Pulmonary nodule diagnostic marker and application

Abstract

The application discloses a lung nodule diagnosis marker and application, and belongs to the technical field of biotechnology detection. The application provides the use of one or more of PLA2G6, PLA2G7, AKR1C1, AKR1C3, LTA4H and PTGER4 genes as biomarker molecules for diagnosing pulmonary sarcoidosis. The use of the biomarkers can assist biopsy and help diagnose related lung diseases. The genes for identifying sarcoidosis provided by the application have an accuracy rate (area under the ROC curve) of 96.5%, 90.9%, 89.1%, 87.5%, 87.2% and 85.8% for distinguishing healthy people, lung adenocarcinoma patients and pulmonary tuberculosis patients in sequence, and the comprehensive accuracy rate is 90.9%. The application collects a certain amount of clinical samples for research and verification, and the research results are in line with clinical practice, and have a good clinical application prospect.

Description

TECHNICAL FIELD

[0001] The present application relates to lung nodule diagnostic markers and applications, in particular to the development of kits and other products for diagnosing lung nodule disease using patient lung tissue samples, belonging to the field of biotechnology detection technology. BACKGROUND

[0002] Lung nodule (sarcoidosis) is a multi-systemic and multi-organ granulomatous disease of unknown etiology, often affecting the lungs, bilateral hilar lymph nodes, eyes, skin and other organs, with a chest invasion rate of 80% to 90%. Clinically, lung nodule has very similar symptoms, pathological characteristics and imaging results to many other chronic lung diseases, such as lung cancer and tuberculosis, posing a great challenge to differential diagnosis. Lung cancer is the most common type of cancer that causes human death, with more than 1.7 million people dying from lung cancer worldwide in 2018. Among them, lung adenocarcinoma is the most common subtype of lung cancer. Sarcoidosis is an autoimmune disease of unknown etiology, often occurring in the lungs, forming granuloma structures similar to tuberculosis, thus causing misdiagnosis. Tuberculosis, lung adenocarcinoma and lung nodule disease are common and widely distributed chronic inflammatory lung diseases worldwide. Therefore, screening specific biomarker molecules for the above diseases and applying them to the development of related differential diagnosis kits are of great significance for the timely diagnosis and treatment of these diseases.

[0003] Clinically, the differential diagnosis of the above diseases often involves biopsy, which is based on histopathological characteristics. However, as mentioned above, tuberculosis, lung adenocarcinoma and lung nodule disease are not easily distinguishable in many cases, so effective disease-specific lung tissue biomarkers are needed for auxiliary detection and judgment. SUMMARY

[0004] The present application provides specific lung tissue biomarker molecules for lung nodule disease, which can be used to distinguish these diseases through simple immunohistochemical staining or real-time fluorescent quantification, and are very suitable for the development of related disease detection, diagnosis and differential kit.

[0005] The first object of the present application is to provide PTGER4, AKR1C1, PLA2G6, LTA4H, PLA2G7, AKR1C3 alone or in combination as lung nodule disease diagnostic markers.

[0006] In one embodiment, the application is the use of a gene fragment specifically amplifying PTGER4, AKR1C1, PLA2G6, LTA4H, PLA2G7 or AKR1C3 for preparing a reagent for assisting in diagnosing pulmonary sarcoidosis, or detecting the presence of pulmonary sarcoidosis, or selecting a reagent for reducing the risk of a patient developing pulmonary sarcoidosis, or in vitro identifying a candidate reagent for treating pulmonary sarcoidosis, or evaluating the likelihood of a patient benefiting from treatment with a reagent for reducing the risk of pulmonary sarcoidosis, or a kit for evaluating the likelihood of a patient benefiting from treatment with an antibody or antigen-binding fragment for reducing the risk of pulmonary sarcoidosis.

[0007] In one embodiment, the nucleotide sequence of PTGER4 is shown as SEQ ID NO. 1; the nucleotide sequence of AKR1C1 is shown as SEQ ID NO. 2; the nucleotide sequence of PLA2G6 is shown as SEQ ID NO. 3; the nucleotide sequence of LTA4H is shown as SEQ ID NO. 4; the nucleotide sequence of PLA2G7 is shown as SEQ ID NO. 5; and the nucleotide sequence of AKR1C3 is shown as SEQ ID NO. 6.

[0008] In one embodiment, the detection product contains primers and / or probes capable of specifically amplifying the PTGER4 gene; the primer sequence is AGGGCTATCATCATCCTACAACTCA and TAGGTCTTCGCAGCCATCAAG.

[0009] In one embodiment, the detection product contains primers and / or probes capable of specifically amplifying the AKR1C1 gene; the primer sequence is TTCATGCCTGTCCTGGGATTT and CTGGCTTTACAGACACTGGAAAA.

[0010] In one embodiment, the detection product contains primers and / or probes capable of specifically amplifying the PLA2G6 gene; the primer sequence is TTTGGCCGCCTGGTCAATAC and CTCCCGAACTCGGTCACTC.

[0011] In one embodiment, the detection product contains primers and / or probes capable of specifically amplifying the LTA4H gene; the primer sequence is AGACAAAGTTACAAGGGATCGC and AGATATGGGTGTTCCTTCCCAG.

[0012] In one embodiment, the detection product comprises primers and / or probes capable of specifically amplifying the PLA2G7 gene; the primer sequences are TCATCAGCATGGGTCAACAAAA and CCAAAGGGTGTCAAGGCGAT.

[0013] In one embodiment, the detection product comprises primers and / or probes capable of specifically amplifying the AKR1C3 gene; the primer sequences are GTCATCCGTATTTCAACCGGAG and CCACCCATCGTTTGTCTCGTT.

