Chemical compositions and methods of use thereof

Abstract

The present disclosure relates to chemical compositions, kits, and devices, and methods for using these compositions, kits, and devices in various assays.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to and the benefit of U.S. Provisional Application No. 62 / 671,091, filed on May 14, 2018, and U.S. Provisional Application No. 62 / 836,327, filed on April 19, 2019. The contents of each of the above patent applications are incorporated herein by reference in their entirety.

[0003] Sequence Listing

[0004] This application contains a sequence listing, which has been submitted in ASCII format by EFS-Web and is incorporated herein by reference in its entirety. The ASCII copy created on May 13, 2019 is named "NATE-039_001WO_SeqList.txt" and is 25,129 bytes in size. Background Art

[0005] There are various methods for nucleic acid sequencing, i.e., the process of determining the precise order of nucleotides within a nucleic acid molecule. Current methods require, for example, PCR and / or enzymatic amplification of nucleic acids by cloning. Further enzymatic polymerization is required to produce a signal detectable by light detection means. Such amplification and polymerization steps are expensive and / or time consuming. Therefore, there is a need in the art for a rapid, amplification-free and enzyme-free nucleic acid sequencing method. The present disclosure addresses these needs. Summary of the invention

[0006] The present disclosure provides sequencing probes, methods, kits and devices, which provide rapid enzyme-free, amplification-free and library-free nucleic acid sequencing with long read length and low error rate. The sequencing probe described herein includes a barcode domain, wherein each position in the barcode domain corresponds to at least two nucleotides in the target binding domain. In addition, the method, kit and device have rapid sampling-response capabilities. These features are particularly useful for sequencing in clinical settings. The present disclosure is an improvement of the disclosure disclosed in patent publication number US 2016 / 0194701, and the contents of the patent disclosure are incorporated herein by reference as a whole.

[0007] The present disclosure provides a probe comprising a target binding domain and a barcode domain; wherein the target binding domain comprises at least eight nucleotides and hybridizes to a target nucleic acid, wherein at least six nucleotides in the target binding domain identify corresponding nucleotides in the target nucleic acid molecule, and wherein at least two nucleotides in the target binding domain do not identify corresponding nucleotides in the target nucleic acid molecule; wherein the barcode domain comprises a synthetic backbone, the barcode domain comprising at least three attachment positions, each attachment position including at least one attachment position comprising at least one nucleic acid sequence that hybridizes to a complementary nucleic acid molecule, and wherein the synthetic backbone comprises L-DNA, wherein each of the at least three attachment positions an attachment position corresponding to two nucleotides of at least six nucleotides in the target binding domain, and the at least three attachment positions each have a different nucleic acid sequence, and wherein the nucleic acid sequence of each of the at least three attachment positions determines the position and identity of corresponding two nucleotides of the at least six nucleotides in the target nucleic acid bound by the target binding domain; and a first complementary primary nucleic acid molecule hybridized to a first attachment position of the at least three attachment positions, wherein the first primary complementary nucleic acid molecule comprises at least two domains and a cleavable linker, wherein the first domain hybridizes to the first attachment position of the barcode domain, and the second domain is capable of hybridizing to at least one complementary secondary nucleic acid molecule, and wherein the linker modification is , , , or , and wherein the linker modification is located between the first domain and the second domain.

[0008] The probe may comprise about 60 nucleotides. The probe may comprise a single-stranded DNA synthetic backbone and a double-stranded DNA spacer between the target binding domain and the barcode domain. The single-stranded DNA synthetic backbone may comprise L-DNA. The single-stranded DNA synthetic backbone may comprise about 27 nucleotides. The double-stranded DNA spacer may comprise L-DNA. The double-stranded DNA spacer may comprise a length of about 25 nucleotides.

[0009] The number of nucleotides in the target binding domain of the probe can be greater than the number of attachment positions in the barcode domain of the probe. The target binding domain can include eight nucleotides and the barcode domain can include three attachment positions. At least one nucleotide in the target binding domain that does not identify a corresponding nucleotide in the target nucleic acid molecule can precede at least six nucleotides in the target binding domain, and at least one nucleotide in the target binding domain that does not identify a corresponding nucleotide in the target nucleic acid molecule can follow at least six nucleotides in the target binding domain.

[0010] The attachment positions in the barcode domain may comprise an attachment region. The at least one nucleic acid sequence of each attachment position in the barcode domain may comprise about 9 nucleotides. The at least one nucleic acid sequence of the attachment position may comprise a 3' terminal guanosine nucleotide. The at least one nucleic acid sequence of each attachment position may comprise at least one adenine nucleotide, at least one thymine nucleotide, at least one cytosine nucleotide, or any combination thereof, and a 3' terminal guanosine nucleotide. Each nucleotide of the at least one nucleic acid sequence of the attachment position may be L-DNA. Each nucleotide of the at least eight nucleotides of the target binding domain may be D-DNA.

[0011] The complementary nucleic acid molecule can be a primary nucleic acid molecule, wherein the primary nucleic acid molecule can directly bind to at least one attachment region within at least one attachment location of the barcode domain. The primary nucleic acid molecule can include at least two domains: a first domain capable of binding to at least one attachment region within at least one attachment location of the barcode domain, and a second domain capable of binding to at least one complementary secondary nucleic acid molecule. The first domain of the primary nucleic acid molecule can include L-DNA. The second domain of the primary nucleic acid molecule can include D-DNA. The first domain of the primary nucleic acid molecule can include a 5' terminal cytosine nucleotide. The first domain of the primary nucleic acid molecule can include at least one adenine nucleotide, at least one thymine nucleotide, at least one guanine nucleotide or any combination thereof, and a 5' terminal cytosine nucleotide. A cleavable linker can be located between the first domain of the primary nucleic acid molecule and the second domain of the primary nucleic acid molecule. The cleavable linker can include at least one cleavable portion. The cleavable portion can be a photocleavable portion.

[0012] The primary nucleic acid molecule can hybridize to at least one attachment region within at least one attachment location of the barcode domain and can hybridize to at least one secondary nucleic acid molecule. The primary nucleic acid molecule can hybridize to four secondary nucleic acid molecules.

[0013] The secondary nucleic acid molecule may comprise at least two domains: a first domain capable of binding to a complementary sequence in at least one primary nucleic acid molecule; and a second domain capable of binding to: (a) a first detectable label and at least a second detectable label, (b) at least one complementary tertiary nucleic acid molecule, or (c) a combination thereof. The secondary nucleic acid molecule may comprise a cleavable joint. The cleavable joint may be located between the first domain and the second domain. The cleavable joint may be photocleavable. The secondary nucleic acid molecule may hybridize with at least one primary nucleic acid molecule and hybridize with at least one tertiary nucleic acid molecule. The secondary nucleic acid molecule may hybridize with: (a) at least one primary nucleic acid molecule, (b) at least one tertiary nucleic acid molecule, and (c) a first detectable label and at least a second detectable label. Each secondary nucleic acid molecule may hybridize with one tertiary nucleic acid molecule. The first detectable label and at least the second detectable label may have the same emission spectrum, or may have different emission spectra.

[0014] The tertiary nucleic acid molecule may comprise at least two domains: a first domain capable of binding to a complementary sequence in a secondary nucleic acid molecule; and a second domain capable of binding to a first detectable label and at least a second detectable label. The tertiary nucleic acid molecule comprises a cleavable joint. The cleavable joint may be located between the first domain and the second domain. The cleavable joint may be photocleavable. The tertiary nucleic acid molecule may hybridize with at least one secondary nucleic acid molecule and may comprise a first detectable label and at least a second detectable label. The first detectable label and at least the second detectable label may have the same emission spectrum, or may have different emission spectra.

[0015] At least a first detectable label and a second detectable label located on a secondary nucleic acid molecule may have the same emission spectrum, and at least a first detectable label and a second detectable label located on a tertiary nucleic acid molecule may have the same emission spectrum, and wherein the emission spectrum of the detectable label on the secondary nucleic acid molecule may be different from the emission spectrum of the detectable label on the tertiary nucleic acid molecule.

[0016] A primary nucleic acid molecule can hybridize with four secondary nucleic acid molecules, wherein each of the four secondary nucleic acid molecules comprises four first detectable labels, and wherein each of the four secondary nucleic acid molecules hybridizes with a tertiary nucleic acid molecule, wherein the tertiary nucleic acid molecule comprises five detectable labels. The emission spectrum of the first detectable label of the secondary nucleic acid molecule can be different from the emission spectrum of the second detectable label on the tertiary nucleic acid molecule.

[0017] The present disclosure provides a method for determining the nucleotide sequence of a nucleic acid, which comprises (1) hybridizing the target binding domain of at least one first probe of claim 1 to a first region of a target nucleic acid, wherein the target nucleic acid is optionally fixed to a substrate at one or more locations; (2) hybridizing a first complementary nucleic acid molecule comprising at least one first detectable label and at least one second detectable label to a first attachment location of at least three attachment locations of a barcode domain; (3) identifying at least one first detectable label and at least one second detectable label of the first complementary nucleic acid molecule hybridized to the first attachment location; (4) removing at least one first detectable label and at least one second detectable label hybridized to the first attachment location; (5) hybridizing a second complementary nucleic acid molecule comprising at least one third detectable label and at least one fourth detectable label to a second attachment location of at least three attachment locations of the barcode domain; and (6) identifying a second complementary nucleic acid molecule hybridized to the second attachment location. at least one third detectable label and at least one fourth detectable label of the second complementary nucleic acid molecule; (7) removing at least one third detectable label and at least one fourth detectable label hybridized to the second attachment position; (8) allowing a third complementary nucleic acid molecule comprising at least one fifth detectable label and at least one sixth detectable label to hybridize to a third attachment position of at least three attachment positions of the barcode domain; (9) identifying at least one fifth detectable label and at least one sixth detectable label of the third complementary nucleic acid molecule hybridized to the third attachment position; and (10) determining the nucleotide sequence of at least six nucleotides of the target nucleic acid that is hybridized to at least six nucleotides of the target binding domain of at least one first probe, based on the identities of at least one first detectable label, at least one second detectable label, at least one third detectable label, at least one fourth detectable label, at least one fifth detectable label and at least one sixth detectable label.

