Application of TPST gene in regulating plant traits

Abstract

The present invention provides the application of the TPST gene in regulating plant traits. Specifically, the present invention provides the application of the TPST gene, or its encoded protein, or its promoter in regulating plant traits or in preparing a preparation or composition for regulating plant traits, wherein the plant traits include one or more traits selected from the following groups: (i) stress resistance; (ii) 1000-grain weight; (iii) yield and / or biomass; (iv) the size, weight and / or quantity of fruits and / or seeds. The present invention discovers for the first time that increasing the expression level or activity of the TPST gene or its encoded protein in the plant (such as rice) can significantly improve the plant traits.

Description

Technical Field

[0001] The present invention relates to the field of agronomy, and in particular, to the application of the TPST gene in regulating plant traits. More specifically, it relates to the application of the TPST gene in regulating plant agronomic traits, especially in aspects such as rice stress resistance and yield. Background Art

[0002] There are numerous genes with diverse functions in organisms, and they cooperate with each other to jointly complete the life process. For example, the genome of the model plant Arabidopsis thaliana contains approximately 25,000 genes, and the rice genome contains 30,000 - 50,000 genes. With the completion of the whole-genome sequence maps of plants such as Arabidopsis thaliana, soybean, rice, and maize, many important genes have been successively cloned, and their functions have been studied in depth. In recent years, with the increasingly serious world food problem, in order to increase the yield of food crops, improve varieties, enhance resistance, and achieve high, stable, and high-quality yields, scientists are gradually shifting from pure gene function research to paying more attention to the relationship between the studied gene functions and important agronomic traits. Research in food crops mainly focuses on new traits such as crop yield, resistance, and variety, with the expectation of discovering important genes that regulate target traits and cultivating excellent varieties through means such as genetic engineering and molecular marker-assisted breeding. Some research results have been successfully applied to crop improvement, showing great application prospects in food production and highlighting the significance of plant functional gene research.

[0003] Rice is one of the most important food crops in the world and is the main source of human energy and protein. Its yield and consumption have always ranked first among food crops. Due to the current lack of arable land, increasing population, and soil erosion problems, the breeding, production, and application of new high-yield, high-quality, and multi-resistant rice varieties have always been the theme of rice breeding in China. Therefore, excavating relevant functional genes and using them to cultivate excellent varieties with target traits and opening up new breeding paths are of great significance for promoting China's transformation from a major seed industry country to a powerful seed industry country. Summary of the Invention

[0004] The purpose of the present invention is to provide the use of the TPST gene, or its encoded protein, or its promoter in regulating plant (such as rice) traits.

[0005] Specifically, in the present invention, by increasing the expression level or activity of the TPST gene or its encoded protein, one or more traits in plants can be improved, including enhancing plant stress resistance, increasing 1000-grain weight, increasing yield and / or biomass, increasing the size, weight, and / or quantity of fruits and / or seeds, and increasing root length or root weight. The present invention provides a new technical means for plant trait improvement and molecular breeding.

[0006] The first aspect of the present invention provides a use of a substance, which is a TPST gene or its encoded protein, or its promoter, for regulating plant traits or preparing a preparation or composition for regulating plant traits, wherein the plant traits include one or more traits selected from the following group:

[0007] (i) Stress resistance;

[0008] (ii) 1000-grain weight;

[0009] (iii) Yield and / or biomass;

[0010] (iv) Size, weight and / or quantity of fruits and / or seeds.

[0011] In another preferred embodiment, the stress resistance is selected from the following group: salt tolerance, drought tolerance, pest and disease resistance, or a combination thereof.

[0012] In another preferred embodiment, the traits further include one or more selected from the following group:

[0013] (v) Root length;

[0014] (vi) Root weight.

[0015] In another preferred embodiment, regulating the plant traits includes:

[0016] (i) Enhancing plant stress resistance; and / or

[0017] (ii) Increasing the 1000-grain weight; and / or

[0018] (iii) Increasing the yield and / or biomass; and / or

[0019] (iv) Increasing the size, weight and / or quantity of fruits and / or seeds.

[0020] In another preferred embodiment, regulating the plant traits further includes:

[0021] (v) Increasing the root length; and / or

[0022] (vi) Increasing the root weight.

[0023] In another preferred embodiment, the composition includes an agricultural composition.

[0024] In another preferred embodiment, the preparation includes an agricultural preparation.

[0025] In another preferred embodiment, the composition comprises (a) a TPST gene or its encoded protein, or its promoter; and (b) an agriculturally acceptable carrier.

[0026] In another preferred embodiment, in the composition, component (a) is contained in an amount of 0.0001-99 wt%, preferably 0.1-90 wt%, based on the total weight of the composition.

[0027] In another preferred embodiment, the dosage form of the composition or preparation is selected from the group consisting of: solution, emulsion, suspension, powder, foam, paste, granule, aerosol, or a combination thereof.

[0028] In another preferred embodiment, the composition further comprises other substances for regulating plant traits.

[0029] In another preferred embodiment, the other substances for regulating plant traits include osmotic regulators, brassinolides, seaweed extracts, fertilizers with high potassium, nitrogen or phosphorus content, trace elements (such as boron, zinc, calcium, silicon), triazole fungicides (such as difenoconazole, propiconazole, tebuconazole), high-potassium foliar fertilizers, plant hormones (such as abscisic acid, ethylene, cytokinins, polyamines), rare earths, PP 333 , benzoic acid, salicylic acid, uniconazole.

[0030] In another preferred embodiment, the osmotic regulator is selected from the group consisting of: inorganic regulators, organic regulators, growth regulators, or a combination thereof.

[0031] In another preferred embodiment, the inorganic regulator includes Ca 2+ , salicylic acid.

[0032] In another preferred embodiment, the organic regulator includes betaine, proline, sodium nitroprusside (SNP).

[0033] In another preferred embodiment, the growth regulator includes: abscisic acid (ABA).

[0034] In another preferred embodiment, the promoter includes a small molecule compound that promotes the expression of the TPST gene or its encoded protein.

[0035] In another preferred embodiment, the promoter is selected from the group consisting of: small molecule compounds, nucleic acid molecules, or a combination thereof.

[0036] In another preferred embodiment, the plant includes monocotyledonous plants, dicotyledonous plants, and / or gymnosperms.

[0037] In another preferred embodiment, the plant includes crops, forestry plants, vegetables, fruits, melons, flowers, forage grasses (including turfgrasses).

[0038] In another preferred embodiment, the plant is selected from the group consisting of: Cruciferae, Gramineae, Leguminosae, Solanaceae, Umbelliferae, Chenopodiaceae, or a combination thereof.

[0039] In another preferred example, the plant is selected from the group consisting of: Arabidopsis thaliana, rice, soybean, tomato, corn, sorghum, tobacco, wheat, sorghum, foxtail millet, quinoa, potato, sweet potato, rapeseed, Chinese cabbage, spinach, lettuce, cucumber, crown daisy, water spinach, celery, lettuce, or a combination thereof.

[0040] In another preferred example, the plant includes: rice, wheat, corn, and / or sorghum.

[0041] In another preferred example, the rice is selected from the group consisting of: indica rice, japonica rice, or a combination thereof.

[0042] In another preferred example, the TPST gene is selected from the group consisting of: cDNA sequence, genomic sequence, or a combination thereof.

[0043] In another preferred example, the TPST gene is from one or more plants selected from the group consisting of: cruciferous plants, gramineous plants, Solanaceae, Leguminosae, Chenopodiaceae.

[0044] In another preferred example, the TPST gene is from one or more plants selected from the group consisting of: Arabidopsis thaliana, rice, corn, sorghum, wheat, foxtail millet, Brachypodium distachyon, quinoa.

[0045] In another preferred example, the TPST gene is selected from the group consisting of: the TPST gene of Arabidopsis thaliana (AtTPST, AT1G08030), the TPST gene of rice (OsTPST, accession number LOC9267276), the TPST gene of corn (ZmTPST of corn, accession number LOC100280275), the TPST gene of sugarcane (SbTPST of sugarcane, accession number LOC8071351), the TPST gene of Camelina sativa (CsTPST of Camelina sativa, accession number LOC104754980), the TPST gene of rapeseed (BrTPST of rapeseed, accession number LOC103871547), the TPST gene of radish (RsTPST of radish, accession number LOC108862166), or a combination thereof.

[0046] In another preferred example, the TPST gene includes a wild-type TPST gene and a mutant TPST gene.

[0047] In another preferred example, the mutant type includes a mutant form in which the function of the encoded protein does not change after mutation (i.e., the function is the same as or substantially the same as that of the wild-type encoded protein) and a mutant form with enhanced function.

[0048] In another preferred example, the polypeptide encoded by the mutant TPST gene is the same as or substantially the same as the polypeptide encoded by the wild-type TPST gene.

[0049] In another preferred embodiment, the mutant TPST gene comprises a polynucleotide having a homology of ≥80% (preferably ≥90%, more preferably ≥95%, still more preferably ≥98% or 99%) compared to the wild-type TPST gene.

[0050] In another preferred embodiment, the mutant TPST gene comprises a polynucleotide truncated or added with 1 - 60 (preferably 1 - 30, more preferably 1 - 10) nucleotides at the 5' end and / or 3' end of the wild-type TPST gene.

[0051] In another preferred embodiment, the amino acid sequence of the TPST protein is selected from the group consisting of:

[0052] (i) a polypeptide having the amino acid sequence shown in SEQ ID NO.:3;

[0053] (ii) a polypeptide derived from (i) with the function of regulating plant traits, formed by substitution, deletion or addition of one or several (such as 1 - 10) amino acid residues in the amino acid sequence shown in SEQ ID NO.:3; or

[0054] (iii) a polypeptide having a homology of ≥80% (preferably ≥90%, more preferably ≥95% or ≥98%) with the amino acid sequence shown in SEQ ID NO.:3 and having the TPST activity.

