according to this aspect of the invention, the test kit further comprises a detection tool for detecting the transcription of the reporter construct.

[0060] In yet another aspect of the invention, there is provided a test kit for screening for the presence of a ligand in a test sample, the ligand being capable of forming a complex with a steroid hormone receptor in a cell and eliciting a genomic response, the test kit comprising:

[0061] (i) a steroid hormone receptor that forms a receptor-ligand complex with the ligand from the test sample; and

[0062] (ii) a nucleic acid response element bound by the receptor-ligand complex; and

[0063] (iii) a reporter construct operably linked to the nucleic acid response element; and

[0064] (iv) a transcription mechanism

[0065] wherein, when the receptor-ligand complex binds to the nucleic acid response element, the reporter construct is activated

[0066] and wherein, when the sample is combined with the test kit and the transcription of the reporter construct is detected, the presence of the ligand in the test sample is determined.

[0067] In an example according to this aspect of the present invention, the relative content of the steroid hormone receptor to the nucleic acid response element in the test kit is x:1, where x is the content of the steroid hormone and is defined as [0.2 ≤ x ≤ 20]. In a related example, the relative content of the steroid hormone receptor to the nucleic acid response element in the test kit is x:1, where x is the content of the steroid hormone receptor and is defined as [0.3 ≤ x ≤ 7].

[0068] In examples according to these and other aspects of the present invention, the steroid hormone receptor cofactor is selected from one or more of heat shock proteins (HSPs) (including but not limited to heat shock protein 70, heat shock protein 40, heat shock protein 90), p23, heat shock protein-organizing protein (Hop), 48kD Hip protein, p60, and FKBP52.

[0069] In more related examples according to these and other aspects of the present invention, the test kit further comprises HSP90.

[0070] In another example according to these and other aspects of the present invention, the transcription of the reporter construct includes detecting the level of deoxyribonucleic acid (DNA), messenger ribonucleic acid (mRNA), or complementary deoxyribonucleic acid (cDNA).

[0071] In yet another example according to these and other aspects of the present invention, the nucleic acid response element and the reporter construct are contained on the same nucleic acid molecule.

[0072] In yet another aspect of the present invention, there is provided a test kit for screening for the presence of a ligand in a test sample, the ligand being capable of forming a complex with a steroid hormone receptor in a cell and triggering a genomic response, the test kit comprising:

[0073] (i) a steroid hormone receptor that forms a receptor-ligand complex with the ligand from the test sample; and

[0074] (ii) a nucleic acid response element that is bound by the receptor-ligand complex; and

[0075] (iii) a reporter construct operably linked to the nucleic acid response element

[0076] wherein, when the receptor-ligand complex binds to the nucleic acid response element, the reporter construct is activated

[0077] and wherein, when the sample is combined with the test kit and the translation of the reporter construct is detected, the presence of the ligand in the test sample is determined.

[0078] In an example according to this aspect of the present invention, the relative content of the steroid hormone receptor to the nucleic acid response element in the test kit is x:1, where x is the content of the steroid hormone and is defined as [0.2 ≤ x ≤ 20]. In a related example, the relative content of the steroid hormone receptor to the nucleic acid response element in the test kit is x:1, where x is the content of the steroid hormone receptor and is defined as [0.3 ≤ x ≤ 7].

[0079] In another example according to this aspect of the present invention, the test kit further comprises steroid hormone receptor cofactors, including, but not limited to, heat shock protein 90, heat shock protein 70, heat shock protein 40, p23, heat shock protein-organizing protein (Hop), 48kD Hip protein, p60, and FKBP52.

[0080] In yet another example according to this aspect of the present invention, as described herein, the test kit further comprises, either bound or separately, a steroid metabolism mechanism, a transcription and / or translation mechanism, and / or a cell-free extract.

[0081] In yet another example according to this aspect of the present invention, the test kit further comprises a detection tool for detecting the translation of the reporter construct.

[0082] In yet another aspect of the present invention, there is provided a test kit for screening for the presence of a ligand in a test sample, the ligand being capable of forming a complex with a steroid hormone receptor in a cell and eliciting a genomic response, the test kit comprising:

[0083] (i) a steroid hormone receptor that forms a receptor-ligand complex with the ligand from the test sample; and

[0084] (ii) a nucleic acid response element bound by the receptor-ligand complex; and

[0085] (iii) a reporter construct operably linked to the nucleic acid response element; and

[0086] (iv) a transcription and translation mechanism

[0087] wherein, when the receptor-ligand complex binds to the nucleic acid response element, the reporter construct is activated

[0088] and wherein, when the sample is combined with the test kit and the translation of the reporter construct is detected, the presence of the ligand in the test sample is determined.

[0089] In an example according to this aspect of the present invention, the relative content of the steroid hormone receptor and the nucleic acid response element in the test kit is x:1, where x is the content of the steroid hormone and is defined as [0.2 ≤ x ≤ 20]. In a related example, the relative content of the steroid hormone receptor and the nucleic acid response element in the test kit is x:1, where x is the content of the steroid hormone receptor and is the content of the steroid hormone receptor and is defined as [0.3 ≤ x ≤ 7].

[0090] In examples according to these and other aspects of the present invention, the steroid hormone receptor cofactor is selected from one or more of heat shock proteins (HSPs) (including but not limited to heat shock protein 70, heat shock protein 40, heat shock protein 90), p23, heat shock protein-organizing protein (Hop), 48kD Hip protein, p60, and FKBP52.

[0091] In more related examples according to these and other aspects of the present invention, the test kit further comprises HSP90.

[0092] In another example according to these and other aspects of the present invention, the translation of the reporter element includes detecting the presence of the translated reporter protein.

[0093] In yet another example according to these and other aspects of the present invention, the nucleic acid sequence and the reporter element are contained on the same nucleic acid molecule.

[0094] In yet another aspect of the present invention, there is provided an assay method for screening for the presence of a ligand in a test sample, the ligand being capable of forming a complex with a steroid hormone receptor in a cell and triggering a genomic response, the assay method comprising the steps of:

[0095] (i) Providing an assay reagent comprising

[0096] (a) a steroid hormone receptor that forms a receptor-ligand complex with a ligand from the test sample; and

[0097] (b) a nucleic acid response element bound by the receptor-ligand complex; and

[0098] (c) a detection tool for detecting the binding between the receptor-ligand complex and the nucleic acid response element; and

[0099] (ii) Combining the test sample with the assay reagent

[0100] wherein, when the sample is combined with the test kit and the binding between the receptor-ligand complex and the nucleic acid response element is detected, the presence of the ligand in the test sample is assayed.

[0101] In an example of the assay method according to the present disclosure, the method further includes comparing the test result with a reference threshold, where the reference threshold reflects the signal level caused by the binding of a steroid hormone receptor to a nucleic acid response element in the absence of a ligand. In a related example, the presence of a ligand in the test sample is confirmed when the signal level obtained from the test sample is higher than the signal level obtained from the reference threshold.

[0102] In an example of this aspect of the present invention, the relative content of the steroid hormone receptor to the nucleic acid response element in the test kit is x:1, where x is the content of the steroid hormone and is defined as [0.2 ≤ x ≤ 20]. In a related example, the relative content of the steroid hormone receptor to the nucleic acid response element in the test kit is x:1, where x is the content of the steroid hormone receptor and is defined as [0.3 ≤ x ≤ 7].

[0103] In an example of this aspect of the present invention, as described herein, the assay reagent further includes a steroid hormone receptor cofactor, a steroid metabolism mechanism, a transcription and / or translation mechanism, and / or a cell-free extract.

[0104] In another example of this aspect of the present invention, the steroid hormone receptor cofactor is selected from one or more of heat shock proteins (HSPs) (including but not limited to heat shock protein 70, heat shock protein 40, heat shock protein 90), p23, heat shock protein-organizing protein (Hop), 48kD Hip protein, p60, and FKBP52.

[0105] In another related example of this aspect of the present invention, the heat shock protein is HSP90.

[0106] In an example of the test kit and method according to the present disclosure, the steroid hormone receptor is selected from androgen receptor (AR); estrogen receptor (ER), including but not limited to estrogen receptor-α (ER-α) and estrogen receptor-β (ER-β); progesterone receptor, including but not limited to progesterone receptor A (PRA) and progesterone receptor B (PRB); mineralocorticoid receptor (MR); and glucocorticoid receptor (GR).

[0107] In another example of the test kit and method according to the present disclosure, the ligand is a performance-enhancing designer drug and / or a steroid.

[0108] In a related example of the test kit and method according to the present disclosure, the ligand has an unknown chemical structure.

[0109] In another example of the test kit and method according to the present disclosure, the ligand has a previously known chemical structure.

[0110] In yet another example of the test kits and methods described herein, the biological sample is derived from an animal selected from the group consisting of horse, dog, camel, cow, pig, sheep, goat, avian, ape, mouse, rabbit, deer, fish, salmonoid, primate, ape, and human.

[0111] In yet another example of the test kits and methods described herein, the test sample is derived from biological materials selected from the group consisting of urine, saliva, feces, hair, and tissue, said tissue including, but not limited to, blood (plasma and serum), muscle, tumor, semen, and the like.

[0112] In yet another example of the test kits and methods described herein, the test sample is derived from food selected from the group consisting of vegetables, meat, beverages (including but not limited to sports drinks and milk), supplements (including but not limited to food supplements, sports supplements, and nutritional supplements), herbal extracts, and the like.

[0113] In yet another example of the test kits and methods described herein, the test sample is derived from medicaments selected from the group consisting of drugs, tonics, syrups, pills, lozenges, creams, sprays, and gels.

[0114] In yet another example of the test kits and methods described herein, the sample is derived from an environment selected from the group consisting of liquid, water, soil, fabric (including but not limited to plastic), and minerals.

[0115] In another aspect of the present invention, there is provided a test kit for screening for the presence of a ligand in a test sample, said ligand being capable of forming a complex with an androgen receptor in a cell and eliciting a genomic response, said test kit comprising:

[0116] (i) an androgen receptor that forms a receptor-ligand complex with the ligand from the test sample; and

[0117] (ii) a nucleic acid response element that is bound by the receptor-ligand complex; and

[0118] (iii) a detection tool for detecting the binding between the receptor-ligand complex and the nucleic acid response element

[0119] wherein the presence of the ligand in the test sample is determined when the sample is combined with the test kit and the binding between the receptor-ligand complex and the nucleic acid response element is detected.

[0120] In an example according to this aspect of the present invention, the relative content of the steroid hormone receptor to the nucleic acid response element in the test kit is x:1, where x is the content of the steroid hormone and is defined as [0.2 ≤ x ≤ 20]. In a related example, the relative content of the steroid hormone receptor to the nucleic acid response element in the test kit is x:1, where x is the content of the steroid hormone receptor and is defined as [0.3 ≤ x ≤ 7].

[0121] In another example according to this aspect of the present invention, the test kit further comprises steroid hormone receptor cofactors, including but not limited to, heat shock protein 90, heat shock protein 70, heat shock protein 40, p23, heat shock protein-organizing protein (Hop), 48kD Hip protein, p60, and FKBP52.

[0122] In a further related example according to this aspect of the present invention, the heat shock protein is HSP90.

[0123] In yet another example according to this aspect of the present invention, as described herein, the test kit further comprises, either combined or separately, steroid metabolic machinery, transcription and / or translation machinery, and / or cell-free extracts.

[0124] In an example according to this aspect of the present invention, the nucleic acid response element comprises the sequence listed in SEQ ID NO:1 or SEQ ID NO:2.

[0125] In another example according to this aspect of the present invention, the ligand is a selective androgen receptor modulator (SARM) compound.

[0126] In another aspect of the present invention, there is provided a test kit for screening for the presence of a ligand in a test sample, the ligand being capable of forming a complex with an estrogen receptor in a cell and eliciting a genomic response, the test kit comprising:

[0127] (i) an estrogen receptor that forms a receptor-ligand complex with the ligand from the test sample; and

[0128] (ii) a nucleic acid response element that is bound by the receptor-ligand complex; and

[0129] (iii) a detection tool for detecting the binding between the receptor-ligand complex and the nucleic acid sequence

[0130] Wherein, when the sample is combined with the test kit and the binding between the receptor-ligand complex and the nucleic acid response element is detected, the presence of the ligand in the test sample is determined.

[0131] In an example according to this aspect of the present invention, the nucleic acid response element comprises the sequence listed in any one of SEQ ID NO:3 to 6.

[0132] In an example according to this aspect of the invention, the relative content of the steroid hormone receptor to the nucleic acid response element in the test kit is x:1, where x is the content of the steroid hormone and is defined as [0.2 ≤ x ≤ 20]. In a related example, the relative content of the steroid hormone receptor to the nucleic acid response element in the test kit is x:1, where x is the content of the steroid hormone receptor and is defined as [0.3 ≤ x ≤ 7].

[0133] In another example according to this aspect of the invention, the test kit further comprises steroid hormone receptor cofactors, including, but not limited to, heat shock protein 90, heat shock protein 70, heat shock protein 40, p23, heat shock protein-organizing protein (Hop), 48kD Hip protein, p60, and FKBP52.

[0134] In a further related example according to this aspect of the invention, the heat shock protein is HSP90.

[0135] In yet another example according to this aspect of the invention, as described herein, the test kit further comprises, either combined or separately, a steroid metabolism mechanism, a transcription and / or translation mechanism, and / or a cell-free extract.

[0136] In another example according to this aspect of the invention, the ligand is a selective estrogen receptor modulator (SERM) compound.

[0137] In yet another aspect of the invention, there is provided a test kit for screening for the presence of a ligand in a test sample, the ligand being capable of forming a complex with a progesterone receptor in a cell and triggering a genomic response, the test kit comprising:

[0138] (i) a progesterone receptor that forms a receptor-ligand complex with the ligand from the test sample; and

[0139] (ii) a nucleic acid response element that is bound by the receptor-ligand complex; and

[0140] (iii) a detection tool for detecting the binding between the receptor-ligand complex and the nucleic acid sequence

[0141] wherein, when the sample is combined with the test kit and the binding between the receptor-ligand complex and the nucleic acid response element is detected, the presence of the ligand in the test sample is determined.

[0142] In an example according to this aspect of the invention, the nucleic acid response element comprises the sequence listed in any one of SEQ ID NO:7 to 10.

[0143] In an example according to this aspect of the present invention, the relative content of the steroid hormone receptor to the nucleic acid response element in the test kit is x:1, where x is the content of the steroid hormone and is defined as [0.2 ≤ x ≤ 20]. In a related example, the relative content of the steroid hormone receptor to the nucleic acid response element in the test kit is x:1, where x is the content of the steroid hormone receptor and is defined as [0.3 ≤ x ≤ 7].

[0144] In another example according to this aspect of the present invention, the test kit further comprises steroid hormone receptor cofactors, including, but not limited to, heat shock protein 90, heat shock protein 70, heat shock protein 40, p23, heat shock protein-organizing protein (Hop), 48kD Hip protein, p60, and FKBP52.

[0145] In a further related example according to this aspect of the present invention, the heat shock protein is HSP90.

[0146] In yet another example according to this aspect of the present invention, as described herein, the test kit further comprises, either combined or separately, a steroid metabolism mechanism, a transcription and / or translation mechanism, and / or a cell-free extract.

[0147] In a further aspect of the present invention, there is provided a test kit for screening for the presence of a ligand in a test sample, the ligand being capable of forming a complex with a mineralocorticoid receptor in a cell and triggering a genomic response, the test kit comprising:

[0148] (i) a mineralocorticoid receptor that forms a receptor-ligand complex with the ligand from the test sample; and

[0149] (ii) a nucleic acid sequence bound by the receptor-ligand complex; and

[0150] (iii) a detection tool for detecting the binding between the receptor-ligand complex and the nucleic acid sequence

[0151] wherein, when the sample is combined with the test kit and the binding between the receptor-ligand complex and the nucleic acid sequence is detected, the presence of the ligand in the sample is determined.

[0152] In an example according to this aspect of the present invention, the nucleic acid response element comprises the sequence listed in SEQ ID NO:11 or SEQ ID NO:12.

[0153] In an example according to this aspect of the invention, the relative content of the steroid hormone receptor to the nucleic acid response element in the test kit is x:1, where x is the content of the steroid hormone and is defined as [0.2 ≤ x ≤ 20]. In a related example, the relative content of the steroid hormone receptor to the nucleic acid response element in the test kit is x:1, where x is the content of the steroid hormone receptor and is defined as [0.3 ≤ x ≤ 7].

[0154] In another example according to this aspect of the invention, the test kit further comprises steroid hormone receptor cofactors, including, but not limited to, heat shock protein 90, heat shock protein 70, heat shock protein 40, p23, heat shock protein-organizing protein (Hop), 48kD Hip protein, p60, and FKBP52.

[0155] In a further related example according to this aspect of the invention, the heat shock protein is HSP90.

[0156] In yet another example according to this aspect of the invention, as described herein, the test kit further comprises, either combined or separately, a steroid metabolism mechanism, a transcription and / or translation mechanism, and / or a cell-free extract.

[0157] In yet another aspect of the invention, there is provided a test kit for screening for the presence of a ligand in a test sample, the ligand being capable of forming a complex with a glucocorticoid receptor in a cell and triggering a genomic response, the test kit comprising:

[0158] (i) a glucocorticoid receptor that forms a receptor-ligand complex with the ligand from the test sample; and

[0159] (ii) a nucleic acid response element that is bound by the receptor-ligand complex; and

[0160] (iii) a detection tool for detecting the binding between the receptor-ligand complex and the nucleic acid sequence

[0161] wherein, when the sample is combined with the test kit and the binding between the receptor-ligand complex and the nucleic acid sequence is detected, the presence of the ligand in the test sample is determined.

[0162] In an example according to this aspect of the invention, the nucleic acid response element comprises the sequence listed in SEQ ID NO:13 or SEQ ID NO:14.

[0163] In an example according to this aspect of the present invention, the relative content of the steroid hormone receptor to the nucleic acid response element in the test kit is x:1, where x is the content of the steroid hormone and is defined as [0.2 ≤ x ≤ 20]. In a related example, the relative content of the steroid hormone receptor to the nucleic acid response element in the test kit is x:1, where x is the content of the steroid hormone receptor and is defined as [0.3 ≤ x ≤ 7].

[0164] In another example according to this aspect of the present invention, the test kit further comprises steroid hormone receptor cofactors, including, but not limited to, heat shock protein 90, heat shock protein 70, heat shock protein 40, p23, heat shock protein-organizing protein (Hop), 48kD Hip protein, p60, and FKBP52.

[0165] In a further related example according to this aspect of the present invention, the heat shock protein is HSP90.

[0166] In yet another example according to this aspect of the present invention, as described herein, the test kit further comprises, either combined or separately, a steroid metabolism mechanism, a transcription and / or translation mechanism, and / or a cell-free extract.

[0167] In yet another aspect of the present invention, there is provided an assay method for screening for the presence of a ligand in a test sample, the ligand being capable of forming a complex with a steroid hormone receptor in a cell and triggering a genomic response, the assay method comprising the steps of:

[0168] (i) Providing an assay reagent comprising:

[0169] (a) A steroid hormone receptor that forms a receptor-ligand complex with a ligand from the test sample; and

[0170] (b) A nucleic acid response element bound by the receptor-ligand complex; and

[0171] (c) A detection tool for detecting the binding between the receptor-ligand complex and the nucleic acid response element; and

[0172] (ii) Combining the biological sample with the assay reagent

[0173] wherein, in (ii), the relative content of the steroid hormone receptor to the nucleic acid response element is x:1, where x is the content of the steroid hormone receptor and is defined as [0.2 ≤ x ≤ 20], and wherein, when the sample is combined with the assay reagent and the binding between the receptor-ligand complex and the nucleic acid response element is detected, the presence of the ligand in the test sample is assayed.

[0174] In an example according to this aspect of the invention, the relative content of the steroid hormone receptor to the nucleic acid response element in the test kit is x:1, where x is the content of the steroid hormone receptor and is defined as [0.3 ≤ x ≤ 7].

[0175] In an example according to this aspect of the invention, as described herein, the test kit further comprises a steroid hormone receptor cofactor, a steroid metabolism mechanism, a transcription and / or translation mechanism, and / or a cell-free extract.

[0176] In yet another example according to this aspect of the invention, the steroid hormone receptor cofactor is selected from one or more of heat shock proteins (HSPs) (including but not limited to heat shock protein 70, heat shock protein 40, heat shock protein 90), p23, heat shock protein-organizing protein (Hop), 48kD Hip protein, p60, and FKBP52.

[0177] In a further related example according to this aspect of the invention, the heat shock protein is HSP90.

[0178] In yet another aspect of the invention, there is provided an assay method for screening for the presence of a ligand in a test sample, the ligand being capable of forming a complex with a steroid hormone receptor in a cell and eliciting a genomic response, the assay method comprising the steps of:

[0179] (i) Providing an assay reagent comprising:

[0180] (a) A steroid hormone receptor that forms a receptor-ligand complex with a ligand from the test sample; and

[0181] (b) A nucleic acid response element that is bound by the receptor-ligand complex; and

[0182] (c) A heat shock protein, including but not limited to heat shock protein 90; and

[0183] (d) A detection tool for detecting the binding between the receptor-ligand complex and the nucleic acid response element; and

[0184] (ii) Combining a biological sample with the assay reagent

[0185] wherein, in (ii), the relative content of the steroid hormone receptor to the nucleic acid response element is x:1, where x is the content of the steroid hormone receptor and is defined as [0.2 ≤ x ≤ 20], and wherein, when the sample is combined with the assay reagent and the binding between the receptor-ligand complex and the nucleic acid response element is detected, the presence of the ligand in the test sample is assayed.