[0014] In one embodiment, the mRNA levels of PLA2G6, PLA2G7, AKR1C1, AKR1C3, LTA4H, and PTGER4 are evaluated with ACTB and 18S rRNA as internal reference genes.

[0015] In one embodiment, the specific primers for ACTB are CATGTACGTTGCTATCCAGGC and CTCCTTAATGTCACGCACGAT.

[0016] In one embodiment, the specific primers for 18S rRNA are CGAACGTCTGCCCTATCAACT and ACCCGTGGTCACCATGGTAG.

[0017] A second object of the present application is to provide the use of a reagent for detecting the markers in the preparation of a detection product for pulmonary sarcoidosis.

[0018] In one embodiment, the reagent comprises PCR amplification primers used in the detection of the expression level of the markers by SYBR Green, TaqMan probes, molecular beacons, dual hybridization probes, or complex probes.

[0019] In one embodiment, the detection product detects the expression of at least one of the genes PTGER4, AKR1C1, PLA2G6, LTA4H, PLA2G7, or AKR1C3 in a sample by fluorescence quantitative PCR, Southern hybridization, Northern hybridization, fluorescence in situ hybridization, DNA microarray, high-throughput sequencing method, or immunological method.

[0020] In one embodiment, the immunological method comprises ELISA, radioimmunoassay, immunohistochemistry, and Western blotting.

[0021] In an embodiment, the detection product comprises primers and / or probes capable of specifically amplifying at least one gene of PTGER4, AKR1C1, PLA2G6, LTA4H, PLA2G7 or AKR1C3; or antibodies capable of specifically binding to the corresponding protein.

[0022] In an embodiment, the sample is tissue or peripheral blood.

[0023] In an embodiment, the detection product comprises a diagnostic reagent, a kit, a chip, a test paper or a high-throughput sequencing platform.

[0024] In an embodiment, the chip comprises nucleic acids or antibodies that bind to the marker or its DNA sequence.

[0025] In an embodiment, the test paper comprises nucleic acids or antibodies that bind to the marker or its DNA sequence.

[0026] In an embodiment, the high-throughput sequencing platform comprises nucleic acids or antibodies that bind to the marker or its DNA sequence.

[0027] In an embodiment, the kit comprises nucleic acids or antibodies that bind to the marker or its DNA sequence.

[0028] In some embodiments, the kit can comprise a DNA extraction reagent and a bisulfite reagent.

[0029] In some embodiments, the DNA extraction reagent can comprise a lysis buffer, a binding buffer, a washing buffer and an elution buffer; the lysis buffer generally consists of a protein denaturant, a detergent, a pH buffer and a nuclease inhibitor; the binding buffer generally consists of a protein denaturant and a pH buffer. The washing buffer is divided into washing buffer A and washing buffer B: washing buffer A consists of a protein denaturant, a nuclease inhibitor, a detergent, a pH buffer and ethanol; washing buffer B consists of a nuclease inhibitor, a pH buffer and ethanol; the elution buffer generally consists of a nuclease inhibitor and a pH buffer.

[0030] In an embodiment, the protein denaturant is selected from one or more of guanidinium isothiocyanate, guanidine hydrochloride and urea; the detergent is selected from one or more of Tween 20, IGEPAL CA-630, Triton X-100, NP-40 and SDS; the pH buffer is selected from one or more of Tris, boric acid, phosphate, MES and HEPES; the nuclease inhibitor is selected from one or more of EDTA, EGTA and DEPC.

[0031] In an embodiment, the bisulfite reagent comprises a bisulfite buffer and a protection buffer; wherein the bisulfite is selected from one or more of sodium metabisulfite, sodium sulfite, sodium bisulfite, ammonium bisulfite and ammonium sulfite; and the protection buffer is composed of an oxygen radical scavenger selected from one or more of hydroquinone, vitamin E, vitamin E derivatives, gallic acid, Trolox, trihydroxybenzoic acid and trihydroxybenzoic acid derivatives.

[0032] The present application also provides a method for detecting pulmonary sarcoidosis, comprising the following steps:

[0033] (1) obtaining a lung tissue sample to be detected from a subject;

[0034] (2) detecting the expression level of the aforementioned marker in the ex vivo sample obtained in step (1);

[0035] (3) comparing the expression level of the marker measured in step (2) with a control.

[0036] In an embodiment, the expression level of PLA2G6 is more than 2.851 times that of the control, or the expression level of PLA2G7 is more than 3.347 times that of the control, or the expression level of AKR1C1 is more than 9.366 times that of the control, or the expression level of AKR1C3 is more than 5.588 times that of the control, or the expression level of LTA4H is more than 3.132-7.494 times that of the control, or the expression level of PTGER4 is more than 4.699 times that of the control, or the total expression level of the aforementioned genes is more than 7.677 times that of the control, is considered to have pulmonary sarcoidosis.

[0037] The present application also claims the use of the diagnostic markers in screening drugs for reducing the risk of pulmonary sarcoidosis, or screening agents for reducing the risk of pulmonary sarcoidosis.

[0038] In an embodiment, the screening is performed by ex vivo experiments.