[0055] In another preferred embodiment, the nucleotide sequence of the TPST gene is selected from the group consisting of:

[0056] (a) a polynucleotide encoding the polypeptide shown in SEQ ID NO.:3;

[0057] (b) a polynucleotide having the sequence shown in any one of SEQ ID NO.:1, 2 or 5;

[0058] (c) a polynucleotide having a homology of ≥75% (preferably ≥85%, more preferably ≥90% or ≥95%) with the sequence shown in any one of SEQ ID NO.:1, 2 or 5;

[0059] (d) a polynucleotide truncated or added with 1 - 60 (preferably 1 - 30, more preferably 1 - 10) nucleotides at the 5' end and / or 3' end of the polynucleotide shown in any one of SEQ ID NO.:1, 2 or 5;

[0060] (e) a polynucleotide complementary to the polynucleotide described in any one of (a) - (d).

[0061] The second aspect of the present invention provides a composition, comprising:

[0062] (a) a promoter of the TPST gene or its encoded protein; and

[0063] (b) an agriculturally acceptable carrier.

[0064] In another preferred embodiment, the composition comprises an agricultural composition.

[0065] In another preferred embodiment, the dosage form of the composition is selected from the following group: solution, emulsion, suspension, powder, foam, paste, granule, aerosol, or a combination thereof.

[0066] In another preferred embodiment, the composition contains 0.0001-99 wt%, preferably 0.1-90 wt% of component (a), based on the total weight of the composition.

[0067] In another preferred embodiment, in the composition, the content (wt%) of the promoter of the TPST gene or its encoded protein is 0.05%-10%, preferably 0.1%-8%, and more preferably 0.5%-6%.

[0068] In another preferred embodiment, the promoter is selected from the following group: small molecule compounds, nucleic acid molecules, or a combination thereof.

[0069] In another preferred embodiment, the composition further comprises other substances that regulate plant traits.

[0070] In another preferred embodiment, the other substances that regulate plant traits include osmotic regulators, brassinolide, algae extract, fertilizers with high potassium, nitrogen or phosphorus content, trace elements (such as boron, zinc, calcium, silicon), triazole fungicides (such as difenoconazole, propiconazole, tebuconazole), high potassium foliar fertilizers, plant hormones (such as abscisic acid, ethylene, cytokinin, polyamines), rare earths, paclobutrazol (PP333), chloroquine (PP433), chloroquine (PP533), chloroquine (PP633), chloroquine (PP733), chloroquine (PP833), chloroquine (PP933), chloroquine (PP103), chloroquine (PP113), chloroquine (PP123), chloroquine (PP124), chloroquine (PP13 ... 333 ), benzoic acid, salicylic acid, uniconazole. In another preferred embodiment, the osmotic regulator is selected from the group consisting of inorganic regulators, organic regulators, growth regulators, or combinations thereof.

[0071] In another preferred embodiment, the inorganic regulator includes Ca 2+ , salicylic acid.

[0072] In another preferred embodiment, the organic regulator includes betaine, proline, and sodium nitroprusside (SNP).

[0073] In another preferred embodiment, the growth regulator includes abscisic acid (ABA).

[0074] The third aspect of the present invention provides a use of the composition according to the second aspect of the present invention for improving plant traits.

[0075] The fourth aspect of the present invention provides a method for improving plant traits, comprising the steps of:

[0076] Increasing the expression level and / or activity of the TPST gene or its encoded protein in the plant, thereby improving the traits of the plant.

[0077] In another preferred embodiment, the method comprises administering a promoter of the TPST gene or its encoded protein to the plant.

[0078] In another preferred embodiment, the promoter is a substance that promotes the expression of the TPST gene or its encoded protein.

[0079] In another preferred embodiment, the promoter is selected from the group consisting of: small molecule compounds, nucleic acid molecules, or combinations thereof.

[0080] In another preferred embodiment, the method comprises introducing an exogenous TPST gene into the plant.

[0081] In another preferred embodiment, the method comprises introducing a substance that promotes the expression of the endogenous TPST gene or its encoded protein into the plant.

[0082] In another preferred embodiment, the method comprises promoting the expression of the endogenous TPST gene or its encoded protein in the plant.

[0083] In another preferred embodiment, the method comprises the steps of:

[0084] (i) providing a plant or a plant cell; and

[0085] (ii) introducing the TPST gene sequence into the plant or the plant cell, thereby obtaining a transgenic plant or a transgenic plant cell.

[0086] In another preferred embodiment, the method comprises the steps of:

[0087] (a) providing Agrobacterium carrying an expression vector of the TPST gene sequence;

[0088] (b) contacting the plant cell or tissue or organ with the Agrobacterium in step (a), thereby transferring the gene sequence of TPST into the plant cell and integrating it into the chromosome of the plant cell;

[0089] (c) selecting the plant cell or tissue or organ that has transferred the TPST gene sequence; and

[0090] (d) regenerating the plant cell or tissue or organ in step (c) into a plant.

[0091] In another preferred embodiment, the expression level or activity of the TPST gene or its encoded protein in the plant tissue or plant cell is increased by ≥5%, ≥10%, ≥20%, more preferably, ≥50%.

[0092] In another preferred embodiment, the "increase" means that the increase in the expression or activity of the TPST gene or its encoded protein satisfies the following conditions:

[0093] The ratio of A1 / A0 ≥ 5%, more preferably ≥ 10%, still more preferably ≥ 20%, and most preferably 50 - 200%; wherein, A1 is the expression or activity of the TPST gene or its encoded protein in plant tissues or plant cells; A0 is the expression or activity of the same TPST gene or its encoded protein in wild-type plant tissues or plant cells of the same species.

[0094] In another preferred embodiment, the ratio (E1 / E0) of the activity E1 of TPST in the plant to the basal activity E0 of the same TPST in wild-type plants of the same species is ≥ 2-fold, preferably ≥ 5-fold, more preferably ≥ 10-fold.

[0095] The fifth aspect of the present invention provides a method for preparing genetically engineered plant tissues or plant cells, comprising the steps of:

[0096] Increasing the expression level and / or activity of the TPST gene or its encoded protein in plant tissues or plant cells, thereby obtaining genetically engineered plant tissues or plant cells.

[0097] In another preferred embodiment, the genetic engineering includes transgenesis.

[0098] In another preferred embodiment, the method further comprises introducing a promoter of the TPST gene or its encoded protein into the plant tissues or plant cells.

[0099] The sixth aspect of the present invention provides a method for preparing a plant with improved traits, comprising the steps of:

[0100] Regenerating the genetically engineered plant tissues or plant cells prepared by the method of the fifth aspect of the present invention into a plant body, thereby obtaining a plant with improved traits.

[0101] In another preferred embodiment, the traits include one or more traits selected from the following group:

[0102] (i) Stress resistance;

[0103] (ii) 1000-grain weight;

[0104] (iii) Yield and / or biomass;

[0105] (iv) Size, weight, and / or number of fruits and / or seeds.

[0106] In another preferred embodiment, the traits further include one or more selected from the following group:

[0107] (iii) Root length;

[0108] (iv) Root weight.

[0109] In another preferred embodiment, the trait improvement includes:

[0110] (i) Enhancing plant stress resistance; and / or

[0111] (ii) Increasing 1000-grain weight; and / or

[0112] (iii) Increasing yield and / or biomass; and / or

[0113] (iv) Increasing the size, weight and / or number of fruits and / or seeds.

[0114] In another preferred embodiment, the trait improvement further includes:

[0115] (iii) Increasing root length; and / or

[0116] (iv) Increasing root weight.

[0117] The seventh aspect of the present invention provides a genetically engineered plant into which the TPST gene or its encoded protein, or its promoter is introduced, or the plant is prepared by the method described in the sixth aspect of the present invention.

[0118] It should be understood that within the scope of the present invention, the above technical features of the present invention and the technical features specifically described below (such as in the examples) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be repeated here one by one. BRIEF DESCRIPTION OF THE DRAWINGS

[0119] Figure 1 Detection of AtTPST gene expression in the T1 generation of AtTPST transgenic rice lines. Among them, control is the Nipponbare negative control transfected with the empty vector pCambia1305. Among them, P35S-3, 46, 51, 52 are transgenic rice lines of TPST CDs driven by the 35S promoter; PTPST-31, 40, 46, 47 are transgenic rice lines of the AtTPST genomic sequence driven by the endogenous promoter of Arabidopsis thaliana TPST.

[0120] Figure 2 Comparison of metal ion contents in transgenic and wild-type rice seeds. Among them, Figure 2 A Potassium element content, Figure 2 B Sodium element content; control is the Nipponbare negative control transfected with the empty vector pCambia1305, P3S is transgenic rice of TPST CDs driven by the 35S promoter, and PTPST is transgenic rice of the AtTPST genomic sequence driven by the endogenous promoter of Arabidopsis thaliana TPST.

[0121] Figure 3 For the comparison of grain weights of transgenic and wild-type rice seeds, where control is the negative control of Nipponbare transformed with the empty vector pCambia1305, P35S is the transgenic rice with TPST CDs driven by the 35S promoter, and PTPST is the transgenic rice with the genomic sequence of AtTPST driven by the endogenous promoter of Arabidopsis TPST.

[0122] Figure 4 For the AtTPST transgenic rice hydroponic seedlings having more developed roots, Figure 4 A. The transgenic lines 7 and 31 with the genomic sequence of AtTPST driven by the endogenous promoter of Arabidopsis TPST have more developed roots compared with Nipponbare (Japonica) and the negative control of Nipponbare transformed with the empty vector (control). Figure 4 B. The transgenic lines 7 and 31 with the genomic sequence of AtTPST driven by the endogenous promoter of Arabidopsis TPST have increased root lengths compared with Nipponbare (Japonica) and the negative control of Nipponbare transformed with the empty vector (control). Figure 4 C. The transgenic lines 7 and 31 with the genomic sequence of AtTPST driven by the endogenous promoter of Arabidopsis TPST have increased fresh root weights and also increased above-ground parts compared with Nipponbare (Japonica) and the negative control of Nipponbare transformed with the empty vector (control); Japonica refers to Nipponbare; control refers to the negative control of Nipponbare transformed with the empty vector; PTPST-7 refers to the transgenic line 7 with the genomic sequence of AtTPST driven by the endogenous promoter of Arabidopsis TPST; PTPST-31 refers to the transgenic line 31 with the genomic sequence of AtTPST driven by the endogenous promoter of Arabidopsis TPST.