[0186] In an example according to this aspect of the invention, the relative content of the steroid hormone receptor to the nucleic acid response element in the test kit is x:1, where x is the content of the steroid hormone receptor and is defined as [0.3 ≤ x ≤ 7].

[0187] In an example according to this aspect of the invention, as described herein, the test kit further comprises a steroid hormone receptor cofactor, a steroid metabolism mechanism, a transcription and / or translation mechanism, and / or a cell-free extract.

[0188] In another example according to this aspect of the invention, the steroid hormone receptor cofactor is selected from one or more of heat shock proteins (HSPs) (including but not limited to heat shock protein 70, heat shock protein 40, heat shock protein 90), p23, heat shock protein-organizing protein (Hop), 48kD Hip protein, p60, and FKBP52.

[0189] In another related example according to this aspect of the invention, the heat shock protein is HSP90.

[0190] In another aspect of the invention, there is provided a manufactured article for screening for the presence of a ligand in a test sample, which ligand is capable of forming a complex with a steroid hormone receptor in a cell and eliciting a genomic response, the manufactured article comprising the test kit described herein and instructions on how to detect the presence of the ligand in the sample.

[0191] In another aspect of the invention, there is provided a manufactured article for determining doping in an athlete, the manufactured article comprising the test kit described herein and instructions for detecting the presence of a ligand in a sample derived from an athlete, wherein the presence of the ligand in the sample indicates the presence of doping in the athlete. Brief Description of the Drawings

[0193] Figure 1 Shows the ARE / enhancer sequence (SEQ ID NO:15). Non-italic residues represent the enhancer sequence, while italic residues represent the ARE sequence, and the palindrome is highlighted in bold.

[0194] Figure 2It shows that testosterone-activated androgen receptor (AR) induces the transcription and translation of GFP. A coupled in vitro transcription and translation reaction was assembled using the ARE / enhancer-minProm-GFP DNA template. The reaction mixture was assembled in a 0.5 mL Eppendorf tube and initiated by adding 4 nM testosterone. After incubation for 2 h, GFP was measured as increased fluorescence. *P < 0.05 (Student's t-test), T-ligated AR versus AR-free control.

[0195] Figure 3 It shows that the GFP level in the testosterone-induced reaction is higher compared to the control. A coupled in vitro transcription and translation reaction was assembled using the ARE / enhancer-minProm-GFP DNA template. The reaction (50 μL) was assembled in a 0.5 mL Eppendorf tube and initiated by adding 4 nM testosterone. After incubation for 5 h, GFP was measured as increased fluorescence. ****P < 0.0001 (one-way ANOVA using Sidak's multiple comparison test).

[0196] Figure 4 It shows that the lyophilized form of the reaction components stored on filter paper disks is capable of producing testosterone-induced GFP. A coupled in vitro transcription and translation reaction was assembled using the ARE / enhancer-minProm-GFP DNA template and immediately aliquoted onto paper disks, snap-frozen and lyophilized, and stored at -80 °C. The reconstitution reaction was assembled in a 0.5 mL Eppendorf tube using 50 μL of nuclease-free water and initiated by adding 4 nM testosterone. After incubation for 6 h, GFP was measured as increased fluorescence.

[0197] Figure 5 It shows the testosterone specificity of the AR-regulated in vitro transcription / translation assay. A coupled in vitro transcription and translation reaction was assembled using the ARE / enhancer-minProm-GFP DNA template. The reaction (50 μL) was assembled in a 0.5 mL Eppendorf tube and initiated by 1 μM testosterone, 1 μM estradiol, or 1 μM progesterone. After incubation for 5 h, GFP was measured as increased fluorescence. ****P < 0.0001 (one-way ANOVA using Sidak's multiple comparison test).

[0198] Figure 6 It shows a preliminary assessment of the sensitivity of the AR-regulated in vitro transcription / translation assay. A coupled in vitro transcription and translation reaction was assembled using the ARE / enhancer-minProm-GFP DNA template. The reaction (50 μL) was assembled in a 0.5 mL Eppendorf tube and initiated by adding testosterone in the sub-μM to sub-nM range. After incubation for 5 h, GFP was measured as fluorescence.

[0199] Figure 7 RNA agarose gel showing RNA molecules produced by the IVT reaction using the MMTV-luciferase template (plasmid > 3000bp DNA band). The gel shows a distinct RNA band at ~850bp (size expected based on the gene transcript length). Different lanes (left to right) show the DNA size marker in lane 1 (farthest left), lane 2 (MMTV IVT stimulated with testosterone), lane 3 (MMTV IVT treated with ethanol), lane 4 (column wash #1), lane 5 (column wash #2).

[0200] Figure 8 RNA agarose gel showing RNA molecules produced by the IVT reaction using the ARE / enhancer DNA template (~850bp DNA band). The gel shows a distinct RNA band at ~450bp. Different lanes (left to right) show lane 1G44, lane 2G32, lane 3 4nM (1×) testosterone, lane 4 40nM (10×) testosterone, lane 5 ethanol.

[0201] Figure 9 Showing the Quant-IT RNA standard curve. RNA standards were incubated with the Quant-IT dye and fluorescence was measured. This standard curve was used to calculate the concentration of RNA molecules in the IVT reaction.

[0202] Figure 10 Showing cyanine-5-labeled UTP (cy-5-UTP) and the associated wavelength excitation and emission spectra.

[0203] Figure 11 Showing the synthetic ARE / enhancer GFP DNA sequence (SEQ ID NO:18) optimized for UTP and CTP.

[0204] Figure 12 Showing that the IVT reaction produces fluorescently labeled RNA molecules. The IVT reaction using the ARE / enhancer synthetic DNA template was activated with testosterone (4nM). The reactions were control (unlabeled, and control for autofluorescence), CY-5-labeled CTP and CY-5-labeled UTP, CY-5-labeled CTP or CY-5-labeled UTP. *P < 0.005 (one-way ANOVA using Sidak's multiple comparison test) for double-labeled reactions relative to the control.

[0205] Figure 13Shows an IVT reaction established with cy-5-labeled CTP and cy-5-labeled UTP and an ARE / enhancer synthetic DNA template. The reaction was activated with 4 nM testosterone (T), 40 nM T (10×T), or 0.1% (v / v) ethanol (E). The RNA molecules were column-purified before measuring direct fluorescence. *P < 0.05 for ethanol relative to testosterone. *P < 0.05 for one-way ANOVA with Sidak's post-multiple comparison test.

[0206] Figure 14 Shows an IVT reaction established with cy-5-labeled CTP and cy-5-labeled UTP and an MMTV-luciferase DNA template. The reaction was activated with 4 nM testosterone (T), 40 nM T (10×T), or 0.1% (v / v) ethanol (E). The RNA molecules were column-purified before measuring direct fluorescence. *P < 0.05 for ethanol relative to testosterone, Student's t-test between E and T. For 10×T, n = 1.

[0207] Figure 15 Shows the evaluation of different concentrations of IVT core components. IVT reactions were prepared using different concentrations of NTP (1 and 10 nM), MgCl2 (3, 5, and 7.5 nM), AR (9.1, 18, 36, 92, and 182 nM, with DNA concentration held at 12.8 nM), and MMTV luciferase DNA template (12.8, 25.6, 51.2, and 102.4 nM, with AR concentration held at 18 nM). The reaction was activated with 4 nM testosterone. The RNA molecules were column-purified before direct quantification. The ratio of AR to DNA for the IVT reaction (when AR was varied) was 0.7, 1.4, 2.8, 7.1, and 14.2. The ratio of AR to DNA for the IVT reaction (when DNA was varied) was 1.4, 0.7, 0.35, and 0.18. All reactions produced RNA output; however, an AR:DNA ratio of 2.8 or lower was the most efficient, although once the ratio reached 0.35 or lower, the response dropped sharply. High AR:DNA ratios (≥7.1) and low AR:DNA ratios (≤0.18) were shown to be detrimental to the IVT reaction.

[0208] Figure 16 Shows that an IVT reaction with cy-5-NTP-labeled RNA molecules as output was able to show a significant difference between castrated plasma samples with known low (G32) and high (G44) bioactivity. Comparing G32 and G44, *P < 0.05, Student's t-test.

[0209] Figure 17Shows the detection of testosterone-induced RNA synthesis using RTqPCR. An IVT reaction was prepared with an MMTV-luciferase DNA template. The reaction was activated with testosterone (4 nM) or ethanol (E, 0.1% v / v) and incubated at 30 °C for 2 h. RNA molecules were purified and treated with DNase before RTqPCR was used to measure the RNA levels. A lower cycle threshold indicates more RNA in the testosterone-treated reaction. (***p<0.0005 Students t-test).

[0210] Figure 18 Shows comparative measurements between a commercial HeLa nuclear extract and in-house preparations of HeLa-PC-3, HuH7, and HEK293 nuclear extracts. An IVT reaction was prepared using MMTV-luciferase as the DNA template and HeLa cell extracts with either a nuclear extract from a commercial source (Promega) or in-house nuclear extracts from HeLa, PC3 (prostate), HuH7 (liver), or HEK293 (kidney) cell cultures. Once prepared, the IVT reaction was activated with testosterone (4 nM) and incubated for 2 h. RNA was purified, the DNA template was destroyed by DNase, and then RTqPCR was used to measure the RNA levels.

[0211] Figure 19 Shows testosterone-induced activation of the AR-mediated IVT reaction in the presence of in-house nuclear extracts. All four nuclear extracts tested showed the ability to produce more RNA transcripts when activated by testosterone (T) relative to ethanol (E), as indicated by a decrease in the cycle threshold number. A lower threshold number indicates higher levels of RNA transcripts. HeLa (cervical cancer cells), HuH7 (hepatocytes), HEK293 (kidney cells), and PC3 (prostate cancer cells).

[0212] Figure 20 Shows that the IVT reaction can be stimulated by testosterone and its active metabolite dihydrotestosterone (DHT). Each IVT-RTqPCR was done 3 times (n = 3). The Y-axis shows the cycle threshold, and a decrease in the cycle threshold indicates more RNA transcripts.

[0213] Figure 21 Shows that an ARE / enhancer DNA template immobilized on beads supports IVT transcription of testosterone (T)-activated AR-induced RNA transcripts, as measured by RTqPCR. RTqPCR was performed using a specific primer / probe set. E - ethanol, T - testosterone, G32 - horse plasma, G44 - horse plasma. The Y-axis shows the cycle threshold, and a decrease in the cycle threshold indicates more RNA transcripts.

[0214] Figure 22Shows an IVT reaction measured by RT-qPCR using a stem-loop reverse primer method. The IVT reaction activated by testosterone (4 nM) consisted of an ARE / enhancer GFP template. mRNA transcripts were purified from the reaction, treated with DNase I, and then levels were measured in a two-step RT-qPCR reaction involving a stem-loop reverse transcription primer, and a stem-loop sequence-specific reverse PCR primer and probe. The Y-axis shows the cycle threshold, and a lower cycle threshold indicates more RNA transcripts.

[0215] Figure 23 Shows that the testosterone-activated AR-ARE / enhancer IVT assay produced RNA Mango aptamer molecules that could be detected by TO1-PB fluorescence. The values shown were corrected for background TO1-PB fluorescence.

[0216] Figure 24 Shows that four different RNA Mango DNA templates were tested in IVT reactions that were either unactivated (ethanol control) or activated with 4 nM testosterone (T). For Mango II, III, and IV, n = 4, and for Mango I, n = 1.

[0217] Figure 25 Shows that the testosterone-activated reaction produced more Mango II aptamer than the control reaction. IVT reactions were assembled and activated with testosterone (4 nM) or ethanol (baseline control). Reactions were completed in triplicate for three consecutive days. Results are shown as mean ± SEM and plotted on a log10 scale. *P < 0.05 Students t-test ethanol relative to testosterone.

[0218] Figure 26 Shows that the IVT-Mango II reaction can detect sub-nM testosterone concentrations. IVT reactions were assembled and activated with testosterone ranging from 2 to 0.4 (nM) or ethanol (baseline control, 0 nM). Results are shown as mean ± SEM and plotted on a log10 scale.

[0219] Figure 27 Shows that the IVT-Mango reaction can detect androgenic activity in horse plasma samples. IVT reactions were assembled and activated with horse serum (15% v / v) from castrated racehorses, G44, and G32. Results are shown as mean ± SEM.

[0220] Figure 28 Shows that the IVT-Mango reaction can detect four different SARMs and two different AASs. IVT reactions were activated with one of six androgen molecules or T. **P < 0.01 *P < 0.05 One-way ANOVA using Sidaks multiple comparison test.

[0221] Figure 29 It shows that the testosterone-activated IVT reaction produces more iSpinach aptamer than the ethanol control. The IVT reaction was assembled and activated with testosterone (4 nM) or ethanol (baseline control). The reaction was repeated three times over three consecutive days. The results are shown as mean ± SEM.

[0222] Figure 30 It shows that the IVT-iSpinach reaction can detect androgen activity in horse plasma samples. The IVT reaction was assembled and activated with horse plasma samples, G33 or G44.

[0223] Figure 31 It shows that AR binds to the AREGFP DNA template. Starting from the far right, the protein ladder indicates size. Lane 1 is the recombinant AR protein probed with AR antibody and HRP secondary antibody. Lane 2 is the AREGFP DNA template alone, with no AR added to the reaction mixture. Lanes 3 - 5 show that AR binds to the AREGFP template in a MgCl2-dependent manner. The next lanes 2 - 5 (SN after incubation) show the supernatant that was removed after the incubation reaction showed only a very faint AR band, indicating that most of the added AR bound to the beads. The rightmost lanes 2 - 5 show the beads after heat treatment (the DNA will separate from the beads) and washing. There is a very faint AR band, indicating that most of the AREGFP DNA template / AR complex has been removed from the beads. In summary, these negative controls show the specificity of the positive reaction and indicate that AR binds to the AREGFP template immobilized on the beads.

[0224] Figure 32 It shows the dot blot of the AR / ARE DNA template.

[0225] Figure 33 It shows the green fluorescent protein (GFP) expression of androgen receptor assay prototype 1 for test reaction mixtures containing testosterone and various positive and negative controls.

[0226] Figure 34 It shows the relative androgen receptor assay prototype 1 testosterone dose-response curve compared to androgen receptor assay prototype 0. Testosterone was serially diluted from 1×10 -6 M to 1×10 -12 M, and the reporter protein output for each concentration was measured using prototype 0 or prototype 1. An S-shaped dose-response curve was generated.

[0227] Figure 35Shows the relative green fluorescent protein expression of androgen receptor assay prototype 1 spiked with testosterone, estradiol, and progesterone. These data demonstrate the specificity of the assay system for testosterone (i.e., an androgen receptor-specific ligand) relative to estradiol and progesterone (non-androgen receptor-specific ligands, but known to cross-react with and activate the androgen receptor).

[0228] Figure 36 Shows a photo of a light agarose gel and the product of an IVT reaction using an MMTV-luciferase DNA template, AR, HeLa cell extract, and reaction buffer. The reaction was set up and AR was activated with testosterone (100 ng). Controls included ethanol and testosterone in the absence of AR.

[0229] Figure 37 Shows an IVT reaction using an MMTV-luciferase DNA template, AR, HeLa cell extract, and reaction buffer. The reaction was set up and AR was activated with decreasing concentrations of testosterone (100 ng, 50 ng, 25 ng, 12.5 ng, ethanol).

[0230] Figure 38 Shows an IVT reaction using an MMTV-luciferase DNA template, AR, an internal HeLa cell extract, and reaction buffer. The reaction was set up and AR was activated with testosterone (100 ng). Controls included ethanol. 10, 5, and 2.5 μl of the RT product were tested in a PCR reaction.

[0231] Figure 39 Shows yeast cell androgen receptor prototype assay 0, measuring assay performance (β-galactosidase activity) as a function of cell density at 30 and 60 minutes after activation, using serum from racehorses administered pharmacologically relevant doses of testosterone (OD 600 = 0.4 or OD 600 = 0.2).

[0232] Figure 40 Shows androgen receptor prototype assay 2, measuring the RTqPCR cycle threshold as a function of HeLa cell extract concentration at 100, 75, and 50 μg / mL cell extract.

[0233] Figure 41 Shows IVT-RT-PCR using testosterone (100 ng) relative to ethanol.

[0234] Figure 42 Shows PCR of DNaseI-treated DNA template.

[0235] Figure 43Shows RT-PCR of the IVT reaction. The IVT reaction was performed (T, ethanol, no NTP). Before performing RT-PCR, Turbo DNase was used to eliminate the DNA template. The results showed DNA bands of a positive IVT reaction, T > ethanol (confirmed by RTqPCR). No NTP (and thus no RNA could form) showed no bands, indicating that the DNA template was destroyed. Lane 4 is the PCR water control.

[0236] Figure 44 Shows the EC of testosterone (T) relative to dihydrotestosterone (DHT) 50 curve, as measured by binding to the androgen receptor and activation of the androgen receptor. The relative potency of dihydrotestosterone to testosterone was calculated at 2.3.

[0237] Figure 45 Shows the transcription of testosterone-activated iSpinach RNA aptamer molecule (A) 4×iSpinach DNA template (B) F30 scaffold iSpinach template. An in vitro transcription reaction was performed, followed by the addition of DFHBI and fluorescence buffer. Relative to ethanol (vehicle, unactivated baseline) or no RNA production control, the fluorescence in the testosterone-activated reaction increased significantly. Reaction (A), n = 4, reaction (B), n = 3.

[0238] Figure 46 Shows the effect of adding HSP90 to the reaction mixture. When no HSP90 was added to the reaction mixture (0 ng), there was less activation of the ligand (testosterone) of AR, as shown by the lower level of induction caused by testosterone being superior to the ethanol control. However, when 100 ng HSP90 was included in the reaction mixture, there was a significant increase in AR activation, as demonstrated by the increased level of induction caused by testosterone being superior to the ethanol control. Finally, when 200 ng HSP90 was included in the reaction mixture, the ligand-independent AR activation of RNA aptamer synthesis was almost completely inhibited, and when AR was activated by the ligand testosterone, this AR blockade by HSP90 was overcome.

[0239] General definitions

[0240] Unless otherwise clearly defined, all technical and scientific terms used herein shall have the same meaning as commonly understood by one of ordinary skill in the art (e.g., immunology, immunohistochemistry, protein chemistry, and biochemistry).

[0241] It is intended that the reference to a numerical range disclosed herein (e.g., 1 to 10) also includes reference to all the relevant numbers within that range (e.g., 1, 1.1, 2, 3, 3.9, 4, 5, 6, 6.5, 7, 8, 9, and 10) and thus all sub-ranges of all ranges explicitly disclosed herein are explicitly disclosed (e.g., 2 to 8, 1.5 to 5.5, and 3.1 to 4.7). These are merely examples for specific purposes, and all possible combinations of values between the recited minimum and maximum values should be considered to be explicitly stated in this application in a similar manner.

[0242] The term “and / or,” e.g., “X and / or Y,” shall be understood to mean “X and Y” or “X or Y” and shall provide explicit support for both meanings or either meaning.

[0243] The term “a” or “an” refers to one or more than one of the designated entity; e.g., “a receptor” or “a nucleic acid molecule” can refer to one or more receptors or nucleic acid molecules, or at least one receptor or nucleic acid molecule. Thus, the terms “a” or “an,” “one or more,” and “at least one” can be used interchangeably herein.

[0244] Throughout the specification, the word “comprise,” or variations thereof such as “comprises” or “comprising,” will be understood to mean the inclusion of the stated element, integer, or step, or group of elements, integers, or steps, but not the exclusion of any other element, integer, or step, or group of elements, integers, or steps.

[0245] Throughout the specification, unless otherwise indicated or the context otherwise requires, reference to a single step, composition of matter, group of steps, or group of compositions of matter shall be taken to include one or plural (i.e., one or more) of those steps, compositions of matter, group of steps, or group of compositions of matter.

[0246] Selected Definitions

[0247] For the purposes of the present invention, the following terms shall have the following meanings.

[0248] The term “assay prototype 0” as used herein refers to yeast- and mammalian cell-based assays for detecting ligands that activate steroid hormone receptors.

[0249] The term “assay prototype 1” as used herein refers to a cell-free assay for detecting ligands having steroid activity, which assay functions by measuring the reporter expression level (e.g., green fluorescent protein) of a reporter element of a nucleic acid response element operably linked to a receptor (or receptor-ligand complex) activated by the ligand to detect the presence of the ligand.

[0250] As used herein, the term "assay prototype 2" refers to a cell-free assay for detecting a ligand having steroid activity from a test sample, which assay functions by measuring the reporter transcript level (e.g., mRNA or cDNA) of a reporter element of a nucleic acid operably linked to a receptor (or receptor-ligand complex) activated by the ligand, to detect the presence of the ligand.

[0251] As used herein, the term "assay prototype 3" refers to a cell-free assay for detecting a ligand having steroid activity from a test sample, which assay functions by measuring the binding interaction between a ligand-activated receptor (or receptor-ligand complex) and a nucleic acid sequence comprising an activated receptor binding domain, to detect the presence of the ligand.

[0252] As used herein, the term "steroid hormone receptor" refers to a protein or polypeptide, including a recombinant polypeptide that selectively binds a ligand that is capable of activating the steroid hormone receptor, and includes, without limitation, androgen receptor, estrogen receptor, progesterone receptor, mineralocorticoid receptor, and glucocorticoid receptor. Generally, a steroid hormone receptor comprises a ligand binding domain, an activation domain, and a deoxyribonucleic acid binding domain. By this definition, "steroid hormone receptor" may optionally include other cofactors, including (e.g.) heat shock proteins, etc., which assist in maintaining the steroid hormone receptor in a folded and hormone-responsive state for activation by the receptor.