[0039] Beneficial effects: The present application provides biomarker molecules that can aid in the differential diagnosis of pulmonary sarcoidosis. The use of these markers can assist in the diagnosis of related lung diseases by biopsy. The genes PLA2G6, PLA2G7, AKR1C1, AKR1C3, LTA4H and PTGER4 provided by the present application for identifying sarcoidosis have an accuracy rate (area under the ROC curve) of 0.965, 0.909, 0.891, 0.875, 0.872 and 0.858, respectively, in distinguishing between healthy subjects, lung adenocarcinoma patients and pulmonary tuberculosis patients, and a comprehensive accuracy rate of 0.909. The present application collects a certain amount of clinical samples for research and verification, and the research results are consistent with the clinical practice, and have good clinical application prospects. BRIEF DESCRIPTION OF DRAWINGS

[0040] Figure 1 Results of qPCR analysis of the differences in the expression of markers in different samples; (A) is PLA2G6 mRNA, (B) is PLA2G7 mRNA, (C) is AKR1C1 mRNA, (D) is AKR1C3 mRNA, (E) is LTA4H mRNA, (F) is PTGER4 mRNA; NC, normal lung tissue sample group; TB, lung tissue sample group of patients with pulmonary tuberculosis; AD, lung tissue sample group of patients with lung adenocarcinoma; SA, lung tissue sample group of patients with pulmonary sarcoidosis.

[0041] Figure 2 (A) is the redundancy analysis (RDA) of the expression amounts of PLA2G6, PLA2G7, AKR1C1, AKR1C3, LTA4H and PTGER4 in various samples; (B) is the receiver operating characteristic (ROC) analysis of the expression amounts of genes PLA2G6, PLA2G7, AKR1C1, AKR1C3, LTA4H and PTGER4 in various samples; NC, normal lung tissue sample group; TB, lung tissue sample group of patients with pulmonary tuberculosis; AD, lung tissue sample group of patients with lung adenocarcinoma; SA, lung tissue sample group of patients with pulmonary sarcoidosis.

[0042] Figure 3Expression of different genes in lung tissues of patients with pulmonary sarcoidosis and normal persons, patients with pulmonary tuberculosis and patients with lung adenocarcinoma; (A), PLA2G4A mRNA; (B), PLA2G4B mRNA; (C), PLA2G4C mRNA; (D), PLA2G4D mRNA; (E), PLA2G4E mRNA; (F), PLA2G4F mRNA; (G), PTGS1 mRNA; (H), PTGS2 mRNA; (I), ALOX5 mRNA; (J) ALOX12B mRNA; (K), ALOX15B mRNA; (L), AKR1B1 mRNA; (M), AKR1C2 mRNA; (N), CBR1 mRNA; (O), PTGES mRNA; (P), PTGES2 mRNA; (Q), PTGES3 mRNA; (R), LTC4S mRNA; (S), GGT1 mRNA; (T), DPEP1 mRNA; (U), PTGDR mRNA; (V), PTGDR2 mRNA; (W), GLRA3 mRNA; (X), PTGER1 mRNA; (Y), PTGER2 mRNA; (Z), PTGER3 mRNA; (AA), PTGFR mRNA; (AB), FPR2 mRNA; (AC), GPR32 mRNA; (AD) LTB4R mRNA; (AE), LTB4R2 mRNA; (AF), CYSLTR1 mRNA; (AG), CYSLTR2 mRNA; NC, normal lung tissue sample group; TB, lung tuberculosis patient lung tissue sample group; AD, lung adenocarcinoma patient lung tissue sample group; SA, lung sarcoidosis patient lung tissue sample group. DETAILED DESCRIPTION

[0043] In the context of the present application, "diagnosis" includes judging whether a subject has already been ill, judging whether a subject is at risk of being ill, judging whether a patient has already relapsed, judging the responsiveness of a patient to a drug treatment, or judging the prognosis of a patient.

[0044] In the context of the present application, the term "marker" as used herein means a label allowing to distinguish between normal and disease states, or enabling the prediction or objective measurement of a treatment outcome. In particular, in the context of a disease, a marker means an organic biomolecule, such as a polypeptide or a nucleic acid (e.g. mRNA, etc.), a lipid, a glycolipid, a glycoprotein, a sugar (monosaccharide, disaccharide, oligosaccharide, etc.), the expression level of which is significantly increased or decreased in a subject suffering from pulmonary sarcoidosis, or in a subject at risk of developing pulmonary sarcoidosis, compared to a normal control (a subject not suffering from the corresponding disease).

[0045] Example 1 The mRNA levels of PTGER4, AKR1C1, PLA2G6, LTA4H, PLA2G7 and AKR1C3 were significantly increased in the lung tissue of patients with pulmonary sarcoidosis

[0046] 1) Obtain lung tissue samples from patients with pulmonary tuberculosis (TB), lung adenocarcinoma (AD) and pulmonary sarcoidosis (SA) (n = 35, 48 and 21, respectively) to be detected, and use the normal tissue adjacent to the lung adenocarcinoma as the normal lung tissue control (NC; n = 40).

[0047] 2) Grind the lung tissue samples, extract and purify the mRNA using RNeasy Plus Mini Kit (Qiagen), and then reverse transcribe the cDNA using the 1st Strand cDNA Synthesis SuperMix (Yeasen) kit.

[0048] 3) Use the Applied Biosystems 7500 Real-Time PCR system to perform qPCR analysis on the above cDNA samples to detect the mRNA levels of PLA2G6, PLA2G7, AKR1C1, AKR1C3, LTA4H and PTGER4. ACTB and 18S rRNA are used as internal reference genes. The primers used are as follows:

[0049] Table 1 Primers for amplifying marker genes

[0050]

[0051] 4) Use the R packages of randomForest 4.6.14 and the R package of vegan 2.5.6 to perform redundancy analysis (RA) to determine the correlation of PLA2G6, PLA2G7, AKR1C1, AKR1C3, LTA4H and PTGER4 with each group of samples.