[0018] The aforementioned method may further include (11) removing at least one first probe from a first region of an optionally fixed target nucleic acid; (12) hybridizing the target binding domain of at least one second probe of claim 1 to a second region of an optionally fixed target nucleic acid, wherein the target binding domains of the first probe and at least the second probe are different; (13) hybridizing a fourth complementary nucleic acid molecule comprising at least one seventh detectable marker and at least one eighth detectable marker to a first attachment position of at least three attachment positions of a barcode domain of at least one second probe; (14) identifying at least one seventh detectable marker and at least one eighth detectable marker of the fourth complementary nucleic acid molecule hybridized to the first attachment position; (15) removing at least one seventh detectable marker and at least one eighth detectable marker hybridized to the first attachment position; (16) hybridizing a fifth complementary nucleic acid molecule comprising at least one ninth detectable marker and at least one tenth detectable marker to a second attachment position of at least three attachment positions of a barcode domain of at least the second probe; (17 ) identifying at least one ninth detectable marker and at least one tenth detectable marker of the fifth complementary nucleic acid molecule hybridized to the second attachment position; (18) removing at least one ninth detectable marker and at least one tenth detectable marker hybridized to the second attachment position; (19) hybridizing a sixth complementary nucleic acid molecule comprising at least one eleventh detectable marker and at least one twelfth detectable marker to a third attachment position of at least three attachment positions of the barcode domain of at least a second probe; (20) identifying at least one eleventh detectable marker and at least one twelfth detectable marker of the sixth complementary nucleic acid molecule hybridized to the third attachment position; and (21) determining the nucleotide sequence of at least six nucleotides of the target nucleic acid hybridized to at least six nucleotides of the target binding domain of at least one second probe, based on the identities of at least one seventh detectable marker, at least one eighth detectable marker, at least one ninth detectable marker, at least one tenth detectable marker, at least one eleventh detectable marker and at least one twelfth detectable marker.

[0019] The aforementioned method may further comprise assembling each identified linear order of nucleotides in at least the first region and at least the second region of the optionally fixed target nucleic acid, thereby identifying the sequence of the optionally fixed target nucleic acid.

[0020] Steps (4) and (5) can occur sequentially or simultaneously. Steps (7) and (8) can occur sequentially or simultaneously.

[0021] The first detectable label and the second detectable label can have the same emission spectrum, or have different emission spectra. The third detectable label and the fourth detectable label can have the same emission spectrum, or have different emission spectra. The fifth detectable label and the sixth detectable label can have the same emission spectrum, or have different emission spectra.

[0022] The first complementary nucleic acid molecule, the second complementary nucleic acid molecule and the third complementary nucleic acid molecule may comprise a cleavable linker. The cleavable linker may be photocleavable.

[0023] The first complementary nucleic acid molecule can comprise a primary nucleic acid, four secondary nucleic acid molecules and four tertiary nucleic acid molecules, wherein the primary nucleic acid is hybridized with the four secondary nucleic acid molecules, wherein the four secondary nucleic acid molecules each comprise four first detectable labels, and wherein the four secondary nucleic acid molecules each hybridize with one tertiary nucleic acid molecule, wherein the four tertiary nucleic acid molecules each comprise five second detectable labels.

[0024] The primary nucleic acid molecule may comprise at least two domains: a first domain that hybridizes to the first attachment site of the barcode domain, and a second domain that hybridizes to the four secondary nucleic acid molecules. The primary nucleic acid molecule may comprise a cleavable linker between the first domain and the second domain.

[0025] The secondary nucleic acid molecule may comprise at least two domains: a first domain that hybridizes with the second domain of the primary nucleic acid molecule; and a second domain that comprises four first detectable labels and hybridizes with a tertiary nucleic acid molecule. The secondary nucleic acid molecule may comprise a cleavable linker between the first domain and the second domain.

[0026] Removing at least one first detectable label and at least one second detectable label hybridized to the first attachment location can include cutting the cleavable linker between the first domain and the second domain of the primary nucleic acid, cutting the cleavable linker between the first domain and the second domain of each secondary nucleic acid, or any combination thereof.

[0027] The present disclosure provides a composition comprising at least one molecular complex, wherein the at least one molecular complex comprises: (A) a target nucleic acid molecule obtained from a biological sample, and (B) at least two nucleic acid molecular complexes, wherein a first complex comprises a first portion of double-stranded nucleic acid molecules, wherein one strand of the first portion of double-stranded nucleic acid molecules comprises: a target-specific domain that hybridizes to a first portion of the target nucleic acid molecule, a duplex domain that anneals to the other strand of the first portion of double-stranded nucleic acid molecules, and at least one first affinity portion, wherein the other strand of the first portion of double-stranded nucleic acid molecules comprises: a duplex domain that anneals to the other strand of the first portion of double-stranded nucleic acid molecules, a substrate-specific domain that hybridizes to a complementary nucleic acid attached to a substrate, and at least one second affinity portion. The affinity portion, wherein the second complex comprises a second portion of double-stranded nucleic acid molecules, wherein one strand of the second portion of double-stranded nucleic acid molecules comprises: a target-specific domain that hybridizes to a second portion of the target nucleic acid, wherein the first portion and the second portion do not overlap, and a duplex domain that anneals to the other strand of the second portion of the double-stranded nucleic acid molecules, wherein the other strand of the second portion of the double-stranded nucleic acid molecules comprises: a duplex domain that anneals to the other strand of the second portion of the double-stranded nucleic acid molecules, a sample-specific domain that identifies a biological sample from which the target nucleic acid is obtained, a first single-stranded purification sequence, a first cleavable portion located between the duplex domain and the sample-specific domain, and a second cleavable portion located between the sample-specific domain and the first single-stranded purification sequence.

[0028] The present disclosure provides a composition comprising at least one molecular complex, wherein the at least one molecular complex comprises: (A) a target nucleic acid molecule obtained from a biological sample, and (B) at least two nucleic acid molecular complexes, wherein a first complex comprises a first portion of double-stranded nucleic acid molecules, wherein one strand of the first portion of double-stranded nucleic acid molecules comprises: a target-specific domain that hybridizes with a first portion of the target nucleic acid molecule, a duplex domain that anneals to the other strand of the first portion of double-stranded nucleic acid molecules, and at least one first affinity portion, wherein the other strand of the first portion of double-stranded nucleic acid molecules comprises: a duplex domain that anneals to the other strand of the first portion of double-stranded nucleic acid molecules and is operably linked to the 3' end of the target nucleic acid molecule, and a complementary nucleic acid attached to a substrate. A hybridized substrate-specific domain, and at least a second affinity portion, wherein the second complex comprises a second portion of double-stranded nucleic acid molecules, wherein one strand of the second portion of double-stranded nucleic acid molecules comprises: a target-specific domain that hybridizes to a second portion of the target nucleic acid, wherein the first portion and the second portion do not overlap, and a duplex domain that anneals to the other strand of the second portion of the double-stranded nucleic acid molecules, wherein the other strand of the second portion of the double-stranded nucleic acid molecules comprises: a duplex domain that anneals to the other strand of the second portion of the double-stranded nucleic acid molecules and is operably connected to the 5' end of the target nucleic acid molecule, a sample-specific domain that identifies the biological sample from which the target nucleic acid is obtained, and a first cleavable portion located between the duplex domain and the sample-specific domain.

[0029] The present disclosure provides a composition comprising at least one molecular complex, wherein the at least one molecular complex comprises: (A) a target nucleic acid molecule obtained from a biological sample, and (B) at least two nucleic acid molecular complexes, wherein a first complex comprises a first portion of double-stranded nucleic acid molecules, wherein one strand of the first portion of double-stranded nucleic acid molecules comprises: a target-specific domain that hybridizes with a first portion of the target nucleic acid molecule, a duplex domain that anneals to the other strand of the first portion of double-stranded nucleic acid molecules, and at least one first affinity portion, wherein the other strand of the first portion of double-stranded nucleic acid molecules comprises: a target-specific domain that anneals to the other strand of the first portion of double-stranded nucleic acid molecules and anneals to the third strand of the target nucleic acid molecule; The invention relates to a method for preparing an oligonucleotide complex comprising: a first complex comprising a first part and a second complex comprising a duplex domain operably connected to the 5' end of the oligonucleotide, a substrate-specific domain hybridized to a complementary nucleic acid attached to a substrate, and at least one second affinity portion, wherein the second complex comprises a second portion of double-stranded nucleic acid molecules, wherein one strand of the second portion of double-stranded nucleic acid molecules comprises: a target-specific domain hybridized to a second portion of the target nucleic acid, wherein the first portion and the second portion do not overlap, and a duplex domain annealed to the other strand of the second portion of the double-stranded nucleic acid molecules, wherein the other strand of the second portion of the double-stranded nucleic acid molecules comprises: a duplex domain annealed to the other strand of the second portion of the double-stranded nucleic acid molecules and operably connected to the 5' end of the target nucleic acid molecule.

[0030] The present disclosure also provides a composition comprising: a planar solid support substrate; a first layer on the planar solid support substrate; a second layer on the first layer; wherein the second layer comprises a plurality of nanopores, wherein each nanopore provides access to an exposed portion of the first layer, wherein each nanopore comprises a plurality of first oligonucleotides covalently attached to the exposed portion of the first layer.

[0031] The present disclosure provides a sequencing probe comprising a target binding domain and a barcode domain; wherein the target binding domain comprises at least eight nucleotides and hybridizes to a target nucleic acid, wherein at least six nucleotides in the target binding domain identify corresponding nucleotides in the target nucleic acid molecule, and wherein at least two nucleotides in the target binding domain do not identify corresponding nucleotides in the target nucleic acid molecule; wherein the barcode domain comprises a synthetic backbone, the barcode domain comprising at least three attachment positions, each attachment position comprising at least one attachment region comprising at least one nucleic acid sequence, the at least one nucleic acid sequence hybridizing to a complementary nucleic acid molecule, wherein the nucleic acid sequences of the at least three attachment positions determine the positions and identities of at least six nucleotides in the target nucleic acid bound by the target binding domain, and wherein each of the at least three attachment positions has a different nucleic acid sequence.