[0253] As used herein, the term "steroid hormone receptor cofactor" refers to one or more cofactors that assist in maintaining the steroid hormone receptor in an optimal folded and hormone-responsive state for activation by a ligand.

[0254] The term "ligand" generally refers to any molecule that binds to a receptor, and includes, without limitation, polypeptides, proteins, vitamins, carbohydrates, glycoproteins, therapeutic agents, drugs, glycosaminoglycans, or any combination thereof. As used herein, "ligand" includes, without limitation, steroid hormones, such as sex hormones, including but not limited to estrogen, progesterone, androgen, etc., as well as natural and synthetic derivatives, analogs, and metabolites thereof, designer steroid hormones, and androgenic anabolic steroids, as well as selective androgen-, progesterone-, and estrogen receptor modulators, those currently known and those expected to be developed.

[0255] As used herein, the terms "receptor-ligand complex" and "activated steroid hormone receptor" refer to a ligand that binds to a steroid hormone receptor, wherein the steroid hormone receptor undergoes a conformational change upon ligand binding and is subsequently referred to as the activated form. The receptor-ligand complexes described herein include, without limitation, monomers of ligand-bound hormone receptors (i.e., HR-L; wherein "HR" is the hormone receptor and "L" is the ligand), dimers of ligand-bound hormone receptors (i.e., (HR-L)2), trimers of ligand-bound hormone receptors (i.e., (HR-L)3), or some other higher-order structure that would be apparent to one of ordinary skill in the art.

[0256] As used herein, the term "genomic response" refers to the ability of an activated steroid hormone receptor (i.e., a ligand-bound receptor) to selectively bind to a nucleic acid binding motif and regulate the expression of nucleic acid molecules (including genes) that are directly or indirectly linked to the binding motif. For the avoidance of doubt, the term "genomic response" need not necessarily refer to the regulation of genes within the nucleus, but rather to a response in which the activated hormone receptor has the ability to switch the transcription of a nucleic acid sequence on or off, or to decrease or increase the expression of a nucleic acid sequence, such as those contained within the receptor constructs used in the test kits, assays, and methods described herein.

[0257] As used herein, the term "steroid metabolizing machinery" refers to any enzyme or non-enzyme cofactor, and includes combinations of enzymes and non-enzyme cofactors, that are sufficient to convert a ligand from a physiologically inactive form to a physiologically active form, or from a physiologically active form to a more physiologically active form, or from a physiologically active form to a less physiologically active form, or from a physiologically active form to a physiologically inactive form.

[0258] As used herein, the term "cell-free extract" refers to an extract derived from cells or nuclei found within cells and that is substantially free of any cell membrane components.

[0259] As used herein, the term "detection tool" refers to any device, apparatus, or configuration suitable for detecting the binding interaction between an activated steroid hormone receptor and a nucleic acid response element. Examples of detection tools include, without limitation, optical methods, spectroscopy, visible spectroscopy, Raman spectroscopy, ultraviolet spectroscopy, surface plasmon resonance, electrochemical methods, impedance, resistance, capacitance, mechanical sensing due to mass changes, changes in mechanical resonance, electrophoresis, gel electrophoresis, gel retardation, imaging, fluorescence, and fluorescence resonance energy transfer, polymerase chain reaction, and the like.

[0260] As used herein, the term "nucleic acid sequence" refers to deoxyribonucleic acid (DNA) sequences, ribonucleic acid sequences (RNA), messenger ribonucleic acid (mRNA), and complementary DNA (cDNA), and consists of a continuous sequence of two or more nucleotides, also referred to as a polynucleotide.

[0261] As used herein, the term "reporter construct" refers to a nucleic acid sequence encoding a reporter molecule that encodes an RNA or enzyme or protein whose expression is to be analyzed; such RNAs include, but are not limited to, fluorophore-binding aptamers, or synthetic RNAs or mRNAs, and such proteins include, but are not limited to, green fluorescent protein (GFP), red fluorescent protein (RFP), orange fluorescent protein (OFP), β-galactosidase (LazZ), β-glucuronidase (GUS), alkaline phosphatase, luciferase, amino acid biosynthesis genes, e.g., yeast LEU2, HIS3 or LYS2 genes, nucleic acid biosynthesis genes, e.g., URA3 or ADE2 genes, chloramphenicol acetyltransferase (CAT) gene, or any surface antigen gene for which a specific antibody is available. Additionally, the reporter gene can include any target gene whose expression product can be detected.

[0262] As used herein, the term "promoter" is a nucleic acid sequence near the transcription start at the 5' end of a transcriptionally operably linked sequence. A promoter can contain one or more regulatory elements that interact in regulating the transcription of an operably linked gene. Promoters are essentially minimal and include, but are not limited to, minimal CMV, minimal pA promoter, minimal pTKHSV promoter, minimal TATA-like promoter.

[0263] As used herein, the term "operably linked" describes the arrangement of two macromolecular elements such that regulation of the activity of the first element induces an effect on the second element. In this way, regulation of the activity of a promoter element can be used to alter and / or regulate the expression of an operably linked reporter construct. For example, transcription of a reporter construct operably linked to a promoter element is induced by a factor that "activates" the promoter activity; transcription of a reporter construct operably linked to a promoter element is inhibited by a factor that "represses" the promoter activity. Thus, a promoter region is operably linked to a reporter construct if transcription of such a reporter construct is affected by the activity of the promoter.

[0264] As used herein, the term "expression" refers to the process by which the information encoded within a gene is expressed. If a gene encodes a protein, expression involves transcription of DNA into mRNA, processing of the mRNA into a mature mRNA product (if required) and translation of the mature mRNA into a protein. A nucleic acid molecule (such as deoxyribonucleic acid (DNA) or a gene) is said to "be capable of expressing" a polypeptide (or protein) if the molecule contains a coding sequence for the polypeptide and expression control sequences that, in a suitable host environment, provide the ability to transcribe, process and translate the genetic information contained in the DNA into a protein product, and if such expression control sequences are operably linked to the nucleotide sequence encoding the polypeptide.

[0265] As used herein, the term "sample" refers to any sample for which the presence of a ligand is desired to be tested.

[0266] As used herein, the term "relative potency" or "RP" refers to the fold increase in biological activity exhibited by a test compound relative to a reference compound, where biological activity is defined by the ability of the compound to bind and activate a steroid hormone receptor, as measured, for example, using the assays and test kits described herein. In the case where relative potency > 1, the test compound is more potent than the reference compound with respect to its biological activity; in the case where relative potency < 1, the test compound is less potent than the reference compound with respect to its biological activity; and in the case where relative potency = 1, the test compound and the reference compound are equivalent with respect to their biological activity.

[0267] As used herein, the term "activation factor" or "AF" relates to the measurement of a test compound (e.g.) metabolically transitioning from a physiologically inactive state to a physiologically active state or from a lower physiologically active state to a higher physiologically active state. An activation factor > 1 indicates that the test compound has undergone a metabolic transition to a higher physiologically active state in the presence of the metabolic machinery in the assay.

[0268] As used herein, the term "reference threshold" represents the level of assay activity measured in the absence of a test sample. In certain instances of the invention described herein, the reference threshold was determined using ethanol in place of the test sample.

[0269] DETAILED DESCRIPTION

[0270] The present invention provides test kits, assays, and methods for screening for the presence of a ligand in a sample, the ligand being capable of forming a complex with a steroid hormone receptor in a cell and eliciting a genomic response. In certain instances, the invention described herein has utility in the detection of performance enhancing prodrugs / drugs (e.g., androgenic steroids) used in human and non-human athletes (including race horses and dogs). In other instances, the present invention described herein has utility in screening additives in foods and health food supplements, the additives being capable of binding to a steroid hormone receptor and eliciting a genomic response in a cell or having such function in a subsequent metabolic process (i.e., in the so-called "prodrug" scenario).

[0271] The assays according to the invention on which the test kits and methods described herein are based are fundamentally activity-based assays that work on the principle of activation of steroid hormone receptors by binding of ligands derived from the sample to be tested. Activation of the steroid hormone receptor occurs when the ligand binds to the receptor and induces a conformational change in the protein tertiary structure, meaning that the receptor-ligand complex (also referred to herein as the "activated hormone receptor") is subsequently able to bind to nucleic acid response elements and initiate a so-called "genomic response" (in other words, the ability to upregulate / downregulate genes in the cell nucleus, which subsequently results in anabolic physiological effects). The binding interaction between this activated steroid hormone receptor and the nucleic acid response element is measured by the test kits, assays and methods described herein as representative of the presence of a ligand with steroid- or steroid-like activity in the sample to be tested.

[0272] Thus, the test kits and assays according to the invention have the ability to detect ligands of unknown structure (such as (e.g.) "designer drugs"). Historically, this has not been possible because conventional laboratory testing equipment, such as gas / liquid chromatography and mass spectrometry, requires prior knowledge of the structure of the molecule under investigation.

[0273] Thus, the activity-based assays according to the invention overcome the limitations associated with the established prior art.

[0274] Furthermore, although the assays described herein are largely modeled on the molecular framework of cell-based systems, the absence of cellular complexity provides enhanced functionality and improved assay sensitivity for the in vitro system compared to cell-based assays.

[0275] The various test kits and assays described herein each provide (i) a steroid hormone receptor comprising a ligand-binding domain for binding ligands that may be present in the sample to be tested and (ii) a nucleic acid response element comprising a protein-binding domain that is bound by the activated steroid hormone receptor (or ligand-receptor complex; HR-L). The term "activated steroid hormone receptor" refers to the receptor-ligand complex and can include various arrangements of HR-L structures (e.g., monomers, dimers, trimers, etc.). The nucleic acid response element contains a binding motif specific for the receptor-ligand complex. Thus, by combining the test kits and assays of the invention with the target test sample, detection of a ligand that has the potential to bind to the steroid hormone receptor in the cell and initiate a genomic response is possible.

[0276] The terms "receptor binding domain", "activated receptor binding domain", "hormone receptor binding domain", "activated hormone receptor binding domain", "receptor-ligand binding domain" and "hormone receptor-ligand binding domain" are used interchangeably to refer to the protein binding domain of a nucleic acid response element that is bound by an activated hormone receptor or ligand-receptor complex as defined herein.

[0277] The test kits, assays and methods described herein may further comprise (iii) steroid hormone receptor cofactors and transcription and / or translation machinery, said other cofactors and / or machinery enhancing the overall performance of the assay. The steroid hormone receptor cofactors described herein help to maintain the hormone receptor in an optimally folded and hormone-responsive state for activation by a ligand and largely prevent the steroid hormone receptor from binding to its response element. Examples of steroid hormone receptor cofactors according to the invention include, but are not limited to, heat shock proteins (including heat shock protein 70, heat shock protein 40, heat shock protein 90) and heat shock protein-organizing protein (Hop), p23, 48 kD Hip protein, p60 and FKBP52.

[0278] The test kits, assays and methods described herein may further comprise (iv) steroid metabolizing machinery sufficient to convert a ligand from a physiologically inactive form to a physiologically active form, or from a physiologically active form to a more physiologically active form or from a physiologically active form to a less physiologically active form or from a physiologically active form to a physiologically inactive form. Only when the ligand is in a physiologically active form does it have the ability to activate a steroid hormone receptor and initiate a genomic response. Thus, the inclusion of steroid metabolizing machinery in the test kits, assays and methods according to the invention helps to facilitate the detection of physiologically inactive ligands from a target test sample, (e.g.) said ligand being present as a prodrug (e.g., a prohormone) and possibly otherwise escaping detection using established methods. In addition, the inclusion of steroid metabolizing machinery in the test kits, assays and methods according to the invention helps to determine the biological activity / potency of a ligand that requires demonstration of an effect.

[0279] According to the present invention, a cell-free extract can provide steroid hormone receptor cofactors, transcription and / or translation machinery, and steroid metabolism machinery in test kits, assays, and methods. In an example according to the present invention, the cell-free extract contains additional proteins and non-protein enzymes, cofactors, etc., including (for example) additional steroid hormone receptor cofactors, transcription and / or translation machinery, and steroid metabolism machinery. In yet another example, the cell-free extract is derived from a target cell. In a related example, the cell-free extract is derived from a cell in which the target ligand is physiologically active. To better illustrate this and for illustrative purposes only, if a test kit according to the present invention has been configured to detect performance-enhancing androgens from a test sample obtained from a racehorse, then the cell-free extract contained in the test kit can be derived from cells of a horse animal. The test kit is optimized for the manner of detecting the target ligand. However, this example does not exclude the possibility that the cell-free extract is derived from cells of another species, and the target ligand of that species need not necessarily be physiologically active (for example, in the above example, as opposed to a horse cell line, in the case where the cell extract is derived from a human cell line).

[0280] Similarly, the steroid hormone receptors provided in the test kits, assays, and methods according to the present invention are directly derived from the target species in which the detection of the target ligand is to be studied. The term "derived from" as used in this context includes steroid hormone receptors that have been purified from the cells or cell nuclei of the target species, or that have been produced by synthetic or recombinant means (and may include one or more mutations to enhance, for example, ligand binding, etc.). Continuing with the example mentioned above, if the test kits, assays, and methods according to the present invention are configured for the detection of androgens that may be present in racehorse serum, then the test kit will include (i) a horse androgen receptor that has been purified from horse cells or (ii) a horse androgen receptor that has been produced by recombinant or synthetic means and that will additionally mimic the performance of an androgen receptor purified from horse cells.

[0281] Furthermore, the present invention relates to test kits in which some other cofactors and / or machinery are provided by the cell-free extract, while other cofactors and / or machinery are provided in recombinant or synthetic form. By way of example only, the present invention further relates to a test kit containing a cell-free extract that provides transcription and / or translation machinery and steroid metabolism machinery, while the steroid hormone receptor cofactor (for example, HSP90) is provided in recombinant form.

[0282] According to the present invention, the cell-free extract is defined by being substantially free of any cell membrane material.

[0283] The test kits, assays, and methods described herein may further comprise (v) a detection tool for detecting binding between a receptor-ligand complex and a nucleic acid response element. Such binding interactions may be measured indirectly (e.g., Assay Prototypes 1 and 2) or directly (e.g., Assay Prototype 3) by a reporter construct operably linked to a nucleic acid sequence.

[0284] For the test kits, assays, and methods according to the invention, Assay Prototype 2 relates to a cell-free assay for detecting a ligand from a test sample, the ligand being capable of forming a complex with a steroid hormone receptor in a cell and eliciting a genomic response, the assay functioning by measuring the level of RNA transcripts (e.g., mRNA or cDNA or synthetic RNA) of a reporter element of a nucleic acid operably linked to a receptor activated by the ligand (or receptor-ligand complex). Assay Prototype 1 refers to a cell-free assay for detecting a ligand from a test sample, the ligand being capable of forming a complex with a steroid hormone receptor in a cell and eliciting a genomic response, the assay functioning by measuring the gene expression level (e.g., green fluorescent protein) of a reporter element of a nucleic acid operably linked to a receptor activated by the ligand (or receptor-ligand complex) to detect the presence of the ligand; while Assay Prototype 3 relates to a cell-free assay for detecting a ligand from a test sample, the ligand being capable of forming a complex with a steroid hormone receptor in a cell and eliciting a genomic response, the assay functioning by measuring the binding interaction between a ligand-activated receptor (or receptor-ligand complex) and a nucleic acid sequence comprising an activated receptor binding domain to detect the presence of the ligand.

[0285] The test kits and assays according to the invention are cell-free. This is particularly important because the molecular complexity of the assay system is significantly reduced. For example, (i) the cell membrane structure, which has the potential to form a thermodynamic sink for steroid hormone molecules and (ii) the absence of endogenous steroid hormone metabolism observed with cell-based systems provide an assay system with enhanced sensitivity. Additionally, and advantageously, for the test kits, assays, and methods described herein, the relative amounts of the essential structural elements (e.g., steroid hormone receptor and nucleic acid response element comprising one or more activated receptor binding domains) can be precisely controlled to provide enhanced assay functionality and increased sensitivity. Further still, the relative amounts of other cofactors (including, for example, steroid hormone receptor cofactors, transcription and / or translation machinery, and steroid metabolism machinery) should also be precisely controlled to provide enhanced assay functionality and increased sensitivity. To further illustrate this point, reference is made to the experiments listed in Figure 43 and 44 The applicant initially demonstrated the importance of controlling the relative confluence / density of yeast cells in the cell culture for Assay Prototype 0 ( Figure 43), where at higher cell densities (i.e., OD 600 = 0.4), the activity of the reporter construct after addition of testosterone could not be distinguished from the negative ethanol control; while at lower cell densities (i.e., OD 600 = 0.2), a measurable difference existed between testosterone and the control sample. These initial observations extended to assay prototype 2 involving cell-free extracts ( Figure 44 ), where the applicant demonstrated the need to control the relative concentration of the cell-free extracts to specifically distinguish testosterone from the control. Again, these data emphasized the importance of precisely controlling the relative amounts of the test kit / assay components to achieve the detection of the target ligand.

[0286] To emphasize the comparative sensitivity and molecular complexity, Table I below lists the basic assay characteristics for assay prototypes according to the present invention (i.e., assay prototypes 1 - 3), including sensitivity, molecular complexity, detection tools, execution time, etc., compared with a cell-based assay from Saccharomyces cerevisiae (i.e., assay prototype 0).

[0287] Table I: Assay Prototype Comparison

[0288]

[0289] To further illustrate the relative sensitivity of the assays described herein, in conjunction with Figures 1-6 , 44, and 45, read in accordance with Examples 2 and 5, confirmed the assay sensitivity. Briefly, assay prototype 1 was engineered using an androgen receptor and an androgen response element operably linked to a green fluorescent protein reporter. The binding between testosterone-activated androgen receptor (i.e., testosterone-androgen receptor complex) and the androgen receptor response element was measured by determining the level of GFP expression. Referring to Examples 2 and 5 and Figure 34 and 35 , a testosterone dose-response curve was generated. The EC 50 of prototype 1 (i.e., cell-free assay) was determined to be 7.9×10 -11 , which represents a sensitivity increase of more than 100-fold higher than that of prototype 0 (i.e., cell-based assay), where the reported EC 50 value was in the 5×10 -9 M range (Death et al. (2004) J. Clin. Endo. Metabol. 89:2498 - 2500).

[0290] According to the test kits, assays, and methods described herein, the Applicant has determined that the optimal amount of steroid hormone receptor to nucleic acid response element should be x:1, where x is defined as [0.2 ≤ x ≤ 20], which includes, but is not limited to, 0.2:1, 0.3:1, 0.4:1, 0.5:1, 0.6:1, 0.7:1, 0.8:1, 0.9:1, 1:1, 1.1:1, 1.2:1, 1.3:1, 1.4:1, 1.5:1, 1.6:1, 1.7:1, 1.8:1, 1.9:1, 2:1, 2.1:1, 2.2:1, 2.3:1, 2.4:1, 2.5:1, 2.6:1, 2.7:1, 2.8:1, 2.9:1, 3:1, 3.1:1, 3.2:1, 3.3:1, 3.4:1, 3.5:1, 3.75:1, 4:1, 4.25:1, 4.5:1, 4.75:1, 5:1, 5.5:1, 6:1, 6.5:1, 7:1, 7.5:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, and 20:1. The reason is related to the following observation: in its ligand-bound / activated form, the steroid hormone receptor forms a dimer (e.g., (SR-L)2), which then binds to and activates its associated response element. Thus, by precisely controlling the amount of steroid hormone receptor relative to the response element, the overall sensitivity of the assay is significantly enhanced because in the presence of the ligand, the assay is formulated to measure the optimal number of binding interactions. In contrast, since the total copy number of the gene or nucleic acid sequence encoding (e.g.) the recombinant receptor and / or nucleic acid response element cloned into the cell cannot be predicted or controlled with any precision, it is difficult (if not impossible) to replicate the same degree of control for cell-based reporter assays that have been configured to detect the presence of a ligand.

[0291] In addition, Figure 46 the data presented in demonstrate the importance of controlling the relative amount of steroid hormone receptor cofactors in the assay. In particular, the relative level of activation of the testosterone-induced response element (as measured by total fluorescence) showed that too much HSP90 (i.e., 200 ng) inhibited more fluorescence than no HSP90 (i.e., 0 ng), while the optimal signal was measured in the presence of 100 ng HSP90. These data further reinforce the importance of being able to precisely control assay parameters in order to obtain the best signal and thus the best assay sensitivity for detecting a ligand in a test sample.

[0292] Although the applicant has determined that the optimal ratio of steroid hormone receptor to nucleic acid response element can optimally be in the range of ≥0.3:1 and ≤7:1, the present invention also contemplates ratios outside of this range. For example, in the case where the ratio of steroid hormone receptor to nucleic acid response element is (for example) x:1, where x is the content of steroid hormone receptor and x = 0.2, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, and 20.

[0293] In addition, although the applicant has determined that an optimal ratio of steroid hormone receptor to nucleic acid response element should be in the range of ≥0.3:1 and ≤7:1, care must be taken not to saturate the assay system with too much receptor, as this can itself form a thermodynamic or kinetic barrier preventing optimal binding (e.g., a ratio of steroid hormone receptor to nucleic acid response element of more than 20:1, and depending on the assay conditions 7:1). However, one of ordinary skill in the art, using conventional tools, can determine the optimal sensitivity of the assay based on the relative content of its component parts.