[0123] Figure 5 Shows the drought resistance of AtTPST transgenic rice, where A: Rice seedlings growing normally; B: Rice seedlings germinated for 2 weeks are stopped watering for two weeks for drought treatment; C: 1 week after resuming watering. Detailed implementation manners

[0124] Through extensive and in-depth research, the present inventors, through the research and screening of a large number of plant trait loci, have first discovered that increasing the expression level or activity of the TPST gene or its encoded protein in the plant (such as rice) can significantly improve the traits of the plant. On this basis, the inventors have completed the present invention.

[0125] Specifically, when increasing the expression level or activity of the TPST gene or its encoded protein in the plant, it is possible to (i) enhance the stress resistance of the plant; and / or (ii) increase the thousand-grain weight; and / or (iii) increase the yield and / or biomass; and / or (iv) increase the size, weight and / or quantity of fruits and / or seeds; and / or (v) root length; and / or (vi) root weight.

[0126] TPST gene

[0127] TPST, namely tyrosyl-protein sulfo-transferase, is named tyrosylsulfotransferase in Chinese and is involved in the sulfation modification after protein translation. It transfers the sulfonic acid group of the substrate 3'-phosphoadenosine-5'-phosphosulfate (PAPS) to the tyrosine residue of the protein, and this modification enables the secreted protein or membrane protein to have mature biological functions. [1] 。

[0128] As used herein, the terms "the TPST gene of the present invention" and "TPST gene" are used interchangeably and both refer to the TPST gene or its variants derived from plants (such as rice, Arabidopsis thaliana). In a preferred embodiment, the nucleotide sequence of the TPST gene of the present invention is as shown in SEQ ID NO.:2. The variants of the gene can be obtained by inserting or deleting regulatory regions, performing random or site-directed mutagenesis, etc.

[0129] The present invention also includes nucleic acids having 50% or more (preferably more than 60%, more than 70%, more than 80%, more preferably more than 90%, more preferably more than 95%, most preferably more than 98%, such as 99%) homology with the preferred gene sequence (SEQ ID NO.:2) of the present invention, and such nucleic acids can also effectively regulate the traits of plants (such as rice). "Homology" refers to the similarity level (i.e., sequence similarity or identity) between two or more nucleic acids according to the percentage of identical positions.

[0130] In the present invention, the nucleotide sequence in SEQ ID NO.:2 can be subjected to substitution, deletion or addition of one or more (usually 1-90, preferably 1-60, more preferably 1-20, most preferably 1-10), and addition of several (usually within 60, preferably within 30, more preferably within 10, most preferably within 5) nucleotides at the 5' and / or 3' ends to generate a derivative sequence of SEQ ID NO.:2. Due to the degeneracy of codons, even with relatively low homology with SEQ ID NO.:2, it can basically encode the amino acid sequence as shown in SEQ ID NO.:3.

[0131] In addition, the meaning of "the nucleotide sequence in SEQ ID NO.: 2 is a derivative sequence with at least one nucleotide substitution, deletion or addition" also includes nucleotide sequences that can hybridize with the nucleotide sequence shown in SEQ ID NO.: 2 under moderately stringent conditions, and more preferably under highly stringent conditions. These variant forms include (but are not limited to): deletion, insertion and / or substitution of several (usually 1-90, preferably 1-60, more preferably 1-20, most preferably 1-10) nucleotides, and addition of several (usually within 60, preferably within 30, more preferably within 10, most preferably within 5) nucleotides at the 5' and / or 3' ends.

[0132] It should be understood that although the genes provided in the examples of the present invention are derived from Arabidopsis thaliana, TPST gene sequences derived from other similar plants (especially plants belonging to the same family or genus as Arabidopsis thaliana or other families or genera with relatively high homology to Arabidopsis thaliana) and having a certain homology (conservatism, such as having more than 80%, such as 85%, 90%, 95% or even 98% sequence identity) with the sequences of the present invention (preferably, the sequences are as shown in SEQ ID NO.: 2) are also included within the scope of the present invention, as long as those skilled in the art can conveniently isolate the sequence from other plants after reading the present application according to the information provided in the present application, and the methods and tools for comparing sequence identity are well known in the art, such as BLAST.

[0133] The polynucleotides of the present invention can be in the form of DNA or RNA. The DNA form includes: DNA, genomic DNA or synthetic DNA, and the DNA can be single-stranded or double-stranded. The DNA can be a coding strand or a non-coding strand. The coding region sequence encoding the mature polypeptide can be the same as or a degenerate variant of the coding region sequence shown in SEQ ID NO.: 2.

[0134] The polynucleotides encoding the mature polypeptide include: the coding sequence encoding only the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences) and non-coding sequences.

[0135] The term "polynucleotide encoding a polypeptide" may include a polynucleotide encoding such polypeptide, or may also include additional coding and / or non-coding sequences. The present invention also relates to variants of the above polynucleotides, which encode fragments, analogs and derivatives of a polynucleotide or polypeptide having the same amino acid sequence as the present invention. Variants of such polynucleotides may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants and insertion variants. As is known in the art, an allelic variant is an alternative form of a polynucleotide, which may be a substitution, deletion or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide encoded thereby.

[0136] The present invention also relates to polynucleotides which hybridize with the above sequences and have at least 50%, preferably at least 70%, more preferably at least 80% identity between the two sequences. The present invention particularly relates to polynucleotides which can hybridize with the polynucleotides described in the present invention under stringent conditions. In the present invention, "stringent conditions" refer to: (1) hybridization and washing at a lower ionic strength and a higher temperature, such as 0.2×SSC, 0.1% SDS, 60°C; or (2) addition of a denaturing agent during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficoll, 42°C, etc.; or (3) hybridization occurs only when the identity between the two sequences is at least 90% or more, preferably 95% or more.

[0137] The full-length TPST nucleotide sequence of the present invention or its fragment can generally be obtained by PCR amplification, recombination or artificial synthesis methods. For PCR amplification, primers can be designed according to the nucleotide sequences disclosed in the present invention, especially the open reading frame sequence, and a commercially available DNA library or a cDNA library prepared by conventional methods known to those skilled in the art can be used as a template for amplification to obtain the relevant sequence. When the sequence is relatively long, it is often necessary to perform PCR amplification two or more times, and then splice the fragments amplified each time together in the correct order. Once the relevant sequence is obtained, the relevant sequence can be obtained in large quantities by recombination methods. Usually, it is cloned into a vector, then transferred into cells, and then the relevant sequence is isolated from the proliferated host cells by conventional methods.

[0138] In addition, the relevant sequence can also be synthesized by artificial synthesis methods, especially when the fragment length is relatively short. Usually, a very long fragment can be obtained by first synthesizing multiple small fragments and then ligating them. At present, it is already possible to completely obtain the DNA sequence encoding the protein of the present invention (or its fragment, or its derivative) by chemical synthesis. Then the DNA sequence can be introduced into various existing DNA molecules (or such as vectors) and cells known in the art. In addition, mutations can also be introduced into the protein sequence of the present invention by chemical synthesis.

[0139] The polypeptide encoded by the TPST gene

[0140] As used herein, the terms "the polypeptide of the present invention", "the encoded protein of the TPST gene" can be used interchangeably, and both refer to the polypeptide of TPST derived from plants and its variants. In a preferred embodiment, a typical amino acid sequence of the polypeptide of the present invention is shown as SEQ ID NO.:3.

[0141] The present invention relates to a TPST polypeptide and its variants for regulating plant traits. In a preferred example of the present invention, the amino acid sequence of the polypeptide is shown as SEQ ID NO.:3. The polypeptide of the present invention can effectively regulate the traits of plants (such as rice).

[0142] The present invention also includes polypeptides or proteins with the same or similar functions having 50% or more (preferably more than 60%, more than 70%, more than 80%, more preferably more than 90%, more preferably more than 95%, most preferably more than 98%, such as 99%) homology with the sequence shown in SEQ ID NO.:3 of the present invention.

[0143] The "same or similar function" mainly refers to: "regulating the traits of plants or crops (such as rice)".

[0144] The polypeptide of the present invention can be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide. The polypeptide of the present invention can be a product of natural purification, a product of chemical synthesis, or a product produced using recombinant techniques from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the present invention can be glycosylated or can be non-glycosylated. The polypeptide of the present invention may also include or not include the starting methionine residue.

[0145] The present invention also includes TPST protein fragments and analogs having TPST protein activity. As used herein, the terms "fragment" and "analog" refer to polypeptides that substantially retain the same biological function or activity as the native TPST protein of the present invention.

[0146] The polypeptide fragments, derivatives or analogs of the present invention may be: (i) polypeptides in which one or more conservative or non-conservative amino acid residues (preferably conservative amino acid residues) are substituted, and such substituted amino acid residues may or may not be encoded by the genetic code; or (ii) polypeptides having a substituent group in one or more amino acid residues; or (iii) polypeptides formed by fusing the mature polypeptide with another compound (such as a compound that prolongs the half-life of the polypeptide, for example, polyethylene glycol); or (iv) polypeptides formed by fusing an additional amino acid sequence to this polypeptide sequence (such as a leader sequence or a secretion sequence or a sequence used to purify this polypeptide or a proprotein sequence, or a fusion protein). These fragments, derivatives and analogs are within the scope well-known to those skilled in the art according to the definitions herein.

[0147] In the present invention, the polypeptide variant is a derived sequence obtained by substituting, deleting or adding at least one amino acid in the amino acid sequence shown in SEQ ID NO.: 3 by several (usually 1-60, preferably 1-30, more preferably 1-20, most preferably 1-10), and adding one or several (usually within 20, preferably within 10, more preferably within 5) amino acids at the C-terminus and / or N-terminus. For example, when substituting amino acids with similar or comparable properties in the said protein, the function of the protein is generally not changed, and adding one or several amino acids at the C-terminus and / or N-terminus generally also does not change the function of the protein. These conservative variations are preferably generated by substitution according to Table 1.