[0032] The present disclosure also provides a sequencing probe comprising a target binding domain and a barcode domain; wherein the target binding domain comprises at least eight nucleotides and hybridizes to a target nucleic acid, wherein at least six nucleotides in the target binding domain identify corresponding nucleotides in the target nucleic acid molecule, and wherein at least two nucleotides in the target binding domain do not identify corresponding nucleotides in the target nucleic acid molecule; wherein the barcode domain comprises a synthetic backbone, the barcode domain comprising at least three attachment positions, each attachment position including at least one attachment position comprising at least one nucleic acid sequence, the at least one nucleic acid sequence hybridizing to a complementary nucleic acid molecule, wherein each of the at least three attachment positions corresponds to two nucleotides of the at least six nucleotides in the target binding domain, and each of the at least three attachment positions has a different nucleic acid sequence, and wherein the nucleic acid sequence of each of the at least three attachment positions determines the position and identity of corresponding two nucleotides of the at least six nucleotides bound by the target binding domain in the target nucleic acid.

[0033] The present disclosure provides a complex comprising: a) a composition comprising a target binding domain and a barcode domain; wherein the target binding domain comprises at least eight nucleotides and hybridizes to a target nucleic acid, wherein at least six nucleotides in the target binding domain identify corresponding nucleotides in the target nucleic acid molecule, and wherein at least two nucleotides in the target binding domain do not identify corresponding nucleotides in the target nucleic acid molecule; wherein the barcode domain comprises a synthetic backbone, the barcode domain comprising at least three attachment positions, each attachment position comprising at least one attachment region comprising at least one nucleic acid sequence that hybridizes to a complementary nucleic acid molecule, wherein the nucleic acid sequences of the at least three attachment positions determine the positions and identities of at least six nucleotides in the target nucleic acid bound by the target binding domain, and wherein each of the at least three attachment positions has a different nucleic acid sequence; and a first complementary primary nucleic acid molecule hybridized to a first attachment position of the at least three attachment positions, wherein the first primary complementary nucleic acid molecule comprises at least two domains and a cleavable linker, wherein the first domain hybridizes to the first attachment position of the barcode domain, and the second domain is capable of hybridizing to at least one complementary secondary nucleic acid molecule, and wherein the cleavable linker is , , , or , and wherein the cleavable linker is located between the first domain and the second domain.

[0034] The present disclosure provides a method for determining the nucleotide sequence of a nucleic acid, which comprises (1) hybridizing a target binding domain of a first sequencing probe of the present disclosure to a first region of a target nucleic acid, wherein the target nucleic acid is optionally fixed to a substrate at one or more locations; (2) hybridizing a first complementary nucleic acid molecule comprising at least one first detectable label and at least one second detectable label to a first attachment location of at least three attachment locations of a barcode domain; (3) identifying at least one first detectable label and at least one second detectable label of the first complementary nucleic acid molecule hybridized to the first attachment location; (4) removing at least one first detectable label and at least one second detectable label hybridized to the first attachment location; (5) hybridizing a second complementary nucleic acid molecule comprising at least one third detectable label and at least one fourth detectable label to a second attachment location of at least three attachment locations of the barcode domain; and (6) identifying a second complementary nucleic acid molecule hybridized to the second attachment location. at least one third detectable label and at least one fourth detectable label of the second complementary nucleic acid molecule; (7) removing at least one third detectable label and at least one fourth detectable label hybridized to the second attachment position; (8) allowing the third complementary nucleic acid molecule comprising at least one fifth detectable label and at least one sixth detectable label to hybridize to the third attachment position of the at least three attachment positions of the barcode domain; (9) identifying at least one fifth detectable label and at least one sixth detectable label of the third complementary nucleic acid molecule hybridized to the third attachment position; and (10) determining the nucleotide sequence of at least six nucleotides of the target nucleic acid hybridized to at least six nucleotides of the target binding domain of the first sequencing probe, optionally fixed, based on the identities of at least one first detectable label, at least one second detectable label, at least one third detectable label, at least one fourth detectable label, at least one fifth detectable label and at least one sixth detectable label.

[0035] The present disclosure provides a method for determining the nucleotide sequence of a nucleic acid, comprising: (1) hybridizing a target binding domain of a first sequencing probe of claim 113 or 114 to a target nucleic acid, optionally fixed to a substrate at one or more locations; (2) hybridizing a first complementary nucleic acid molecule comprising at least one first detectable label and at least one second detectable label to a first attachment location of at least three attachment locations of a barcode domain; (3) identifying at least one first detectable label and at least one second detectable label of the first complementary nucleic acid molecule hybridized to the first attachment location; (4) based on the identities of the at least one first detectable label and at least one second detectable label, identifying the location and identity of a first nucleotide and a second nucleotide in the optionally fixed target nucleic acid hybridized to two of the at least six nucleotides of the target binding domain; (5) removing the at least one first detectable label and at least one second detectable label hybridized to the first attachment location; (6) hybridizing a second complementary nucleic acid molecule comprising at least one third detectable label and at least one fourth detectable label to a second attachment location of the at least three attachment locations of the barcode domain; and (7) identifying the second complementary nucleic acid molecule hybridized to the second attachment location. (8) based on the identities of the at least one third detectable label and the at least one fourth detectable label, identifying the position and identity of the third nucleotide and the fourth nucleotide in the target nucleic acid that are hybridized to two of the at least six nucleotides of the target binding domain and are optionally fixed; (9) removing the at least one third detectable label and the at least one fourth detectable label that are hybridized to the second attachment position; (10) allowing a third complementary nucleic acid molecule comprising at least one fifth detectable label and at least one sixth detectable label to hybridize to a third attachment position of the at least three attachment positions of the barcode domain; (11) identifying at least one fifth detectable label and at least one sixth detectable label of the third complementary nucleic acid molecule that are hybridized to the third attachment position; and (12) based on the identities of the at least one fifth detectable label and the at least one sixth detectable label, identifying the position and identity of the fifth nucleotide and the sixth nucleotide in the target nucleic acid that are hybridized to two of the at least six nucleotides of the target binding domain and are optionally fixed; thereby determining the nucleotide sequence of the at least six nucleotides of the target nucleic acid that are hybridized to the at least six nucleotides of the target binding domain of the first sequencing probe and are optionally fixed.

[0036] The present disclosure also provides a method for identifying the presence of a predetermined nucleotide sequence in a target nucleic acid, which comprises (1) hybridizing a target binding domain of a first sequencing probe of the present disclosure to a first region of a target nucleic acid, wherein the target nucleic acid is optionally fixed to a substrate at one or more locations; (2) hybridizing a first complementary nucleic acid molecule comprising at least one first detectable label and at least one second detectable label to a first attachment location of at least three attachment locations of a barcode domain; (3) identifying at least one first detectable label and at least one second detectable label of the first complementary nucleic acid molecule hybridized to the first attachment location; (4) removing at least one first detectable label and at least one second detectable label hybridized to the first attachment location; (5) hybridizing a second complementary nucleic acid molecule comprising at least one third detectable label and at least one fourth detectable label to a first attachment location of at least three attachment locations of the barcode domain; (6) identifying at least one third detectable marker and at least one fourth detectable marker of the second complementary nucleic acid molecule hybridized to the second attachment position; (7) removing at least one third detectable marker and at least one fourth detectable marker hybridized to the second attachment position; (8) allowing a third complementary nucleic acid molecule comprising at least one fifth detectable marker and at least one sixth detectable marker to hybridize to a third attachment position of at least three attachment positions of the barcode domain; (9) identifying at least one fifth detectable marker and at least one sixth detectable marker of the third complementary nucleic acid molecule hybridized to the third attachment position, thereby determining the presence of a predetermined nucleotide sequence based on the identity of at least one first detectable marker, at least one second detectable marker, at least one third detectable marker, at least one fourth detectable marker, at least one fifth detectable marker and at least one sixth detectable marker.

[0037] The present disclosure provides a kit comprising: (A) a first nucleic acid molecule complex comprising a first portion of double-stranded nucleic acid molecules, wherein one strand of the first portion of double-stranded nucleic acid molecules comprises: a target-specific domain that hybridizes to a first portion of a target nucleic acid molecule, a duplex domain that anneals to the other strand of the first portion of double-stranded nucleic acid molecules, at least one first affinity portion, wherein the other strand of the first portion of double-stranded nucleic acid molecules comprises: a duplex domain that anneals to the other strand of the first portion of double-stranded nucleic acid molecules, a substrate-specific domain that hybridizes to a complementary nucleic acid attached to a substrate, and at least one second affinity portion, and (B) a second nucleic acid molecule complex comprising a second portion of double-stranded nucleic acid molecules, wherein the second strand of the double-stranded nucleic acid molecules comprises: a duplex domain that anneals to the other strand of the first portion of double-stranded nucleic acid molecules, a substrate-specific domain that hybridizes to a complementary nucleic acid attached to a substrate, and at least one second affinity portion. One strand of the double-stranded nucleic acid molecule comprises: a target-specific domain that hybridizes to a second portion of the target nucleic acid, wherein the first portion and the second portion do not overlap, and a duplex domain that anneals to the other strand of the second portion of the double-stranded nucleic acid molecule, and wherein the other strand of the second portion of the double-stranded nucleic acid molecule comprises: a duplex domain that anneals to the other strand of the second portion of the double-stranded nucleic acid molecule, a sample-specific domain that identifies a biological sample from which the target nucleic acid is obtained, a substrate-specific domain that hybridizes to a complementary nucleic acid attached to a substrate, a first single-stranded purification sequence, a first cleavable portion located between the duplex domain and the sample-specific domain, and a second cleavable portion located between the sample-specific domain and the first single-stranded purification sequence.