[0294] Another advantage afforded by the test kits and assays according to the present invention is the relative ease of performance. In other words, the performance of the test kits, assays, and methods described herein does not require complex cell culture techniques, experienced laboratory technicians, or complex laboratory test equipment and analysis. This is particularly advantageous because the test kits, assays, and methods according to the present invention can be implemented by untrained personnel in the art according to relatively simple test procedures. In addition, the performance of the test kits, assays, and methods can provide real-time information, e.g., when assaying for performance enhancing substances in a sample obtained from an athlete immediately before or after a test event.

[0295] Thus, in one aspect of the present invention, there is provided a test kit for screening for the presence of a ligand in a test sample, the ligand being capable of forming a complex with a steroid hormone receptor in a cell and eliciting a genomic response, the test kit comprising:

[0296] (i) a steroid hormone receptor that forms a receptor-ligand complex with the ligand from the test sample; and

[0297] (ii) a nucleic acid response element that is bound by the receptor-ligand complex; and

[0298] (iii) a detection tool for detecting the binding between the receptor-ligand complex and the nucleic acid response element

[0299] wherein, when the sample is combined with the test kit and binding between the receptor-ligand complex and the nucleic acid sequence is detected, the presence of the ligand in the test sample is assayed.

[0300] In an example according to this aspect of the invention, the relative content of the steroid hormone receptor and the nucleic acid response element in the test kit is x:1, where x is the content of the steroid hormone and is defined as [0.2 ≤ x ≤ 20]. In a related example, the relative content of the steroid hormone receptor and the nucleic acid response element in the test kit is x:1, where x is the content of the steroid hormone receptor and is defined as [0.3 ≤ x ≤ 7].

[0301] In another example according to this aspect of the invention, the test kit further comprises a steroid hormone receptor cofactor that helps the steroid hormone receptor to remain in an optimal folded and hormone-responsive state (i.e., for ligand binding). Examples of the steroid hormone receptor cofactor according to the invention include, but are not limited to, heat shock protein 70, heat shock protein 40, heat shock protein 90, p23, heat shock protein-organizing protein (Hop), 48kD Hip protein, p60, and FKBP52.

[0302] In a related example according to this aspect of the invention, the test kit comprises a heat shock protein (HSP). In yet another related example, the HSP is HSP90.

[0303] In another example, the steroid hormone receptor cofactor is provided by a cell-free extract or in a recombinant or synthetic form.

[0304] In yet another example according to this aspect of the invention, the nucleic acid response element comprises a promoter operably linked to a reporter construct. In yet another example, the reporter construct comprises a sequence encoding at least one RNA aptamer that, after transcription, folds to form a structure capable of binding a fluorophore, the fluorescence of which is only activated or increased upon binding to the RNA aptamer. In this way, the binding of the fluorophore to the RNA aptamer generates a detectable fluorescence signal that reports that the nucleic acid has been activated by the ligand-receptor complex, ultimately reflecting the presence of the ligand in the test sample. Refer to Examples 4 and 7 by combining the following appendices Figure 46 , and read with reference to (for example) Examples 4 and 7.

[0305] In yet another aspect of the invention, there is provided a test kit for screening for the presence of a ligand in a test sample, the ligand being capable of forming a complex with a steroid hormone receptor in a cell and initiating a genomic response, the test kit comprising:

[0306] (i) a steroid hormone receptor that forms a receptor-ligand complex with the ligand from the test sample; and

[0307] (ii) a steroid hormone receptor cofactor; and

[0308] (iii) a nucleic acid response element bound by the receptor-ligand complex; and

[0309] (iv) A detection tool for detecting the binding between a receptor-ligand complex and a nucleic acid response element

[0310] Wherein, when a sample is combined with a test kit and the binding between the receptor-ligand complex and the nucleic acid sequence is detected, the presence of the ligand in the sample is determined.

[0311] In an example according to this aspect of the present invention, the relative content of the steroid hormone receptor to the nucleic acid response element in the test kit is x:1, where x is the content of the steroid hormone and is defined as [0.2 ≤ x ≤ 20]. In a related example, the relative content of the steroid hormone receptor to the nucleic acid response element in the test kit is x:1, where x is the content of the steroid hormone receptor and is defined as [0.3 ≤ x ≤ 7].

[0312] In yet another aspect of the present invention, there is provided a test kit for screening for the presence of a ligand in a test sample, the ligand being capable of forming a complex with a steroid hormone receptor in a cell and triggering a genomic response, the test kit comprising:

[0313] (i) A steroid hormone receptor that forms a receptor-ligand complex with the ligand from the test sample; and

[0314] (ii) A steroid hormone receptor cofactor; and

[0315] (iii) A nucleic acid response element bound by the receptor-ligand complex; and

[0316] (iv) A detection tool for detecting the binding between the receptor-ligand complex and the nucleic acid response element

[0317] Wherein the relative content of the steroid hormone receptor to the nucleic acid response element in the test kit is x:1, where x is the content of the steroid hormone receptor and is defined as [0.2 ≤ x ≤ 20] and

[0318] Wherein, when a sample is combined with the test kit and the binding between the receptor-ligand complex and the nucleic acid sequence is detected, the presence of the ligand in the sample is determined.

[0319] In one example, the relative content of the steroid hormone receptor to the nucleic acid response element in the test kit is x:1, where x is the content of the steroid hormone receptor and is defined as [0.3 ≤ x ≤ 7].

[0320] The test kit described herein may further comprise a steroid metabolism mechanism to facilitate the detection of ligands that are essentially inactive.

[0321] Accordingly, in a further aspect of the present invention, there is provided a test kit for screening for the presence of a ligand in a test sample, said ligand being capable of forming a complex with a steroid hormone receptor in a cell and eliciting a genomic response, said test kit comprising:

[0322] (i) a steroid hormone receptor that forms a receptor-ligand complex with the ligand from the test sample; and

[0323] (ii) a steroid hormone receptor cofactor and / or a steroid metabolism mechanism; and

[0324] (iii) a nucleic acid response element that is bound by the receptor-ligand complex; and

[0325] (iv) a detection tool for detecting the binding between the receptor-ligand complex and the nucleic acid response element

[0326] wherein, when the sample is combined with the test kit and the binding between the receptor-ligand complex and the nucleic acid sequence is detected, the presence of the ligand in the sample is determined.

[0327] In an example according to this aspect of the present invention, the relative content of the steroid hormone receptor to the nucleic acid response element in the test kit is x:1, where x is the content of the steroid hormone and is defined as [0.2 ≤ x ≤ 20]. In a related example, the relative content of the steroid hormone receptor to the nucleic acid response element in the test kit is x:1, where x is the content of the steroid hormone receptor and is defined as [0.3 ≤ x ≤ 7].

[0328] The test kit described herein may further comprise a cell-free extract.

[0329] Accordingly, in a further aspect of the present invention, there is provided a test kit for screening for the presence of a ligand in a test sample, said ligand being capable of forming a complex with a steroid hormone receptor in a cell and eliciting a genomic response, said test kit comprising:

[0330] (i) a steroid hormone receptor that forms a receptor-ligand complex with the ligand from the test sample; and

[0331] (ii) a steroid hormone receptor cofactor and / or a steroid metabolism mechanism and / or a cell-free extract; and

[0332] (iii) a nucleic acid response element that is bound by the receptor-ligand complex; and

[0333] (iv) a detection tool for detecting the binding between the receptor-ligand complex and the nucleic acid response element

[0334] Wherein, when the sample is combined with the test kit and binding between the receptor-ligand complex and the nucleic acid sequence is detected, the presence of the ligand in the sample is assayed.

[0335] In an example according to this aspect of the invention, the relative content of the steroid hormone receptor to the nucleic acid response element in the test kit is x:1, where x is the content of the steroid hormone and is defined as [0.2 ≤ x ≤ 20]. In a related example, the relative content of the steroid hormone receptor to the nucleic acid response element in the test kit is x:1, where x is the content of the steroid hormone receptor and is defined as [0.3 ≤ x ≤ 7].

[0336] In another example according to these and other aspects of the invention, the nucleic acid response element is linked to a reporter construct, and binding of the receptor-ligand complex to the nucleic acid response element is assayed by studying the transcription or translation of the reporter construct.

[0337] Thus, the test kit described herein further comprises a transcription and / or translation mechanism to obtain successful transcription and / or translation of the reporter construct.

[0338] In one example, the transcription and / or translation mechanism is provided by a nuclear or cell-free extract.

[0339] In another example, the reporter construct comprises a promoter sequence and a reporter construct, and when the nucleic acid response element is bound by the receptor-ligand complex, the promoter sequence is activated. Examples of promoters include, but are not limited to, minimal CMV, minimal pA promoter, minimal TKHSV promoter, minimal TATA-like promoter.

[0340] In yet another example, the nucleic acid response element and the promoter driving the expression of the reporter construct are operably linked.

[0341] In a related example, the nucleic acid response element and the reporter construct are contained within the same nucleic acid sequence or on different nucleic acid sequences.

[0342] In another related example, the nucleic acid response element, promoter, enhancer sequence, and reporter construct are contained within the same nucleic acid sequence or on different nucleic acid sequences, including examples where some elements are contained within the same nucleic acid sequence while other elements are contained within separate nucleic acid sequences.

[0343] Thus, the test kit, assay, and method according to the invention can be configured to detect the transcript level of the reporter construct, which is detected by studying, for example, messenger ribonucleic acid (mRNA) or complementary deoxyribonucleic acid (cDNA) levels when the test sample is combined with the assay, as a tool for screening for the presence of a ligand having steroid hormone receptor activity in the sample.

[0344] The present invention further relates to a reporter construct comprising one or more copies of an RNA aptamer sequence which, upon transcription, folds to form a structure capable of binding a fluorophore, the fluorescence of which is only revealed / activated upon binding of the RNA aptamer. Examples of such RNA aptamer / fluorophore combinations include, but are not limited to, Spinach and its associated fluorophore 3,5-difluoro-4-hydroxybenzylidene imidazolinone (DFHBI); Spinach 2 and its associated fluorophores DFHBI-1T and DFHBI-2T; iSpinach and its associated fluorophores DFHBI-1T and DFHBI-2T; Broccoli and its associated fluorophore DFHBI-1T; Corn and its associated fluorophore DFHO; Mango and its associated fluorophores derived from thiazole orange (TO; including TO-1 and TO-3); DiR2s-Apt and its associated fluorophore OTB; AptII-mini3-4c and its associated fluorophore Hoescht; DNB and its associated fluorophore RG-DN; BHQ apt (A1) and its associated fluorophore CY3-BHQ1; Red-Broccoli and its associated fluorophore DFHO; DNB and its associated fluorophores TMR-DN and SR-DN; DIR aptamer and its associated fluorophore DIR; MG aptamer and its associated fluorophore Mal Green; DIR2s-ATP and its associated fluorophore DIR-pro; SRB apt and its associated fluorophore Patent Blue (see, e.g., Bouhedda F. et al., International Journal of Molecular Sciences, 2017). Importantly, the binding interaction between the fluorophore and the RNA aptamer enhances the molecular fluorescence, although some fluorophores may have low levels of innate or background fluorescence.

[0345] Accordingly, in another aspect of the present invention, there is provided a test kit for screening for the presence of a ligand in a test sample, the ligand being capable of forming a complex with a steroid hormone receptor in a cell and eliciting a genomic response, the test kit comprising:

[0346] (i) a steroid hormone receptor that forms a receptor-ligand complex with the ligand from the test sample; and

[0347] (ii) a nucleic acid response element that is bound by the receptor-ligand complex; and

[0348] (iii) a reporter construct operably linked to the nucleic acid response element,

[0349] wherein the reporter construct is activated when the receptor-ligand complex binds to the nucleic acid response element, and

[0350] Wherein, when a sample is combined with a test kit and transcription of a reporter construct is detected, the presence of a ligand in the sample is determined.

[0351] In yet another aspect of the present invention, there is provided a test kit for screening for the presence of a ligand in a test sample, the ligand being capable of forming a complex with a steroid hormone receptor in a cell and eliciting a genomic response, the test kit comprising:

[0352] (i) A steroid hormone receptor that forms a receptor-ligand complex with a ligand from a test sample; and

[0353] (ii) A nucleic acid response element bound by the receptor-ligand complex; and

[0354] (iii) A reporter construct operably linked to the nucleic acid response element; and

[0355] (iv) A transcriptional machinery

[0356] Wherein, when the receptor-ligand complex binds to the nucleic acid response element, the reporter construct is activated, and

[0357] Wherein, when a sample is combined with a test kit and transcription of a reporter construct is detected, the presence of a ligand in the sample is determined.

[0358] According to this aspect of the present invention, as described herein, the test kit may further comprise a steroid hormone receptor cofactor, a steroid metabolism machinery, and / or a cell-free extract.

[0359] In certain instances according to this aspect of the present invention, established techniques such as quantitative polymerase chain reaction (qPCR, including real-time qPCR and reverse transcription-qPCR), or other techniques such as fluorescence based on intercalating dye detection, may be used to semi-quantitatively / quantitatively determine the level of reporter gene transcripts comprising (e.g.) mRNA or cDNA. For example, a fluorophore that binds to an RNA aptamer is used to form an RNA-fluorophore complex, as described herein. These and other techniques will be known to those skilled in the art.

[0360] Thus, in another aspect of the present invention, there is provided a test kit for screening for the presence of a ligand in a test sample, the ligand being capable of forming a complex with a steroid hormone receptor in a cell and eliciting a genomic response, the test kit comprising:

[0361] (i) A steroid hormone receptor that forms a receptor-ligand complex; and

[0362] (ii) A nucleic acid response element bound by the receptor-ligand complex; and

[0363] (iii) A reporter construct operably linked to a nucleic acid response element, wherein the reporter construct comprises at least one RNA aptamer sequence capable of binding a fluorophore

[0364] Wherein, when the receptor-ligand complex binds to the nucleic acid response element, the receptor construct is activated, and

[0365] Wherein, when a sample is combined with the test kit and fluorescence activated by the binding of the fluorophore to at least one RNA aptamer is detected, the presence of the ligand in the sample is determined.

[0366] In an example of this aspect according to the present invention, the nucleic acid response element and the reporter construct are contained on the same nucleic acid sequence. In a related example, the nucleic acid sequence containing the nucleic acid response element and the reporter construct is defined by SEQ ID NO:19 as follows:

[0367] SEQ ID NO:19

[0368] TGGAGAACAGCCTGTTCTCCATCTAGATGGAGAACAGCCTGTTCTCCATCTAGATGGAGAACAGCCTGTTCTCCATCTAGAGCCGCCCCGACTGCATCTGCGTGTTCGAATTCGCCAATGACAAGACGCTGGGCGGGGTTTGTGTCATCATAGAACTAAAGACATGCAAATATATTTCTTCCGGGGACACCGCCAGCAAACGCGAGCAACGGGCCACGGGGATGAAGCAGAAGCTTCGAATCGCGAATTCGCCCACCATGGGGAGACAGCCTACGAGCCTGAGCCTCCAGTCTTGCCATGTGTATGTGGGTACGAAGGAGAGGAGAGGAAGAGGAGAGTACCCACATACTCTGATGATCCTTCGGGATCATTCATGGCAA

[0369] In yet another example of this aspect according to the present invention, the test kit further comprises a detection tool for detecting the transcription of the reporter construct.

[0370] In an example of this aspect according to the present invention, the test kit further comprises a transcription mechanism to facilitate the transcription of the reporter construct containing the RNA aptamer.

[0371] In another example according to this aspect of the invention, the RNA aptamer is selected from Spinach, iSpinach, and Broccoli, and the fluorophore that binds to the RNA aptamer and thereby generates a fluorescent signal is 3,5-difluoro-4-hydroxybenzylidene imidazolinone (DFHBI).

[0372] In another example according to this aspect of the invention, the RNA aptamer is Mango, and the fluorophore that binds to the RNA aptamer and thereby generates a fluorescent signal is thiazole orange (TO).

[0373] In yet another example according to these and other aspects of the invention, the reporter construct comprises a single sequence copy of the RNA aptamer, or multiple sequence copies of the RNA aptamer, e.g., two, three, four, five, six, etc. copies of the sequence encoding the RNA aptamer. Those skilled in the art will recognize that the copy number of the RNA aptamer sequence is controlled by the optimal signal-to-noise ratio, as determined by routine optimization studies. In yet another example, the reporter construct comprises four copies of the RNA aptamer sequence iSpinach, sometimes referred to in the art as "4×Spinach". The DNA sequence (SEQ ID NO:17) encoding the RNA aptamer iSpinach is as follows:

[0374] SEQ ID NO:17

[0375] AGGAGTACGGTGAGGGTCGGGTCCAGTAGGTACGCCTACTGTTGAGTAGAGTGTGGGCTCCGTACTCCC

[0376] The DNA template sequence for engineering 4×Spinach of the reporter construct / assay prototype described in Example 7 is well documented in the art.

[0377] Alternatively, the assay can be configured to detect the protein expression level of the reporter construct when the test sample is combined with the assay, as a tool for screening for the presence of a ligand in the sample that has the ability to bind to a steroid hormone receptor in a cell and trigger a genomic response.

[0378] Thus, in yet another aspect of the invention, there is provided a test kit for screening for the presence of a ligand in a test sample, the ligand being capable of forming a complex with a steroid hormone receptor in a cell and triggering a genomic response, the test kit comprising:

[0379] (i) a steroid hormone receptor that forms a receptor-ligand complex with the ligand from the test sample; and

[0380] (ii) a nucleic acid response element that is bound by the receptor-ligand complex; and

[0381] (iii) A reporter construct operably linked to a nucleic acid sequence

[0382] wherein the reporter construct is activated when the receptor-ligand complex binds to the nucleic acid response element, and

[0383] wherein the presence of the ligand in the sample is determined when the test sample is combined with the test kit and transcription of the reporter construct is detected.

[0384] In a further aspect of the present invention, there is provided a test kit for screening for the presence of a ligand in a test sample, the ligand being capable of forming a complex with a steroid hormone receptor in a cell and eliciting a genomic response, the test kit comprising:

[0385] (i) A hormone receptor that forms a receptor-ligand complex with the ligand from the test sample; and

[0386] (ii) A nucleic acid response element that is bound by the receptor-ligand complex; and

[0387] (iii) A reporter construct operably linked to a nucleic acid sequence; and

[0388] (iv) Transcription and translation machinery

[0389] wherein the reporter construct is activated when the receptor-ligand complex binds to the nucleic acid response element, and

[0390] wherein the presence of the ligand in the sample is determined when the sample is combined with the test kit and translation of the reporter construct is detected.

[0391] According to this aspect of the present invention, the test kit may further comprise a steroid hormone receptor cofactor and / or a steroid metabolism machinery and / or a cell-free extract as described herein.

[0392] Again, detecting the gene expression level based on the translation of the reporter construct will depend on the nature of the reporter marker used. For example, the reporter construct may include a gene encoding a fluorescent protein, such as green fluorescent protein (GFP), red fluorescent protein (RFP), orange fluorescent protein, etc., and spectroscopic-based methods known to those skilled in the art can be used to detect and semi-quantify / quantify the fluorescent gene product. Alternatively, there are well-established methods for (e.g.) β-galactosidase (LacZ) and β-glucuronidase (GUS), luciferase detection, so the reporter constructs used in the test kits, assays and methods according to the present invention can be engineered to include genes encoding these gene products.

[0393] Binding Figures 1-6, as read by 33 and 34, Examples 2 and 5 describe test kits / assays according to this aspect of the invention.

[0394] In yet another aspect of the invention, there is provided a test kit for screening for the presence of a ligand in a test sample, the ligand being capable of forming a complex with a steroid hormone receptor in a cell and eliciting a genomic response, the test kit comprising:

[0395] (i) a steroid hormone receptor that forms a receptor-ligand complex with the ligand from the test sample; and

[0396] (ii) a nucleic acid response element that is bound by the receptor-ligand complex; and

[0397] (iii) a detection tool for detecting the binding between the receptor-ligand complex and the nucleic acid response element

[0398] wherein, when the sample is combined with the test kit and the binding between the receptor-ligand complex and the nucleic acid response element is detected, the presence of the ligand in the sample is determined.

[0399] According to this aspect of the invention, the test kit may further comprise a steroid hormone receptor cofactor and / or a steroid metabolism mechanism and / or a transcription and / or translation mechanism and / or a cell-free extract as described herein.

[0400] Also according to this aspect of the invention, the binding interaction between the nucleic acid response element and the activated hormone receptor / receptor-ligand complex is measured directly. Many techniques can be used to detect the direct binding interaction, including but not limited to optical methods, spectroscopy, visible spectroscopy, Raman spectroscopy, UV spectroscopy, surface plasmon resonance, electrochemical methods, impedance, resistance, capacitance, mechanical sensing due to mass changes, changes in mechanical resonance, electrophoresis, gel electrophoresis, gel retardation, imaging, fluorescence, and fluorescence resonance energy transfer.

[0401] In another example of the invention, the hormone receptor is selected from androgen receptor, estrogen receptor, including estrogen receptor α (ER-α) and estrogen receptor β (ER-β), progesterone receptor, including progesterone receptor A (PRA) and progesterone receptor B (PRB), mineralocorticoid receptor, and glucocorticoid receptor.

