A method for detecting miscellaneous bacteria in fermented milk

Abstract

The present application relates to the field of dairy products, in particular to a kind of fermented milk detection method of miscellaneous bacteria.The present application provides a kind of fermented milk detection method of miscellaneous bacteria, comprising:1) providing the bacterial genome DNA sample of sample to be measured;2) by CRISPR-Cas9 system, specifically cutting the fermented bacteria genome DNA in the bacterial genome DNA sample provided in step 1) to provide the genome DNA sample after cutting;3) by the genome DNA sample after cutting provided in step 2), construct the sequencing library of the target sequence of target miscellaneous bacteria;4) according to the sequencing library provided in step 3), obtain the target miscellaneous bacteria contained in the sample to be measured.The miscellaneous bacteria detection method provided by the present application can efficiently exclude the interference of fermentation bacteria, quickly and sensitively analyze the miscellaneous bacteria pollution in fermented milk, and has the advantages of simple operation, accurate deletion, high sensitivity, low cost and the like.

Description

Technical Field

[0001] This invention relates to the field of dairy products, and in particular to a method for detecting miscellaneous bacteria in fermented milk. Background Technology

[0002] Fermented milk products, with their probiotic properties, are increasingly becoming a favorite. However, contamination by other microorganisms is common in actual production, seriously affecting product quality and safety. The difficulty in detecting and identifying other microorganisms in fermented milk stems from the fact that fermenting bacteria constitute the vast majority, while other microorganisms are few and far between. Their growth conditions are unknown, making it difficult to find suitable culture media and conditions for isolation and culture; this is especially true for pasteurized products. How to remove interference from fermenting bacteria and rapidly detect other microorganisms is a major challenge in current microbial detection. High-throughput sequencing technology based on 16S rRNA genes is widely used in microbial composition studies, but the sequences obtained from fermented milk samples are predominantly from fermenting bacteria. The abundance of other microorganisms is extremely low, requiring increased sequencing depth and increasing detection costs; simultaneously, the abundance of other microorganisms and sequencing noise levels are similar, making analysis difficult. To reduce interference from fermenting bacteria, lower sequencing costs, and improve detection accuracy and sensitivity, it is necessary to remove high-abundance fermenting bacteria. CRISPR-Cas9 technology, a breakthrough technology developed in recent years, has caused a major revolution in biological research. As a precise and efficient gene-editing tool, it has been widely used in various fields, demonstrating immense application value. Based on the 16S rRNA gene sequence of the interfering bacteria, specific sgRNAs were designed to precisely cleave the genomic DNA of the interfering bacteria, thereby reducing the abundance of the interfering bacteria and enriching and increasing the abundance of other bacteria. Summary of the Invention

[0003] In view of the shortcomings of the prior art described above, the purpose of this invention is to provide a method for detecting miscellaneous bacteria in fermented milk, so as to solve the problems in the prior art.

[0004] To achieve the above and other related objectives, the present invention provides a method for detecting contaminants in fermented milk, comprising:

[0005] 1) Provide the bacterial genomic DNA sample to be tested;

[0006] 2) The fermentation bacteria genomic DNA in the bacterial genomic DNA sample provided in step 1) is specifically cut using the CRISPR-Cas9 system to provide a cut genomic DNA sample;

[0007] 3) Using the genomic DNA sample that has undergone cutting provided in step 2), construct a sequencing library of the target sequence of the target bacteria;

[0008] 4) Based on the sequencing library provided in step 3), obtain the target bacteria contained in the sample to be tested.

[0009] In some embodiments of the present invention, the fermenting bacteria are selected from one or more combinations of Streptococcus thermophilus, Lactobacillus delbrueckii, Lactobacillus casei, Lactobacillus rhamnosus, and Lactobacillus plantarum, and the target bacteria are selected from one or more combinations of Lactobacillus plantarum, Acetobacter, Escherichia coli, Pseudomonas aeruginosa, Glucosamine oxidase, Bacillus pumilus, Pseudomonas saccharophilus, Lactococcus lactis, and Bifidobacterium.

[0010] In some embodiments of the present invention, in step 2), the CRISPR-Cas9 system includes sgRNA and Cas9 enzyme, wherein the sgRNA targets the 16S rRNA sequence on the genomic DNA of the fermenting bacteria. Preferably, the sgRNA includes a first sgRNA and a second sgRNA, and the polynucleotide sequences of the first sgRNA and the second sgRNA are as shown in SEQ ID NO.1 and SEQ ID NO.2, respectively.