[0038] The present disclosure also provides a kit comprising: a first single-stranded nucleic acid molecule comprising: a target-specific domain that hybridizes to a first portion of a target nucleic acid molecule, a duplex domain that anneals to the duplex domain of a second single-stranded nucleic acid molecule, and at least one first affinity moiety, (B) a second single-stranded nucleic acid molecule comprising: a duplex domain that anneals to the duplex domain of the first single-stranded nucleic acid molecule, a substrate-specific domain that hybridizes to a complementary nucleic acid attached to a substrate, and at least one second affinity moiety, (C) a third single-stranded nucleic acid molecule comprising: a duplex domain that anneals to the duplex domain of the first single-stranded nucleic acid molecule, a substrate-specific domain that hybridizes to a first portion of a target nucleic acid molecule, and at least one second affinity moiety. a target-specific domain that hybridizes to two parts, wherein the first part and the second part do not overlap, and a duplex domain that anneals to the duplex domain of a fourth single-stranded nucleic acid molecule, (D) a fourth single-stranded nucleic acid molecule, which comprises: a duplex domain that anneals to the duplex domain of a third single-stranded nucleic acid molecule, a sample-specific domain for identifying a biological sample from which the target nucleic acid is obtained, a first single-stranded purification sequence, a first cleavable portion located between the duplex domain and the sample-specific domain, and a second cleavable portion located between the sample-specific domain and the first single-stranded purification sequence.

[0039] Any of the above aspects may be combined with any other aspects.

[0040] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those generally understood by those of ordinary skill in the art to which the present disclosure belongs. In this specification, unless the context clearly states otherwise, the singular form also includes the plural form; as an example, the terms "one", "a kind of" and "the / said" should be understood as singular or plural, and the term "or" should be understood as inclusive. For example, "element" means one or more elements. Throughout the specification, the word "comprising" or changes such as "comprises" or "comprising" should be understood to imply the elements, integers or steps stated, or elements, integers or step groups, but do not exclude any other elements, integers or steps, or elements, integers or step groups. About can be understood as within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05% or 0.01% of the value. Unless otherwise clear from the context, all numerical values ​​provided herein are modified by the term "about".

[0041] Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, suitable methods and materials are described below. All publications, patent applications, patents and other references mentioned herein are incorporated by reference in their entirety. The references cited herein are not admitted to be prior art of the present invention. In the event of a conflict, the present specification including definitions shall prevail. In addition, materials, methods and embodiments are illustrative only and are not intended to be restrictive. Other features and advantages of the present disclosure will be apparent from the following detailed description and claims. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

[0043] The above and further features will become more particularly apparent from the following detailed description when taken in conjunction with the accompanying drawings.

[0044] Figure 1 is a diagrammatic representation of an exemplary sequencing probe of the present disclosure.

[0045] Figure 2 Designs of standard, three-part sequencing, and one-part adapter probes of the present disclosure are shown.

[0046] Figure 3 is a graphic representation of an exemplary reporter complex of the disclosure hybridized to an exemplary sequencing probe of the disclosure.

[0047] Figure 4A schematic diagram of an exemplary reporter probe of the present disclosure is shown.

[0048] Figure 5 are schematic diagrams of several exemplary reporter probes of the present disclosure comprising different arrangements of tertiary nucleic acids.

[0049] Figure 6 are schematic diagrams of several exemplary reporter probes of the present disclosure comprising branched tertiary nucleic acids.

[0050] Figure 7 Possible locations for cleavable linker modifications within exemplary reporter probes of the present disclosure are shown.

[0051] Figure 8 is a schematic diagram of capturing a target nucleic acid using the dual capture probe system of the present disclosure.

[0052] Fig. 9 Shown are the results of an experiment using FFPE samples to capture and detect a multiplexed cancer panel consisting of 100 targets using the methods of the present invention.

[0053] Fig.10 is a schematic diagram of a single cycle of the sequencing method of the present disclosure.

[0054] Fig.11 is a schematic diagram of one cycle of the sequencing method of the present disclosure, and the corresponding imaging data collected during the cycle.

[0055] Fig.12 An exemplary sequencing probe pool configuration of the present disclosure is shown, in which eight color combinations are used to design eight different sequencing probe pools.

[0056] Fig.13 The barcode domain design disclosed in US 2016 / 019470 was compared with the barcode domain design of the present disclosure.

[0057] Fig.14 is a schematic diagram of the sequencing cycles of the present disclosure, wherein cleavable adapter modifications are used to darken barcode positions.

[0058] Fig.15 is an illustrative example of an exemplary sequencing cycle of the present disclosure, in which positions within the barcode domain are dimmed by displacement of the primary nucleic acid.

[0059] Fig.16 is a schematic diagram of how the sequencing method of the present disclosure allows the same base of a target nucleic acid to be sequenced with different sequencing probes.

[0060] Fig.17It is shown how multiple base calls recorded from one or more sequencing probes at specific nucleotide positions on a target nucleic acid can be combined to generate a consensus sequence, thereby increasing the accuracy of the final base call.

[0061] Fig.18 Results from sequencing experiments obtained using the sequencing methods of the present disclosure and analyzed using the assembly algorithm are shown. For the chart on the left, starting from the top left chart and moving clockwise, the sequences shown correspond to SEQ ID NOs: 3, 4, 6, 8, 7, and 5. For the table on the right, starting from the top and moving down, the sequences correspond to SEQ ID NOs: 3, 4, 7, 8, 6, and 5.

[0062] Fig.19 A schematic diagram of the experimental design for multiplexed capture and sequencing of oncogene targets from FFPE samples is shown.

[0063] Fig. 20 An illustrative schematic diagram of direct RNA sequencing is shown, along with results from experiments testing the compatibility of RNA molecules with the sequencing methods of the present disclosure.

[0064] Fig.21 It is shown that RNA molecules and DNA molecules having the same nucleotide sequence are sequenced using the sequencing method of the present disclosure.

[0065] Fig. 22 A performance comparison of standard and tripartite sequencing probes of the present disclosure is shown.

[0066] Fig.23 The effects of LNA substitutions within exemplary target binding domains of the present disclosure are shown using individual probes.

[0067] Fig.24 Shown are the effects of LNA substitutions within exemplary target binding domains of the present disclosure using a pool of nine probes.

[0068] Fig.25 The effects of modified nucleotides and nucleic acid analog substitutions in exemplary target binding domains of the disclosure are shown.

[0069] Fig.26 Results from experiments quantifying the raw accuracy of the sequencing methods of the present disclosure are shown.

[0070] Fig. 27 Shown are results from experiments to determine the accuracy of the sequencing methods of the present disclosure when nucleotides in a target nucleic acid are sequenced by more than one sequencing probe.

[0071] Fig.28is a schematic diagram of a sequencing probe of the present disclosure comprising a pocket oligonucleotide.

[0072] Fig.29 is a schematic diagram of a sequencing probe of the present disclosure comprising a PEG linker region between each attachment position.

[0073] Fig.30 is a schematic diagram of a sequencing probe of the present disclosure comprising an abasic region between each attachment position.

[0074] Fig.31 is a schematic representation of an exemplary reporter complex of the present disclosure that is indirectly hybridized to an exemplary sequencing probe of the present disclosure via a linker oligonucleotide.

[0075] Fig.32 is a diagrammatic representation of a parity scheme used in the methods of the present disclosure.

[0076] Fig.33 is a schematic diagram of the capture probe, adaptor oligonucleotide and lawn oligonucleotide complex of the present invention.

[0077] Fig.34 is a schematic diagram of a c5 probe complex and a c3 probe complex of the present disclosure hybridized to a target nucleic acid.

[0078] Fig.35 is a schematic diagram of the target nucleic acid-c3 probe-c5 probe complex of the present disclosure after digestion with FEN1.

[0079] Fig.36 is a schematic diagram of the target nucleic acid-c3 probe-c5 probe complex of the present disclosure after ligation.

[0080] Fig.37 is a schematic diagram of USER-mediated cleavage of the target nucleic acid-c3 probe-c5 probe complex of the present disclosure.

[0081] Fig.38 is a schematic diagram of the target nucleic acid-c3 probe-c5 probe complex of the present disclosure after USER-mediated cleavage.

[0082] Fig.39 is a schematic diagram of UV-mediated cleavage of the target nucleic acid-c3 probe-c5 probe complex of the present disclosure.

[0083] Fig.40is a schematic diagram of the target nucleic acid-c3 probe-c5 probe complex of the present disclosure attached to a substrate via complementary nucleic acid, following UV-mediated cleavage.

[0084] Fig.41 is a schematic diagram of a c3.2 probe complex and a c5.2 probe complex of the present disclosure hybridized to a target nucleic acid.

[0085] Fig.42 is a schematic diagram of a target nucleic acid complex of the present disclosure after ligation of the c3.2 and c5.2 probe complexes.

[0086] Fig.43 is a schematic diagram of the cleavage and release of a single-stranded purification sequence in a target nucleic acid complex of the present disclosure.

[0087] Fig.44 is a schematic diagram of a target nucleic acid complex of the present disclosure immobilized on a substrate of the present disclosure.

[0088] Fig.45 is a schematic diagram of the cleavage and release of the substrate-specific domain after the target nucleic acid complex of the present disclosure is immobilized to the substrate of the present disclosure.

[0089] Fig.46 is a schematic diagram of the target nucleic acid complex of the present disclosure after the substrate-specific domain immobilized on the substrate of the present disclosure is released.

[0090] Fig.47 is a schematic cross-section of an exemplary array of the present invention.

[0091] Fig.48 is a schematic cross-section of an exemplary array of the present invention comprising nanopores having a pyramidal shape.

[0092] Fig.49 is a schematic illustration of an exemplary array of the present disclosure comprising a plurality of cylindrical nanopores arranged in a random pattern.

[0093] Fig.50 is a schematic illustration of an exemplary array of the present disclosure comprising cylindrical nanopores arranged in an ordered grid with a constant pitch.

[0094] Fig.51 is a schematic cross-section of an exemplary array of the invention in which a single target nucleic acid complex is immobilized in each nanowell.