[0148] Table 1

[0149]

[0150] [[ID=Thirteen]]

[0151] The present invention also includes analogs of the claimed protein. These analogs may differ from the native SEQ ID NO.: 3 in the amino acid sequence, or in the modified form that does not affect the sequence, or both. These analogs of the protein include natural or induced genetic variants. The induced variants can be obtained by various techniques, such as by random mutagenesis through radiation or exposure to mutagenic agents, and can also be obtained by site-directed mutagenesis or other known molecular biology techniques. The analogs also include analogs having residues different from the native L-amino acids (such as D-amino acids), and analogs having non-naturally occurring or synthetic amino acids (such as β, γ-amino acids). It should be understood that the proteins of the present invention are not limited to the representative proteins exemplified above.

[0152] Modified (usually without changing the primary structure) forms include: chemically derivatized forms of proteins in vivo or in vitro, such as acetylation or carboxylation. Modifications also include glycosylation, such as those that occur during protein synthesis and processing. Such modifications can be accomplished by exposing the protein to enzymes that effect glycosylation (such as mammalian glycosylating or deglycosylating enzymes). Modified forms also include sequences having phosphorylated amino acid residues (such as phosphotyrosine, phosphoserine, phosphothreonine).

[0153] Expression vector

[0154] The present invention also relates to vectors comprising the polynucleotides of the present invention, host cells genetically engineered with the vectors of the present invention or the mutant protein coding sequences of the present invention, and methods for producing the polypeptides of the present invention by recombinant techniques.

[0155] By conventional recombinant DNA techniques, the polynucleotide sequences of the present invention can be used to express or produce the proteins or variants thereof of the present invention. Generally, the following steps are involved:

[0156] (1). Transforming or transducing a suitable host cell with a polynucleotide encoding the protein or variant thereof of the present invention, or with a recombinant expression vector containing the polynucleotide;

[0157] (2). Culturing the host cell in a suitable medium;

[0158] (3). Isolating and purifying the protein from the medium or the cells.

[0159] The present invention also provides a recombinant vector comprising the gene of the present invention. As a preferred embodiment, the recombinant vector contains a multiple cloning site or at least one restriction site downstream of the promoter. When it is desired to express the target gene of the present invention, the target gene is ligated into a suitable multiple cloning site or restriction site so that the target gene is operably linked to the promoter. As another preferred embodiment, the recombinant vector comprises (in the 5' to 3' direction): a promoter, a target gene, and a terminator. If desired, the recombinant vector may further comprise elements selected from the group consisting of: a 3' polynucleotidylation signal; an untranslated nucleic acid sequence; a transport and targeting nucleic acid sequence; a resistance selection marker (such as dihydrofolate reductase, neomycin resistance, hygromycin resistance, and fluorescent proteins); an enhancer; or an operator.

[0160] In the present invention, the polynucleotide sequence encoding the protein can be inserted into a recombinant expression vector. The term "recombinant expression vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art. Any plasmid and vector can be used as long as it can replicate and be stable in the host. An important feature of the expression vector is that it usually contains an origin of replication, a promoter, a marker gene and translation control elements.

[0161] Methods well known to those skilled in the art can be used to construct expression vectors containing the protein-coding DNA sequence of the present invention and appropriate transcriptional / translational control signals. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, etc. When using the gene of the present invention to construct a recombinant expression vector, any one of enhancer-type, constitutive, tissue-specific or inducible promoters can be added before the transcriptional start nucleotide.

[0162] The DNA sequence described above can be effectively ligated to an appropriate promoter in the expression vector to direct mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of Escherichia coli; the λ phage PL promoter; eukaryotic promoters including the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, the LTRs of retroviruses and some other known promoters that can control gene expression in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator.

[0163] Vectors including the gene, expression cassette or of the present invention can be used to transform appropriate host cells so that the host expresses the protein. The host cell can be a prokaryotic cell, such as Escherichia coli, Streptomyces, Agrobacterium; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a plant cell. Those of ordinary skill in the art are well aware of how to select appropriate vectors and host cells. Transforming host cells with recombinant DNA can be carried out by conventional techniques well known to those skilled in the art. When the host is a prokaryote (such as Escherichia coli), competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl2 method, and the steps used are well known in the art. Another method is to use MgCl2. If necessary, transformation can also be carried out by electroporation. When the host is a eukaryote, the following DNA transfection methods can be selected: calcium phosphate co-precipitation method, conventional mechanical methods such as microinjection, electroporation, liposome packaging, etc. Transforming plants can also use methods such as Agrobacterium transformation or gene gun transformation, such as the leaf disc method, young embryo transformation method, flower bud soaking method, etc. Transformed plant cells, tissues or organs can be regenerated into plants by conventional methods to obtain transgenic plants.

[0164] In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selecting transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green fluorescent protein (GFP) for eukaryotic cell culture, or tetracycline or ampicillin resistance for Escherichia coli.

[0165] Vectors containing the appropriate DNA sequences described above and appropriate promoters or control sequences can be used to transform appropriate host cells to enable them to express proteins.

[0166] The host cell can be a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples include: Escherichia coli, Streptomyces; bacterial cells of Salmonella typhimurium; fungal cells such as yeast, plant cells (such as rice cells).

[0167] When the polynucleotide of the present invention is expressed in higher eukaryotic cells, transcription will be enhanced if an enhancer sequence is inserted into the vector. An enhancer is a cis-acting factor of DNA, usually about 10 to 300 base pairs, which acts on the promoter to enhance gene transcription. Examples include the 100 to 270 base pair SV40 enhancer on the late side of the replication origin, the polyoma enhancer on the late side of the replication origin, and the adenovirus enhancer, etc.

[0168] Those of ordinary skill in the art are well aware of how to select appropriate vectors, promoters, enhancers, and host cells.

[0169] The obtained transformants can be cultured by conventional methods to express the polypeptide encoded by the gene of the present invention. Depending on the host cell used, the culture medium used in the culture can be selected from various conventional culture media. The culture is carried out under conditions suitable for the growth of the host cell. When the host cell grows to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature shift or chemical induction), and the cells are cultured for a further period of time.

[0170] The protein described in the present invention can be expressed intracellularly, or on the cell membrane, or secreted extracellularly. If desired, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical, and other properties. These methods are well known to those skilled in the art. Examples of these methods include, but are not limited to: conventional renaturation treatment, treatment with protein precipitants (salting-out method), centrifugation, osmotic lysis, sonication, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC), and various other liquid chromatography techniques and combinations of these methods.

[0171] Improving the traits of plants

[0172] In the present invention, a method for improving plant traits is also provided. Specifically, promoting or enhancing the expression of the TPST gene or its encoded protein can improve plant traits, and the traits are selected from one or more of the following groups:

[0173] (i) Stress resistance;

[0174] (ii) 1000-grain weight.

[0175] (iii) Yield and / or biomass;

[0176] (iv) Size, weight and / or quantity of fruits and / or seeds.

[0177] In a preferred embodiment, the traits also include one or more selected from the following groups:

[0178] (v) Root length;

[0179] (vi) Root weight.

[0180] In a preferred embodiment, the improvement of plant traits includes:

[0181] (i) Enhancing plant stress resistance; and / or

[0182] (ii) Increasing 1000-grain weight; and / or

[0183] (iii) Increasing yield and / or biomass; and / or

[0184] (iv) Increasing size, weight and / or quantity of fruits and / or seeds.

[0185] In a preferred embodiment, the improvement of plant traits also includes:

[0186] (v) Increasing root length; and / or

[0187] (vi) Increasing root weight.

[0188] The main advantages of the present invention include:

[0189] (1) It is first discovered in the present invention that increasing the content of the TPST gene in plants or up-regulating the expression of this gene can improve the agronomic traits of plants, such as stress resistance, 1000-grain weight, yield, biomass, size, weight, quantity of fruits or seeds, root length, root weight, etc.

[0190] (2) The present invention discovers for the first time that expressing the Arabidopsis AtTPST gene driven by an Arabidopsis endogenous promoter in rice can promote the root development of rice seedlings at the seedling stage, which will necessarily be beneficial to the growth of the above-ground part of rice under natural cultivation conditions, achieving the effect of strengthening seedlings. The developed and strong roots can also endow rice with excellent growth traits of drought resistance and barren resistance, promoting the robustness of rice plants at later stages in many aspects. Moreover, this gene-transformed rice can increase the 1000-grain weight of grains, directly promoting the rice yield and endowing the plants with excellent yield traits. It is the most direct and effective way to solve the problems of food shortage and efficient land use.

[0191] The following specific examples are provided to further illustrate the present invention. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods without specific conditions noted in the following examples are generally carried out under conventional conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise specified, the materials and reagents used in the examples are all commercially available products.

[0192] Example 1 Obtaining the TPST gene:

[0193] 1) Cloning of the TPST gene promoter and genomic sequence

[0194] The total volume of the reaction system is 25 μL, and the template is Arabidopsis genomic DNA for gene cloning to obtain the full-length sequence of the TPST gene (SEQ ID NO: 1). The promoter sequence is as shown in SEQ ID NO: 4, and the genomic sequence is as shown in SEQ ID NO: 5.

[0195] The primers used (designed by the present inventors) are as follows:

[0196] TPST-F: GTAAGCTTCATGGGAGCTCCA (SEQ ID NO.: 6);

[0197] TPST-R: AATCTTAACTTTGGAGGTTCTTCT (SEQ ID NO.: 7).

[0198] Reaction system:

[0199]

[0200] Add water to 50 μL.

[0201] Amplification process: 98 °C for 2 min;

[0202] (98°C for 20 sec; 58°C for 30 min; 72°C for 90 sec) for 30 cycles;

[0203] 72°C for 5 min.

[0204] 2) Cloning of the TPST CDS gene sequence

[0205] The total volume of the reaction system was 25 μL, and Arabidopsis cDNA was used as the template for gene cloning to obtain the TPST CDS sequence (the sequence is shown in SEQ ID NO: 2), and the amino acid sequence encoded by this gene is shown in SEQ ID NO: 3;

[0206] The primers used (designed by the present inventors) are as follows:

[0207] TPST-CDS-F: ATGCAAATGAACTCTGTTTGGA (SEQ ID NO.: 8);

[0208] TPST-CDS-R: AATCTTAACTTTGGAGGTTCTTCT (SEQ ID NO.: 9).