[0402] Thus, in other aspects of the invention, there is provided a test kit for screening for the presence of a ligand in a test sample, the ligand being capable of forming a complex with a steroid hormone receptor in a cell and eliciting a genomic response, the test kit comprising:

[0403] (i) an androgen receptor that forms a receptor-ligand complex with the ligand from the test sample; or

[0404] (ii) An estrogen receptor that forms a receptor-ligand complex with a ligand from a test sample, wherein the estrogen receptor is estrogen receptor α or estrogen receptor β; or

[0405] (iii) A progesterone receptor that forms a receptor-ligand complex with a ligand from a test sample, wherein the progesterone receptor is progesterone receptor A or progesterone receptor B; or

[0406] (iv) A mineralocorticoid receptor that forms a receptor-ligand complex with a ligand from a test sample; or

[0407] (v) A glucocorticoid receptor that forms a receptor-ligand complex with a ligand from a test sample; and

[0408] (vi) A nucleic acid response element that is bound by the receptor-ligand complex defined in any one of (i) to (v) above; and

[0409] (vii) A detection tool for detecting the binding between the receptor-ligand complex and the nucleic acid response element

[0410] Wherein, when the sample is combined with the test kit and the binding between the receptor-ligand complex and the nucleic acid sequence is detected, the presence of the ligand in the test sample is determined.

[0411] In a further aspect of the present invention, there is provided a test kit for screening for the presence of a ligand in a test sample, the ligand being capable of forming a complex with a steroid hormone receptor in a cell and triggering a genomic response, the test kit comprising:

[0412] (i) An androgen receptor that forms a receptor-ligand complex with a ligand from a test sample; or

[0413] (ii) An estrogen receptor that forms a receptor-ligand complex with a ligand from a test sample, wherein the estrogen receptor is estrogen receptor α or estrogen receptor β; or

[0414] (iii) A progesterone receptor that forms a receptor-ligand complex with a ligand from a test sample, wherein the progesterone receptor is progesterone receptor A or progesterone receptor B; or

[0415] (iv) A mineralocorticoid receptor that forms a receptor-ligand complex with a ligand from a test sample; or

[0416] (v) A glucocorticoid receptor that forms a receptor-ligand complex with a ligand from a test sample; and

[0417] (vi) A nucleic acid response element that is bound by the receptor-ligand complex defined in any one of (i) to (v) above; and

[0418] (vii) Detection tools for detecting the binding between receptor-ligand complexes and nucleic acid response elements; and

[0419] (viii) Steroid hormone receptor cofactors, steroid metabolism machinery, transcription and / or translation machinery and / or cell-free extracts as described herein

[0420] Wherein, when a sample is combined with a test kit and the binding between the receptor-ligand complex and the nucleic acid sequence is detected, the presence of the ligand in the test sample is determined.

[0421] In an example of these aspects according to the present invention, the nucleic acid response element is selected from an androgen response element, an estrogen response element, a progesterone response element, a mineralocorticoid response element or a glucocorticoid element, depending on the nature of the sample to be tested and also depending on the possible group of ligands to be studied.

[0422] In another example, the androgen response element contains a DNA binding motif that selectively binds to the activated androgen receptor. In a related example, the DNA binding motif binds to a dimer of the ligand-bound androgen receptor (i.e., (AR-L)2; where "AR" is the androgen receptor and "L" is the ligand). In yet another related example, the DNA binding motif contains a dyad symmetry palindrome to form binding specificity between the activated androgen receptor and the related response element.

[0423] In yet another example, the estrogen response element contains a DNA binding motif that selectively binds to the activated estrogen receptor. In a related example, the DNA binding motif binds to a dimer of the ligand-bound estrogen receptor (i.e., (ER-L)2; where "ER" is an estrogen receptor selected from ER-α or ER-β). In yet another related example, the DNA binding motif contains a dyad symmetry palindrome to form binding specificity between the activated estrogen receptor and the related response element.

[0424] In yet another example, the progesterone response element contains a DNA binding motif that selectively binds to the activated progesterone receptor. In a related example, the DNA binding motif binds to a dimer of the ligand-bound progesterone receptor (i.e., (PR-L)2; where "PR" is an estrogen receptor selected from PRA or PRB). In yet another related example, the DNA binding motif contains a dyad symmetry palindrome to form binding specificity between the activated progesterone receptor and the related response element.

[0425] In yet another example, the mineralocorticoid response element contains a DNA binding motif that selectively binds to the activated mineralocorticoid receptor. In a related example, the DNA binding motif binds to a dimer of the ligand-bound mineralocorticoid receptor (i.e., (MR-L)2; where "MR" is the mineralocorticoid). In yet another related example, the DNA binding motif contains a dyad symmetry palindrome to form binding specificity between the activated mineralocorticoid receptor and the related response element.

[0426] In yet another example, the glucocorticoid response element contains a DNA binding motif that selectively binds to the activated glucocorticoid receptor. In a related example, the DNA binding motif binds to a dimer of the ligand-bound glucocorticoid receptor (i.e., (GR-L)2; where "GR" is the glucocorticoid). In yet another related example, the DNA binding motif contains a dyad symmetry palindrome to form binding specificity between the activated glucocorticoid receptor and the related response element.

[0427] In yet another example of these and other aspects of the present invention, the relative content of the steroid hormone receptor to the nucleic acid response element in the test kit is x:1, where x is the content of the steroid hormone and is defined as [0.2 ≤ x ≤ 20]. In a related example, the relative content of the steroid hormone receptor to the nucleic acid response element in the test kit is x:1, where x is the content of the steroid hormone receptor and is defined as [0.3 ≤ x ≤ 7].

[0428] Thus, in yet another aspect of the present invention, there is provided a test kit for screening for the presence of a ligand in a test sample, the ligand being capable of forming a complex with a steroid hormone receptor in a cell and triggering a genomic response, the test kit comprising:

[0429] (i) A hormone receptor that forms a receptor-ligand complex with the ligand from the test sample; and

[0430] (ii) A nucleic acid response element bound by the receptor-ligand complex; and

[0431] (iii) A detection tool for detecting the binding between the receptor-ligand complex and the nucleic acid response element

[0432] wherein the relative content of the steroid hormone receptor to the nucleic acid response element in the test kit is x:1, where x is the content of the steroid hormone receptor and is defined as [0.2 ≤ x ≤ 20], and

[0433] wherein when the sample is combined with the test kit and the binding between the receptor-ligand complex and the nucleic acid response is detected, the presence of the ligand in the sample is determined.

[0434] In an example according to this aspect of the invention, the relative content of the steroid hormone receptor to the nucleic acid response element in the test kit is x:1, where x is the content of the steroid hormone receptor and is defined as [0.3 ≤ x ≤ 7].

[0435] According to this aspect of the invention, the test kit may further comprise a steroid hormone receptor cofactor, a steroid metabolism mechanism, a transcription and / or translation mechanism, and / or a cell-free extract as described herein.

[0436] Although the assays according to the invention describe a system in which the response element comprises a palindromic sequence that only recognizes and selectively binds to a dimeric hormone receptor-ligand complex (i.e., (HR-L)2), the invention further contemplates other types of protein / nucleic acid binding interactions between the activated hormone receptor and the response element. For example, non-(HR-L)2 complexes, such as (HR-L)1, (HR-L)3 can be configured to bind various response elements, or according to the assay design and functionality, bind to the activated hormone receptor, where there are two ligands binding to one receptor (e.g., HR-(L)2), or multiple receptors binding to a single ligand (e.g., (HR)2-L) or multiple receptors binding to multiple ligands (e.g., (HR)3-(L)2), etc., all of which can selectively bind to the DNA motif within the response element and activate the genomic response based on the promoter / enhancer structure.

[0437] Those skilled in the art will recognize that the test kits, assays, and methods of the invention may include one or more receptor types that, when activated by ligand binding, are capable of forming (e.g.) homodimers or heterodimers (or indeed any other ligand-receptor complex structure). By way of illustration only, in the case of detecting estrogen and estrogen-like steroids, or non-steroid hormones, the test kits, assays, and methods may comprise a mixture of both estrogen receptor α (ER-α) and estrogen receptor β (ER-β) receptors, which when activated by a steroid ligand such as estradiol, can form (e.g.) homodimers of ER-α or ER-β (i.e., (ER-α)-(ER-α); or (ER-β)-(ER-β)) or heterodimers of ER-α and ER-β (i.e., (ER-α)-(ER-β); or (ER-β)-(ER-α)). Similarly, in the case of detecting progesterone and progesterone-like steroids or non-steroid hormones, the test kits, assays, and methods may comprise a mixture of both progesterone receptor A (PRA) and progesterone receptor B (PRB), which when activated by a steroid ligand such as progesterone, can form (e.g.) homodimers of PRA or PRB (i.e., PRA-PRA or PRB-PRB), or heterodimers of PRA and PRB (i.e., PRA-PRB or PRB-PRA).

[0438] In another example of the invention, steroid hormone receptors are purified from cells or produced from cell-based hormone receptors by recombinant cloning, expression, and purification.

[0439] In yet another example of the invention, the hormone receptor is synthetic and its synthesis is modeled (i) on an endogenous cell-based hormone receptor or (ii) on an engineered form of an endogenous cell-based hormone receptor, where the receptor has been engineered (e.g.) to improve the binding kinetics of the ligand to its receptor to improve assay sensitivity or (e.g.) the receptor has been engineered with a peptide handle for immobilization on a substrate or solid support to facilitate the conduct of the assay. By way of illustration only, those skilled in the art will understand that the androgen receptor has five distinct domains (nominally domains A / B, C, D, E, and F) and any one of these domains can be mutated to engineer the receptor to be more or less sensitive to ligand binding. The domains of other hormone receptors will be known to those skilled in the art of steroid hormone detection and can be engineered in detail.

[0440] Those skilled in the art will recognize that modifications of steroid hormone receptors (or any other test kit / assay component), such as those described just above, can be engineered by synthetic and recombinant means.

[0441] Those skilled in the art will also recognize that any steroid hormone receptor can be used in the test kits, assays, and methods of the invention so long as it retains the ability to bind the target ligand for detection and is activated by the target ligand for detection. This includes steroid hormone receptors in endogenous cell-based forms as well as recombinant forms and includes recombinant hormone receptors engineered for increased or decreased ligand affinity.

[0442] Thus, the test kits, assays, and methods according to the invention can be configured to screen / detect any ligand that elicits a steroid response. However, those skilled in the art will recognize that, according to the various assay concepts described herein, the detection of different hormone classes (i.e., ligands) will require that the format of the test kits, assays, and methods must be properly configured and optimized. For example, the detection of ligands that bind and activate the androgen receptor (such as testosterone and other testosterone-like hormones) will require a test kit / assay that includes the androgen receptor and an androgen response element that can bind the activated androgen receptor complex.

[0443] In an example of the invention, the androgen response element is a nucleic acid sequence that includes one or more of the sequences listed below:

[0444] SEQ ID NO:1

[0445] Androgen response element; sense strand

[0446] GGTACAnnnTGTTCT, where n is any nucleotide; or

[0447] SEQ ID NO:2

[0448] Androgen response element; antisense strand

[0449] CCATGTnnnACAAGA, where n is any nucleotide.

[0450] Similarly, the detection of ligands that bind to and activate estrogen receptors (such as estradiol, estrone, other estrogen-like steroid hormones, and non-steroidal estrogen receptor modulators) requires a test kit / assay that includes estrogen receptor α (ER-α) or estrogen receptor β (ER-β) and an estrogen response element that can bind to the activated estrogen receptor complex.

[0451] In another example of the present invention, the estrogen response element is a nucleic acid sequence that includes one or more of the following sequences:

[0452] SEQ ID NO:3

[0453] ER-α response element; sense strand

[0454] AGGTCAnnnTGACCT, where n is any nucleotide; or

[0455] SEQ ID NO:4

[0456] ER-α response element; antisense strand

[0457] TCCAGTnnnACTGGA, where n is any nucleotide; or

[0458] SEQ ID NO:5

[0459] ER-β response element; sense strand

[0460] AGGTCAnnnTGACCT, where n is any nucleotide; or

[0461] SEQ ID NO:6

[0462] ER-β response element; antisense strand

[0463] TCCAGTnnnACTGGA, where n is any nucleotide.

[0464] Similarly, the detection of ligands that bind to and activate progesterone receptors (such as progesterone and other progesterone-like hormones) requires a test kit / assay that includes progesterone receptor A (PRA) or progesterone receptor B (PRB) and a nucleic acid based on a progesterone response element that can bind to the activated progesterone receptor.

[0465] In yet another example of the present invention, the progesterone response element is a nucleic acid sequence comprising one or more of the sequences listed below:

[0466] SEQ ID NO: 7

[0467] PRA response element; sense strand

[0468] AGAACAnnnTGTTCT, where n is any nucleotide; or

[0469] SEQ ID NO:8

[0470] PRA response element; antisense strand

[0471] TCTTGTnnnACAAGA, where n is any nucleotide.

[0472] SEQ ID NO: 9

[0473] PRB response element; sense strand

[0474] AGAACAnnnTGTTCT, where n is any nucleotide; or

[0475] SEQID NO:10

[0476] PRB response element; antisense strand

[0477] TCTTGTnnnACAAGA, where n is any nucleotide.

[0478] Similarly, the detection of ligands that bind and activate the mineralocorticoid receptor (such as aldosterone and other aldosterone-like hormones or non-steroidal mineralocorticoid receptor modulators) requires a test kit / assay comprising a mineralocorticoid receptor and a nucleic acid based on a mineralocorticoid response element that can bind the activated mineralocorticoid receptor.

[0479] In yet another example of the present invention, the mineralocorticoid response element is a nucleic acid sequence comprising one or more of the sequences listed below:

[0480] SEQ ID NO:11

[0481] Mineralocorticoid response element; sense strand

[0482] AGAACAnnnTGTTCT, where n is any nucleotide; or

[0483] SEQ ID NO:12

[0484] Mineralocorticoid response element; antisense strand

[0485] TCTTGTnnnACAAGA, where n is any nucleotide.

[0486] Similarly, the detection of ligands that bind and activate the glucocorticoid receptor (such as cortisol and other cortisol-like hormones or non-steroidal glucocorticoid receptor modulators) requires a test kit / assay that includes the glucocorticoid receptor and a nucleic acid based on a glucocorticoid response element that can bind the activated glucocorticoid receptor.

[0487] In yet another example of the present invention, the glucocorticoid response element is a nucleic acid sequence comprising one or more of the sequences listed below:

[0488] SEQ ID NO: 13

[0489] Glucocorticoid response element; sense strand

[0490] AGAACAnnnTGTTCT, where n is any nucleotide; or

[0491] SEQ ID NO: 14

[0492] Glucocorticoid response element; antisense strand

[0493] TCTTGTnnnACAAGA, where n is any nucleotide.

[0494] As previously described, the various response elements include binding motifs configured to selectively bind the activated ligand-receptor complex. For example, each of the androgen, estrogen, progesterone, mineralocorticoid, and glucocorticoid response elements contains a palindromic dihexamer sequence that contributes to the binding of the dimerized ligand receptor complex (i.e., (HR-L)2) to the response element in its secondary structure orientation.

[0495] The test kits, assays, and methods described herein may further include translation and / or transcription machinery, one or more steroid hormone receptor cofactors, including but not limited to heat shock proteins, and / or buffers to enhance the functionality and / or sensitivity of the test kits, assays, and methods described herein.

[0496] In one example, the steroid hormone receptor cofactors according to the present invention include, but are not limited to, heat shock protein 70, heat shock protein 40, heat shock protein 90, p23, heat shock protein-organizing protein (Hop), 48kD Hip protein, p60, and FKBP52.

[0497] The present invention further relates to the detection of one or more physiologically inactive ligands from a test sample, which ligands are ultimately capable of activating a steroid hormone receptor when converted to a physiologically active form. Accordingly, the test kits, assays and methods described herein further comprise a steroid metabolism mechanism capable of processing the ligand in a manner that activates the corresponding steroid hormone receptor. Thus, it becomes possible to detect physiologically inactive ligands (e.g., prohormones) from a sample such as a nutritional supplement.

[0498] Accordingly, in a further aspect of the present invention, there is provided a test kit for screening for the presence of a ligand in a test sample, which ligand is capable of forming a complex with a steroid hormone receptor in a cell and eliciting a genomic response, the test kit comprising:

[0499] (i) a steroid hormone receptor that forms a receptor-ligand complex with the ligand from the test sample; and

[0500] (ii) a nucleic acid response element that is bound by the receptor-ligand complex; and

[0501] (iii) a detection means for detecting the binding between the receptor-ligand complex and the nucleic acid response element; and

[0502] (iv) a steroid hormone receptor cofactor, transcription and / or translation machinery, steroid metabolism machinery and / or cell-free extract

[0503] wherein the presence of the ligand in the sample is determined when the sample is combined with the test kit and binding between the receptor-ligand complex and the nucleic acid sequence is detected.

[0504] In an example according to this aspect of the present invention, the relative content of the steroid hormone receptor to the nucleic acid response element in the test kit is x:1, where x is the content of the steroid hormone and is defined as [0.2 ≤ x ≤ 20]. In a related example, the relative content of the steroid hormone receptor to the nucleic acid response element in the test kit is x:1, where x is the content of the steroid hormone receptor and is defined as [0.3 ≤ x ≤ 7].

[0505] In certain examples, the steroid hormone receptor cofactor, translation and / or transcription machinery and / or steroid metabolism machinery may be derived from one or more cell-free extracts as defined herein.

[0506] In another example, the test sample is a biological sample. In a related example, the biological sample is a body fluid sample, including but not limited to, blood, plasma, serum, saliva, interstitial fluid, semen and urine.

[0507] In another instance, the test sample is sourced from an animal, including but not limited to, equine, canine, camelid, bovine, porcine, ovine, caprine, avian, simian, murine, lagomorph, cervid, fish, salmonid, primate, ape, and human animals.

[0508] In another instance, the test sample is a non-biological sample. In related instances, non-biological samples include, but are not limited to, liquid samples including water, soil samples, fabric samples including but not limited to plastics, mineral samples, food samples, and pharmaceuticals.

[0509] Examples of food samples include, but are not limited to, vegetables, meats, beverages, supplements, and herbal extracts.

[0510] Examples of pharmaceuticals include, but are not limited to, medicines, tonics, syrups, pills, lozenges, creams, sprays, and gels.

[0511] Designer steroids and non-steroidal anabolic drugs pose a significant and increasing challenge to anti-doping laboratories. Tetrahydrogestrinone and madol were first detected and identified in the early 2000s, but the threat posed by designer anabolic drugs has rapidly increased to include many potential agents. These synthetically derived anabolic drugs are designed to circumvent detection or legal controls regarding manufacture and supply, and many are sold on the internet as so-called "supplements".

[0512] Mass spectrometry remains the primary technique for identifying known illicit steroid hormones and non-steroidal anabolic drugs in biological samples and / or supplements. Despite its sensitivity and specificity, mass spectrometry is still limited because it requires prior knowledge of the chemical structure of the steroid and non-steroidal anabolic drugs for detection. In addition, mass spectrometry cannot provide information on the biological activity of the detected anabolic drugs and cannot distinguish between bioactive and inactive molecules. This is the information required for the legal prosecution of athletes, coaches, trainers, managers, and manufacturers.

[0513] In recent years, in vitro androgen bioassays based on yeast and mammalian cells have been used to detect the presence of novel synthetic androgens, progestogens, and the androgenic potential of androgens, pro-androgens, designer androgens, and designer non-steroidal anabolic drugs in supplements. However, these assays suffer from limitations related to molecular complexity, as described elsewhere in this article, and inherently require molecular and microbiological technical skills, which are time-consuming, laborious, and expensive. Therefore, it is not feasible to consider including these assays in their current form in routine screening. In other words, the yeast- and mammalian cell-based assays have significant limitations because they are not high-throughput or cost-effective.

[0514] Advantageously, the present invention provides activity-based test kits, assays, and methods that operate substantially according to the principle of steroid hormone receptor activation. By detecting the activation of steroid hormone receptors by ligands present in a test sample, the present invention provides cell-free test kits, assays, and methods that do not rely on knowledge of the structure of the ligand being studied, can readily distinguish the presence of bioactive and inactive ligands, and provide an economically efficient, reliable, and reproducible system that can be performed without complex laboratory equipment or specific expertise.

[0515] Thus, in an example of the test kits, assays, and methods described herein, the ligand is a performance-enhancing designer drug and / or steroid.

[0516] In another example of the test kits, assays, and methods described herein, the ligand has an unknown chemical structure.

[0517] In yet another example of the test kits, assays, and methods described herein, the ligand has a previously unknown chemical structure.

[0518] The present invention also relates to an assay method based on the test kits described herein.

[0519] Thus, in yet another aspect of the present invention, there is provided an assay method for screening for the presence of a ligand in a test sample, the ligand being capable of forming a complex with a steroid hormone receptor in a cell and eliciting a genomic response, the assay method comprising the steps of:

[0520] (i) providing an assay reagent comprising

[0521] (a) a steroid hormone receptor that forms a receptor-ligand complex with a ligand from the test sample; and

[0522] (b) a nucleic acid sequence that is bound by the receptor-ligand complex; and

[0523] (c) a detection tool for detecting the binding between the receptor-ligand complex and the nucleic acid sequence; and

[0524] (ii) combining the test sample with the assay reagent,

[0525] wherein the presence of the ligand in the sample is determined when the test sample is combined with the assay reagent and binding between the receptor-ligand complex and the nucleic acid sequence is detected.

[0526] According to this aspect of the invention, the relative content of the steroid hormone receptor and the nucleic acid response element in (ii) can be x:1, where x is the content of the steroid hormone and is defined as [0.2 ≤ x ≤ 20]. In a related example, the relative content of the steroid hormone receptor and the nucleic acid response element in the test kit is x:1, where x is the content of the steroid hormone receptor and is defined as [0.3 ≤ x ≤ 7].