[0011] In some embodiments of the present invention, in step 3), the sequencing library is a cloning sequencing library;

[0012] And / or, the target sequence of the target contaminant is the 16S rRNA sequence of the target contaminant;

[0013] And / or, the method of constructing a clone sequencing library of the target sequence of the target bacterium using the cleaved genomic DNA sample provided in step 2) specifically includes: amplifying the cleaved genomic DNA sample provided in step 2) with universal primers specifically targeting the target sequence of the target bacterium to provide a clone sequencing library of the target sequence of the target bacterium.

[0014] In some embodiments of the present invention, in step 3), the sequencing library is a high-throughput sequencing library;

[0015] And / or, the target sequence of the target contaminant is the 16S rRNA sequence of the target contaminant;

[0016] And / or, the method of constructing a high-throughput sequencing library of the target sequence of the target bacteria using the cleaved genomic DNA sample provided in step 2) specifically includes: amplifying the cleaved genomic DNA sample provided in step 2) with high-throughput sequencing primers specifically targeting the target sequence of the target bacteria to provide a high-throughput sequencing library of the target sequence of the target bacteria.

[0017] In some embodiments of the present invention, in step 3), the sequencing library is a high-throughput sequencing library;

[0018] And / or, the target sequence of the target contaminant is the 16S rRNA sequence of the target contaminant;

[0019] And / or, the method for constructing a high-throughput sequencing library of the target sequence of the target bacteria using the cleaved genomic DNA sample provided in step 2) specifically includes: amplifying the cleaved genomic DNA sample provided in step 2) with universal primers specifically targeting the target sequence of the target bacteria, adding adapters and tags to the amplification products to provide a high-throughput sequencing library of the target sequence of the target bacteria.

[0020] In some embodiments of the present invention, step 3) of constructing a high-throughput sequencing library of the target sequence of the target bacteria using the cleaved genomic DNA sample provided in step 2) specifically includes: amplifying the cleaved genomic DNA sample provided in step 2) sequentially with universal primers specifically targeting the target sequence of the target bacteria and high-throughput sequencing primers specifically targeting the target sequence of the target bacteria to provide a high-throughput sequencing library of the target sequence of the target bacteria.

[0021] In some embodiments of the present invention, in step 3), the polynucleotide sequence of the high-throughput sequencing primer specifically targeting the target bacteria includes a sequencing adapter and a universal primer sequence, and also includes a tag sequence and / or a probe sequence.

[0022] In some embodiments of the present invention, in step 3), the polynucleotide sequence of the high-throughput sequencing primer specifically targeting the target bacteria includes, from the 5' end to the 3' end, a sequencing adapter, a tag sequence, and a universal primer sequence.

[0023] In some embodiments of the present invention, in step 3), the high-throughput sequencing primers specifically targeting the target sequence of the target bacteria include a first amplification primer and a second amplification primer, wherein the polynucleotide sequences of the first amplification primer and the second amplification primer respectively include the sequences shown in SEQ ID NO.3 and SEQ ID NO.4.

[0024] In some embodiments of the present invention, in step 3), the universal primers specifically targeting the target sequence of the target bacteria include a third amplification primer and a fourth amplification primer, and the polynucleotide sequences of the third amplification primer and the fourth amplification primer respectively include the sequences shown in SEQ ID NO.5 and SEQ ID NO.6. Attached Figure Description

[0025] Figure 1 The diagram shows a sequencing process provided by this invention.

[0026] Figure 2 The diagram shows a sequencing workflow for other existing technologies. Detailed Implementation

[0027] To make the inventive objectives, technical solutions, and beneficial effects of this invention clearer, the invention will be further described in detail below with reference to embodiments. Those skilled in the art can easily understand other advantages and effects of this invention from the content disclosed in this specification.

[0028] After extensive research, the inventors of this invention have developed a method for detecting miscellaneous bacteria in fermented milk. This method can effectively reduce the abundance of fermenting bacteria in the sample and simultaneously enrich miscellaneous bacteria, thereby effectively improving the detection efficiency and sensitivity of miscellaneous bacteria in fermented milk. Based on this, the present invention was completed.