[0095] Fig.52 is a schematic cross-section of an exemplary array of the invention in which a single target nucleic acid complex is immobilized in each nanowell, thereby preventing the immobilization of other target nucleic acid complexes.

[0096] Fig.53 is a schematic diagram of a sequencing probe of the present disclosure consisting entirely of L-DNA and comprising an attachment region having a 3' terminal L-dG nucleotide.

[0097] Fig.54 is a schematic diagram of a sequencing probe of the present disclosure, which is composed entirely of D-DNA and comprises pocket oligonucleotides located between attachment region 1 (spot 1) and attachment region 2 (spot 2), and between attachment region 2 (spot 2) and attachment region 3 (spot 3).

[0098] Fig.55 Schematic diagram of synthetic target nucleic acids immobilized on a solid substrate using capture probes and lawn oligonucleotides in combination with protein locks.

[0099] Fig.56 is a series of graphs showing the results of sequencing experiments using LG-spaced sequencing probes and D-pocket sequencing probes of the present disclosure. The x-axis indicates the specific nucleotide of the target nucleic acid to be sequenced. The top graph shows the theoretical sequencing diversity, observed sequencing diversity, and observed sequencing coverage for LG-spaced and D-pocket sequencing probes. The red boxes indicate predicted problematic sequencing regions.

[0100] Fig.57 is a series of graphs showing the results of sequencing experiments using LG-spaced sequencing probes and D-pocket sequencing probes of the present disclosure. The x-axis indicates the specific nucleotide of the target nucleic acid to be sequenced. The top graph shows the theoretical sequencing diversity, observed sequencing diversity, and observed sequencing coverage for LG-spaced and D-pocket sequencing probes. The red boxes indicate predicted problematic sequencing regions.

[0101] Fig.58 is a series of graphs showing the results of sequencing experiments using LG-spaced sequencing probes and D-pocket sequencing probes of the present disclosure. The x-axis indicates the specific nucleotide of the target nucleic acid to be sequenced. The top graph shows the theoretical sequencing diversity, observed sequencing diversity, and observed sequencing coverage for LG-spaced and D-pocket sequencing probes. The red boxes indicate predicted problematic sequencing regions.

[0102] Fig.59 is a series of graphs showing the results of sequencing experiments using LG-spaced sequencing probes and D-pocket sequencing probes of the present disclosure. The x-axis indicates the specific nucleotide of the target nucleic acid to be sequenced. The top graph shows the observed sequencing diversity and observed sequencing coverage for LG-spaced and D-pocket sequencing probes.

[0103] Fig.60 is a series of graphs showing the results of sequencing experiments using LG-spaced sequencing probes and D-pocket sequencing probes of the present disclosure. The x-axis indicates the specific nucleotide of the target nucleic acid to be sequenced. The top graph shows the observed sequencing diversity and observed sequencing coverage for LG-spaced and D-pocket sequencing probes.

[0104] Fig.61 is a series of graphs showing the results of sequencing experiments using LG-spaced sequencing probes and D-pocket sequencing probes of the present disclosure. The x-axis indicates the specific nucleotide of the target nucleic acid to be sequenced. The top graph shows the observed sequencing diversity and observed sequencing coverage for LG-spaced and D-pocket sequencing probes.

[0105] Fig.62 is a series of histograms showing the total number of barcode events and the number of valid 3-site reads in sequencing experiments using the LG-spaced sequencing probe and the D-pocket sequencing probe of the present disclosure.

[0106] Fig.63 is a series of graphs showing the total number of on-target events, invalid events, off-target events, 1 error at b1-b6 events, 2 errors at b1-b6 events, 3 errors at b1-b6 events, 4 errors at b1-b6 events, 5 errors at b1-b6 events, and 6 errors at b1-b6 events in sequencing experiments using the LG-spaced sequencing probes and D-pocket sequencing probes of the present disclosure.

[0107] Fig.64 is a series of graphs showing the total number of on-target events, invalid events, off-target events, 1 error at b1-b6 events, 2 errors at b1-b6 events, 3 errors at b1-b6 events, 4 errors at b1-b6 events, 5 errors at b1-b6 events, and 6 errors at b1-b6 events in sequencing experiments using the LG-spaced sequencing probes and D-pocket sequencing probes of the present disclosure.

[0108] Fig.65 is a graph showing the number of 1 spotter (only one of three possible reporter probes was successfully recorded), 2 spotters (only two of three possible reporter probes were successfully recorded), and 3 spotter (all three possible reporter probes were successfully recorded) events in each cycle of a sequencing experiment using the D-pocket sequencing probe (cycles 1-50) and the LG-spaced sequencing probe (cycles 51-100) of the present disclosure.

[0109] Fig.66is a series of graphs showing the results of sequencing experiments using LG-spaced sequencing probes and D-pocket sequencing probes of the present disclosure. The leftmost graph shows the number of on-target, new hexamers, redundant hexamers, off-target, and invalid events recorded in each cycle of the sequencing experiment. Cycles 1-50 were performed using the D-pocket sequencing probe, and cycles 51-100 were performed using the LG-spaced sequencing probes of the present disclosure.

[0110] Fig.67 is a schematic diagram of immobilizing a target nucleic acid to a solid substrate using the methods and compositions of the present disclosure. The target nucleic acid is immobilized using a protein lock between the biotin and neutravidin moieties on the capture probes and lawn oligonucleotides. DETAILED DESCRIPTION OF THE INVENTION

[0112] The present disclosure provides sequencing probes, reporter probes, methods, kits and apparatuses that provide rapid enzyme-free, amplification-free and library-free nucleic acid sequencing with long read lengths and low error rates.

[0113] Compositions of the Disclosure

[0114] The present disclosure provides a sequencing probe comprising a target binding domain and a barcode domain; wherein the target binding domain comprises any of the constructs described in Table 1. An exemplary target binding domain comprises at least eight nucleotides and is capable of hybridizing to a target nucleic acid, wherein at least six nucleotides in the target binding domain are capable of identifying a corresponding (complementary) nucleotide in a target nucleic acid molecule, and wherein at least two nucleotides in the target binding domain do not identify a corresponding nucleotide in a target nucleic acid molecule; wherein any of the at least six nucleotides in the target binding domain may be a modified nucleotide or a nucleotide analog, and wherein at least two nucleotides in the target binding domain that do not identify a corresponding nucleotide in a target nucleic acid molecule may be any of the four canonical bases that are not specific to a target determined by the at least six nucleotides in the target binding domain, or a universal base or a degenerate base. An exemplary barcode domain comprises a synthetic backbone comprising at least three attachment positions, each attachment position comprising at least one attachment region comprising at least one nucleic acid sequence capable of being bound by a complementary nucleic acid molecule, wherein each of the at least three attachment positions corresponds to two nucleotides of at least six nucleotides in a target binding domain, and wherein each of the at least three attachment positions has a different nucleic acid sequence, and wherein the nucleic acid sequence of each of the at least three attachment positions determines the position and identity of corresponding two nucleotides of the at least six nucleotides in a target nucleic acid bound by the target binding domain.

[0115] In other aspects, an exemplary target binding domain can comprise at least six nucleotides capable of hybridizing to a target nucleic acid, wherein the at least six nucleotides in the target binding domain are capable of identifying corresponding (complementary) nucleotides in the target nucleic acid molecule; wherein any of the at least six nucleotides in the target binding domain can be a modified nucleotide or a nucleotide analog.

[0116] The present disclosure also provides a sequencing probe comprising a target binding domain and a barcode domain; wherein the target binding domain comprises at least ten nucleotides and is capable of binding to a target nucleic acid, wherein at least six nucleotides in the target binding domain are capable of identifying corresponding (complementary) nucleotides in the target nucleic acid molecule, and wherein at least four nucleotides in the target binding domain do not identify corresponding nucleotides in the target nucleic acid molecule; wherein the barcode domain comprises a synthetic backbone, the barcode domain comprising at least three attachment positions, each attachment position comprising at least one attachment region comprising at least one nucleic acid sequence, the at least one nucleic acid sequence being capable of being bound by a complementary nucleic acid molecule, wherein each of the at least three attachment positions corresponds to two nucleotides of the at least six nucleotides in the target binding domain, and each of the at least three attachment positions has a different nucleic acid sequence, and wherein the nucleic acid sequence at each of the at least three attachment positions determines the position and identity of corresponding two nucleotides of the at least six nucleotides bound by the target binding domain in the target nucleic acid.

[0117] The present disclosure also provides a population of sequencing probes comprising a plurality of any of the sequencing probes disclosed herein.

[0118] The target binding domain, barcode domain and backbone, and complementary nucleic acid molecule (eg, reporter molecule or reporter complex) of the disclosed sequencing probes are described in more detail below.

[0119] The sequencing probes of the present disclosure comprise a target binding domain and a barcode domain. Figure 1 is a schematic diagram of an exemplary sequencing probe of the present disclosure. Figure 1 It is shown that the target binding domain is capable of binding to a target nucleic acid. The target nucleic acid can be any nucleic acid to which the sequencing probe of the present disclosure can hybridize. The target nucleic acid can be DNA or RNA. The target nucleic acid can be obtained from a biological sample from a subject. The terms "target binding domain" and "sequencing domain" are used interchangeably herein.

[0120] The target binding domain may comprise a series of nucleotides (e.g., a polynucleotide). The target binding domain may comprise DNA, RNA, or a combination thereof. In the case where the target binding domain is a polynucleotide, the target binding domain binds to the target nucleic acid by hybridizing with a portion of the target nucleic acid that is complementary to the target binding domain of the sequencing probe, such as Figure 1as shown in .

[0121] The target binding domain of the sequencing probe can be designed to control the probability of hybridization and / or dehybridization of the sequencing probe, and the rate at which these occur. Generally, the lower the Tm of the probe, the faster and more likely the probe will hybridize with / from the target nucleic acid. Therefore, using a lower Tm probe will reduce the number of probes that bind to the target nucleic acid.