[0052] 5) Use IBM SPSS Statistics 22.0 software to analyze the area under the ROC curve of PTGER4, AKR1C1, PLA2G6, LTA4H, PLA2G7 and AKR1C3 as diagnostic markers for pulmonary sarcoidosis for distinguishing between healthy individuals, lung adenocarcinoma patients and pulmonary tuberculosis patients.

[0053] The results are as follows Figure 1 ​As shown in the box plot, compared with the NC group, the mRNA levels of PLA2G6, PLA2G7, AKR1C1, AKR1C3, LTA4H, and PTGER4 were significantly increased in the SA group, while no significant changes were observed in the TB and AD groups. The expression levels of PLA2G6 were 8.981 ± 2.939 (mean ± standard error), ranging from 2.851 to 15.11 (95% confidence interval); PLA2G7 was 7.937 ± 2.201 (mean ± standard error), ranging from 3.347 to 12.53 (95% confidence interval); AKR1C1 was 17.02 ± 3.671 (mean ± standard error), ranging from 9.366 to 24.68 (95% confidence interval); and AKR1C3 was 8.475 ± 1.384 (mean ± standard error). 0.588-11.36 (95% confidence interval); LTA4H expression level was 5.313±1.046 (mean difference ± standard error), 3.132-7.494 (95% confidence interval); PTGER4 expression level was 11.91±3.459 (mean difference ± standard error), 4.699-19.13 (95% confidence interval); total expression level (average of the expression levels of 6 genes in each sample) was 9.941±1.085 (mean difference ± standard error), 7.677-12.2 (95% confidence interval).

[0054] like Figure 2 As shown in Figure A, the direction of the arrows indicates a positive correlation between the expression level of each marker and the sample, and the length of the arrows indicates the strength of the correlation. The figure shows that PLA2G6, PLA2G7, AKR1C1, AKR1C3, LTA4H, and PTGER4 are positively correlated with samples from the SA group, while they are negatively correlated or have weak correlations with samples from other groups.

[0055] like Figure 2 As shown in Figure B, the receiver operating characteristic (ROC) curve and area under the curve (AUC) were used to evaluate the ability of PLA2G6, PLA2G7, AKR1C1, AKR1C3, LTA4H, and PTGER4 as differential diagnostic biomarkers for pulmonary sarcoidosis to differentiate between healthy individuals, patients with lung adenocarcinoma, and patients with pulmonary tuberculosis. The ROC curves were 0.965, 0.909, 0.891, 0.875, 0.872, and 0.858, respectively, with a combined AUC of 0.909. These results suggest that PLA2G6, PLA2G7, AKR1C1, AKR1C3, LTA4H, and PTGER4 have high diagnostic ability as biomarkers.

[0056] Example 2: Preparation and Use of the Detection Kit

[0057] The nucleotide sequences shown in Table 1 were synthesized and used as primers for amplifying internal reference genes and biomarkers.

[0058] For convenience, the kit can also comprise a control: the cDNA sequence of a normal human lung tissue sample.

[0059] The method of using the kit is as follows: take a lung tissue sample of a subject, extract RNA from the lung tissue sample using a conventional method (or using a specific kit), use the reagents in the detection kit, and use the cDNA sequence of a normal lung tissue sample in the kit as a control cDNA in Real-Time PCR quantitative detection, to detect the relative expression change of at least one gene in SEQ ID NO. 1-6 in the lung tissue of the subject.

[0060] PLA2G6 expression is more than 2.851 times that of the control, or PLA2G7 expression is more than 3.347 times that of the control, or AKR1C1 expression is more than 9.366 times that of the control, or AKR1C3 expression is more than 5.588 times that of the control, or LTA4H expression is more than 3.132-7.494 times that of the control, or PTGER4 expression is more than 4.699 times that of the control, or the total expression of the above genes is more than 7.677 times that of the control, is considered to have a lung nodule.

[0061] Application of the marker in Example 3 in clinical diagnosis

[0062] According to the method of Example 1, a plurality of subjects were detected respectively, and the detection results were compared with the results of the current diagnostic methods (such as blood test, nodule antigen test, biopsy, lung X-ray examination, chest computer tomography, etc.). The results showed that the diagnostic results obtained by detecting the diagnostic markers of the present application were consistent with the pathological diagnostic results.

[0063] Comparative Example

[0064] According to the same strategy as in Example 1, primers were also designed to detect the mRNA levels of the coding genes of other major enzymes and receptors in the arachidonic acid metabolism pathway, in addition to PLA2G6, PLA2G7, AKR1C1, AKR1C3, LTA4H and PTGER4. The primers used are as follows:

[0065] Table 2 Primers for amplifying different genes

[0066]

[0067]

[0068] As Figure 3As shown, the specificity of the expression level of these genes in the lung of the patient with pulmonary sarcoidosis is not as strong as the specificity of the above-mentioned 6 genes screened out in Example 1.