[0029] This invention provides a method for detecting contaminating bacteria in fermented milk, comprising:

[0030] 1) Provide the bacterial genomic DNA sample to be tested;

[0031] 2) The fermentation bacteria genomic DNA in the bacterial genomic DNA sample provided in step 1) is specifically cut using the CRISPR-Cas9 system to provide a cut genomic DNA sample;

[0032] 3) Using the genomic DNA sample that has undergone cutting provided in step 2), construct a sequencing library of the target sequence of the target bacteria;

[0033] 4) Based on the sequencing library provided in step 3), obtain the target bacteria contained in the sample to be tested. In the bacterial detection method, the genomic DNA of the extracted sample can be specifically cleaved using the CRISPR-Cas9 system to reduce the abundance of fermenting bacteria and simultaneously enrich other bacteria. Subsequently, the sample can be further amplified to construct a sequencing library of the target bacteria, and the target bacteria contained in the sample can be detected using the sequencing library.

[0034] The method for detecting miscellaneous bacteria provided by this invention may include providing a bacterial genomic DNA sample of the sample to be tested. Suitable methods for providing the bacterial genomic DNA sample of the sample to be tested should be known to those skilled in the art; for example, various commercially available bacterial genomic DNA extraction kits (e.g., bacterial genomic DNA extraction kits, bacterial genomic DNA mini-purification kits, etc.) can be used.

[0035] In the above-mentioned detection methods, the sample to be tested can typically include fermented milk. Fermented milk generally refers to dairy products with a lower pH value obtained by using raw milk or milk powder as raw materials, which undergo sterilization (e.g., pasteurization) and fermentation. Beneficial bacteria (e.g., starter cultures) may be added during the fermentation process. For example, the sample to be tested can be fermented milk, flavored fermented milk, room-temperature yogurt, refrigerated yogurt, etc. As another example, the sample to be tested can be various fermented milk products that comply with the relevant standards of GB 19302-2010.

[0036] The method for detecting contaminating bacteria provided by this invention may further include: specifically cutting the fermentation bacteria genomic DNA in the bacterial genomic DNA sample provided in step 1) using a CRISPR-Cas9 system to provide a cut genomic DNA sample. By specifically cutting the fermentation bacteria genomic DNA in the bacterial genomic DNA sample using the CRISPR-Cas9 system, only the fermentation bacteria genomic DNA can be cut, without cutting the genomic DNA of other bacteria, thereby effectively reducing the abundance of fermentation bacteria in the sample to be tested.

[0037] In the aforementioned detection methods, fermentation bacteria typically refer to the microorganisms inoculated during the fermentation process of fermented milk for dairy product fermentation. They usually constitute a high proportion, even the majority, of the sample being tested. Suitable types of fermentation bacteria that may exist in fermented milk should be known to those skilled in the art. For example, fermentation bacteria can be selected from one or more combinations of Streptococcus thermophilus, Lactobacillus delbrueckii (e.g., Lactobacillus delbrueckii subsp. Bulgaricus), Lactobacillus casei, Lactobacillus rhamnosus, and Lactobacillus plantarum. Target bacteria, on the other hand, typically refer to other microorganisms present in fermented milk besides the fermentation bacteria. Compared to the fermentation bacteria, the number of target bacteria is usually smaller or lower, and may even be so low that they are difficult to detect directly by some existing detection methods. The target contaminants can be other microbial species present in a relatively small number compared to the fermenting bacteria in fermented milk, or various contaminants that may be introduced during the production process. For example, the ratio of the total amount of target contaminants to the fermenting bacteria, based on molecular ratio, can be 0.1–40%, 0.1–0.2%, 0.2–0.4%, 0.4–0.6%, 0.6–0.8%, 0.8–1%, 1–2%, 2–4%, 4–6%, 6–8%, 8–10%, 10–15%, 15–20%, 20–25%, 25–30%, 30–35%, or 35–40%. The molecular ratio can be calculated as follows: First, divide the total length of the bacterial genome DNA by the rRNA gene copy number to obtain the length of each bacterial rRNA gene, and calculate the molecular weight of the rRNA corresponding to each bacterial rRNA gene. Then, divide the mass of each bacterial genome DNA by the rRNA molecular weight to calculate the number of molecules of each bacterium. The ratio between the number of bacterial molecules is the molecular ratio of different bacteria. For example, the target bacteria can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more species. There are no particular restrictions on the types of target bacteria that may exist in fermented milk, but the target bacteria and the fermenting bacteria are usually different species.For example, the target bacteria can be selected from Lactobacillus plantarum, Acetobacterium Balch, and the other bacteria can be selected from one or more combinations of Escherichia coli, Pseudomonas sp., Gluconobacter oxydans, Bacillus pumilus, Pelomonas sp., Lactococcus lactis, Bifidobacterium, etc.