[0209] Reaction system:

[0210]

[0211] Add water to 50 μL

[0212] Amplification process: 98°C for 2 min;

[0213] (98°C for 20 sec; 58°C for 30 min; 72°C for 90 sec) for 30 cycles;

[0214] 72°C for 5 min.

[0215] Example 2: Construction and trait analysis of transgenic plants

[0216] 1. Construction of transgenic vectors

[0217] 1) Construction of the TPST gene transgenic vector

[0218] The sequence shown in SEQ ID NO: 1 was cloned into the pCambia1305 vector and fused with HA (influenza hemagglutinin epitope: YPYDVPDYA (SEQ ID NO.:

[0219] 10)) tag for fusion expression to construct the TPST gene transgenic vector.

[0220] 2) Construction of 35S-TPST transgenic vector

[0221] Clone the sequence shown in SEQ ID NO:2 into the pCambia1305 vector, and fuse it with the HA tag for expression to construct a 35S-TPST gene transgenic vector.

[0222] 2. Rice genetic transformation

[0223] For rice genetic transformation, the genetic transformation method mediated by Agrobacterium EHA105 is used, and the specific steps are as follows:

[0224] After dehulling and disinfecting mature rice seeds with mercuric chloride, culture them in the callus induction medium at 26°C in the dark for 30 days; culture the induced callus in the subculture medium for 15 days; select bright yellow callus and soak it in the Agrobacterium liquid carrying the target vector for 30 minutes, then dry it and culture it on the co-culture medium at 18°C for 2 days; wash the callus with sterile water, dry it, and place it on the resistant screening medium. After 2 rounds of resistant screening, each round for 15 days; transfer the obtained resistant callus to the differentiation medium and differentiate it in the light culture room for about 40 days to produce regenerated plants; transfer the regenerated plants to the rooting medium and culture them for 10 days, and transplant them after acclimatizing for 3 - 5 days.

[0225] 3. Transplanting, expression level identification and phenotypic analysis

[0226] Each genetic line of the rooted transgenic plants is transplanted into the greenhouse, and leaves are taken for realtime qRT-PCR expression level identification.

[0227] The primers (designed by the present inventors) used are as follows:

[0228] qTPST-1F TTACTTCTTAGCTCAGTTATTGGC (SEQ ID NO.:11)

[0229] qTPST-1R CAATGAAAATATGTTCTGCCTCCA (SEQ ID NO.:12)

[0230] Reaction system:

[0231]

[0232] Add water to 15 μL

[0233] Amplification process: 98°C for 2 min; (98°C for 20 sec; 60°C for 30 sec) for 45 cycles;

[0234] Add the melting curve.

[0235] 4. Results

[0236] 1) Detection of AtTPST gene expression in T1 generation transgenic rice of AtTPST

[0237] As Figure 1 , after the seeds of T1 generation transgenic rice lines germinated, total RNA was extracted and RT-qPCR was performed. Compared with the negative control transformed with the empty vector, AtTPST transcripts were detected in both the AtTPST expression lines P35-3 / 46 / 51 / 52 driven by the PCMV35S promoter and the transgenic rice lines PTPST-31 / 40 / 46 / 47 of AtTPST gene driven by the AtTPST endogenous promoter. Moreover, the activity of the AtTPST endogenous promoter was significantly higher than that of the CMV35S promoter lines in the detected lines, with an average transcriptional activity 3.5 times higher in T1 generation rice.

[0238] 2) Phenotypic identification of T1 generation transgenic rice of AtTPST

[0239] For the identification results, please refer to Figures 2 - 4 . There were significant differences in the metal ion contents of AtTPST transgenic rice seeds compared with the control. Especially, there was a higher K content. The K content in transgenic plants of AtTPST was all higher than 130% of the control group ( Figure 2 A), and at the same time, a lower Na content, about 50% of the control group ( Figure 2 B).

[0240] In terms of the weight of 1000-grain weight of grains, the seeds of transgenic plants were heavier than the control, with an average weight increase of about 15% ( Figure 3 ).

[0241] AtTPST transgenic rice seedlings had more developed roots. The root length increased by more than 14%, and the root weight increased by more than 60%, showing significantly more developed roots ( Figure 4 A- Figure 4 C). Among them, the transgenic lines 7 and 31 of AtTPST genomic sequence driven by the Arabidopsis TPST endogenous promoter had more developed roots compared with Nipponbare (Japonica) and the negative control of Nipponbare transformed with the empty vector (control) ( Figure 4 A), with a significant increase in root length ( Figure 4 B), a significant increase in root fresh weight, and an increase in the above-ground part as well ( Figure 4 C).

[0242] 3) Drought resistance test of T1 generation transgenic rice of AtTPST

[0243] The seeds were soaked in water for germination for three days. Weigh equal amounts of dry soil into flower pots, place the flower pots on the same tray, and water them by soaking until the upper layer of soil is moist. Plant the germinated seeds in the soil. Cultivate in a greenhouse. Ensure that the upper layer of soil remains moist before the drought treatment. Stop watering after the rice seedlings have grown for two weeks, and observe the phenotypic changes after two weeks of growth. Then resume watering and observe the phenotypic changes after one week of growth.

[0244] The results showed that: under normal conditions, there was no significant difference between the wild-type group and the vector control group, as shown in Figure 5 A. The seedlings of the wild-type group and the vector control group after two weeks of drought treatment showed significantly inhibited growth, with significantly shorter plant heights and more wilted leaves compared to the transgenic plants, as shown in Figure 5 B. After rewatering, there was no obvious improvement in the seedlings of the wild-type group and the vector control group, while the transgenic plants were improved to a certain extent, as shown in Figure 5 C.

[0245] 5. Conclusion

[0246] The increase in TPST content can reduce the Na / K ratio in plants, thereby enhancing the salt tolerance of plants; at the same time, it significantly increases the 1000-grain weight of seeds, thereby increasing the yield of crops; it significantly increases the root length and root weight of plants, thereby enhancing the drought resistance, pest and disease resistance, and lodging resistance of plants, and enhancing the environmental adaptability. It shows that TPST has important scientific application value in cultivating new plant varieties with high yield and stress tolerance.

[0247] Example 3 Experiment on enhancing the relative expression level of OsTPST gene in rice

[0248] Furthermore, the inventors will also increase the expression level of OsTPST in rice by the following methods:

[0249] (1) By transferring the OsTPST-related gene into rice to increase its endogenous content;

[0250] (2) Insert OsTPST after an endogenous strong promoter such as UBQ1, UBQ2, UBI9 or ACT2 to increase its expression level;

[0251] (3) Insert AHD and / or AMV upstream or downstream of the OsTPST promoter to promote the expression of OsTPST and increase its expression level.

[0252] By the above methods, the expression level of endogenous TPST in rice can be significantly enhanced, and some traits of rice can be improved, such as increasing the 1000-grain weight of rice, enhancing stress resistance, and increasing root length and root weight. This method provides a new means for plant trait improvement.

[0253] All documents mentioned in the present invention are incorporated herein by reference as if each document was individually incorporated by reference. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the appended claims of the present application.