[0122] The length of the target binding domain partially affects the possibility of the probe hybridizing with the target nucleic acid and maintaining hybridization. Generally, the longer the target binding domain is (the more the number of nucleotides), the less likely the complementary sequence is to exist in the target nucleotide. On the contrary, the shorter the target binding domain is, the greater the possibility of the complementary sequence to exist in the target nucleotide. For example, the probability that a tetramer sequence is located in a target nucleic acid is 1 / 256, while the probability that a hexamer sequence is located in a target nucleic acid is 1 / 4096. Therefore, when compared with a set of longer probes, a set of shorter probes may be combined in more positions for a given nucleic acid segment.

[0123] In many cases, it is preferred to have probes with shorter target binding domains to increase the number of reads in a given nucleic acid segment, thereby enriching coverage of the target nucleic acid or a portion of the target nucleic acid, especially a portion of particular interest, such as when detecting mutations or SNP alleles.

[0124] The target binding domain can be any amount or number of nucleotides in length. The target binding domain can be at least 12 nucleotides in length, at least 10 nucleotides in length, at least 8 nucleotides in length, at least 6 nucleotides in length, or at least 3 nucleotides in length.

[0125] Each nucleotide in the target binding domain can identify (or encode) a complementary nucleotide of the target molecule. Alternatively, some nucleotides in the target binding domain identify (or encode) a complementary nucleotide of the target molecule, while some nucleotides in the target binding domain do not identify (or encode) a complementary nucleotide of the target molecule.

[0126] The target binding domain may include at least one natural base. The target binding domain may not include a natural base. The target binding domain may include at least one modified nucleotide or nucleic acid analog. The target binding domain may not include a modified nucleotide or nucleic acid analog. The target binding domain may include at least one universal base. The target binding domain may not include a universal base. The target binding domain may include at least one degenerate base. The target binding domain may not include a degenerate base.

[0127] The target domain can comprise any combination of natural bases (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more natural bases), modified nucleotides or nucleic acid analogs (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more modified nucleotides or nucleic acid analogs), universal bases (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more universal bases), or degenerate bases (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more degenerate bases). When present in combination, the natural bases, modified nucleotides or nucleic acid analogs, universal bases, and degenerate bases of a particular target binding domain can be arranged in any order.

[0128] The term "modified nucleotide" or "nucleic acid analog" includes, but is not limited to, locked nucleic acid (LNA), bridged nucleic acid (BNA), propyne-modified nucleic acid, zipper nucleic acid (ZNA ® ), isoguanine, isocytosine, 6-amino-1-(4-hydroxy-5-hydroxymethyl-tetrahydrofuran-2-yl)-1,5-dihydro-pyrazolo[3,4-d]pyrimidin-4-one (PPG), and 2'-modified nucleic acids such as 2'-O-methyl nucleic acids. The target binding domain may include zero to six (e.g., 0, 1, 2, 3, 4, 5 or 6) modified nucleotides or nucleic acid analogs. Preferably, the modified nucleotide or nucleic acid analog is a locked nucleic acid (LNA).

[0129] As used herein, the term "locked nucleic acid (LNA)" includes, but is not limited to, modified RNA nucleotides in which the ribose moiety includes a methylene bridge connecting the 2' oxygen and the 4' carbon. This methylene bridge locks the ribose in a 3-endo conformation (also known as the North conformation, which is found in A-type RNA duplexes). The term inaccessible RNA can be used interchangeably with LNA. As used herein, the term "bridged nucleic acid (BNA)" includes, but is not limited to, modified RNA molecules comprising a five-membered or six-membered bridging structure with a fixed 3'-endo conformation (also known as the North conformation). The bridging structure connects the 2' oxygen of ribose to the 4' carbon of ribose. Various different bridge structures containing carbon, nitrogen and hydrogen atoms are possible. As used herein, the term "propyne-modified nucleic acids" includes, but is not limited to, pyrimidines containing propyne modifications at the C5 position of the nucleic acid base, i.e., cytosine and thymine / uracil. As used herein, the term "zipper nucleic acid (ZNA)" includes, but is not limited to, ® )" includes, but is not limited to, oligonucleotides conjugated to a cationic spermine moiety.

[0130] As used herein, the term "universal base" includes, but is not limited to, a nucleotide base that does not follow the Watson-Crick base pair rule, but can bind to any of the four canonical bases (A, T / U, C, G) located on the target nucleic acid. As used herein, the term "degenerate base" includes, but is not limited to, a nucleotide base that does not follow the Watson-Crick base pair rule, but can bind to at least two of the four canonical bases (A, T / U, C, G), but not all four. Degenerate bases may also be referred to as wobble bases; these terms are used interchangeably herein.

[0131] Figure 1 The exemplary sequencing probe depicted in shows a target binding domain comprising a six-nucleotide length (6-mer) sequence (b1- b2- b3- b4- b5- b6) that specifically hybridizes to complementary nucleotides 1-6 of a target nucleic acid to be sequenced. This 6-mer portion (b1- b2- b3- b4- b5- b6) of the target binding domain identifies (or encodes) complementary nucleotides (1- 2- 3- 4- 5- 6) in the target sequence. This 6-mer sequence is flanked on either side by bases (N). The base indicated by (N) can independently be a universal base or a degenerate base. Typically, the base indicated by (N) is independently one of the canonical bases. The base indicated by (N) does not identify (or encode) the complementary nucleotide to which it binds in the target sequence and is independent of the nucleic acid sequence of the (6-mer) sequence (b1- b2-b3- b4- b5- b6).

[0132] Figure 1 The sequencing probes depicted in can be used in conjunction with the sequencing methods of the present disclosure to sequence a target nucleic acid using only a hybridization reaction without the need for covalent chemistry, enzymes, or amplification. In order to sequence all possible 6-mer sequences in a target nucleic acid molecule, a total of 4096 sequencing probes (4^6=4096) are required.

[0133] Figure 1is an example of a configuration of a target binding domain of a sequence probe of the present disclosure. Table 1 provides several other configurations of target binding domains of the present disclosure. A preferred target binding domain, referred to as a "6 LNA" target binding domain, comprises 6 LNAs at positions b1 to b6 of the target binding domain. These 6 LNAs are flanked by bases (N) on either side. As used herein, the (N) bases may be universal / degenerate bases or canonical bases of a nucleic acid sequence independent of the (6-mer) sequence (b1- b2- b3- b4- b5- b6). In other words, although the bases b1- b2- b3- b4- b5- b6 may be specific for any given target sequence, the (N) bases may be universal / degenerate bases, or may be composed of any of the four canonical bases that are not specific to a target determined by the bases b1-b2-b3-b4-b5-b6. For example, if the target sequence to be queried is CAGGCATA, the bases b1-b2-b3-b4-b5-b6 of the target binding domain will be TCCGTA, and each (N) base of the target binding domain can independently be A, C, T or G, so that the resulting target binding domain can have the sequence ATCCGTAG, TTCCGTAC, GTCCGTAG or any of the other 16 possible iterations. Alternatively, the two (N) bases can precede the 6 LNAs. Still alternatively, the two (N) bases can follow the 6 LNAs.

[0134] Table 1

[0135]

[0136] b = natural base; + = modified nucleotide or nucleotide analog (e.g. LNA, 2-O'-methyl modified base, 6-amino-1-(4-hydroxy-5-hydroxymethyl-tetrahydrofuran-2-yl)-1,5-dihydro-pyrazolo[3,4-d]pyrimidin-4-one (PPG)); N = natural, universal or degenerate base; Q is a minor groove binder (e.g. Twisted Intercalating Nucleic Acid, MGB-BP3, Brostallicin)

[0137] Table 1 also describes a "10-mer" target binding domain comprising 10 natural, target-specific bases. Table 1 also describes an "8-mer" target binding domain comprising 8 natural, target-specific bases.

[0138] Table 1 further describes a "natural 1" target binding domain comprising 6 natural bases at positions b1 to b6. These 6 natural bases are flanked by 2 (N) bases on either side. Alternatively, all four (N) bases can be before the 6 natural bases. Also alternatively, all four (N) bases can be after the 6 natural bases. Any number (i.e. 1, 2, 3 or 4) of the four (N) bases can be before the 6 natural bases, and the remaining (N) bases are after the 6 natural bases.

[0139] Table 1 further describes a "native II" target binding domain comprising 6 natural bases at positions b1 to b6. These 6 natural bases are flanked by (N) bases on either side. Alternatively, both (N) bases can be before the 6 natural bases. Also alternatively, both (N) bases can be after the 6 natural bases. Typically, the (N) bases of the natural II binding domain are degenerate bases.

[0140] Table 1 also describes a "2 LNA" target binding domain, which comprises a combination of 2 LNAs and 4 natural bases at positions b1 to b6 of the target binding domain. The 2 LNAs and 4 natural bases may be present in any order. For example, positions b3 and b4 may be LNAs, while positions b1, b2, b5, and b6 are natural bases. Bases b1 to b6 are flanked on either side by (N) bases. Alternatively, bases b1 to b6 may be preceded by two (N) bases. Still alternatively, bases b1 to b6 may be followed by two (N) bases.

[0141] Table 1 further describes a "4 LNA" target binding domain, which comprises a combination of 4 LNAs and 2 natural bases at positions b1 to b6 of the target binding domain. The 4 LNAs and 2 natural bases may be present in any order. For example, positions b2 to b5 may be LNAs, while positions b1 and b6 are natural bases. Bases b1 to b6 are flanked on either side by (N) bases. Alternatively, bases b1 to b6 may be preceded by two (N) bases. Also alternatively, bases b1 to b6 may be followed by two (N) bases.

[0142] Table 1 further describes a "6 LNA" target binding domain, which comprises 6 LNAs at positions b1 to b6 of the target binding domain. Bases b1 to b6 may be flanked on either side by (N) bases.

[0143] Table 1 further describes "8-mer with LNA" target binding domains, which individually comprise natural bases or LNAs at any of positions b1 to b6 of the target binding domain. Bases b1 to b6 may be flanked on either side by (N) bases.