[0527] According to this aspect of the invention, the test kit can further comprise a steroid hormone receptor cofactor, a steroid metabolism mechanism, a transcription and / or translation mechanism, and / or a cell-free extract as described herein.

[0528] According to the method described herein, the test result can be compared with a reference threshold to determine the absolute level of the signal generated by the ligand present in the test sample. In fact, the applicant has observed non-specific binding and / or activation of the response element caused by binding of non-ligand receptors (e.g., Figure 32 ). Thus, in cases where semi-quantitative analysis is desired for any given test sample, the assays and methods described herein can be performed in the absence of the test sample to first establish a reference threshold (e.g., in the presence of ethanol acting as a negative control). The assay results obtained from the test sample can then be compared with the reference threshold to determine the absolute activity attributable to the ligand present in the sample using simple subtraction.

[0529] The invention further relates to the use of the assays and test kits described herein to determine the potency of a test compound relative to a reference compound. According to the invention, the term "relative potency" is defined as the multiplication of the biological activity of the test compound relative to the reference compound, as determined by normalizing the biological activity of the test compound to the reference compound.

[0530] The biological activity of the test compound and the reference compound can be determined using EC 50 or the compound concentration at which half of the maximum response is obtained from the dose-response curve of the specific compound. The dose-response curve is generated by serially diluting the compound and measuring its steroid hormone receptor binding / activation profile. Then, a plot of the measured activity (e.g., measured by fluorescence, absorbance, chemiluminescence, etc.) versus the compound concentration (i.e., the concentration range optimally presented on a logarithmic scale generated by the serial dilution of the compound) is made.

[0531] To further illustrate the concept of relative potency, Figure 44 an example measurement and calculation of relative potency is given. The androgen receptor binding / activation activity of testosterone (T; reference) is compared with dihydrotestosterone (DHT; test compound), where the measured EC 50 value is 4.08×10 -9 (T) and 1.74×10-9 (DHT). By converting the EC of T 50 Value EC for DHT 50 The value was standardized (i.e. 4.08×10 -9 / 1.74×10 -9 ) to determine relative potency, yielding a relative potency of ~2.3. In other words, in this experiment, dihydrotestosterone is 2.3 times more potent than testosterone in binding to and activating its target androgen receptor.

[0532] Those skilled in the art will recognize that the relative potency of a test compound is measured relative to the reference compound used. In other words, the relative potency of a test compound is likely to be different depending on the reference compound to which it is normalized.

[0533] In the case of relative potency>1, the test compound causes a higher measured biological activity in the assay compared to the reference compound. In the case of relative potency<1, the test compound produces a lower measured biological activity in the assay compared to the reference compound. In the case of relative potency=1, the test compound and the reference compound produce equal biological activity in the assay.

[0534] Relative potency can also be used to determine the activation factor of the test compound being studied. As described herein, the activation factor relates to the relative potency of the test compound measured in yeast cells or using a yeast cell extract (i.e., it does not contain a metabolic mechanism) and the relative potency of the same test compound measured in mammalian cells or using a mammalian cell extract (i.e., it includes a metabolic mechanism), as a measurement of relative activation between two states of the test compound. An activation factor > 1 indicates that the test compound has undergone metabolic conversion to a more physiologically active state in the presence of the metabolic mechanism being measured.

[0535] To further illustrate this point, Applicants determined the EC values ​​of the known androgenic anabolic steroid "Jungle Warfare" for dihydrotestosterone in yeast and human cell lines as shown in Table II below: 50 and relative effectiveness.

[0536] Table II: Relative potency and activation factors of Jungle Warfare and BMS-564929 (known SARMs)

[0537]

[0538] The activation factor is calculated by dividing the relative potency measured in mammalian cells (i.e., containing a metabolic machinery capable of converting androgens from a physiologically inactive to a physiologically active form, from a less physiologically active to a more physiologically active form, from a more physiologically active form to a less physiologically active form, or from a physiologically active form to a physiologically inactive form) by the relative potency measured in yeast cells (i.e., without a metabolic machinery). This yields an AF of ~40 (i.e., AF = RP(mammal) / RP(yeast)), which in this example and considering the EC 50 value indicates the presence of "Jungle Warfare" as a physiologically active supplement that, upon metabolism, is converted to a form that is more physiologically active than DHT, which is the reference compound against which this activity is normalized for the purposes of these calculations.

[0539] In yet another example, the applicant determined the EC 50 and relative potency of a known selective androgen receptor molecule (SARM) with the designated classification of BMS-564929. This SARM had previously been detected in racehorses and humans. As determined by its relative potency in yeast relative to DHT (i.e., without a metabolic machinery), BMS-546929 had a very low relative potency value of approximately 5×10 -4 . However, when measuring the EC 50 value of BMS-546929 in HuH7 cells in which BMS-546929 is metabolized, it becomes a much more potent androgen, having an RP relative to DHT of ~60% (i.e., 0.607). Thus, its activation factor of >1200 reflects that BMS-546929 is converted from an inactive selective androgen receptor modulator to an active selective androgen receptor modulator upon metabolism.

[0540] These data emphasize the activating power of metabolism in the study of certain compounds / ligands, and the importance of optionally including a metabolic machinery capable of metabolizing the compound / ligand from the sample under study (i.e., converting the compound / ligand from a physiologically inactive form to a physiologically active form, from a physiologically active form to a more physiologically active form, from a more physiologically active form to a less physiologically active form, or from a physiologically active form to a physiologically inactive form). In the absence of this feature, the assay system may not always be reliable in detecting prodrug / non-metabolized forms such as, for example, designed drugs, which may otherwise evade detection.

[0541] In yet another aspect of the present invention, there is provided an assay method for screening for the presence of a ligand in a test sample, the ligand being capable of forming a complex with a steroid hormone receptor in a cell and eliciting a genomic response, the assay method comprising the steps:

[0542] (i) Provide a determination reagent, which comprises:

[0543] a. A steroid hormone receptor that forms a receptor-ligand complex with a ligand from a test sample; and

[0544] b. A nucleic acid response element bound by the receptor-ligand complex; and

[0545] c. A detection tool for detecting the binding between the receptor-ligand complex and the nucleic acid response element; and

[0546] (ii) Combine the test sample with the determination reagent,

[0547] wherein the relative content of the steroid hormone receptor to the nucleic acid response element in (ii) can be x:1, where x is the content of the steroid hormone and is defined as [0.2 ≤ x ≤ 20], and

[0548] wherein when the sample is combined with the determination reagent and the binding between the receptor-ligand complex and the nucleic acid response element is detected, the presence of the ligand in the sample is determined.

[0549] In one example, the relative content of the steroid hormone receptor to the nucleic acid response element in the test kit is x:1, where x is the content of the steroid hormone receptor and is defined as [0.3 ≤ x ≤ 7].

[0550] In certain examples, the invention described herein has utility in detecting performance-enhancing prodrugs / drugs (e.g., anabolic steroids and selective androgen receptor modulators) in humans and non-human athletes (including racehorses, camels, and dogs).

[0551] Accordingly, in another aspect of the present invention, there is provided a method for determining the doping status of an athlete, the method comprising combining a test sample obtained from the athlete with the test kit described herein.

[0552] In an example according to this aspect of the present invention, the test sample obtained from the athlete is a serum or plasma sample.

[0553] In yet another aspect of the present invention, there is provided a manufactured article for screening for the presence of a ligand in a test sample, the ligand being capable of activating a steroid hormone receptor in a cell and eliciting a genomic response, the manufactured article comprising the test kit described herein and instructions on how to detect the presence of the ligand in the sample.

[0554] In yet another aspect of the invention, there is provided a manufactured article for determining an athlete's doping agent, the manufactured article comprising a test kit as described herein and instructions for detecting the presence of a ligand in a sample derived from an athlete, wherein the presence of the ligand in the sample indicates that the athlete has taken a doping agent.

[0555] Finally, the invention further relates to the use of the test kits, assays and methods described herein for detecting antagonists of a target ligand by screening for compounds in a target sample that prevent a ligand from binding to its steroid hormone receptor such that it no longer activates the receptor and elicits a genomic response.

[0556] This is particularly useful when screening for antagonists that block steroid hormone receptor activation (for example) as potential therapeutic agents for treating endocrine and non-endocrine cancers. For example, the activity-based test kits, methods and assays according to the invention that comprise one or more estrogen receptors can be used to screen for the presence of antagonists of estrogen receptor activation in a breast cancer tissue in a compound library.

[0557] ***

[0558] The invention is further described with reference to the following examples. It will be appreciated that the claimed invention is not intended to be limited in any way by these examples. Examples

[0559] The following information and data demonstrate various prototype assays related to the detection of ligands that bind and activate androgen receptors, which receptors include (for example) testosterone and dihydrotestosterone. These examples are used to illustrate the activity assay platform described and claimed herein, wherein the analytical concepts and principles exemplified by the detection of androgen ligands will apply equally to the detection of other target receptor ligands, including but not limited to, ligands that bind estrogen receptors including estradiol, ligands that bind progesterone receptors including progesterone, ligands that bind mineralocorticoid receptors, and ligands that bind glucocorticoid receptors.

[0560] Example 1

[0561] Determination Concept Overview

[0562] 1.1 IVT platform

[0563] The main components of the IVT platform include an androgen response element (ARE) enhancer-driven minimal promoter DNA template, a recombinant androgen receptor (AR), a cell- or nuclear-extract containing the transcriptional machinery, and a transcriptional or transcription / translation buffer that allows RNA synthesis or synthesis of both RNA and protein. The minimal promoter will drive the synthesis of RNA molecules and the basal level of subsequent protein. Activation of transcription by the ligand-activated AR that binds to the ARE / enhancer will increase the amount of RNA molecule synthesis and protein level.

[0564] Androgen Response Element (ARE)

[0565] The androgen response elements tested in these experiments included:

[0566] 1. Mouse mammary tumor virus (MMTV), a response element that strongly transcribes in response to steroid hormones

[0567] 2. Enhancer / ARE - Due to the enhancer region, this is more specific for AR. The consensus ARE DNA sequence shows high homology with the response elements of the glucocorticoid receptor (GR), mineralocorticoid receptor (MR), and progesterone receptor (PR). To increase the specificity of ARE for androgens, the adjacent androgen - specific enhancer region was used.

[0568] Androgen Receptor (AR)

[0569] - Commercial recombinant androgen receptor (AR) was tested from independent commercial sources including AR obtained from both Abcam and Sigma - Aldrich.

[0570] Cell or Nuclear Extract

[0571] The cell - or nuclear - extracts tested included commercial HeLa (cervical cancer cell line) extract, internally generated HeLa cell extract, internally generated PC - 3 (prostate cancer cell line) extract, internally generated HEK293 (kidney) extract, and internally generated HuH7 (human hepatocyte cell line) extract.

[0572] 1.2 Description of ARE - mediated transcription / translation

[0573] Natural androgen signaling starts with the diffusion of androgen molecules into the cell, where they bind to AR that remains inactive in the cytoplasm. The AR binds heat - shock protein 90 (HSP90). When an androgen molecule (or ligand) binds, the AR undergoes a conformational change, which releases HSP90 and exposes the nuclear localization and dimerization sites. The ligand - AR complex translocates to the nucleus, where the AR binds to the ARE site in the DNA and directs RNA polymerase II to initiate the transcription of AR - regulated genes. The transcription of genes by RNA polymerase II produces mRNA transcripts, which in turn serve as templates for the ribosomal machinery to produce proteins.

[0574] In short, androgen - AR binds to DNA [Step 1; Assay Prototype 3 in Example 4] to produce mRNA [Step 2; Assay Prototype 2 in Example 3], which serves as a template for protein synthesis [Step 3; Assay Prototype 1 in Example 2].

[0575] Example 2

[0576] Assay Prototype 1: ARE / Enhancer-Regulated Reporter Protein Synthesis

[0577] 2.1 Overview

[0578] When AR binds to an ARE / enhancer, it organizes the interaction of RNA polymerase II with the cellular transcriptional machinery to produce messenger RNA molecules, which in turn will serve as templates for protein synthesis. The end result is the synthesis of new proteins.

[0579] In these experiments, the ARE / enhancer sequence was cloned upstream of the pA-MinProm-Green Fluorescent Protein (GFP) sequence in the plasmid pSF-pA-minPromGFP (Oxford Genetics) such that when introduced into a coupled in vitro transcription / translation reaction, this DNA template would drive ligand-activated AR to produce GFP.

[0580] 2.2 Methods and Results

[0581] (1) The ARE / enhancer sequence was designed to have an enhancer sequence followed by a 3× tandem ARE sequence, as Figure 1 shown in (SEQ ID NO:15).

[0582] Sense and antisense oligonucleotides were commercially synthesized by Sigma-Aldrich as separate molecules. The separate strands were annealed by a conventional temperature hybridization reaction. Annealing was confirmed by 3% gel electrophoresis. The synthesized ARE / enhancer had restriction enzyme SalI- and SmaI-overhang sequences incorporated at the 5' and 3' ends, respectively, so that the ARE / enhancer sequence DNA could be inserted into the plasmid pSF-pA-minPromGFP, which was also digested with SalI and SmaI, using directional restriction enzyme cloning. Subsequently, the plasmid DNA was linearized with the restriction enzyme PvuI before use in the in vitro transcription / translation reaction.

[0583] (2) A commercially available in vitro transcription / translation kit (ThermoFisher Scientific, 1-step Human Coupled IVT Kit) was used. The kit contained HeLa cell extract, accessory proteins, and reaction mixture. Recombinant AR protein (Abcam) was added to the reaction mixture.

[0584] (3) To initiate transcription, 4 nM testosterone (T) was added to the assembled reaction. For the negative control, no AR was added to the reaction. The reaction was incubated at 30 °C with shaking at 300 rpm for 2 h.

[0585] The results are presented in Figure 2in which testosterone-activated AR induced the transcription and translation of GFP.

[0586] Next, the inducibility of the assay was determined. The reaction was set up as above, except that a 50 μl reaction was prepared. An AR-negative control was included to measure (baseline promoter activation) and a no-DNA template control (to measure the autofluorescence of the cell lysate). To activate transcription / translation, 4 nM testosterone was added, or as an unactivated vehicle control, ethanol at a final concentration of 0.1% v / v was added. The reaction was incubated at 30 °C with shaking at 300 rpm for 5 h.

[0587] The results are shown in Figure 3 in which the fluorescence level generated by green fluorescent protein translation in the testosterone-induced AR activation reaction was significantly higher compared to various control reactions.

[0588] Ideally, one application of the assay is the ability to use the test in field applications (e.g., beside a racehorse or athlete's track). For this purpose, the applicant tested whether a lyophilized reaction on the surface of a filter paper disk would result in a viable in vitro transcription / translation reaction.

[0589] The reaction was assembled as above (50 μl) (test and no AR as a negative control) and then pipetted onto a small disk of Whatman filter paper. Immediately after the reaction mixture was transferred, the filter paper was flash-frozen in liquid nitrogen and transferred to a lyophilizer, after which the reaction paper disk was stored at -80 °C overnight.

[0590] The next day, the paper disk was reconstituted in nuclease-free water and brought to a temperature of 30 °C. The in vitro transcription / translation reaction was initiated with 4 nM testosterone, and the reaction mixture was incubated at 30 °C with shaking at 300 rpm for 6 h.

[0591] The results are shown in Figure 4 in which the AR-positive assay reaction had increased fluorescence compared to the no-AR control. The high baseline fluorescence of the no-AR reaction was most likely due to the autofluorescence of the paper disk.

[0592] To demonstrate assay specificity, the applicant demonstrated testosterone-specific activation by showing non-responsiveness to other sex hormones (e.g., estradiol and progesterone). These data are shown in Figure 5 in which even at high doses (i.e., μM concentrations), estradiol and progesterone could not activate the AR-ARE / enhancer-regulated in vitro transcription / translation assay. These data also demonstrated that increasing testosterone [μM vs nM (Figure)] induced higher levels of fluorescence, indicating that, as expected, using higher testosterone concentrations produced more AR (8000 vs 600 fluorescence units, respectively).

[0593] Next, the sensitivity of the assay was tested. An in vitro transcription and translation reaction was assembled and activated by testosterone in the concentration range of 3.7×10 -7 to 5×10 -11 M. The data are shown in Figure 6 where the approximate EC 50 (dose resulting in half-maximal response) was 7.9×10 -11 M.

[0594] In summary, the in vitro coupled transcription / translation assay (i.e., assay prototype 1) successfully produced GFP from an ARE / enhancer-regulated DNA template after activation of AR by testosterone. These data demonstrate that assay prototype 1 is (i) testosterone-specific and cannot be activated by estradiol or progesterone, (ii) sensitive in the physiological range of nM to sub-nM, and (iii) the reaction mixture can be flash-frozen, lyophilized, and reconstituted after storage at -80 °C, which is an important first finding exemplifying the field-test version of this assay.

[0595] Example 3

[0596] Assay Prototype 2: ARE / Enhancer-Regulated RNA Synthesis

[0597] A variety of different methods were investigated for detecting and measuring the amount of RNA molecules produced from in vitro transcription (IVT, no longer coupled to translation) reactions, including:

[0598] (i) Direct detection of RNA molecules (i.e., proof of principle)

[0599] (ii) Direct detection of RNA molecules by incorporation of fluorophore-labeled NTPs

[0600] (iii) RTqPCR

[0601] (iv) RNA aptamer and fluorophore binding

[0602] Since there is no longer a need to produce proteins from the mRNA transcript, the mRNA transcripts used in this assay prototype validation were: (a) a truncated GFP sequence, as shorter molecules are more resistant to degradation; (b) a synthetic mRNA sequence; or (c) an RNA aptamer sequence.

[0603] 3.1 Direct detection of prototype 2 RNA

[0604] (i) Visualization of RNA Molecules Produced by IVT

[0605] To display RNA produced by an IVT reaction that can be quantified by cyanine-5-NTP labeling, RTqPCR, or RNA aptamer detection, an IVT reaction was prepared with an MMTV-luciferase DNA template and activated with testosterone (4 nM), or ethanol (0.1% v / v) as a vehicle control. After 1 h incubation, RNA / DNA was purified from the transcription reaction by standard column purification and subsequently the RNA / DNA molecules were subjected to agarose gel electrophoresis. The DNA and RNA molecules were then visualized by SYBR Green dye. The results are presented in Figure 7 where an 850 bp RNA band was detected, which is the expected transcript size.

[0606] Similarly, to display RNA molecules produced by an ARE / enhancer IVT reaction, an IVT reaction was prepared with an ARE / enhancer DNA template and activated with testosterone (4 nM 1×T or 40 nM 10×T), ethanol (0.1% v / v), G32, or G44 (horse plasma samples from castrated racehorses). After 1 h incubation, RNA / DNA was purified from the transcription reaction by standard column purification and subsequently the RNA / DNA molecules were subjected to agarose gel electrophoresis. The DNA and RNA were visualized with SYBR Green dye. The data are presented in Table 8.

[0607] (ii) Fluorescence Detection of RNA Molecules Produced in the IVT Reaction

[0608] Next, the RNA molecules produced in the IVT reaction were quantified using the Quant-IT RNA Assay (Molecular Probes Life Technologies). The assay is based on a fluorescent dye with higher selectivity for RNA over double-stranded DNA. After the dye binds to the RNA, the complex is stabilized for 3 h. An IVT reaction was prepared with an ARE / enhancer DNA template, stimulated with testosterone (4 nM), and incubated at 30 °C for 1 h. A reaction without NTPs served as a control.

[0609] The results are shown in Figure 9 and in Table III below:

[0610] Table III: Detection of RNA molecules by Quant-IT RNA assay

[0611] IVT Reaction 19.06.18 ARE-T (Replicate #1) 168 ng / ml IVT Reaction 19.06.18 ARE-T (Replicate #2) 153 ng / ml IVT Reaction 19.06.18 ARE-T (Replicate #3) 143 ng / ml IVT Reaction 19.06.18 No NTP (Control for DNA) 22 ng / ml

[0612] These data indicate that the RNA transcripts in the AR-activated reaction are approximately 7-fold higher than in the control reaction.

[0613] 3.2: Direct detection of RNA by binding of fluorophore-labeled NTPs

[0614] The next method developed for detecting RNA molecules generated in an IVT reaction involves incorporating fluorescently labeled NTPs into the RNA molecule. The RNA molecule is synthesized by RNA polymerase II, which adds one NTP (UTP, CTP, ATP, GTP) at a time, and the NTPs represent the building blocks of the RNA molecule. The basic idea of this method is to replace UTP with cyanine-5-labeled UTP (cy-5-UTP) or CTP with cyanine-5-labeled CTP (cy-5-CTP) or use both simultaneously. The cyanine-5-labeled UTP (cy-5-UTP) and the associated wavelength excitation and emission spectra are as Figure 10 shown in.

[0615] For these experiments, the truncated ARE / enhancer GFP DNA sequence was switched to a synthetic DNA sequence optimized for UTP and CTP, as Figure 11 shown in. This template will increase the incorporation of labeled UTP and / or labeled CTP. The sequence designed and cloned into the ARE / enhancer / minTK promoter plasmid is shown below (note that it is shown as a DNA template, not RNA, where dTTP in DNA is the codon for UTP in RNA). This synthetic DNA does not encode a gene and will not produce a functional messenger RNA and thus will not produce a protein.