[0069] Although the present application has been disclosed with reference to the preferred embodiments, it is not intended to limit the application, and any person skilled in the art can make various modifications and modifications without departing from the spirit and scope of the application, and the protection scope of the application should be defined by the claims. SEQUENCE LISTING <110> Institute of Microbiology, Chinese Academy of Sciences <120> Lung nodule diagnosis marker and application <160> 18 <170> PatentIn version 3.3 <210> 1 <211> 1467 <212> DNA <213> Homo sapiens <400> 1 atgtccactc ccggggtcaa ttcgtccgcc tccttgagcc ccgaccggct gaacagccca 60 gtgaccatcc cggcggtgat gttcatcttc ggggtggtgg gcaacctggt ggccatcgtg 120 gtgctgtgca agtcgcgcaa ggagcagaag gagacgacct tctacacgct ggtatgtggg 180 ctggctgtca ccgacctgtt gggcactttg ttggtgagcc cggtgaccat cgccacgtac 240 atgaagggcc aatggcccgg gggccagccg ctgtgcgagt acagcacctt cattctgctc 300 ttcttcagcc tgtccggcct cagcatcatc tgcgccatga gtgtcgagcg ctacctggcc 360 atcaaccatg cctatttcta cagccactac gtggacaagc gattggcggg cctcacgctc 420 tttgcagtct atgcgtccaa cgtgctcttt tgcgcgctgc ccaacatggg tctcggtagc 480 tcgcggctgc agtacccaga cacctggtgc ttcatcgact ggaccaccaa cgtgacggcg 540 cacgccgcct actcctacat gtacgcgggc ttcagctcct tcctcattct cgccaccgtc 600 ctctgcaacg tgcttgtgtg cggcgcgctg ctccgcatgc accgccagtt catgcgccgc 660 acctcgctgg gcaccgagca gcaccacgcg gccgcggccg cctcggttgc ctcccggggc 720 caccccgctg cctccccagc cttgccgcgc ctcagcgact ttcggcgccg ccggagcttc 780 cgccgcatcg cgggcgccga gatccagatg gtcatcttac tcattgccac ctccctggtg 840 gtgctcatct gctccatccc gctcgtggtg cgagtattcg tcaaccagtt atatcagcca 900 agtttggagc gagaagtcag taaaaatcca gatttgcagg ccatccgaat tgcttctgtg 960 aaccccatcc tagacccctg gatatatatc ctcctgagaa agacagtgct cagtaaagca 1020 atagagaaga tcaaatgcct cttctgccgc attggcgggt cccgcaggga gcgctccgga 1080 cagcactgct cagacagtca aaggacatct tctgccatgt caggccactc tcgctccttc 1140 atctcccggg agctgaagga gatcagcagt acatctcaga ccctcctgcc agacctctca 1200 ctgccagacc tcagtgaaaa tggccttgga ggcaggaatt tgcttccagg tgtgcctggc 1260 atgggcctgg cccaggaaga caccacctca ctgaggactt tgcgaatatc agagacctca 1320 gactcttcac agggtcagga ctcagagagt gtcttactgg tggatgaggc tggtgggagc 1380 ggcagggctg ggcctgcccc taaggggagc tccctgcaag tcacatttcc cagtgaaaca 1440 ctgaacttat cagaaaaatg tatataa 1467 <210> 2 <211> 972 <212> DNA <213> Homo sapiens <400> 2 atggattcga aatatcagtg tgtgaagctg aatgatggtc acttcatgcc tgtcctggga 60 tttggcacct atgcgcctgc agaggttcct aaaagtaaag cttagaggc caccaaattg 120 gcaattgaag ctggcttccg ccatattgat tctgctcatt tatacaataa tgaggagcag 180 gttggactgg ccatccgaag caagattgca gatggcagtg tgaagagaga agacatattc 240 tacacttcaa agctttggtg caattcccat cgaccagagt tggtccgacc agccttggaa 300 aggtcactga aaaatcttca attggattat gttgacctct accttattca ttttccagtg 360 tctgtaaagc caggtgagga agtgatccca aaagatgaaa atggaaaaat actatttgac 420 acagtggatc tctgtgccac atgggaggcc gtggagaagt gtaaagatgc aggattggcc 480 aagtccatcg gggtgtccaa cttcaaccgc aggcagctgg agatgatcct caacaagcca 540 gggctcaagt acaagcctgt ctgcaaccag gtggaatgtc atccttactt caaccagaga 600 aaactgctgg atttctgcaa gtcaaaagac attgttctgg ttgcctatag tgctctggga 660 tcccaccgag aagaaccatg ggtggacccg aactccccgg tgctcttgga ggacccagtc 720 ctttgtgcct tggcaaaaaa gcacaagcga accccagccc tgattgccct gcgctaccag 780 ctacagcgtg gggttgtggt cctggccaag agctacaatg agcagcgcat cagacagaac 840 gtgcaggtgt ttgaattcca gttgacttca gaggagatga aagccataga tggcctaaac 900 agaaatgtgc gatatttgac ccttgatatt tttgctggcc cccctaatta tccattttct 960 gatgaatatt aa 972 <210> 3 <211> 2421 <212> DNA <213> Homo sapiens <400> 3 atgcagttct ttggccgcct ggtcaatacc ttcagtggcg tcaccaactt gttctctaac 60 ccattccggg tgaaggaggt ggctgtggcc gactacacct cgagtgaccg agttcgggag 120 gaagggcagc tgattctgtt ccagaacact cccaaccgca cctgggactg cgtcctggtc 180 aaccccagga actcacagag tggattccga ctcttccagc tggagttgga ggctgacgcc 240 ctagtgaatt tccatcagta ttcttcccag ctgctaccct tctatgagag ctcccctcag 300 gtcctgcaca ctgaggtcct gcagcacctg accgacctca tccgtaacca ccccagctgg 360 tcagtggccc acctggctgt ggagctaggg atccgcgagt gcttccatca cagccgtatc 420 atcagctgtg ccaattgcgc ggagaacgag gagggctgca cacccctgca cctggcctgc 480 cgcaagggtg atggggagat cctggtggag