[0038] In the above detection methods, the CRISPR-Cas9 system typically includes sgRNA and the Cas9 enzyme. The sgRNA usually targets a target fragment on the genomic DNA of the fermenting bacteria, for example, a 16S rRNA sequence. In a specific embodiment of the present invention, the sgRNA includes a first sgRNA and a second sgRNA, and the polynucleotide sequences of the first sgRNA and the second sgRNA are as shown in SEQ ID NO.3 and SEQ ID NO.4, respectively.

[0039] The method for detecting contaminating bacteria provided by this invention may further include: constructing a sequencing library of target sequences of the target contaminating bacteria using the cleaved genomic DNA sample provided in step 2). After specifically cleaving the fermenting bacteria genomic DNA in the bacterial genomic DNA sample provided in step 1) using a CRISPR-Cas9 system, the target sequences of the target contaminating bacteria can be amplified (e.g., by PCR amplification) to construct a sequencing library of target sequences of the target contaminating bacteria, so as to facilitate sequencing based on the constructed library to complete the analysis of bacterial composition.

[0040] In the above detection methods, the target sequence corresponding to the target bacteria is typically an rRNA sequence that can be used to distinguish bacterial species. A suitable target sequence for the target bacteria can be reasonably selected by those skilled in the art. For example, the target sequence of the target bacteria can typically be the 16S rRNA sequence of the target bacteria.

[0041] In the above detection methods, the sequencing library can be a high-throughput sequencing library. After the target sequence is determined, a suitable method for constructing a high-throughput sequencing library of the target bacteria's target sequence should be known to those skilled in the art. For example, a method for constructing a high-throughput sequencing library of the target bacteria's target sequence using the cleaved genomic DNA sample provided in step 2) specifically includes: amplifying the cleaved genomic DNA sample provided in step 2) using high-throughput sequencing primers specifically targeting the target bacteria's target sequence to provide a high-throughput sequencing library of the target bacteria's target sequence. As another example, a method for constructing a high-throughput sequencing library of the target bacteria's target sequence using the cleaved genomic DNA sample provided in step 2) specifically includes: amplifying the cleaved genomic DNA sample provided in step 2) using universal primers specifically targeting the target bacteria's target sequence, adding adapters and tags to the amplification products to provide a high-throughput sequencing library of the target bacteria's target sequence. For example, the method for constructing a high-throughput sequencing library of the target sequence of a target bacterium using the cleaved genomic DNA sample provided in step 2) specifically includes: amplifying the cleaved genomic DNA sample provided in step 2) sequentially with universal primers specifically targeting the target sequence of the target bacterium and high-throughput sequencing primers specifically targeting the target sequence of the target bacterium, to provide a high-throughput sequencing library of the target sequence of the target bacterium. Typically, the polynucleotide sequence of the high-throughput sequencing primers specifically targeting the target sequence of the target bacterium includes sequencing adapters and universal primer sequences, as well as tag sequences and / or probe sequences.

[0042] In the above detection method, the sequencing library can be a clonal sequencing library. After the target sequence is determined, a suitable method for constructing a clonal sequencing library of the target bacteria's target sequence should be known to those skilled in the art. For example, the method for constructing a sequencing library of the target bacteria's target sequence using the cut genomic DNA sample provided in step 2) specifically includes: amplifying the cut genomic DNA sample provided in step 2) using universal primers specifically targeting the target sequence of the target bacteria to provide a clonal sequencing library of the target bacteria's target sequence. Subsequently, based on the provided sequencing library, the target bacteria contained in the sample to be tested can be obtained; for example, the obtained amplification product can be ligated into a vector; transformation and screening can be performed to select colonies.

[0043] In a specific embodiment of the present invention, the high-throughput sequencing primers specifically targeting the target sequence of the target bacteria include a first amplification primer and a second amplification primer (e.g., P5-16S-F and P7-16S-R), and the polynucleotide sequences of the first amplification primer and the second amplification primer respectively include the sequences shown in SEQ ID NO.3 and SEQ ID NO.4.