[0616] The DNA was commercially synthesized as a short DNA molecule (Sigma-Aldrich) and provided in plasmid pA. Escherichia coli competent cells were transformed with this plasmid (selected for ampicillin resistance), and then the plasmid DNA was propagated with the E. coli cells. The plasmid DNA was isolated from the bacterial culture and used as a template for standard PCR. The PCR-amplified DNA molecule was then purified using phenol / chloroform extraction followed by ethanol precipitation and used as a DNA template (470 bp) in the IVT reaction. The IVT reaction was activated by testosterone (4 nM), where UTP was replaced with a cy-UTP:UTP combination, or CTP was replaced with a cy-5-CTP:CTP combination, or both UTP and CTP were replaced with a cy-5-UTP:UTP:cy-5-CTP:CTP combination. Column purification was used to purify the RNA molecule from the transcription reaction (to remove free cy-NTP) and resuspended in 100 μL of nuclease-free water. The fluorophore was excited at 630 nm and the fluorescence emission was measured at 650 nm. For some reactions, MMTV luciferase was used as a DNA template to illustrate two AR DNA binding sites. The results are shown in Figure 2 in.

[0617] Next, the activation levels of testosterone relative to its inactive vehicle control (ethanol) were tested against the ARE / enhancer synthetic - luciferase and MMTV - luciferase DNA templates. IVT reactions were assembled with the cy - 5 - UTP:UTP:cy - 5 - CTP:CTP combination and either the ARE / enhancer synthetic DNA template or the MMTV luciferase DNA template. The reactions were activated with testosterone (4 nM) or its inactive control (0.1% (v / v) ethanol). The results are presented in Figure 13 and Figure 14 . Comparing the fluorescence readings of the ARE / enhancer synthetic DNA template with the MMTV - luciferase DNA template, the 4 nM testosterone reading of the synthetic DNA template was higher. This is consistent with the higher number of U and C bases engineered into the synthetic DNA sequence to increase the incorporation of cy - 5 - labeled nucleotides ( Figure 11 ).

[0618] The IVT reaction contains the core components AR, DNA template, MgCl2, and NTP. The next experiment tested whether changing the concentrations of these core components in the IVT reaction would affect the output level of RNA molecules. As shown in Figure 15 , IVT reactions were prepared with 1× or 10× NTP; 3 mM, 5 mM, and 7.5 mM MgCl2; 25 ng, 50 ng, 100 ng, 250 ng, or 500 ng AR; 100 ng, 200 ng, 400 ng, or 800 ng DNA template. These data show that the synthesis of RNA molecules decreases with increasing concentrations of MgCl2, AR, and DNA template. Findings indicate that a certain range of AR with DNA templating results in more RNA molecule synthesis. These data suggest that the optimal molar ratio of AR to DNA template is in the range of ≥0.3:1 and ≤7:1.

[0619] The next experiment investigated whether differences in AR bioactivity between two horse plasma samples (designated G32 and G44 respectively) obtained from castrated racehorses could be detected using the cy - 5 - NTP labeling method. These two horse plasma samples had previously been tested by a HEK293 cell - based AR bioactivity assay and G44 was shown to be more active than G32. IVT reactions were assembled with the cy - 5 - UTP:UTP or cy - 5 - CTP:CTP combination and the ARE / enhancer synthetic DNA template. The reactions were activated with castrated plasma (15% v / v). The results are presented in Figure 16 and confirmed that Assay Prototype 2 was able to correctly distinguish between the two field samples based on prior verification of their respective androgen content.

[0620] 3.3 RNA Detection by RTqPCR (Version 1 - MMTV - minProm - truncated luciferase gene as DNA template)

[0621] The first experiment of this assay prototype illustrates the MMTV-minProm-truncated luciferase gene DNA template for IVT-RTqPCR measurement.

[0622] Assemble the ITV reaction and activate it by adding testosterone (4 nM), and then incubate it at 30 °C for 2 h.

[0623] After the IVT reaction, the DNA template was removed by DNase I digestion (Baseline-Zero DNase, Epicentre). The RNA was purified by standard phenol / chloroform extraction followed by ethanol precipitation (or column purification). A standard reverse transcription reaction (Superscript VILO cDNA Synthesis Kit, ThermoFisher Scientific) was completed to generate cDNA. The cDNA was amplified by qPCR (KAPA SYBR Fast qPCR Kit) using a specific primer kit.

[0624] These data are presented in Figure 17 which shows the raw data of the cycle threshold for the measurement of RNA levels in the IVT reaction for ethanol treatment relative to T treatment. PCR works by exponentially amplifying a very small number of cDNA (=RNA) molecules into a very large number of double-stranded DNA molecules. If there are more starting cDNA molecules at the beginning of the amplification, the double-stranded DNA generated from those cDNA molecules will be fluorescently detected at a lower number of amplification cycles (referred to as the cycle threshold). In Figure 17 the average cycle threshold number for testosterone was ~24, while for ethanol it was ~30. This indicates a 64-fold difference in the starting RNA levels.

[0625] Next, an IVT / RTqPCR reaction containing the MMTV luciferase DNA template was used to illustrate nuclear extracts prepared from different cell types. The nuclear extract mainly used for the IVT reaction example was HeLa nuclear extract (cervical cancer cell line). This cell line does not express AR. This nuclear extract is commercially available (e.g., Promega). In the applicant's laboratory, an experimental protocol was established to prepare an in-house HeLa nuclear extract. Subsequently, the same experimental protocol was used to prepare nuclear extracts from PC-3 (human prostate cancer cell line), HuH7 (human hepatocyte cell line), and HEK293 (human kidney cell line) cells. These data are presented in Figure 18 and show that in-house nuclear extracts from various cell types provide sufficient transcriptional machinery to support the IVT reaction. The cycle threshold data indicate that no extract results in a significant increase in RNA transcription (indicated by a decrease in the cycle threshold) or a significant decrease in its output (indicated by an increase in the cycle threshold).

[0626] Next, the intrinsic activation levels of different nuclear extracts were determined. The IVT reactions were prepared as above, transcription was driven with different nuclear extracts, and the reactions were activated with testosterone or ethanol as a vehicle control. These data are presented in Figure 19 and show that all four cell lines produce transcriptionally active nuclear extracts that respond to testosterone. HuH7 and HEK293 cells are stable cell lines expressing AR, PC3 cells express endogenous AR, while HeLa cells do not express AR.

[0627] Thus, the IVT reactions exemplified so far are activated only by the major male endogenous androgen in males, i.e., testosterone. AR is activated by other natural androgens, such as dihydrotestosterone, a potent endogenous androgen that shows 4-fold higher biological activity on AR than testosterone. IVT reactions were prepared with commercially available HeLa nuclear extracts and activated with testosterone (T, 4 nM) or dihydrotestosterone (DHT, 4 nM). Using the MMTV luciferase DNA template, mRNA levels were read by RTqPCR. These data are presented in Figure 20 and show that DHT induces more RNA synthesis than T, as evidenced by the lower cycle threshold (DHT ~ 20 compared to T ~ 24). These results are consistent with the reported higher binding affinity of AR for DHT and its higher intrinsic AR activation.

[0628] 3.4 RNA detection by RTqPCR (Version 2 - ARE / enhancer - minProm - truncated GFP gene as DNA template)

[0629] In this series of experiments, the ARE / enhancer minPromGFP DNA template used for IVT - TRqPCR measurements was exemplified.

[0630] During the development of Version 2 (ARE / enhancer - minProm - GFP), various improvements were made, including addressing the complete removal of the DNA template in the IVT reaction after incubation and protecting the newly synthesized RNA from degradation. Subsequent development was to design a primer set constructed for a special purpose to ensure that the DNA template is not amplified in the real - time PCR reaction.

[0631] To enhance the destruction of DNA templates after the IVT reaction, EDTA was removed from the IVT transcription buffer because EDTA can inhibit DNaseI. Removal of EDTA had no effect on the IVT reaction (data not shown). Subsequently, the DNA was modified such that it could be immobilized on magnetic beads. PCR primers with a biotin group linked to the 5'-sense primer were used to amplify the DNA template. Using a truncated 3'-antisense primer, the GFP gene also allowed for the generation of shorter DNA templates and thus shorter mRNA transcripts that were more resistant to degradation. The biotin-labeled DNA was then mixed with streptavidin-coated magnetic beads (Dynabeads 280) to capture the DNA on the beads. This enhanced DNA template removal because after completion of the IVT reaction, the DNA template could be separated from the IVT reaction by a magnet, causing the beads to settle to the bottom of the tube. The IVT reaction was transferred to a fresh tube and treated with ZeroBaseline DNase. This two-step method reduced the risk of residual DNA template entering the PCR reaction.

[0632] To test the improved IVT-RTqPCR system involving DNA templates immobilized on magnetic beads, the IVT reaction was assembled as follows:

[0633] Reaction mixture:

[0634]

[0635]

[0636] The IVT reaction was activated by adding testosterone (4 nM) or ethanol (0.1% v / v) and incubated at 30 °C for 2 h. Samples G32 and G44 from horses were also tested in this modified system. The IVT reaction was separated from the DNA template using magnetic separation and then purified by standard phenol / chloroform extraction followed by ethanol precipitation. Alternatively, RNA was purified by column purification. Then, any residual DNA template was destroyed using Epicenter BaselineZero DNase I before RT-qPCR using specific primers / probes. The results are presented in Figure 21 and show that testosterone (T) induced more RNA transcript generation than ethanol (E). The results also demonstrated that the AR-IVT reaction was able to distinguish endogenous androgen bioactivity in equine plasma samples, with G44 showing higher activity than G32.

[0637] To overcome potential contamination of PCR reagents by DNA templates, a revised reverse transcription step and PCR were designed. Using a specific reverse transcription primer, a stem-loop structure was added to the end of the DNA template during the cDNA synthesis step. During the denaturation step of PCR, the stem-loop structure opens, exposing the PCR-specific primer sites. Using a specific reverse transcription primer followed by a specific reverse PCR primer, the initial DNA template cannot be amplified.

[0638] An IVT reaction was performed, followed by phenol / chloroform extraction, then ethanol precipitation to purify the RNA molecules, and treatment with DNaseI to destroy the DNA template. Alternatively, column purification with DNaseI treatment was used to prepare purified RNA molecules. Then RTqPCR was performed using a specific reverse transcription primer for the cDNA synthesis step. qPCR was performed using a specific PCR reverse primer, forward primer, and probe set. The reverse primer and probe anneal to the hairpin loop region of the cDNA and do not anneal to the initial DNA template (if any residual or contaminating molecules enter the PCR reaction tube). The results are presented in Figure 22 and demonstrate that the stem-loop assay further exemplifies RTqPCR as a method for measuring RNA produced in an IVT reaction.

[0639] 3.5 Detection by RNA Aptamer:Fluorophore-Conjugated RNA

[0640] RNA molecule aptamer technology provides a single-tube option for AR-IVT-RNA detection. RNA aptamers exemplified in the following experiments are RNA Mango and RNA iSpinach.

[0641] (i) RNA Mango

[0642] RNA Mango is a high-affinity RNA aptamer that binds the fluorophore TO1-PEG-biotin (TO1-PB) (TO - thiazole orange). When binding to RNA Mango, the fluorescence of TO1-PEG-biotin increases up to 1000-fold. RNA Mango binds TO1 with a K D = 3.2 ± 0.7 nM, so a low concentration of the fluorophore can be used to detect RNA Mango. The on-rate of RNA binding to TO1 is within 30 minutes, and the slow off-rate exceeds 2 hours.

[0643] In aqueous solution, TO1 exhibits very low fluorescence because the bridge between its two heterocycles is not rigid. When binding to RNA Mango, the bridge becomes rigid and the molecule becomes strongly fluorescent. To further support the folding and stability of the RNA Mango molecule, it is usually produced together with a scaffold structure. The sequence of the scaffold structure has been included in the DNA template used in this study.

[0644] There are several forms of RNA Mango, called Mango I, II, III, and IV. All four of these RNA Mango forms were illustrated using an AR / ARE / enhancer in vitro transcription assay (sequences are included in the appendix materials). Assemble the IVT reaction and activate it with testosterone (4 nM). Incubate the IVT reaction at 30 °C for 1 h and then dilute it in RNA Mango binding buffer supplemented with TO1-PB (40 nM). The binding reaction was continued at 25 °C for 25 minutes. The results are presented in Figure 23 and show that the testosterone-activated AR-ARE / enhancer IVT assay produces RNA Mango aptamer molecules that can be detected by TO1-PB fluorescence.

[0645] Next, for each form of Mango, the levels of RNA Mango aptamers produced by the testosterone-activated reaction were measured compared to an ethanol control. Assemble the IVT reaction and activate it with testosterone (4 nM) or ethanol (as a control, final concentration of 0.1% v / v). Incubate the IVT reaction at 30 °C for 1 h and then dilute it in RNA Mango binding buffer supplemented with TO1-PB (40 nM). The binding reaction was continued at 25 °C for 25 min. The results are presented in Figure 24 and indicate that the Mango variant with the highest fold difference between baseline expression (ethanol) and induced level (testosterone) is Mango II. Therefore, Mango II was used in subsequent experiments.

[0646] Next, it was necessary to determine the reproducibility of the Mango II results for testosterone relative to baseline expression. The experiment was repeated three times on consecutive days. These data are shown in Figure 25 and demonstrate the testosterone-specific activation of the Mango II aptamer compared to the ethanol control.

[0647] So far, the IVT reaction has been activated with 4 nM testosterone, which is sufficient to measure the male physiological range of 7.8 - 29.4 nM. However, the sensitivity range of cell-based bioassays is sub-nM, so it is questioned whether the IVT assay can detect sub-nM concentrations of testosterone. Prepare the IVT reaction and activate it with 2, 0.8, 0.4 nM T and compare it with ethanol (0.1% v / v). The results are presented in Figure 26In addition, it was demonstrated that assay prototype 2 equipped with the Mango II aptamer for ligand activation could detect in the sub-nM range.

[0648] Next, it was investigated whether the assay prototype 2 RNA Mango aptamer assay could measure androgen activity in equine plasma samples. Two castrated samples (designated G44 and G32), where G44 consistently showed higher androgen activity than G32, were tested in (a) a cell-based bioassay (HEK293), (b) prototype 2 RTqPCR assay, and (c) prototype 2 direct readout assay. Both samples were tested in the assay prototype 2 RNA Mango aptamer assay. The results are presented in Figure 27 In addition, it was again shown that G44 had higher androgen activity than G32, which was consistent with findings from established cell-based bioassays and other assay prototype 2 configurations.

[0649] Next, it was investigated whether the prototype 2 Mango RNA aptamer assay could detect anabolic androgenic steroids (AAS) and selective androgen receptor modulators (SARM). Four different SARMs, LGD-2226, BMS-564929, Ostarine, and Andarine, which had recently been detected as substances of abuse in the horse racing industry, were tested in the AR-ARE / enhancer RNA Mango aptamer assay. Two different AAS, namely 11-ketotestosterone and 11-ketodihydrotestosterone, were also tested. IVT reactions were prepared and activated with one of six different androgen molecules, namely LGD-2226, BMS-564929, Ostarine, Andarine, 11-K-DHT, and 11-K-T, or testosterone. Ethanol was used as a baseline control. These data are presented in Figure 28 In addition, it clearly showed the detection of these androgen molecules using this specific activity / activation assay configuration. Although these six androgen molecules represent only a small fraction of the SARMs and AAS that can be used as sports doping substances, this indicates that the AR-induced IVT reaction responds to non-endogenous androgens.

[0650] (2) RNA iSpinach

[0651] RNA iSpinach is an RNA aptamer that binds the fluorophore 3,5-difluoro-4-hydroxybenzylidene imidazolinone (DFHBI). Upon binding to RNA iSpinach, the fluorescence of DFHBI increases measurably. RNA iSpinach binds DFHBI with an affinity of 1.18 μM. Similar to the RNA Mango experiment, the levels of the RNA iSpinach aptamer produced in response to testosterone activation were measured relative to baseline expression (ethanol control). The only difference between the IVT reactions was the switch from the DNA Mango template to the DNA iSpinach template. The DNA template had the iSpinach expressed with the F30 scaffold. The IVT reactions were assembled and activated with testosterone (4 nM) or ethanol (0.1% v / v final concentration). The IVT reactions were incubated at 30 °C for 1 h and then diluted in RNA iSpinach binding buffer supplemented with DFHBI (40 μM). The binding reaction was continued for 25 min at 37 °C. The results are presented in Figure 29 and clearly show that the testosterone-activated IVT reactions produce more iSpinach aptamer than the ethanol control.

[0652] Having shown that the iSpinach responds to T, IVT reactions were assembled and activated with horse plasma samples G33 or G44. Both samples had previously been tested with a cell-based bioassay, and G33 had been shown to have lower androgenic bioactivity than G44. The IVT reaction mixtures were incubated at 30 °C for 1 h and then diluted in RNA iSpinach binding buffer supplemented with DFHBI (40 μM). The binding reaction was continued for 25 min at 37 °C. Fluorescence was then read at 405 nm excitation and 498 nm emission. The results are shown in Figure 30 and demonstrate that the IVT-iSpinach assay reaction is capable of detecting androgenic activity in horse plasma samples. Additionally, these data confirm the previously determined observation that G44 has higher androgenic activity than G33, which is consistent with the results of the cell-based bioassay.

[0653] Example 4

[0654] Assay Prototype 3: Androgen Receptor Directly Binds to DNA

[0655] The applicant further determined that in the activity assay system, the endogenous androgen molecule testosterone can induce the binding of AR to the ARE / enhancer DNA template.

[0656] Fix the AREminpromGFP DNA template to magnetic beads. Use a magnetic stand to wash the beads in transcription buffer (equivalent to 100 ng of AREminpromGFP DNA). Remove the supernatant and resuspend the beads in 25 μL of transcription buffer, and add 100 ng of recombinant AR and 5 nM testosterone. Incubate the reaction at 30 °C for 1 hour. MgCl2 was either not supplemented, or supplemented with 1.5 μL or 3 μL in the transcription buffer. After incubation, remove the supernatant from the beads, wash the beads twice with transcription buffer, and then resuspend in 20 μL of transcription buffer, Western blot loading buffer, and reducing agent. At this time, heat the sample to 95 °C to break the DNA / bead bond, and transfer the supernatant to a fresh tube containing 20 μl of transcription buffer, Western blot loading buffer, and reducing agent. Then subject the sample to PAGE (150 V, 1.5 h) and transfer it to a PVDF membrane (1 h, 100 V). Block at 5% PBSTM for 1 hour at room temperature, and then expose to the anti-AR antibody in PBSTM overnight at 4 °C. Wash the PVDF membrane 3 times in PBST for 5 minutes each, and then incubate with anti-mouse IgG conjugated to horseradish peroxidase (HRP) in PBSTM for 4 hours. Wash the blot again 3 times in PBST for 5 minutes each. Observe HRP for 5 minutes using WestPico. The results are presented in Figure 31 and show that AR binds to the AREGFP DNA template.

[0657] Next, it was determined whether testosterone activates more AR to bind to the ARE-DNA template relative to ethanol (vehicle control). As a further control, the binding of AR to the ERE-DNA template was tested. The ARE DNA template was incubated with recombinant AR in the presence of transcription buffer, and as a control, the estrogen response element (ERE) DNA template was also incubated with recombinant AR. AR was activated with testosterone (5 nM) or ethanol (0.1% v / v) to bind to the DNA template. Then the AR / ARE complex was fixed to a nitrocellulose membrane, and then the anti-AR primary antibody was used to target AR, and subsequently the horseradish peroxidase-conjugated secondary antibody was used to target AR.

[0658] Figure 32 The dot blot presented in shows that testosterone stimulates more AR binding relative to the ethanol control. It also shows that AR does not bind to the ERE template.

[0659] In summary, the data presented in this example show that the in vitro coupling reaction of the recombinant AR protein and the ARE-DNA template successfully demonstrated the binding of AR to the androgen response element. In addition, the experiment showed that testosterone induced more AR binding to ARE. The poor binding of AR to the estrogen response element demonstrated the specificity of AR binding to its own response element.

[0660] Example 5

[0661] Supplementary Information for Assay Prototype 1

[0662] 5.1 Generation of DNA Templates

[0663] The androgen response element / enhancer sequences for generating assay prototype 1 were as follows:

[0664] SEQ ID NO:15 : Sense strand

[0665] ACTCTGGAGGAACATATTGTATCGATTAAGCTT AGAACA GTT TGTAAC GAGCTC GTTACA AAC TGTTCT AGCTC GTTACA AAC TGTTCT AAGCTCAAGCTTA

[0666] SEQ ID NO:16 : Sense strand

[0667] ATGAGACCTCCTTGTATAACATAGCTAATTCGAATCTTGTCAAACATTGCTCGAGCAATGTTTGACAAGATCGAGCAATGTTTGACAAGATTCGAGTTCGAA

[0668] 5.2 In Vitro Transcription / In Vitro Translation Reaction

[0669] The following reaction mixtures were prepared:

[0670] Reaction mixture #1 [test]

[0671] i. HeLa cell extract *

[0672] ii. Recombinant AR *

[0673] iii. Reaction buffer *

[0674] iv. pARE / epAGFP DNA template

[0675] v. 40 nM testosterone

[0676] Reaction mixture #2 [vector control]

[0677] 1. HeLa cell extract

[0678] 2. Recombinant AR

[0679] 3. Reaction buffer

[0680] 4. pARE / epAGFP DNA template

[0681] 5. 0 / 1% v / v ethanol

[0682] Reaction mixture #3 [negative control]

[0683] 1. HeLa cell extract

[0684] 2. Recombinant AR

[0685] 3. Reaction buffer

[0686] 4. 0 / 1% v / v ethanol

[0687] Reaction mixture #4 [negative control]

[0688] 1. HeLa cell extract

[0689] 2. Reaction buffer

[0690] 3. pARE / epAGFP DNA template

[0691] 4. 0 / 1% v / v ethanol

[0692] Reaction mixture #5 [positive control]

[0693] 1. HeLa cell extract

[0694] 2. Reaction buffer

[0695] 3. pCMV-GFP DNA template

[0696] 4. 0 / 1% v / v ethanol

[0697] * HeLa cell extract, recombinant AR, and reaction buffer are from ThermoFisher Scientific.