[0144] The target binding domain may also include a minor groove binder portion. The minor groove binder portion is a chemical modification of an oligonucleotide that adds a chemical portion that can bind to the minor groove of a target nucleotide to which the oligonucleotide hybridizes. Without being bound by theory, the inclusion of a minor groove binder portion increases the affinity of the target binding domain for the target nucleic acid and increases the melting temperature of the target binding domain-target nucleic acid duplex. Higher binding affinity can allow the use of a smaller target binding domain.

[0145] The target binding domain may also comprise one or more twisted intercalating nucleic acids (TINAs). TINAs are nucleic acid molecules that stabilize the Hoogsteen triplex DNA formation from double-stranded oligonucleotides and triplex-forming oligonucleotides. TINAs can be used to stabilize double-stranded oligonucleotides, thereby improving the specificity and sensitivity of oligonucleotide probes to target nucleic acids.

[0146] The target binding domain can also include a nucleic acid molecule comprising a 2'-O-methyl modified base. A 2'-O-methyl modified base is a nucleoside modification of RNA in which a methyl group is added to the 2' hydroxyl of the ribose to produce a 2' methoxy group. The 2'-O-methyl modified base provides excellent protection against base hydrolysis and digestion by nucleases. Without being bound by theory, the addition of a 2'-O-methyl modified base also increases the melting temperature of a nucleic acid duplex.

[0147] The target binding domain may also include a covalently attached stilbene modification. The stilbene modification may increase the stability of the nucleic acid duplex.

[0148] The sequencing probes of the present disclosure comprise a synthetic backbone. A target binding domain, also described herein as a sequencing domain, is operably linked to a barcode domain. The target binding domain and the barcode domain can be covalently attached as part of a synthetic backbone. The target binding domain and the barcode domain can be attached via a linker (e.g., a nucleic acid linker, a chemical linker). The synthetic backbone can comprise any material, such as a polysaccharide, a polynucleotide, a polymer, a plastic, a fiber, a peptide, a peptide nucleic acid, or a polypeptide. Preferably, the synthetic backbone is rigid. The synthetic backbone can comprise a single-stranded DNA molecule. The backbone can comprise a "DNA origami" of six DNA double helices (see, e.g., Lin et al., "Submicrometregeometrically encoded fluorescent barcodes self-assembled from DNA." Nature Chemistry; 2012 Oct; 4(10): 832-9). Barcodes can be made from DNA origami tiles (Jungmann et al., "Multiplexed 3D cellular super-resolution imaging with DNA-PAINT and Exchange-PAINT", Nature Methods , Vol. 11, No. 3, 2014).

[0149] The sequencing probe of the present disclosure may comprise a partially double-stranded synthetic backbone. The sequencing probe may comprise a single-stranded DNA synthetic backbone and a double-stranded DNA spacer between the target binding domain and the barcode domain. The double-stranded DNA spacer may comprise at least one modified nucleotide or nucleic acid analog. Common modified nucleotides or nucleic acid analogs that can be used in the double-stranded DNA spacer are isoguanine and isocytosine. Alternatively, each nucleic acid comprising the double-stranded DNA spacer may independently be L-DNA. In some aspects, the double-stranded DNA spacer may comprise L-DNA. The double-stranded DNA spacer may consist of L-DNA. The double-stranded DNA spacer may consist essentially of L-DNA.

[0150] The double-stranded DNA spacer may comprise a length of about 1 nucleotide to about 100 nucleotides. The double-stranded DNA spacer may comprise a length of about 25 nucleotides.

[0151] The synthetic backbone may comprise L-DNA. The synthetic backbone may consist of L-DNA. The synthetic backbone may consist essentially of L-DNA. The single-stranded DNA synthetic backbone may comprise a length of about 10 nucleotides to about 100 nucleotides. The single-stranded DNA synthetic backbone may comprise a length of about 52 nucleotides. The single-stranded DNA synthetic backbone may comprise a length of about 27 nucleotides.

[0152] The barcode domain may comprise L-DNA. The barcode domain may consist of L-DNA. The barcode domain may consist essentially of L-DNA. The barcode domain may comprise about 27 nucleotides, or about 52 nucleotides, or about 99 nucleotides, or about 74 nucleotides. The barcode domain may be about 27 nucleotides, or about 52 nucleotides, or about 99 nucleotides, or about 74 nucleotides in length.

[0153] The sequencing probe may comprise a single-stranded DNA synthetic backbone and a polymer-based spacer between the target binding domain and the barcode domain, which has similar mechanical properties to double-stranded DNA. Typical polymer-based spacers include polyethylene glycol (PEG)-type polymers.

[0154] The double-stranded DNA spacer can be about 1 nucleotide to about 100 nucleotides in length; about 2 nucleotides to about 50 nucleotides in length; about 20 nucleotides to about 40 nucleotides in length. Preferably, the double-stranded DNA spacer is about 36 nucleotides in length.

[0155] exist Figure 2 A sequencing probe of the present disclosure, referred to as a "standard probe," is shown in the left figure of FIG. Figure 2 The standard probe comprises a barcode domain covalently attached to a target binding domain such that the target binding domain and the barcode domain are present in the same single stranded oligonucleotide. Figure 2 , left, a single-stranded oligonucleotide is combined with a stem oligonucleotide to create a 36-nucleotide-long double-stranded spacer region called a stem. Using this structure, each sequencing probe in the probe pool can hybridize to the same stem sequence.

[0156] In alternative aspects, each nucleic acid comprising a barcode domain and a region bound to a stem oligonucleotide of a standard probe can be a canonical base or a modified nucleotide or nucleic acid analog. Common modified nucleotides or nucleic acid analogs that can be used in a barcode domain and a region bound to a stem oligonucleotide of a standard probe are isoguanine and isocytosine. Alternatively, each nucleic acid comprising a barcode domain and a region bound to a stem oligonucleotide of a standard probe can be independently L-DNA. For example, a barcode domain and a region bound to a stem oligonucleotide of a standard probe can be composed entirely of L-DNA. In other examples, a barcode domain and a region bound to a stem oligonucleotide of a standard probe can be composed of L-DNA segments, which are separated by a polymer (e.g., PEG) segment having similar mechanical properties to double-stranded DNA, or further described below.

[0157] exist Figure 2 Another sequencing probe of the present disclosure, referred to as a "3-part probe", is shown in the middle figure of . Figure 2 The 3-part probe comprises a barcode domain, which is attached to the target binding domain via a joint. In this example, the joint is a single-stranded stem oligonucleotide, which hybridizes with the single-stranded oligonucleotide containing the target binding domain and the single-stranded oligonucleotide containing the barcode domain, producing a double-stranded spacer region of 36 nucleotides bridging the barcode domain (18 nucleotides) and the target binding domain (18 nucleotides). Using this exemplary probe configuration, in order to prevent the exchange of the barcode domain, each barcode can be designed so that it hybridizes with a unique stem sequence. In addition, before different sequencing probes are merged together, each barcode domain can also be hybridized with its corresponding stem oligonucleotide.

[0158] In alternative, every kind of nucleic acid comprising the single-stranded stem oligonucleotide can be a nucleotide or nucleic acid analog of a standard base or modification. Commonly modified nucleotides or nucleic acid analogs that can be used in the single-stranded stem oligonucleotide are isoguanine and isocytosine. Also alternatively, every kind of nucleic acid comprising the single-stranded stem oligonucleotide can be L-DNA independently.

[0159] In alternative aspects, each nucleic acid contained in the region on the barcode domain to which the single-stranded stem oligonucleotide hybridizes can be a canonical base or a modified nucleotide or nucleic acid analog. Common modified nucleotides or nucleic acid analogs that can be used in single-stranded stem oligonucleotides are isoguanine and isocytosine. Also alternatively, each nucleic acid contained in the region on the barcode domain to which the single-stranded stem oligonucleotide hybridizes can independently be L-DNA.

[0160] In alternative aspect, every kind of nucleic acid included in the region of the target binding domain that contains the single-stranded stem oligonucleotide hybridizing therewith on the single-stranded oligonucleotide can be a nucleotide or nucleic acid analog of a standard base or modification. Common modified nucleotides or nucleic acid analogs that can be used in the single-stranded stem oligonucleotide are isoguanine and isocytosine. Also alternatively, every kind of nucleic acid included in the region of the target binding domain that contains the single-stranded stem oligonucleotide hybridizing therewith on the single-stranded oligonucleotide can independently be L-DNA.

[0161] exist Figure 2 Another sequencing probe of the present disclosure, referred to as a "1-part adapter probe", is shown in the right figure of FIG. Figure 2 The 1-part linker probe comprises a barcode domain attached to a target binding domain via a linker. In this example, the linker is a PEG molecule. Alternatively, the linker can be a trans-stilbene. Still alternatively, the linker can be any polymer having similar mechanical properties to double-stranded DNA. Common polymer-based spacers include polyethylene glycol (PEG) type polymers.

[0162] The sequencing probe of the present disclosure may contain about 60 nucleotides. The sequencing probe of the present disclosure may contain about 107 nucleotides. The sequencing probe of the present disclosure may be about 60 nucleotides in length, or about 107 nucleotides in length. The nucleotides constituting the sequencing probe may each individually be canonical bases, modified nucleotides or nucleic acid analogs, including L-DNA and D-DNA.

[0163] The barcode domain comprises a plurality of attachment sites, such as one, two, three, four, five, six, seven, eight, nine, ten or more attachment sites. The number of attachment sites may be less than, equal to or more than the number of nucleotides in the target binding domain. The target binding domain may comprise more nucleotides than the number of attachment sites in the backbone domain, such as one, two, three, four, five, six, seven, eight, nine, ten or more nucleotides. The target binding domain may comprise eight nucleotides and the barcode domain may comprise three attachment sites. The target binding domain may comprise ten nucleotides and the barcode domain may comprise three attachment sites.

[0164] The length of the barcode domain is not limited, as long as there is enough space for at least three attachment positions, as described below. The terms "attachment position", "position" and "site" are used interchangeably herein. The terms "barcode domain" and "reporter domain" are used interchangeably herein.