[0044] In another specific embodiment of the present invention, the universal primers specifically targeting the target sequence of the target bacteria include a third amplification primer and a fourth amplification primer (e.g., 16S-F and 16S-R), wherein the polynucleotide sequences of the third amplification primer and the fourth amplification primer respectively include the sequences shown in SEQ ID NO.5 and SEQ ID NO.6.

[0045] The method for detecting contaminants provided by this invention may further include: obtaining the target contaminants contained in the sample to be tested based on the sequencing library provided in step 3). As described above, after sequencing the sequencing library containing the target sequence of the target contaminants, the target contaminants contained in the sample to be tested can be determined based on the sequencing results.

[0046] The method for detecting contaminating bacteria provided by this invention, compared with existing sequencing procedures (see...), Figure 2 This introduces a step for cutting genomic DNA from samples (see [link]). Figure 1 This allows for efficient elimination of interference from fermenting bacteria, rapid and sensitive analysis of contamination in fermented milk, and offers advantages such as ease of operation, precise deletion, high sensitivity, and low cost. It can even directly apply first-generation sequencing technology's cloning sequencing method to rapidly analyze contaminating bacteria and promptly resolve production problems, thus demonstrating promising industrialization prospects.

[0047] The invention of this application will be further illustrated by the following embodiments, but this does not limit the scope of this application.

[0048] Example 1

[0049] Optimization of high-throughput deletion sequencing method conditions (comparison of primary and secondary PCR steps: studying the difference in cleavage efficiency (1%)):

[0050] The gene length of *Lactobacillus plantarum* is 6.5 Mbp, and the 16S rRNA copy number is 5 (*Lactobacillus plantarum* subsp. *plantarum* ST-III, complete sequence (NC_014554.1)). The gene length of *Streptococcus thermophilus* is 3.1 Mbp, and the 16S rRNA copy number is 6 (*Streptococcus thermophilus* strain ST3, complete genome (CP017064.1)). After correcting the gene length and rRNA copy number of the strains, a mixed simulated sample of 50 ng with a 1% 16S rRNA molecular ratio of *Lactobacillus plantarum* and *Streptococcus thermophilus* was prepared. Two sgRNA sequences (sg1: SEQ ID NO.1, sg2: SEQ ID NO.2) designed based on the *Streptococcus thermophilus* 16S rRNA gene sequence specifically cleave *Streptococcus thermophilus*, without cleaving other bacteria. sgRNA was synthesized in vitro using T7 RNA Polymerase (Takara Biomedical Technology (Beijing) Co., Ltd.), and then used with Cas9 (Takara Biomedical Technology (Beijing) Co., Ltd.) to cleave the genomic DNA of a mixed simulated sample. The cleavage system (20 μL) consisted of: 0.2 g Lactobacillus plantarum, 50 ng thermophilic streptococcal DNA, and 0.5 μg Cas9 enzyme. The incubation period was 37 °C for 3 h and 95 °C for 10 min to inactivate the sgRNA.

[0051] sg1:GATCACTAATACGACTCACTATAGGCAATTGCTCCACTACAAGAGTTTTAGAGCTAGAAA(SEQID NO.1)

[0052] sg2:GATCACTAATACGACTCACTATAGACACATGTCATTTATTTGAAGTTTTAGAGCTAGAAA(SEQID NO.2)

[0053] High-throughput sequencing was performed using two different methods: a single-round PCR method and a two-round PCR method.

[0054] One-round PCR method: Directly use long primers P5-16S-F and P7-16S-R (sequencing adapter + tag sequence + universal 16S RNA primers, SEQ ID NO.3 and SEQ ID NO.4) for one round of PCR amplification (pre-denaturation: 95℃ for 5 min; 30 cycles: 98℃ for 10 s, 55℃ for 10 s, 72℃ for 30 s; extension: 72℃ for 5 min), then purify and sequence.

[0055] Two-round PCR method: First, PCR amplification was performed using the universal 16S RNA primers 16S-F and 16S-R (SEQ ID NO.5, SEQ ID NO.6) (30 cycles: 98℃ 10s, 55℃ 10s, 72℃ 30s; extension: 72℃ 5min). Then, using the first-round PCR product as a template, a second round of PCR amplification was performed using long primers P5-16S-F and P7-16S-R (sequencing adapter + tag sequence + universal 16S RNA primers) (15 cycles: 98℃ 10s, 58℃ 10s, 72℃ 30s; extension: 72℃ 5min). The product was then purified and sequenced.