[0254] References

[0255] [1]Moore K L(2003).The biology and enzymology of protein tyrosine Osulfation.J Biol Chem,278(27):24243-24246. Sequence Listing <110> Shandong Shunfeng Biotechnology Co., Ltd. <120> Application of TPST Gene in Regulating Plant Traits <130> P2019-1380 <160> 12 <170> SIPO Sequence Listing 1.0 <210> 1 <211> 5523 <212> DNA <213> Arabidopsis thaliana <400> 1 gtaagcttca tgggagctcc agggcaagct gcagagacag gtgtgtgaga accataacca 60 gattcctctg tttgaaggca gagaacaata ctaaagatgt tttgatacaa agactcaatg 120 atttcttcat cggaacaagt agtaagagaa tcaatcctca tgtgattatt gtagtggtca 180 cagagtggag aaattgcaat gattccactg tctcctttag agatcatagg agttatgggt 240 tccacataac ctgatgttcc ttcaatggag ttttcttcat agtccatggt gatggtgtca 300 caatatctgg aaaaagacag taaaaccata cattcagaca aagcccttgt aaacgaaacc 360 caatatctgg aaaaagacag taaaaccata cattcagaca aagcccttgt aaacgaaacc 360 agaggaagca acgagtttaa aatccatgat tattgaatag tacccctaat aagctatttc 420 agaggaagca acgagtttaa aatccatgat tattgaatag tacccctaat aagctatttc 420 acaaattgcg ttaagttcga gaagaaacat ttagtcgcat atcgtgatgc cattaatgaa 480 acaaattgcg ttaagttcga gaagaaacat ttagtcgcat atcgtgatgc cattaatgaa 480 agaaaaaaaa tctaatctaa aagacaaaaa gattgcacga caaattagat gatacgaaat 540 agaaaaaaaa tctaatctaa aagacaaaaa gattgcacga caaattagat gatacgaaat 540 catcgaattt attagagtta tggcactttt tcagaaacga ttcaaaagag tgagaaaatc 600 catcgaattt attagagtta tggcactttt tcagaaacga ttcaaaagag tgagaaaatc 600 tctatacctt tgactcatga ggtctgtaat tttttgttta tcttttcttt ttttctttga 660 tctatacctt tgactcatga ggtctgtaat tttttgttta tcttttcttt ttttctttga 660 cagcaatttt tttttttttt ttttttttgc gattttaata ttttttataa acttaagaaa 720 cagcaatttt tttttttttt ttttttttgc gattttaata ttttttataa acttaagaaa 720 atgataagcg gagaaacaga agacactagg cccatttaat tatcaggccc aattgtatta 780 atgataagcg gagaaacaga agacactagg cccatttaat tatcaggccc aattgtatta 780 atatcttaaa ccttctttaa aaccataaga ttaacacaaa ggtttacgac tatccttcta 840 atatcttaaa ccttctttaa aaccataaga ttaacacaaa ggtttacgac tatccttcta 840 gattttattt tccaagcatt tttaatccta ctgtatttct caaatctaca acctttgatg 900 gattttattt tccaagcatt tttaatccta ctgtatttct caaatctaca acctttgatg 900 attttttgtc atcaccaact tttttaaaaa aataattcat tttaggacat ttcaatccca 960 attttttgtc atcaccaact tttttaaaaa aataattcat tttaggacat ttcaatccca 960 atggcaataa ttacccattt atacgaattc tagcatacta gttaatgtat aattactttg 1020 atggcaataa ttacccattt atacgaattc tagcatacta gttaatgtat aattactttg 1020 ctatttattg gaaacctatg gaggtaatat ttatctctaa aggaatttat atatattttt 1080 agttaaatac atatttattg atattttagg attacaataa acatggcaac aaattatatt 1140 aaaaattaaa aaacagatat ttttattgta tagatgaaaa caaacaagtc attgcaaaac 1200 gaatggaacg atgacaagat tgaaaggaga cagcatccgc catcagcatg agacatttga 1260 acccacaaca tttttttgta gacaagtctg gtctttttac ttaaagcaaa taaactctag 1320 actttaggcc ttataacatt taagcataaa gtatggccac tgtcaggatt gaactctcaa 1380 atctcaacgg aaaactttaa tgctcataaa aatctgtgaa cgaatgattg aactgaagca 1440 atgactaaga acaaatgagt cataactcat aaccatgatc ctgtaactat aagtttcctc 1500 cttgaggtct ttcacacaca acgagggatg gatgtacatg tcaccagaag caacaagaag 1560 atcaagacgc aactaaaagg ccaaaagaag tgaagaacaa aatattacac aaagagggga 1620 tgtatagttg tatacccacg gtttaccgat ttcggttttc gttccgataa ccggttatgt 1680 atttcatttt gtattatata gaaggcattg gtcaaaccgc actcgaacca gaaaggaaag 1740 tgcattcata ctattactga ctagtggaaa aaaaaaaaaa aaaaaagcat tggtctctct 1800 caaaaaagat taattcgttt ggctaaatca aatttgacac tagtgtcttc ctcagtgcgt 1860 gtttataatt tttctgggtg gcgagaaacc aagagaaaat ctcgtgaccc tgttctctcg 1920 ggagcgcaca caatctctct tcttcttcgt cttcctcctc caatcgatgt aatcacacac 1980 acacacaaaa acacatcttt tccttgtttt cgtaggacct agtagatagc gagttttgcc 2040 cccaaaacag cgatcgaggg aatttatgag cacgagatct cgattcccca tacacgtagg 2100 cctctgcttc tctctcttgt tcctttgttc ctttctttat tcgattttct gggtcccttt 2160 tgccctgttt ttcctctgtc tccttccccc aaaatctttc ggttttgttt ttatacaact 2220 tgcaaccgtt aatgttcatc ctcaccgatt gatcacctac tcttttccct tcctgggttt 2280 tgtttctttc gaataaagat tgatccttct ttcacttata atcgttttgg taatcagtag 2340 ggtttggaat cgaggcacaa tgcaaatgaa ctctgtttgg aagctgtctc ttgggttatt 2400 acttcttagc tcaggtatgt atgcagaatg gttttacaaa attgttcatt tgataaaaaa 2460 gctggacttg tctctgatgt tcttggaata attggcaaat tatatctcag ttattggctc 2520 ttttgcggaa cttgattttg gccattgcga aactcttgtg aaaaaatggg ctgattcttc 2580 ttcatctcgt gaagaacatg ttaataaaga caaacgctcg cttaaggatt tgctcttctt 2640 tctccacgtt ccgcgaactg gaggcagaac atattttcat tggtgatttg atttccttta 2700 ccaaaaagtt tttgagagat tcttttatga ttgttgtgtg gttaaggctg tgtttgtgct 2760 cttgtagttt tttgaggaag ttgtatgata gctctgagga atgtcctcga tcttacgaca 2820 agctccactt caatccaagg tatcttaatt tcatcagtgc tctcgctaat tgtacgtctt 2880 tatttgatgc caaagactct ttcttgtgga aacaataaga tggcttacag aatgctgttt 2940 gtacattcta ttggttgtta agttgacttt agatagctta gctagacata tataaagtta 3000 aatattgttt catatgaaaa tcaattttcc ctagcctcct ttacctaaag aaaaacaatg 3060 tgaaaaaagt attttgcctg tggtgttact accttcggac agttaagatc gtgttgactc 3120 gtaaatttat aggaaggaaa agtgcaagtt gttagccaca catgatgatt atagtttgat 3180 ggcaaagctt ccgagggaga gaacttcggt gatgacaata gttcgggatc ctattgcgcg 3240 tgtgttaagc acttatgaat tttccgtaga ggtagcagct aggtttttgg tgcatcccaa 3300 tttaacttct gcgtcaagga tgtctagccg catacgcaag agtaatgtaa taagcacact 3360 agacatatgg ccatggaaat acctagttcc atggatgaga gaagacttgt ttgctcgggt 3420 atgtcgacct atcccattcg tcttttttgg cttttaagct agaacatgat aagaacacat 3480 aaaacttggg ctgaagcttt ttttactcat ccttggcttt tcttagcgag atgcacgaaa 3540 attgaaggag gtagtgatca ttgaggacga taacccgtat gacatggagg agatgcttat 3600 gcctttgcac aaatatcttg atgcgcctac tgctcatgac atcatccaca atggagcgac 3660 ttttcaggta ctttttcatg ctatttgttt aagttttcaa agttattgat tagagatctc 3720[[ID=?]] cagagcattt tcatttcact tcacagattg caggattgac aaataactcc catttatcag 3780 aagcacacga ggttcggcat tgtgtgcaga aattcaaaag ccttggtgag tctgttctcc 3840 aagttgccaa ggtagtaaca cttcttcttc atcatagttc actgcgtctt ggtattgtgc 3900 It should be noted that there seems to be an incorrect tag "? " in the provided text. Please check and correct it if necessary.ttttaaaagc agcagattct gtaagctttt ttaaattttg cagaggaggc tagacagcat 3960 gttgtatgtt ggactgacag aggagcacag ggaatctgca tcactttttg ccaatgtagt 4020 gggttctcaa gtgctgtctc aagtggttcc gtccaatgca actgcgaaaa tcaaagctct 4080 taaatcaggt tggtgtaagt ttcttaatac catcgctggg ctatctaagg agaatctagc 4140 aacttagttg aaggacatgg tgatcatttt tttagtcaca gtgtacagtt ttttcagagt 4200 accgctttgg agatggtatt tactttagtt tttggctttt gaaagtcaaa acccgtcata 4260 ttattcatta aaatgtttga ctgatatttt tcattcactt tttaggagtt tgatttttaa 4320 ttacctaggg aagctactta ttgttctctg ttatttgggg attatcgtat aaggtttgat 4380 tgtctttcat catgaagatt tttctgatct atgtttcttg ttgtcacatc atctttaaag 4440 gttctcttgc cctcttttgt tttagacttg tgtcttgtta ctctgggtcc ctgggtttat 4500 taaagtttct ttgttggtta atcatagtct cttagagtaa gtagaatgat gatatgacag 4560 ttcatgtgca tacagcctag gctttctatt gcttttgttg tatttaaagt caggataaca 4620 aatggttgta cttgcactca ccaaattgtc aactttattt ccttgatgct tcagaagcaa 4680 gtgtcacaat ttcagaaacc gggtcagata agagtaatat tcaggtaaag tcctgctgca 4740 gaaggtaata atttgtttgt tcaactgtca tttttgtaat tgtcttgctg aaaatggctg 4800 tgacattaca gaatggtaca tctgaagtta cattgaataa ggcagaagct aagagtggga 4860 atgtaagtag aatccctttt ccaatttatt atcaacgctt gagaccttgt gtgactttta 4920 tatatacact tcagatgacg gtaaaaaccc ttatggaagt ctatgaaggc tgcatcactc 4980 atttacgaaa gtcccaagga accagacggg tcaactctct gaagagaata actccagcaa 5040 attttacaag aggggtaaag tgttttcgta catgatctaa acttagtaaa gttaatgaga 5100 gaaggctgga ataatgaaat cttttgacaa tgcatctaac agacgcgtac aagagttcct 5160 aaagaggtca ttcagcagat caaatcgctt aacaacctcg atgtggagct ctacaaatat 5220 gcaaaagtaa tctttgccaa agaacatgaa ttagtgtcga ataagttgat ctcaagtgta 5280 agaaacttct tgtcttcaca tttcgccttt tagtttctgt ctgatataag actaaactcc 5340 atgattcgtg tgcagtctaa gagaagcatt gttgatctgc cgagtgagtt aaagagcgta 5400 ttgggagaaa tgggtgaaga gaagctatgg aagttcgtac cagtggcatt gatgctttta 5460 ttgatcgtcc tcttctttct atttgtaaac gctaaaagga gaagaacctc caaagttaag 5520 att 5523 <210> 2 <211> 1503 <212> DNA <213> Arabidopsis thaliana <400> 2 atgcaaatga actctgtttg gaagctgtct cttgggttat tacttcttag ctcagttatt 60 ggctcttttg cggaacttga ttttggccat tgcgaaactc ttgtgaaaaa atgggctgat 120 tcttcttcat ctcgtgaaga acatgttaat aaagacaaac gctcgcttaa ggatttgctc 180 ttctttctcc acgttccgcg aactggaggc agaacatatt ttcattgttt tttgaggaag 240 ttgtatgata gctctgagga atgtcctcga tcttacgaca agctccactt caatccaagg 300 aaggaaaagt gcaagttgtt agccacacat gatgattata gtttgatggc aaagcttccg 360 agggagagaa cttcggtgat gacaatagtt cgggatccta ttgcgcgtgt gttaagcact 420 tatgaatttt ccgtagaggt agcagctagg tttttggtgc atcccaattt aacttctgcg 480 tcaaggatgt ctagccgcat acgcaagagt aatgtaataa gcacactaga catatggcca 540 tggaaatacc tagttccatg gatgagagaa gacttgtttg ctcggcgaga tgcacgaaaa 600 ttgaaggagg tagtgatcat tgaggacgat aacccgtatg acatggagga gatgcttatg 660 cctttgcaca aatatcttga tgcgcctact gctcatgaca tcatccacaa tggagcgact 720 tttcagattg caggattgac aaataactcc catttatcag aagcacacga ggttcggcat 780 tgtgtgcaga aattcaaaag ccttggtgag tctgttctcc aagttgccaa gaggaggcta 840 gacagcatgt tgtatgttgg actgacagag gagcacaggg aatctgcatc actttttgcc 900 aatgtagtgg gttctcaagt gctgtctcaa gtggttccgt ccaatgcaac tgcgaaaatc 960 aaagctctta aatcagaagc aagtgtcaca atttcagaaa ccgggtcaga taagagtaat 1020 attcagaatg gtacatctga agttacattg aataaggcag aagctaagag tgggaatatg 1080 acggtaaaaa cccttatgga agtctatgaa ggctgcatca ctcatttacg aaagtcccaa 1140 ggaaccagac gggtcaactc tctgaagaga ataactccag caaattttac aagagggacg 1200 cgtacaagag ttcctaaaga ggtcattcag cagatcaaat cgcttaacaa cctcgatgtg 1260 gagctctaca aatatgcaaa agtaatcttt gccaaagaac atgaattagt gtcgaataag 1320 ttgatctcaa gttctaagag aagcattgtt gatctgccga gtgagttaaa gagcgtattg 1380 ggagaaatgg gtgaagagaa gctatggaag ttcgtaccag tggcattgat gcttttattg 1440 atcgtcctct tctttctatt tgtaaacgct aaaaggagaa gaacctccaa agttaagatt 1500 tga 1503 <210> 3 <211> 500 <212> PRT <213> Arabidopsis thaliana <400> 3 Met Gln Met Asn Ser Val Trp Lys Leu Ser Leu Gly Leu Leu Leu Leu 1 5 10 15 Ser Ser Val Ile Gly Ser Phe Ala Glu Leu Asp Phe Gly His Cys Glu 20 25 30 Thr Leu Val Lys Lys Trp Ala Asp Ser Ser Ser Ser Arg Glu Glu His 35 40 45 Val Asn Lys Asp Lys Arg Ser Leu Lys Asp Leu Leu Phe Phe Leu His 50 55 60 Val Pro Arg Thr Gly Gly Arg Thr Tyr Phe His Cys Phe Leu Arg Lys 65 70 75 80 Leu Tyr Asp Ser Ser Glu Glu Cys Pro Arg Ser Tyr Asp Lys Leu His 85 90 95 Phe Asn Pro