ctggtgcagt actgccacac tcagatggat 540 gtcaccgact acaagggaga gaccgtcttc cattatgctg tccagggtga caattctcag 600 gtgctgcagc tccttggaag gaacgcagtg gctggcctga accaggtgaa taaccaaggg 660 ctgaccccgc tgcacctggc ctgccagctg gggaagcagg agatggtccg cgtgctgctg 720 ctgtgcaatg ctcggtgcaa catcatgggc cccaacggct accccatcca ctcggccatg 780 aagttctctc agaaggggtg tgcggagatg atcatcagca tggacagcag ccagatccac 840 agcaaagacc cccgttacgg agccagcccc ctccactggg ccaagaacgc agagatggcc 900 cgcatgctgc tgaaacgggg ctgcaacgtg aacagcacca gctccgcggg gaacacggcc 960 ctgcacgtgg cggtgatgcg caaccgcttc gactgtgcca tagtgctgct gacccacggg 1020 gccaacgcgg atgcccgcgg agagcacggc aacaccccgc tgcacctggc catgtcgaaa 1080 gacaacgtgg agatgatcaa ggccctcatc gtgttcggag cagaagtgga caccccgaat 1140 gactttgggg agactcctac attcctagcc tccaaaatcg gcagacttgt caccaggaag 1200 gcgatcttga ctctgctgag aaccgtgggg gccgaatact gcttcccacc catccacggg 1260 gtccccgcgg agcagggctc tgcagcgcca catcatccct tctccctgga aagagctcag 1320 cccccaccga tcagcctaaa caacctagaa ctacaggatc tcatgcacat ctcacgggcc 1380 cggaagccag cgttcatcct gggctccatg agggacgaga agcggaccca cgaccacctg 1440 ctgtgcctgg atggaggagg agtgaaaggc ctcatcatca tccagctcct catcgccatc 1500 gagaaggcct cgggtgtggc caccaaggac ctgtttgact gggtggcggg caccagcact 1560 ggaggcatcc tggccctggc cattctgcac agtaagtcca tggcctacat gcgcggcatg 1620 tactttcgca tgaaggatga ggtgttccgg ggctccaggc cctacgagtc ggggcccctg 1680 gaggagttcc tgaagcggga gtttggggag cacaccaaga tgacggacgt caggaaaccc 1740 aaggtgatgc tgacagggac actgtctgac cggcagccgg ctgaactcca cctcttccgg 1800 aactacgatg ctccagaaac tgtccgggag cctcgtttca accagaacgt taacctcagg 1860 cctccagctc agccctcaga ccagctggtg tggcgggcgg cccgaagcag cggggcagct 1920 cctacttact tccgacccaa tgggcgcttc ctggacggtg ggctgctggc caacaacccc 1980 acgctggatg ccatgaccga gatccatgag tacaatcagg acctgatccg caagggtcag 2040 GAGAAGCCAACAAGGTGAAGAAACTCTCCATCGTTGTCTCCCTGGGGACAGGGAGGTCCCCACA A 2100 GTGCCTGTGACCTGTGTGGATGTCTTCCGTC CCA GCAACCCTGGGAGCTGGCC AAGACT 2160 GTTTTTGGGGCCAAGGAAC TGGGCAAGATGGTG GTGGACTGTTGCACGGATCCAGACGGG 2220 C GGGCTGTGG ACCGGGCACGGGCCTGGTGCGAGATGGTCGGCATCCAGTACTTCAGATTG 2280 AACCCCCAGCTGGGGACGGACATCATGCTGGATGAGGTCA GTGACACAGT GCTG GTCAAC 2340 GCCCTCTGGGAGACC GAGGTCTACATCTATGAGCACCGCGAGGAGTTCCAGAAGCTCATC 2400 CAGCTGCTGCTCTCACCCTGA 2421 <210> 4 <211> 1836 <212> DNA <213> Homo sapiens <400> 4 ATGCCGAGATAGTGGATA CCTGTTCGTTGGCCTCTCCGGCTTCCGTCTGCCGGACCAAG 60 CACCTGCACCTGCGCTGCAGC GTCGACTTTACTCGCCGGACGCTGACC GGGACTGCTGCT 120 CTCACG GTCAGTCTCAGGAGGACAATCTGC GCAGCCTGGTTTGGATA CAAAGGACCTT 180 ACAATAGAAAAAGTAGTGATCAATGGACAAGAAGTCAAA TATGCTCTTGGAGAAAGACAA 240 AGTTACAAGG GATCGCCAAT GGAAATCTCT CTTCCTATCG CTTTGAGCAA AAATCAAGAA 300 ATTGTTATAG AAATTTCTTT TGAGACCTCT CCAAATCTT CTGCTCTCCAGTGGCTC ACT 360 CCTGAACAGACTTCTGGGAAGGAACACCCATATCTCTTTAGTCAGTGCCAGGCCATCCAC 420 TGCAGAGCAATCCTTCCTTGT CAGGACACT CCTTCTGTGA AATTAACCTA TACTGCAGAG 480 GTGTCTGTCCC TAAAGA ACT GGTGGC ACTT ATGAGTGCT ATTCGTGATGG AGAAACACCT 540 GACCCAGAAG ACCCAAGCAG GAAAATATA CAAATT CATCC AAAAGTTCC AATACCCTGC 600 TACCTGATTG CTTTAGTTGT TGGAGCTTTA GAAAGCAGGC AAATTGGCCC AAGA ACTTTG 660 GTGTGGTCTG AGAAAGAGCA GGTGGAAAAG TCTGCTTATG AGTTTTCTGA GACTGAA TCT 720 ATGCTTAAAA TAGCAGAGAT CTGGGAGGAC CGTATGTATG GGGACAGTAT GACCTATTG 780 GTCCTGCCAC CATCCTTCCC TTATGGTGCA TGGAGAATC CTTGCCTTAC TTTTGTAAC T 840 CCTACTCTAC TGGCAGGCGA CAAGTCAC TCTCCAATG TCA TTGCACATG AAATATCTC AT 900 AGCTGGACAG GGAATCTAGT GACCAACAAA ACTTGGGATC ACTTTTG GTT AAATGAGGGA 960 catactgtgt acttggaacg ccacatttgc ggacgattgt ttggtgaaaa gttcagacat 1020 tttaatgctc tgggaggatg gggagaacta cagaattcgg taaagacatt tggggagaca 1080 catcctttca ccaaacttgt ggttgatctg acagatatag accctgatgt agcttattct 1140 tcagttccct atgagaaggg ctttgcttta cttttttacc ttgaacaact gcttggagga 1200 ccagagattt tcctaggatt cttaaaagct tatgttgaga agttttccta taagagcata 1260 actactgatg actggaagga tttcctgtat tcctatttta aagataaggt tgatgttctc 1320 aatcaagttg attggaatgc ctggctctac tctcctggac tgcctcccat aaagcccaat 1380 tatgatatga ctctgacaaa tgcttgtatt gccttaagtc aaagatggat tactgccaaa 1440 gaagatgatt taaattcatt caatgccaca gacctgaagg atctctcttc tcatcaattg 1500 aatgagtttt tagcacagac gctccagagg gcacctcttc cattggggca cataaagcga 1560 atgcaagagg tgtacaactt caatgccatt aacaattctg aaatacgatt