[0056] Sequencing statistics showed that the sequence abundance of Lactobacillus plantarum was 10% and 75% in the first-round PCR and second-round PCR methods, respectively. Therefore, the deletion efficiency was increased by 10 times and 75 times respectively from 1% in the first-round PCR and second-round PCR methods. The deletion efficiency of the second-round PCR method was better than that of the first-round PCR method.

[0057] P5-16S-F:

[0058] TACACTCTTTCCCTACACGACGCTCTTCCGATCAGAGTTTGATCMTGGCTCAG(SEQ ID NO.3)

[0059] P7-16S-R:

[0060] CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGCTGCCTCCCGTAGGAG(SEQ ID NO.4)

[0061] 16S-F: AGAGTTTGATCMTGGCTCAG (SEQ ID NO.5)

[0062] 16S-R:TGCTGCCTCCCGTAGGAG(SEQ ID NO.6)

[0063] Example 2

[0064] Concentration gradient dilution simulation experiment (0.1%, 0.3%, 1%):

[0065] A mixed simulated gradient experimental sample was constructed with 16S RNA molecular ratios of 0.1%, 0.3%, and 1% for *Lactobacillus plantarum* and *Streptococcus thermophilus* (after correcting for 16S RNA copy number and total genome base count). Other components in the mixed simulated sample were described in Example 1. *Streptococcus thermophilus* 16S rRNA was specifically cleaved using a CRISPR-Cas9 system, following the cleavage method described in Example 1. Subsequent two-round PCR (as described in Example 1) and sequencing analysis showed that the *Lactobacillus plantarum* content increased to 25%, 50%, and 75%, respectively, corresponding to deletion efficiencies increased by 250, 50, and 75 times. This method can be used to detect contaminating bacteria with a content as low as 0.1%, and can even be used for direct cloning and sequencing (selecting 16 clones for sequencing) for rapid identification of contaminating bacteria.

[0066] Furthermore, as the ratio of *Lactobacillus plantarum* to *Streptococcus thermophilus* further decreased, the sequencing noise value relatively increased. With the ratio of *Lactobacillus plantarum* to *Streptococcus thermophilus* further decreasing (below 0.1%), after deletion enrichment and sequencing, the abundance of *Lactobacillus plantarum* approached the sequencing noise value (total noise value approximately 5%), making it difficult to distinguish and detect. The main reasons for the noise value may be that the PCR process is easily interfered with by trace amounts of bacterial contamination in the environment, and issues such as the fidelity of Taq enzyme amplification. The mutation rate of each Taq enzyme amplification is 1×10⁻⁶. -8 As the ratio of Lactobacillus plantarum to Streptococcus thermophilus further decreased and the number of amplification cycles increased, the abundance of mutant sequences accumulated from multiple amplifications further increased.

[0067] Example 3

[0068] Multi-strain bacterial simulated mixed deletion experiment:

[0069] Based on the gene length and 16S rRNA copy number of the strains, 10 mixed simulated samples were prepared with a ratio (corrected for 16S RNA copy number and whole genome sequence length) of 0.2% to Streptococcus thermophilus (Bacillus pumilus CMCC63202; Staphylococcus aureus ATCC25923; Escherichia coli DH5a; Enterococcus faecalis ACCC10699; Pseudomonas fluorescens Migula AS1.823; Lactobacillus sacidophilus NCFM; Listeria monocytogenes ATCC19115; Citrobacter freundii ATCC43864; Lactobacillus casei ZHANG; Lactobacillus rhamnosus GG, with each strain having a ratio of 0.2% to Streptococcus thermophilus). (The other components in the mixed simulated samples are as described in Example 1.) The 16S rRNA of Streptococcus thermophilus was specifically cleaved using the CRISPR-Cas9 system, following the cleavage method described in Example 1. Subsequent two-round PCR (see Example 1) was performed, followed by sequencing analysis. Table 1 shows a comparison of bacterial content before and after cleavage. The average content of the 10 bacterial strains increased to 7.5%, demonstrating that the cleavage was specific and accurate, without off-target effects.