Arg Lys Glu Lys Cys Lys Leu Leu Ala Thr His Asp Asp 100 105 110 Tyr Ser Leu Met Ala Lys Leu Pro Arg Glu Arg Thr Ser Val Met Thr 115 120 125 Ile Val Arg Asp Pro Ile Ala Arg Val Leu Ser Thr Tyr Glu Phe Ser 130 135 140 Val Glu Val Ala Ala Arg Phe Leu Val His Pro Asn Leu Thr Ser Ala 145 150 155 160 Ser Arg Met Ser Ser Arg Ile Arg Lys Ser Asn Val Ile Ser Thr Leu 165 170 175 Asp Ile Trp Pro Trp Lys Tyr Leu Val Pro Trp Met Arg Glu Asp Leu 180 185 190 Phe Ala Arg Arg Asp Ala Arg Lys Leu Lys Glu Val Val Ile Ile Glu 195 200 205 Asp Asp Asn Pro Tyr Asp Met Glu Glu Met Leu Met Pro Leu His Lys 210 215 220 Tyr Leu Asp Ala Pro Thr Ala His Asp Ile Ile His Asn Gly Ala Thr 225 230 235 240 Phe Gln Ile Ala Gly Leu Thr Asn Asn Ser His Leu Ser Glu Ala His 245 250 255 Glu Val Arg His Cys Val Gln Lys Phe Lys Ser Leu Gly Glu Ser Val 260 265 270 Leu Gln Val Ala Lys Arg Arg Leu Asp Ser Met Leu Tyr Val Gly Leu 275 280 285 Thr Glu Glu His Arg Glu Ser Ala Ser Leu Phe Ala Asn Val Val Gly 290 295 300 Ser Gln Val Leu Ser Gln Val Val Pro Ser Asn Ala Thr Ala Lys Ile 305 310 315 320 Lys Ala Leu Lys Ser Glu Ala Ser Val Thr Ile Ser Glu Thr Gly Ser 325 330 335 Asp Lys Ser Asn Ile Gln Asn Gly Thr Ser Glu Val Thr Leu Asn Lys 340 345 350 Ala Glu Ala Lys Ser Gly Asn Met Thr Val Lys Thr Leu Met Glu Val 355 360 365 Tyr Glu Gly Cys Ile Thr His Leu Arg Lys Ser Gln Gly Thr Arg Arg 370 375 380 Val Asn Ser Leu Lys Arg Ile Thr Pro Ala Asn Phe Thr Arg Gly Thr 385 390 395 400 Arg Thr Arg Val Pro Lys Glu Val Ile Gln Gln Ile Lys Ser Leu Asn 405 410 415 Asn Leu Asp Val Glu Leu Tyr Lys Tyr Ala Lys Val Ile Phe Ala Lys 420 425 430 Glu His Glu Leu Val Ser Asn Lys Leu Ile Ser Ser Ser Lys Arg Ser 435 440 445 Ile Val Asp Leu Pro Ser Glu Leu Lys Ser Val Leu Gly Glu Met Gly 450 455 460 Glu Glu Lys Leu Trp Lys Phe Val Pro Val Ala Leu Met Leu Leu Leu 465 470 475 480 Ile Val Leu Phe Phe Leu Phe Val Asn Ala Lys Arg Arg Arg Thr Ser 485 490 495 Lys Val Lys Ile 500 <210> 4 <211> 1850 <212> DNA <213> Arabidopsis thaliana <400> 4 gtaagcttca tgggagctcc agggcaagct gcagagacag gtgtgtgaga accataacca 60 gt aag ctt ca tgg gag ct cca ggg caa gct gca gag aca ggt gtg tga gaa cca taa cca 60 gattcctctg tttgaaggca gagaacaata ctaaagatgt tttgatacaa agactcaatg 120 gat tcc tct gtt tga agg caa gag aac aat act aaa gat gtt ttg ata caa aga ctc aat g 120 atttcttcat cggaacaagt agtaagagaa tcaatcctca tgtgattatt gtagtggtca 180 att tct tca tcg gaac aag tag taa gag aat caa tcc tca tgt gat tat tgt agt ggt ca 180 cagagtggag aaattgcaat gattccactg tctcctttag agatcatagg agttatgggt 240 cag agt gga gaa att gca at gat tcc act gtc tcc ttt aga gat cat agg agt tat ggg t 240 tccacataac ctgatgttcc ttcaatggag ttttcttcat agtccatggt gatggtgtca 300 tcc aca taa cct gat gtt cct tca atg ga gtt ttc ttc at agt cca tgg tga tgg tgt ca 300 caatatctgg aaaaagacag taaaaccata cattcagaca aagcccttgt aaacgaaacc 360 caa tat ctg gaa aaa gac agt aaa acc ata cat tca gac aaa gcc ctt gta aaa cga aac c 360 agaggaagca acgagtttaa aatccatgat tattgaatag tacccctaat aagctatttc 420 aga gga agc aac gag ttt aaa atc cat gat tat tga ata gta ccc cta ata agc tat ttc 420 acaaattgcg ttaagttcga gaagaaacat ttagtcgcat atcgtgatgc cattaatgaa 480 aca aat tgc gtt aag ttc gag aag aaa cat tta gtc gca tat cgt gat gcc att aat gaa 480 agaaaaaaaa tctaatctaa aagacaaaaa gattgcacga caaattagat gatacgaaat 540 aga aaa aaa tct aat cta aaa gac aaa aaa gat tgc acg aca aat tag at gat acg aat 540 catcgaattt attagagtta tggcactttt tcagaaacga ttcaaaagag tgagaaaatc 600 cat cga att tat tag agt tat ggc act ttt tca gaa acg att caa aag agt gag aaa atc 600 tctatacctt tgactcatga ggtctgtaat tttttgttta tcttttcttt ttttctttga 660 tct ata cct ttg act cat gag gtc tgt aat ttt ttg ttt atc ttt tct ttt ttt tct ttg a 660 cagcaatttt tttttttttt ttttttttgc gattttaata ttttttataa acttaagaaa 720 cag caa ttt ttt ttt ttt ttt ttt ttt ttg cga ttt taa tat ttt ttt tat aaa ctt aag aaa 720 atgataagcg gagaaacaga agacactagg cccatttaat tatcaggccc aattgtatta 780 atatcttaaa ccttctttaa aaccataaga ttaacacaaa ggtttacgac tatccttcta 840 gattttattt tccaagcatt tttaatccta ctgtatttct caaatctaca acctttgatg 900 attttttgtc atcaccaact tttttaaaaa aataattcat tttaggacat ttcaatccca 960 atggcaataa ttacccattt atacgaattc tagcatacta gttaatgtat aattactttg 1020 ctatttattg gaaacctatg gaggtaatat ttatctctaa aggaatttat atatattttt 1080 agttaaatac atatttattg atattttagg attacaataa acatggcaac aaattatatt 1140 aaaaattaaa aaacagatat ttttattgta tagatgaaaa caaacaagtc attgcaaaac 1200 gaatggaacg atgacaagat tgaaaggaga cagcatccgc catcagcatg agacatttga 1260 acccacaaca tttttttgta gacaagtctg gtctttttac ttaaagcaaa taaactctag 1320 actttaggcc ttataacatt taagcataaa gtatggccac tgtcaggatt gaactctcaa 1380 atctcaacgg aaaactttaa tgctcataaa aatctgtgaa cgaatgattg aactgaagca 1440 atgactaaga acaaatgagt cataactcat aaccatgatc ctgtaactat aagtttcctc 1500 cttgaggtct ttcacacaca acgagggatg gatgtacatg tcaccagaag caacaagaag 1560 atcaagacgc aactaaaagg ccaaaagaag tgaagaacaa aatattacac aaagagggga 1620 tgtatagttg tatacccacg gtttaccgat ttcggttttc gttccgataa ccggttatgt 1680 atttcatttt gtattatata gaaggcattg gtcaaaccgc actcgaacca gaaaggaaag 1740 tgcattcata ctattactga ctagtggaaa aaaaaaaaaa aaaaaagcat tggtctctct 1800 caaaaaagat taattcgttt ggctaaatca aatttgacac tagtgtcttc 1850 <210> 5 <211> 3673 <212> DNA <213> Arabidopsis thaliana <400> 5 ctcagtgcgt gtttataatt tttctgggtg gcgagaaacc aagagaaaat ctcgtgaccc 60 tgttctctcg ggagcgcaca caatctctct tcttcttcgt cttcctcctc caatcgatgt 120 aatcacacac acacacaaaa acacatcttt tccttgtttt cgtaggacct agtagatagc 180 gagttttgcc cccaaaacag cgatcgaggg aatttatgag cacgagatct cgattcccca 240 tacacgtagg cctctgcttc tctctcttgt tcctttgttc ctttctttat tcgattttct 300 gggtcccttt tgccctgttt ttcctctgtc tccttccccc aaaatctttc ggttttgttt 360 ttatacaact tgcaaccgtt aatgttcatc ctcaccgatt gatcacctac tcttttccct 420 tcctgggttt tgtttctttc gaataaagat tgatccttct ttcacttata atcgttttgg 480 taatcagtag ggtttggaat cgaggcacaa tgcaaatgaa ctctgtttgg aagctgtctc 540 ttgggttatt acttcttagc tcaggtatgt atgcagaatg gttttacaaa attgttcatt 600 tgataaaaaa gctggacttg tctctgatgt tcttggaata attggcaaat tatatctcag 660 ttattggctc ttttgcggaa cttgattttg gccattgcga aactcttgtg aaaaaatggg 720 ctgattcttc ttcatctcgt gaagaacatg ttaataaaga caaacgctcg cttaaggatt 780 tgctcttctt tctccacgtt ccgcgaactg gaggcagaac atattttcat tggtgatttg 840 atttccttta ccaaaaagtt tttgagagat tcttttatga ttgttgtgtg gttaaggctg 900 tgtttgtgct cttgtagttt tttgaggaag ttgtatgata gctctgagga atgtcctcga 960 tcttacgaca agctccactt caatccaagg tatcttaatt tcatcagtgc tctcgctaat 1020 tgtacgtctt tatttgatgc caaagactct ttcttgtgga aacaataaga tggcttacag 1080 aatgctgttt gtacattcta ttggttgtta agttgacttt agatagctta gctagacata 1140 tataaagtta aatattgttt catatgaaaa tcaattttcc ctagcctcct ttacctaaag 1200 aaaaacaatg tgaaaaaagt attttgcctg tggtgttact accttcggac agttaagatc 1260 gtgttgactc gtaaatttat aggaaggaaa agtgcaagtt gttagccaca catgatgatt 1320 atagtttgat ggcaaagctt ccgagggaga gaacttcggt gatgacaata gttcgggatc 1380 ctattgcgcg tgtgttaagc acttatgaat tttccgtaga ggtagcagct aggtttttgg 1440 tgcatcccaa tttaacttct gcgtcaagga tgtctagccg catacgcaag agtaatgtaa 1500 taagcacact agacatatgg ccatggaaat acctagttcc atggatgaga gaagacttgt 1560 ttgctcgggt atgtcgacct atcccattcg tcttttttgg cttttaagct agaacatgat 1620 aagaacacat aaaacttggg ctgaagcttt ttttactcat ccttggcttt tcttagcgag 1680 atgcacgaaa attgaaggag gtagtgatca ttgaggacga taacccgtat gacatggagg 1740 agatgcttat gcctttgcac aaatatcttg atgcgcctac tgctcatgac atcatccaca 1800 atggagcgac ttttcaggta ctttttcatg ctatttgttt aagttttcaa agttattgat 1860 tagagatctc cagagcattt tcatttcact tcacagattg caggattgac aaataactcc 1920 catttatcag aagcacacga ggttcggcat tgtgtgcaga aattcaaaag ccttggtgag 1980 tctgttctcc aagttgccaa ggtagtaaca cttcttcttc atcatagttc actgcgtctt 2040 ggtattgtgc ttttaaaagc agcagattct gtaagctttt ttaaattttg cagaggaggc 2100 tagacagcat gttgtatgtt ggactgacag aggagcacag ggaatctgca tcactttttg 2160 ccaatgtagt gggttctcaa gtgctgtctc aagtggttcc gtccaatgca actgcgaaaa 2220 tcaaagctct taaatcaggt tggtgtaagt ttcttaatac catcgctggg ctatctaagg 2280 agaatctagc aacttagttg aaggacatgg tgatcatttt tttagtcaca gtgtacagtt 2340 ttttcagagt accgctttgg agatggtatt tactttagtt tttggctttt gaaagtcaaa 2400 acccgtcata ttattcatta aaatgtttga ctgatatttt tcattcactt tttaggagtt 2460 tgatttttaa ttacctaggg aagctactta ttgttctctg ttatttgggg attatcgtat 2520 aaggtttgat tgtctttcat catgaagatt tttctgatct atgtttcttg ttgtcacatc 2580 atctttaaag gttctcttgc cctcttttgt tttagacttg tgtcttgtta ctctgggtcc 2640 ctgggtttat taaagtttct ttgttggtta atcatagtct cttagagtaa gtagaatgat 2700 gatatgacag ttcatgtgca tacagcctag gctttctatt gcttttgttg tatttaaagt 2760 caggataaca aatggttgta cttgcactca ccaaattgtc aactttattt ccttgatgct 2820 tcagaagcaa gtgtcacaat ttcagaaacc gggtcagata agagtaatat tcaggtaaag 2880 tcctgctgca gaaggtaata atttgtttgt tcaactgtca tttttgtaat tgtcttgctg 2940 aaaatggctg tgacattaca gaatggtaca tctgaagtta cattgaataa ggcagaagct 3000 aagagtggga atgtaagtag aatccctttt ccaatttatt atcaacgctt gagaccttgt 3060 gtgactttta tatatacact tcagatgacg gtaaaaaccc ttatggaagt ctatgaaggc 3120 tgcatcactc atttacgaaa gtcccaagga accagacggg tcaactctct gaagagaata 3180 actccagcaa attttacaag aggggtaaag tgttttcgta catgatctaa acttagtaaa 3240 gttaatgaga gaaggctgga ataatgaaat cttttgacaa tgcatctaac agacgcgtac 3300 aagagttcct aaagaggtca ttcagcagat caaatcgctt aacaacctcg atgtggagct 3360 ctacaaatat gcaaaagtaa tctttgccaa agaacatgaa ttagtgtcga ataagttgat 3420 ctcaagtgta agaaacttct tgtcttcaca tttcgccttt tagtttctgt ctgatataag 3480 actaaactcc atgattcgtg tgcagtctaa gagaagcatt gttgatctgc cgagtgagtt 3540 aaagagcgta ttgggagaaa tgggtgaaga gaagctatgg aagttcgtac cagtggcatt 3600 gatgctttta ttgatcgtcc tcttctttct atttgtaaac gctaaaagga gaagaacctc 3660 caaagttaag att 3673 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <400> 6 gtaagcttca tgggagctcc a 21 <210> 7 <211> 24 <212> DNA <213> artificial sequence <400> 7 aatcttaact ttggaggttc ttct 24 <210> 8 <211> 22 <212> DNA <213> artificial sequence <400> 8 atgcaaatga actctgtttg ga 22 <210> 9 <211> 24 <212> DNA <213> artificial sequence <400> 9 aatcttaact ttggaggttc ttct 24 <210> 10 <211> 9 <212> PRT <213> artificial sequence <400> 10 Tyr Pro Tyr Asp Val Pro Asp Tyr Ala 1 5 <210> 11 <211> 24 <212> DNA <213> artificial sequence <400> 11 ttacttctta gctcagttat tggc 24 <210> 12 <211> 24 <212> DNA <213> Artificial Sequence <400> 12 caatgaaaat atgttctgcc tcca 24