[0698] As negative controls, reaction mixture #3 was assembled without a DNA template (reaction #3), and reaction mixture #4 was assembled without AR, since HeLa cells are reported to be AR-free (this has been confirmed using Western analysis).

[0699] As a positive control, reaction mixture #5 was assembled, containing the DNA control plasmid (pCMV-GFP) from an IVT kit (ThermoFisher Scientific).

[0700] The various reaction mixtures were incubated at 37 °C for 5 h. Fluorescence readings were obtained using a standard 96-well fluorometer (488 nm / 525 nm) to detect the amount of GFP expressed.

[0701] Results are shown in Figure 33 . These data indicate that green fluorescent protein was expressed in the AR / ARE / enhancer assay when stimulated by testosterone (reaction mixture #1), but not ethanol (reaction mixture #2). All negative controls showed low fluorescence readings (reaction mixture #3; reaction mixture #4). There was measurable fluorescence in the ethanol control, indicating basal GFP expression from the minimal promoter pA. The levels were similar to those measured for the AR-free control, again indicating basal RNAPII expression of GFP from pA. The no-DNA template control showed absolute baseline levels. The fluorescence measured in this reaction was attributed to the autofluorescence of the HeLa cell extract.

[0702] The amount of GFP produced by the inducible AR / ARE / enhancer template was much lower than that of the positive control CMV-GFP (reaction mixture #5). CMV is a strong promoter and should thus produce high levels of GFP. Subsequently, assay prototype 1 was further optimized to increase the dynamic range (increase GFP output; data not shown).

[0703] 5.3 Assessing the sensitivity (EC 50 )

[0704] The next step was to evaluate the concentration range over which the assay could measure testosterone. Multiple reaction mixtures #1 as described above were set up and used to test testosterone from 1 μM to 1 nM. The data were used to generate a sigmoidal dose-response curve. Results are shown in Figure 34 and 35 .

[0705] Figure 34 Shows the relative sensitivity of assay prototype 1 compared to assay prototype 0 (i.e., the cell-based assay).

[0706] Figure 35 Shows that compared to the EC -9 of assay prototype 0 at 5x10 50 M, the EC 50 of assay prototype 2 was 7.9x10 -11 M. This represents almost a 100-fold higher sensitivity than the cell-based assay (assay prototype 0).

[0707] 5.4 Determination of the specificity of Assay Prototype 1 (v1)

[0708] The steroid hormone family includes estradiol (E2) and progesterone (P), and both can activate AR at high doses. Therefore, the applicant next tested whether Assay Prototype 2 (v1) could be activated by estradiol (E2) and progesterone (P) within the physiological range. Tested from 4 nM to 1 μM, the applicant found that both P and E2 could activate AR, but only in the μM concentration range. Importantly, this response was negligible and far lower than the measurement for T at the same concentration. Note that the basal fluorescence of this system was ~190 units (determined in Sections 5.2 and 5.3 above).

[0709] Example 6

[0710] Supplementary Information for Assay Prototype 2

[0711] 6.1 In vitro transcription (IVT) reaction

[0712] Assay Prototype 2 does not require protein synthesis (translation) and is based only on IVT after androgen activation of its specific receptor, the androgen receptor (AR).

[0713] The following reaction mixtures were prepared:

[0714] Reaction Mixture #6

[0715] 1. HeLa cell extract

[0716] 2. Reaction buffer

[0717] 3. NTP and MgCl2

[0718] 4. DNA template

[0719] 5. Recombinant AR

[0720] 6. 100 ng testosterone

[0721] Reaction Mixture #7

[0722] 1. HeLa cell extract

[0723] 2. Reaction buffer

[0724] 3. NTP and MgCl2

[0725] 4. DNA template

[0726] 5. Recombinant AR

[0727] 6. 0.1% v / v ethanol

[0728] The reaction mixture was incubated at 37 °C for 1 hour, during which mRNA was synthesized from the DNA template.

[0729] Using reverse transcription-PCR (RT-PCR), the mRNA was converted into a DNA product. Initially, this was visualized using 2% agarose gel electrophoresis ( Figure 36 ).

[0730] This was the first indication that the IVT reaction was effective. Compared to two controls, after activating AR with T, RT-PCR using luciferase-specific primers showed stronger bands (indicating more RNA was produced). Baseline products were present in both controls.

[0731] These experiments were repeated over three consecutive days, all with the same results (gels not shown). These data indicate that when testosterone (T) binds to the androgen receptor (AR) and induces AR to initiate transcription of MMTV, IVT is consistently activated.

[0732] The next step was to determine whether a testosterone dose response could be seen, indicating a certain dynamic range within the assay. Using 100, 50, 25, 12.5 ng of testosterone versus ethanol, RT-PCR showed decreasing DNA output, indicating decreasing mRNA production from less androgen activation by lower testosterone concentrations ( Figure 37 ).

[0733] 6.2. IVT components

[0734] The IVT components used to show T+AR transcriptional activation were from a commercially available kit, the HeLaScribe kit. In this kit, for the AR-T IVT reaction, HeLa cell extract and reaction buffer were used.

[0735] HeLa cell extract was generated in the laboratory using cultured Hela cells. This in-house developed extract was tested in the AR-T IVT reaction ( Figure 38 ).

[0736] These experiments were repeated n = 3 times to demonstrate reproducibility.

[0737] Finally, the goal was to use RTqPCR instead of RT-PCR. As Figure 38 shown above, the AR-T reaction was completed relative to the AR+T IVT reaction. Then RNA was extracted, the reverse transcription step was completed to generate cDNA, and a 1:100 dilution of the cDNA was tested in a SYBRgreen-based RTqPCR assay (TaKara) using the same gene-specific primers as for RTPCR.

[0738] The average C of the AR-T reaction TThe value is 21.78. The average C of AR+T T The value is 18.03. This indicates a 13.5-fold increase in expression.

[0739] 6.3 Assay Optimization

[0740] 6.3.1 Hormone Steroid Receptor Co-factors

[0741] In cells, AR is kept inactive through protein-protein interactions with heat shock protein 90 (HSP90). When androgens enter the cell, they bind to AR, and this ligand-protein interaction causes HSP90 to dislocate from AR. In the assays under development, HSP90 was added to ensure that only ligand-activated AR activates MMTV luciferase transcription.

[0742] IVT reactions including HSP90 were carried out, while HSP90 was not added to the control. Then RNA extraction was completed, followed by RT reaction. The CT values of SYBRgreen-based qPCR (TaKara) were 15.37 without HSP90 and 17.08 with HSP90.

[0743] When activated with T, without HSP90 it was 10.86, while with HSP90 it was 14.24.

[0744] These findings showed that the background was suppressed by ~4-fold with HSP90 and the activation was increased to ~16-fold.

[0745] The IVT reaction was incubated at 37 °C for 1 hour. To determine if increasing the incubation time to 2 hours would result in increased mRNA and a higher difference between ethanol and testosterone, tests were conducted. The CT values after IVT, RNA extraction, and RTqPCR showed only an approximately 4-fold increase after this time. The standard experimental protocol of 1 hour at 37 °C will be used for assay development.

[0746] IVT reactions can be sensitive to MgCl2. Therefore, it was tested whether increasing the MgCl2 concentration would increase mRNA output. IVT reactions were set up with 3, 4, 5, 6, and 7 nM MgCl2. After 1 hour at 37 °C, mRNA was extracted and RTqPCR was performed. The CT values showed that 25.75 for 3 nM was lower than any other MgCl2 concentration (29.38, 26.35, 27.95, and 26.22 for 4, 5, 6, and 7 nM respectively). Therefore, the standard experimental protocol using 3 nM MgCl2 in the IVT reaction will be used for assay development.

[0747] 6.3.2 Optimization of Cell / Cell-free Extracts

[0748] The applicant has demonstrated that for cell-based bioassays, it is absolutely necessary to keep the number of cells being assayed below a certain threshold. For example, for Assay Prototype 0 (Yeast AR Bioassay) to function optimally, the optical density (OD) of the cell culture used for the assay must be less than 0.2 in order to distinguish AR activation from background noise. If the OD value exceeds 0.2, the assay fails to show a difference between the test sample and the baseline control. This is shown in Figure 39 . For these results, thoroughbred horses were administered testosterone at time 0. Blood samples were collected at 30 and 60 minutes and analyzed for AR bioactivity by incubating yeast AR bioassay cells in the presence of 5% horse serum. If the yeast cells were too confluent, e.g., OD 0.4, neither 30 minutes nor 60 minutes showed AR bioactivity higher than the negative control (ethanol) sample. However, if the cells were at optimal confluence (OD 0.2), both the 30-minute and 60-minute samples showed enhanced AR bioactivity relative to the negative control. Also, the 60-minute sample showed higher activity than the 30-minute sample. It is difficult to control cell growth, especially in serum containing many growth factors. If the cells overgrow, the experiment must be stopped and restarted, estimating the starting cell number empirically.

[0749] Using Assay Prototype 2, the cell extract composition can be precisely optimized. The activity of cell extract components can be tested. Once defined as an activity unit, many units of the activity of the cell component extract can be added to each reaction to determine the stoichiometry of the reaction. As Figure 40 seen, the cell extract concentration is an important consideration. For these results, cell-free reactions of Assay Prototype 2 were prepared and activated with 100 ng testosterone or an equal volume of ethanol as a negative vehicle control. For each pair of cell-free reactions (testosterone and ethanol), titrated amounts of HeLa cell extract (100, 75, or 50 μg protein / ml) were added. The results demonstrated that when 100 μg of HeLa extract was added to the reaction, testosterone activation could not be distinguished from the negative control. As the concentration of the HeLa cell extract decreased (75 μg, then 50 μg), there was a clear and measurable difference between testosterone and the negative control. This was evident as a difference was detected in the cycle threshold, where the threshold for testosterone was lower than that of ethanol, indicating more starting RNA molecules. This allowed determination of the optimal concentration of the HeLa cell extract to be added to the cell-free reaction. The activity at this concentration was then determined and defined as an activity unit. All future reactions could then be assembled to contain a defined number of activity units. This step eliminates the uncertainty of cell growth and subsequent inconsistencies in the repeated measurements inherent in cell-based bioassays.

[0750] 6.4 RNA Extraction

[0751] 6.4.1 Reaction to RT-PCR

[0752] Finally, it was tested whether the IVT reaction could simply be used as the RT step followed by the PCR step for mRNA samples.

[0753] The crude RT-PCR reaction showed that PCR bands were obtained ( Figure 41 ).

[0754] Although the PCR was not optimized, it showed that DNA was produced and allowed for the omission of the RNA extraction step.

[0755] 6.4.2 DNase Treatment

[0756] Before the RT-PCR step, DNase I was used to destroy the DNA template. Using increasing volumes of DNase I, the number of DNase I units required to completely destroy the DNA was empirically evaluated ( Figure 42 ). 4 μL was selected from the results for the IVT reaction. However, it could not eliminate the DNA template, most likely due to the high salt concentration of the IVT reaction buffer. DNase I was switched to Turbo DNase (Thermo Scientific) as it is more resistant to high salt conditions. The results showed that the DNA template was destroyed and no PCR products were produced ( Figure 43 ).

[0757] 6.4.3 Single Step of IVT-RTqPCR

[0758] The next approach was to directly access RTqPCR from the IVT reaction. Figure 40 The crude reaction shown in T proved possible but required optimization. The IVT reaction was performed using the Cells-to-C T Reaction Enzyme / Mix (ThermoFisher Scientific) with AR activated by T (100 ng) or ethanol (as a control). After DNase treatment, RTqPCR was then performed using a one-step method. The threshold cycle (C T ) values were 21.99 for ethanol, 19.80 for testosterone (first attempt), 22.21 for ethanol, 19.98 for testosterone (second attempt), and then after adjusting the reaction volume to shift the C T value to a more accurate position of >20, 34.5 for ethanol and 24.29 for testosterone. This represents a 1184-fold activation of T-AR-induced mRNA synthesis.

[0759] Therefore, a proof of principle for androgen receptor assay prototype 2 has been established, enabling the activation of the IVT reaction by ligand AR and the detection of subsequent RNA by RTqPCR.

[0760] Example 7

[0761] Aptamer: Supplementary Information for the Fluorophore Assay Prototype 2

[0762] 7.1 Introduction

[0763] This study used the fluorescent RNA aptamer iSpinach and a commercially available dye that mimics the native fluorophore of green fluorescent protein (GFP), 3,5-difluoro-4-hydroxybenzylidene imidazolinone (DFHBI).

[0764] A DNA template was engineered to have an androgen response element (ARE) upstream of a minimal promoter element and a DNA sequence encoding the iSpinach fluorescent RNA aptamer. Using the DNA template and androgen receptor (AR) together, the transcription of the iSpinach fluorescent RNA aptamer was driven only in the presence of androgen, thus demonstrating androgen detection in vitro.

[0765] 7.2 Methods

[0766] An in vitro transcription reaction was carried out by combining 1× transcription buffer (20 mM HEPES pH 7.9, 100 mM KCl, 20% glycerol), 3 mM MgCl2, 10 mM NTP, 50 ng recombinant AR protein, 20 U RNase Out, 100 ng DNA template, and 60 μg HeLa cell extract (Promega), and made up to a final volume of 25 μL with nuclease-free water. Testosterone (1 μL) or ethanol (1 μL) as a vehicle control was added to the reaction mixture, and then incubated at 30 °C for 1 h.

[0767] The DNA templates were (A) enhancer / ARE TK minimal promoter 4XiSpinach (ARE4XiSpinach) with a linker between each Spinach sequence or (B) enhancer / ARE TK minimal promoter (ARE-F30iSpinach) with a 32-mer linker sequence, an iSpinach sequence, and then the remaining part of the F30 scaffold before the F30 scaffold sequence.

[0768] After the in vitro transcription reaction, 2 μL of the fluorophore DFHBI (200 μM) and 73 μL of fluorescence buffer (200 mM KCl, 10 mM NaHPO4 pH 7.2, 0.05% Tween-20) were added to a final volume of 100 μL. The binding reaction was incubated at 37 °C for 25 minutes in the dark.

[0769] The reaction was measured at an excitation wavelength of 460 nm in a black clear-bottom 96-well plate on a Fluroskan (Thermofisher), and the maximum emission was detected at 505 nm with a bandwidth of 15 - 25 nm.

[0770] For the control reaction, the DNA template was added to the transcription reaction without AR and NTPs. This is a no-RNA production control for testing the binding of DFHBI to DNA and the autofluorescence of the cell extract.

[0771] The DNA template (GeneART, ThermoFisher) was synthesized and subcloned into the plasmid vector pMA. This plasmid has ampicillin resistance. Competent Escherichia coli was transformed with the plasmid vector for plasmid amplification and purification. The plasmid DNA was linearized using the enzyme PvuI by restriction endonuclease digestion, and the product was purified by column purification.

[0772] 7.3 Results

[0773] The results are presented in Figure 45 which shows that the AR reaction activated by testosterone has higher fluorescence than the ethanol and no-RNA controls, directly demonstrating that more fluorescent RNA aptamer was synthesized in the presence of testosterone relative to the ethanol or no-RNA control reactions.

[0774] The testosterone-activated AR reactions show increased fluorescence for two tested DNA templates: (A) ARE4XiSpinach; and (B) ARE-F30iSpinach.

[0775] 7.4 Conclusions

[0776] The results for the first time show the synthesis of a fluorescent RNA aptamer for in vitro testosterone activation of AR and its subsequent ARE-directed RNA transcription.

[0777] The applicant has also engineered reporter constructs containing other fluorescent RNA aptamers (such as Mango I, II, III, and IV) and demonstrated their dual utility as detection tools using their aptamer-specific dye thiazole orange (TO1) (Example 3).

[0778] Although the present invention has been described by way of example, it should be understood that various changes and modifications can be made without departing from the scope of the invention defined by the claims. In addition, where known equivalents exist for specific features, these equivalents are incorporated as if specifically recited in this specification.

[0779] ***

[0780] All patents, publications, scientific articles, websites, and other documents and materials cited or referred to herein represent the state of the art of those skilled in the art to which the present invention pertains, and each such cited document and material is hereby incorporated by reference into this application to the same extent as if it had been incorporated by reference in its entirety or set forth in its entirety herein. The applicant reserves the right to physically incorporate into this specification any and all materials and information from any such patents, publications, scientific articles, websites, electronically available information, and other reference materials or documents.

[0781] The terms and expressions that have been employed are used as terms of description and not of limitation, and it is not intended that such terms and expressions be used to exclude any equivalents of the features shown and described or portions thereof, but it is to be understood that various modifications are possible within the scope of the claimed invention. Accordingly, it will be understood that although the present invention has been specifically disclosed by way of preferred embodiments and alternative features, those skilled in the art can make modifications and variations to the concepts disclosed herein, and such modifications and variations are to be regarded as within the scope of the invention described herein and defined by the appended claims.

[0782] The present invention has been described herein in broad and general terms. Each narrower species and subgeneric grouping falling within the general disclosure also forms part of the present invention. This includes the general description of the invention, with conditional or negative limitations removing any subject matter from the genus, whether or not the excised material is specifically recited herein.

[0783] Other examples are in the following claims. Further, in cases where the present invention is described in terms of a Markush group, those skilled in the art will recognize that the invention is thus also described in terms of any single member or subgroup of members of the Markush group.

Claims

1. A cell-free test kit for screening for the presence of a ligand in a test sample, the ligand being capable of forming a complex with a steroid hormone receptor and binding to a nucleic acid response element, the test kit comprising: (i) a steroid hormone receptor that forms a receptor-ligand complex with the ligand from the test sample; and (ii) a nucleic acid response element bound by the receptor-ligand complex; and (iii) a transcription-based reporter gene construct operably linked to the nucleic acid response element, wherein the relative content of the steroid hormone receptor to the nucleic acid response element in the test kit is x:1, where x is the content of the steroid hormone receptor and is defined as [0.2 ≤ x ≤ 20].

2. The test kit according to claim 1, wherein the test kit further comprises a steroid hormone receptor cofactor that prevents the steroid hormone receptor from binding to the nucleic acid response element.

3. The test kit according to claim 2, wherein the steroid hormone receptor cofactor is selected from heat shock protein 70, heat shock protein 40, heat shock protein 90, p23, heat shock protein-organizing protein (Hop), 48kD Hip protein, p60, and FKBP52.

4. The test kit according to claim 1, which further comprises one, two, or all three of a transcription machinery, a steroid metabolism machinery, and a cell-free extract.

5. The test kit according to claim 1, wherein the reporter construct comprises a promoter sequence and a reporter element, and when the nucleic acid response element is bound by the receptor-ligand complex, the promoter sequence is activated.

6. The test kit according to claim 1, wherein the reporter construct comprises a nucleic acid sequence encoding an RNA aptamer that can bind and enhance the fluorescence of a fluorophore.

7. The test kit according to claim 6, wherein the RNA aptamer is selected from Spinach, Spinach 2, iSpinach, Broccoli, and Mango.

8. The test kit according to claim 7, wherein the Mango aptamer is selected from MangoⅠ, MangoⅡ, MangoⅢ, and MangoⅣ.

9. The test kit according to claim 8, wherein the fluorophore is selected from 3,5-difluoro-4-hydroxybenzylidene imidazolinone (DFHBI) and thiazole orange 1 (TO-1).

10. The test kit according to claim 1, wherein the steroid hormone receptor is selected from androgen receptor, estrogen receptor, progesterone receptor, mineralocorticoid receptor, and glucocorticoid receptor.

11. The test kit according to claim 1, wherein the ligand is a performance-enhancing drug, or wherein the ligand has an unknown chemical structure.

12. The test kit according to claim 1, wherein the sample is a biological sample derived from an animal selected from horses, dogs, camels, cows, pigs, sheep, goats, birds, apes, mice, rabbits, deer, fish, and humans.

13. An in vitro assay method for detecting a ligand in a test sample, the ligand being capable of forming a complex with a steroid hormone receptor and binding to a nucleic acid response element, the assay method comprising the steps of: (i) providing an assay reagent, which comprises: a. A steroid hormone receptor that forms a receptor-ligand complex with a ligand from a test sample; and b. A nucleic acid response element bound by a receptor-ligand complex; c. A transcription-based reporter gene construct operably linked to a nucleic acid sequence; and d. None, one, two, three, four, or all five of a steroid hormone receptor cofactor, a transcription machinery, a translation machinery, a steroid metabolism machinery, and a cell-free extract (ii) combining a test sample with an in vitro assay reagent, wherein the relative content of the steroid hormone receptor to the nucleic acid response element in (ii) is x:1, where x is the content of the steroid hormone receptor and is defined as [0.2 ≤ x ≤ 20], and wherein, when the sample is combined with the assay reagent and binding between the receptor-ligand complex and the nucleic acid response element is detected, the presence of the ligand in the sample is assayed.

14. The assay method according to claim 13, wherein the sample is a biological sample derived from an animal, and the presence of the ligand in the sample indicates doping in the animal.

15. A manufactured article for assaying the use of a sports doping agent in an animal, the manufactured article comprising a test kit according to claim 1 or claim 4 and instructions for detecting the presence of a ligand in a test sample derived from an animal, wherein the presence of the ligand in the sample indicates the use of a doping agent in the animal.

Images