[0070] Table 1 Sequencing results of mixed strain deletion

[0071]

[0072]

[0073] Example 4

[0074] Analysis of the reasons for yogurt packaging shrinkage:

[0075] During refrigeration, approximately 0.1% of samples of strawberry yogurt with large fruit pieces (Mengniu Dairy Co., Ltd.) exhibited shrinkage. This was initially ruled out as a cause of shrinkage due to changes in air volume within the packaging caused by variations in canning or temperature. Strawberry yogurt is made by fermenting white sugar, milk, and stabilizers with Streptococcus thermophilus until curdled, then adding strawberry jam and flavoring. All raw materials used in production underwent various routine microbiological tests (including mold, yeast, and aerobic bacteria), and no abnormal microorganisms were found. Genomic DNA was extracted from three yogurt samples using a bacterial genomic DNA extraction kit (Tiangen Biotech (Beijing) Co., Ltd.). Cas9-sRNA was used to specifically cleave Streptococcus thermophilus without cleaving other bacteria (specific method as described in Example 1). Amplification and sequencing were performed using the two-round PCR method described in Example 1. The analysis results are detailed in Table 2.

[0076] Table 2 Sequencing results after deletion of the retracted yogurt packaging

[0077]

[0078] In the three shrunk yogurt samples tested, the abundance of *Streptococcus thermophilus* sequences decreased to 46%, while the content of other bacteria increased to 33%. This demonstrates that the designed deletion method is highly specific, specifically cleaving only the fermenting bacteria but not other bacteria (such as *Escherichia coli*, *Glucosidobacterium oxysporum*, etc.). The experimental results show that all three samples contained *Glucosidobacterium oxysporum* (abundance of 12%), an acid-tolerant obligate aerobic bacterium that consumes oxygen from the air in the sealed packaging during its growth, causing shrinkage.

[0079] The reason why Glucosamine oxidase is difficult to detect in routine culture and testing is that the content of Glucosamine oxidase is low and its growth is slow; while the content of fermentation bacteria in yogurt is high and its growth is fast, which seriously interferes with the isolation and identification of Glucosamine oxidase.

[0080] *Glucosobacterium oxidans* is mainly distributed in fruit and orchard soil, possibly originating from strawberry jam used in the production process. However, no abnormal microorganisms were found in the related microbial tests of strawberry jam. This is because *Glucosobacterium oxidans* grows slowly, and the jam has been sterilized, resulting in extremely low viable bacterial content, making it difficult to detect and identify. The specific microbial detection methods are as follows: For mold and yeast detection, PDA medium was used, and colony growth was observed after culturing at 25–28°C for 3 days, with a total incubation period of 5 days. For aerobic colony count detection, LB plates were incubated at 37°C for 2 days, and colony growth was observed. For anaerobic lactic acid bacteria detection, MRS medium was used, and the bacteria were anaerobically cultured at 37°C for 3 days, with colony growth observed.

[0081] The strawberry jam was inoculated into blank yogurt (20 cups, 3 times). The blank yogurt was prepared as follows: fresh pure milk (Bright Dairy Industry Co., Ltd.) was mixed with 7% white sugar, homogenized at 65℃ and 15MPa, and then sterilized at 90℃ for 10 minutes. After cooling to 40-45℃, 0.02% yogurt starter culture (DuPont) was added, and fermentation was carried out at 42℃ for 4-6 hours until curdled. The mixture was then refrigerated at 4℃. After sealing and storing at 25℃ for 2 weeks, no shrinkage occurred. This is likely because yogurt with shrinkage accounts for only a very small percentage (approximately 0.1%). Theoretically, thousands of experiments would be required to simulate shrinkage caused by *Glucosium oxidase* contamination, making direct tracing difficult. However, in subsequent production, after strengthening the sterilization of the jam, no further shrinkage issues occurred, indirectly proving that *Glucosium oxidase* originated from the strawberry jam.

[0082] Example 5

[0083] Yogurt shrink-pack clone sequencing analysis:

[0084] The genomic DNA extracted from the yogurt packaged in Example 4 was specifically cleaved in *Streptococcus thermophilus* using Cas9-sRNA without cleaving other bacteria, and then amplified by PCR using the universal 16S RNA primers 16S-F and 16S-R. The PCR amplification conditions were: 30 cycles: 98℃ for 10s, 55℃ for 10s, 72℃ for 30s; extension: 72℃ for 5min. After purification using a PCR purification kit (Tiangen Biotech (Beijing) Co., Ltd.), the DNA was ligated into a T-vector (Takara Biomedical Technology (Beijing) Co., Ltd.), transformed, and after blue-white screening, 20 colony clones were selected for sequencing. The results are detailed in Table 3.