Claims

1. A method for improving plant traits, characterized in that, Comprising the steps of: increasing the expression level of the TPST gene or its encoded protein in the plant, thereby improving the traits of the plant; The improved plant traits are: reducing the Na / K ratio, enhancing drought resistance, increasing root length or increasing root weight; The TPST gene is derived from Arabidopsis thaliana, and the amino acid sequence encoded by the TPST gene is as shown in SEQ ID NO: 3; The method comprises the steps of: (i) providing a plant or a plant cell; and (ii) introducing the TPST gene sequence into the plant or the plant cell, thereby obtaining a transgenic plant or a transgenic plant cell; The plant is rice.

2. A method for preparing a plant with improved traits, characterized in that, Comprising the steps of: increasing the expression level and / or activity of the TPST gene or its encoded protein in a plant tissue or a plant cell, thereby obtaining a genetically engineered plant tissue or a plant cell, and then regenerating it into a plant, thereby obtaining a plant with improved traits; The traits of the plant include: reducing the Na / K ratio, enhancing drought resistance, increasing root length or increasing root weight; The TPST gene is derived from Arabidopsis thaliana, and the amino acid sequence encoded by the TPST gene is as shown in SEQ ID NO: 3; The method comprises the steps of: (i) providing a plant or a plant cell; and (ii) introducing the TPST gene sequence into the plant or the plant cell, thereby obtaining a transgenic plant or a transgenic plant cell; The plant is rice.

3. The method according to claim 1 or 2, characterized in that, The method comprises the following steps: (a) Providing Agrobacterium carrying an expression vector with the TPST gene sequence; (b) Contacting the plant cell or tissue or organ with the Agrobacterium in step (a), so that the gene sequence of TPST is transferred into the plant cell and integrated into the chromosome of the plant cell; (c) Selecting the plant cell or tissue or organ into which the TPST gene sequence has been transferred; (d) Regenerating the plant cell or tissue or organ in step (c) into a plant.

4. The method according to claim 3, wherein The gene sequence of TPST is as shown in SEQ ID NO: 2.

Images