cagatggctg 1620 cggctctgca ttcaatccaa gtgggaggac gcaattcctt tggcgctaaa gatggcaact 1680 gaacaaggaa gaatgaagtt tacccggccc ttattcaagg atcttgctgc ctttgacaaa 1740 tcccatgatc aagctgtccg aacctaccaa gagcacaaag caagcatgca tcccgtgact 1800 gcaatgctgg tggggaaaga cttaaaagtg gattaa 1836 <210> 5 <211> 1326 <212> DNA <213> Homo sapiens <400> 5 atggtgccac ccaaattgca tgtgcttttc tgcctctgcg gctgcctggc tgtggtttat 60 ccttttgact ggcaatacat aaatcctgtt gcccatatga aatcatcagc atgggtcaac 120 aaaatacaag tactgatggc tgctgcaagc tttggccaaa ctaaaatccc ccggggaaat 180 gggccttatt ccgttggttg tacagactta atgtttgatc acactaataa gggcaccttc 240 ttgcgtttat attatccatc ccaagataat gatcgccttg acaccctttg gatcccaaat 300 aaagaatatt tttggggtct tagcaaattt cttggaacac actggcttat gggcaacatt 360 ttgaggttac tctttggttc aatgacaact cctgcaaact ggaattcccc tctgaggcct 420 ggtgaaaaat atccacttgt tgttttttct catggtcttg gggcattcag gacactttat 480 tctgctattg gcattgacct ggcatctcat gggtttatag ttgctgctgt agaacacaga 540 gatagatctg catctgcaac ttactatttc aaggaccaat ctgctgcaga aataggggac 600 aagtcttggc tctaccttag aaccctgaaa caagaggagg agacacatat acgaaatgag 660 caggtacggc aaagagcaaa agaatgttcc caagctctca gtctgattct tgacattgat 720 catggaaagc cagtgaagaa tgcattagat ttaaagtttg atatggaaca actgaaggac 780 tctattgata gggaaaaaat agcagtaatt ggacattctt ttggtggagc aacggttatt 840 cagactctta gtgaagatca gagattcaga tgtggtattg ccctggatgc atggatgttt 900 ccactgggtg atgaagtata ttccagaatt cctcagcccc tcttttttat caactctgaa 960 tatttccaat atcctgctaa tatcataaaa atgaaaaaat gctactcacc tgataaagaa 1020 agaaagatga ttacaatcag gggttcagtc caccagaatt ttgctgactt cacttttgca 1080 actggcaaaa taattggaca catgctcaaa ttaaagggag acatagattc aaatgtagct 1140 attgatctta gcaacaaagc ttcattagca ttcttacaaa agcatttagg acttcataaa 1200 gattttgatc agtgggactg cttgattgaa ggagatgatg agaatcttat tccagggacc 1260 aacattaaca caaccaatca acacatcatg ttacagaact cttcaggaat agagaaatac 1320 aattag 1326 <210> 6 <211> 972 <212> DNA <213> Homo sapiens <400> 6 atggattcca aacaccagtg tgtaaagcta aatgatggcc acttcatgcc tgtattggga 60 tttggcacct atgcacctcc agaggttccg agaagtaaag ctttggaggt cacaaaatta 120 gcaatagaag ctgggttccg ccatatagat tctgctcatt tatacaataa tgaggagcag 180 gttggactgg ccatccgaag caagattgca gatggcagtg tgaagagaga agacatattc 240 tacacttcaa agctttggtc cacttttcat cgaccagagt tggtccgacc agccttggaa 300 aactcactga agaaagctca attggactat gttgacctct atcttattca ttctccaatg 360 tctctaaagc caggtgagga actttcacca acagatgaaa atggaaaagt aatatttgac 420 atagtggatc tctgtaccac ctgggaggcc atggagaagt gtaaggatgc aggattggcc 480 aagtccattg gggtgtcaaa cttcaaccgc aggcagctgg agatgatcct caacaagcca 540 ggactcaagt acaagcctgt ctgcaaccag gtagaatgtc atccgtattt caaccggagt 600 aaattgctag atttctgcaa gtcgaaagat attgttctgg ttgcctatag tgctctggga 660 tctcaacgag acaaacgatg ggtggacccg aactccccgg tgctcttgga ggacccagtc 720 ctttgtgcct tggcaaaaaa gcacaagcga accccagccc tgattgccct gcgctaccag 780 ctgcagcgtg gggttgtggt cctggccaag agctacaatg agcagcgcat cagacagaac 840 gtgcaggttt ttgagttcca gttgactgca gaggacatga aagccataga tggcctagac 900 agaaatctcc actattttaa cagtgatagt tttgctagcc accctaatta tccatattca 960 gatgaatatt aa 972 <210> 7 <211> 25 <212> DNA <213> Artificial Sequence <400> 7 agggctatca tcatcctaca actca 25 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <400> 8 taggtcttcg cagccatcaa g 21 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <400> 9 ttcatgcctg tcctgggatt t 21 <210> 10 <211> 23 <212> DNA <213> Artificial Sequence <400> 10 ctggctttac agacactgga aaa 23 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <400> 11 tttggccgcc tggtcaatac 20 <210> 12 <211> 19 <212> DNA <213> Artificial Sequence <400> 12 ctcccgaact cggtcactc 19 <210> 13 <211> 22 <212> DNA <213> Artificial Sequence <400> 13 agacaaagtt acaagggatc gc 22 <210> 14 <211> 22 <212> DNA <213> Artificial Sequence <400> 14 agatatgggt gttccttccc ag 22 <210> 15 <211> 22 <212> DNA <213> Artificial Sequence <400> 15 tcatcagcat gggtcaacaa aa 22 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <400> 16 ccaaagggtg tcaaggcgat 20 <210> 17 <211> 22 <212> DNA <213> Artificial Sequence <400> 17 gtcatccgta tttcaaccgg ag 22 <210> 18 <211> 21 <212> DNA <213> Artificial Sequence <400> 18 ccacccatcg tttgtctcgt t 21