[0085] Table 3. Cloning and sequencing results of shredded yogurt.

[0086]

[0087] All three samples contained *Gastroenterobacter oxidase* at abnormal levels (abundance exceeding 10%), allowing for direct cloning and detection. High-throughput sequencing typically takes over two weeks to obtain results and requires specialized software analysis, resulting in long processing times and high costs. In contrast, cloning detection yields results in just 3-4 days, requires no specialized software analysis, and is faster and less expensive. Therefore, deleting and enriching contaminating bacteria before cloning and sequencing provides a quick and convenient way to obtain test results, resolving unexpected product quality incidents.

[0088] In summary, this invention effectively overcomes the various shortcomings of the prior art and has high industrial application value.

[0089] The above embodiments are merely illustrative of the principles and effects of the present invention and are not intended to limit the invention. Any person skilled in the art can modify or alter the above embodiments without departing from the spirit and scope of the present invention. Therefore, all equivalent modifications or alterations made by those skilled in the art without departing from the spirit and technical concept disclosed in the present invention should still be covered by the claims of the present invention. sequence list <110> Bright Dairy Co., Ltd. <120> A method for detecting miscellaneous bacteria in fermented milk <160> 6 <170> SIPOSequenceListing 1.0 <210> 1 <211> 60 <212> DNA <213> Artificial Sequence <400> 1 gatcactaat acgactcact ataggcaatt gctccactac aagagtttta gagctagaaa 60 <210> 2 <211> 60 <212> DNA <213> Artificial Sequence <400> 2 gatcactaat acgactcact atagacacat gtcatttatttgaagtttta gagctagaaa 60 <210> 3 <211> 53 <212> DNA <213> Artificial Sequence <400> 3 tacactcttt ccctacacga cgctcttccg atcagagttt gatcmtggct cag 53 <210> 4 <211> 81 <212> DNA <213> Artificial Sequence <400> 4 caagcagaag acggcatacg agatnnnnnn gtgactggag ttcagacgtg tgctcttccg 60 atctgctgcc tcccgtagga g 81 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <400> 5 agagtttgat cmtggctcag 20 <210> 6 <211> 18 <212> DNA <213> Artificial Sequence <400> 6 tgctgcctcc cgtaggag 18

Claims

1. A method for detecting miscellaneous bacteria in fermented milk, comprising: 1) providing a bacterial genomic DNA sample of a sample to be tested; 2) specifically cleaving the genomic DNA sample of the fermenting bacteria in step 1) by a CRISPR-Cas9 system to provide a cleaved genomic DNA sample; the CRISPR-Cas9 system comprises sgRNA and Cas9 enzyme, the sgRNA is directed against the 16S rRNA sequence on the genomic DNA of the fermenting bacteria; the sgRNA comprises a first sgRNA and a second sgRNA, the polynucleotide sequences of the first sgRNA and the second sgRNA are respectively SEQ ID NO. 1 and SEQ ID NO. 2; 3) constructing a sequencing library of the target sequence of the target miscellaneous bacteria by the cleaved genomic DNA sample provided in step 2); 4) obtaining the target miscellaneous bacteria contained in the sample to be tested according to the sequencing library provided in step 3); The sequencing library is a high-throughput sequencing library, and the method for constructing a high-throughput sequencing library of the target sequence of the target miscellaneous bacteria specifically comprises: amplifying the cleaved genomic DNA sample provided in step 2) with a universal primer specific to the target sequence of the target miscellaneous bacteria, adding a linker and a tag to the amplification product to provide a high-throughput sequencing library of the target sequence of the target miscellaneous bacteria; The target sequence of the target miscellaneous bacteria is the 16S rRNA sequence of the target miscellaneous bacteria; the high-throughput sequencing primer specific to the target sequence of the target miscellaneous bacteria comprises a first amplification primer and a second amplification primer, the polynucleotide sequences of the first amplification primer and the second amplification primer comprise the sequences shown in SEQ ID NO. 3 and SEQ ID NO. 4, respectively; The universal primer specific to the target sequence of the target miscellaneous bacteria comprises a third amplification primer and a fourth amplification primer, the polynucleotide sequences of the third amplification primer and the fourth amplification primer comprise the sequences shown in SEQ ID NO. 5 and SEQ ID NO. 6, respectively; The fermenting bacteria are selected from Streptococcus thermophilus, and the target miscellaneous bacteria are selected from Lactobacillus plantarum.

Images