Claims

1. The use of primers for amplifying the gene fragments of PTGER4, AKR1C1, PLA2G6, LTA4H, PLA2G7 and AKR1C3 in the preparation of a product for the detection and / or diagnosis of pulmonary sarcoidosis; characterized in that, The product is used for specifically recognizing pulmonary sarcoidosis in pulmonary tuberculosis, pulmonary adenocarcinoma and pulmonary sarcoidosis. The primer contains (a)-(f): (a) the DNA fragment as shown in SEQ ID NO. 7 and SEQ ID NO. 8; (b) the DNA fragment as shown in SEQ ID NO. 9 and SEQ ID NO. 10; (c) the DNA fragment as shown in SEQ ID NO. 11 and SEQ ID NO. 12; (d) the DNA fragment as shown in SEQ ID NO. 13 and SEQ ID NO. 14; (e) the DNA fragment as shown in SEQ ID NO. 15 and SEQ ID NO. 16; (f) the DNA fragment as shown in SEQ ID NO. 17 and SEQ ID NO.

18.

2. Use according to claim 1, characterized in that, The nucleotide sequence of the PTGER4 is shown in SEQ ID NO. 1; the nucleotide sequence of the AKR1C1 is shown in SEQ ID NO. 2; the nucleotide sequence of the PLA2G6 is shown in SEQ ID NO. 3; the nucleotide sequence of the LTA4H is shown in SEQ ID NO. 4; the nucleotide sequence of the PLA2G7 is shown in SEQ ID NO. 5; and the nucleotide sequence of the AKR1C3 is shown in SEQ ID NO.

6.

3. A pulmonary sarcoidosis detection product characterized by, The primer contains (a)-(f): (a) the DNA fragment as shown in SEQ ID NO. 7 and SEQ ID NO. 8; (b) the DNA fragment as shown in SEQ ID NO. 9 and SEQ ID NO. 10; (c) the DNA fragment as shown in SEQ ID NO. 11 and SEQ ID NO. 12; (d) the DNA fragment as shown in SEQ ID NO. 13 and SEQ ID NO. 14; (e) the DNA fragment as shown in SEQ ID NO. 15 and SEQ ID NO. 16; (f) the DNA fragment as shown in SEQ ID NO. 17 and SEQ ID NO.

18.

4. The test product according to claim 3, characterized in that The primer contains (a)-(f):

5. The detection product according to claim 3 or 4, characterized in that (a) the DNA fragment as shown in SEQ ID NO. 7 and SEQ ID NO. 8; 6. The detection product according to claim 3 or 4, characterized in that (b) the DNA fragment as shown in SEQ ID NO. 9 and SEQ ID NO. 10; (c) the DNA fragment as shown in SEQ ID NO. 11 and SEQ ID NO. 12; (d) the DNA fragment as shown in SEQ ID NO. 13 and SEQ ID NO. 14; (e) the DNA fragment as shown in SEQ ID NO. 15 and SEQ ID NO. 16; (f) the DNA fragment as shown in SEQ ID NO. 17 and SEQ ID NO.

18. The detection product also contains an internal reference gene; the internal reference gene is ACTB and 18S rRNA. The detection product detects the expression of the PTGER4, AKR1C1, PLA2G6, LTA4H, PLA2G7 and AKR1C3 genes in a sample by fluorescence quantitative PCR, Southern hybridization, Northern hybridization, fluorescence in situ hybridization, DNA microarray, high-throughput sequencing method or immunological method. The detection product includes reagents, kits, chips, test papers or high-throughput sequencing platforms.

Images