[0165] Each attachment position in the barcode domain corresponds to two nucleotides (dinucleotides) in the target binding domain, and therefore corresponds to a complementary dinucleotide in the target nucleic acid that hybridizes to a dinucleotide in the target binding domain. As a non-limiting example, a first attachment position in the barcode domain corresponds to a first nucleotide and a second nucleotide in the target binding domain (e.g., Figure 1 , wherein R1 is the first attachment position in the barcode domain, and R1 corresponds to dinucleotides b1 and b2 in the target binding domain - which in turn identify dinucleotides 1 and 2 of the target nucleic acid); the second attachment position in the barcode domain corresponds to the third and fourth nucleotides in the target binding domain (e.g. Figure 1 , wherein R2 is the second attachment position in the barcode domain, and R2 corresponds to dinucleotides b3 and b4 in the target binding domain - which in turn identify dinucleotides 3 and 4 of the target nucleic acid); and the third attachment position in the barcode domain corresponds to the fifth and sixth nucleotides in the target binding domain (e.g. Figure 1 , wherein R3 is the third attachment position in the barcode domain, and R3 corresponds to dinucleotides b5 and b6 in the target binding domain - which in turn identify dinucleotides 5 and 6 of the target nucleic acid). In a further non-limiting example, the first attachment position in the barcode domain, the second attachment position in the barcode domain, and the third attachment position in the barcode domain, collectively correspond to the first to sixth nucleotides in the target binding domain (e.g. Figure 1 , where nucleotides b1 to b6 in the target binding domain - which in turn identify six nucleotides of the target nucleic acid).

[0166] Each attachment position in the barcode structure domain includes at least one attachment region, such as one to 50 or more attachment regions. Certain positions in the barcode structure domain may have more attachment regions than other positions (e.g., a first attachment position may have three attachment regions, and a second attachment position may have two attachment regions); alternatively, each position in the barcode structure domain has the same number of attachment regions. Each attachment position in the barcode structure domain may include one attachment region. Each attachment position in the barcode structure domain may include more than one attachment region. At least one of the at least three attachment positions in the barcode structure domain may include a different number of attachment regions from the other two attachment positions in the barcode structure domain. In some aspects, each attachment position in the barcode structure domain may include one attachment region.

[0167] Each attachment region comprises at least one (i.e., one to fifty, e.g., ten to thirty) copy of a nucleic acid sequence that can be reversibly bound by a complementary nucleic acid molecule (e.g., DNA or RNA). The nucleic acid sequences of the attachment regions at a single attachment location can be identical; therefore, the complementary nucleic acid molecules that bind to those attachment regions are identical. Alternatively, the nucleic acid sequences of the attachment regions at a location are not identical; therefore, the complementary nucleic acid molecules that bind to those attachment regions are not identical.

[0168] The nucleic acid sequence comprising each attachment region in the barcode domain may be about 6 nucleotides to about 20 nucleotides in length. The nucleic acid sequence comprising each attachment region in the barcode domain may be about 12 nucleotides in length. The nucleic acid sequence comprising each attachment region in the barcode domain may be about 16 nucleotides in length. The nucleic acid sequence comprising each attachment region in the barcode domain may be about 14 nucleotides in length. The nucleic acid sequence comprising each attachment region in the barcode domain may be about 8 nucleotides in length. The nucleic acid sequence comprising each attachment region in the barcode domain may be about 9 nucleotides in length.

[0169] The attachment site, attachment region, or at least one nucleic acid sequence of the attachment region may contain at least one super T base (5-hydroxybutyne-2'-deoxyuridine). The attachment site, attachment region, or at least one nucleic acid sequence of the attachment region may contain at least one 3' terminal super T base (5-hydroxybutyne-2'-deoxyuridine). The attachment site, attachment region, or at least one nucleic acid sequence of the attachment region may contain at least one 5' terminal super T base (5-hydroxybutyne-2'-deoxyuridine).

[0170] Each nucleic acid comprising each attachment region in the barcode domain can independently be a canonical base or a modified nucleotide or nucleic acid analog. At least one, at least two, at least three, at least four, at least five or at least six nucleotides in the attachment region of the barcode domain can be a modified nucleotide or nucleotide analog. The usual ratio of modified nucleotides or nucleotide analogs to canonical bases in the barcode domain is 1:2 to 1:8. Common modified nucleotides or nucleic acid analogs that can be used in the attachment region of the barcode domain are isoguanine and isocytosine. For example, the use of modified nucleotides or nucleotide analogs such as isoguanine and isocytosine can improve the binding efficiency and accuracy of the reporter to the appropriate attachment region in the barcode domain, while minimizing the binding elsewhere (including to the target).

[0171] One or more attachment regions within the barcode domain may comprise L-DNA. L-DNA is a left-handed and mirrored version of the naturally occurring right-turning D-DNA. L-DNA is more stable and resistant to enzymatic digestion. Since L-DNA cannot hybridize with D-DNA, L-DNA can improve the binding efficiency and binding accuracy of the reporter to the appropriate attachment region in the barcode domain, and prevent the reporter from binding to other places on the sequencing probe. In some aspects, each nucleotide of at least one nucleic acid sequence of the attachment position may be L-DNA.

[0172] Each nucleic acid comprising each attachment region in the barcode domain may independently comprise an adenine, cytosine, guanine or thymine base. Alternatively, each nucleic acid comprising each attachment region in the barcode domain may independently comprise an adenine, guanine or thymine base.

[0173] Each nucleic acid sequence comprising each attachment region in the barcode domain may comprise at least one adenine nucleotide, at least one thymine nucleotide, at least one cytosine nucleotide, or any combination thereof, and a 3' terminal guanosine nucleotide. Each nucleic acid sequence comprising each attachment region in the barcode domain may consist of at least one adenine nucleotide, at least one thymine nucleotide, at least one cytosine nucleotide, or any combination thereof, and a 3' terminal guanosine nucleotide. Each nucleic acid sequence comprising each attachment region in the barcode domain may consist essentially of at least one adenine nucleotide, at least one thymine nucleotide, at least one cytosine nucleotide, or any combination thereof, and a 3' terminal guanosine nucleotide.

[0174] Each nucleic acid sequence comprising each attachment region in the barcode domain may comprise at least one adenine nucleotide, at least one thymine nucleotide, at least one cytosine nucleotide, or any combination thereof, and a 5' terminal guanosine nucleotide. Each nucleic acid sequence comprising each attachment region in the barcode domain may consist of at least one adenine nucleotide, at least one thymine nucleotide, at least one cytosine nucleotide, or any combination thereof, and a 5' terminal guanosine nucleotide. Each nucleic acid sequence comprising each attachment region in the barcode domain may consist essentially of at least one adenine nucleotide, at least one thymine nucleotide, at least one cytosine nucleotide, or any combination thereof, and a 5' terminal guanosine nucleotide.

[0175] In some aspects, at least one attachment region of at least one attachment position of a barcode domain can comprise a 3' terminal guanosine nucleotide. In some aspects, at least one attachment region of at least two attachment positions of a barcode domain can comprise a 3' terminal guanosine nucleotide. In some aspects, at least one attachment region of at least three attachment positions of a barcode domain can comprise a 3' terminal guanosine nucleotide. The 3' terminal guanosine nucleotide can be L-DNA.

[0176] In some aspects, at least one attachment region of at least one attachment position of a barcode domain can comprise a 3' terminal guanosine nucleotide. In some aspects, at least one attachment region of at least two attachment positions of a barcode domain can comprise a 3' terminal guanosine nucleotide. In some aspects, at least one attachment region of at least three attachment positions of a barcode domain can comprise a 5' terminal guanosine nucleotide. The 3' terminal guanosine nucleotide can be L-DNA, such as L-deoxyguanosine (L-dG). The terminal L-dG nucleotide mitigates cross-linking hybridization between attachment regions and / or attachment positions and maintains stability by providing base stacking interactions.

[0177] One or more attachment regions can be integrated with a polynucleotide backbone; that is, the backbone is a single polynucleotide, and the attachment region is part of a single polynucleotide sequence. One or more attachment regions can be connected to a modified monomer (e.g., a modified nucleotide) in a synthetic backbone so that the attachment region branches out from the synthetic backbone. An attachment position can include more than one attachment region, some of which branch out from the synthetic backbone, and some of which are integrated with the synthetic backbone. At least one attachment region in at least one attachment position can be integrated with the synthetic backbone. Each of the at least three attachment positions can be integrated with the synthetic backbone. At least one attachment region in at least one attachment position can branch out from the synthetic backbone. Each of the at least three attachment positions can branch out from the synthetic backbone.

[0178] Each attachment position within the barcode domain corresponds to one of sixteen dinucleotides, i.e., adenine-adenine, adenine-thymine / uracil, adenine-cytosine, adenine-guanine, thymine / uracil-adenine, thymine / uracil-thymine / uracil, thymine / uracil-cytosine, thymine / uracil-guanine, cytosine-adenine, cytosine-thymine / uracil, cytosine-cytosine, cytosine-guanine, guanine-adenine, guanine-thymine / uracil, guanine-cytosine, or guanine-guanine. Thus, one or more attachment regions located in a single attachment position of the barcode domain correspond to one of the sixteen dinucleotides and comprise a nucleic acid sequence specific for the dinucleotide to which the attachment region corresponds. Attachment regions located in different attachment positions of the barcode domain contain unique nucleic acid sequences even if these positions within the barcode domain correspond to the same dinucleotide. For example, given that a sequencing probe of the present disclosure contains a hexameric target binding domain having a coding sequence of AGAGAC, the barcode domain of the sequencing probe will contain three positions, wherein the first attachment position corresponds to an adenine-guanine dinucleotide, the second attachment position corresponds to an adenine-guanine dinucleotide, and the third attachment position corresponds to an adenine-cytosine dinucleotide. Even if both attachment position 1 and attachment position 2 correspond to the dinucleotide adenine-guanine, the attachment region located in position one of the example probe contains a unique nucleic acid sequence relative to the nucleic acid sequence of the attachment region located in position two. The sequences of specific attachment positions are designed and tested in this way so that the complementary nucleic acid of a specific attachment position does not interact with a different attachment position. In addition, the nucleotide sequence of the complementary nucleic acid is not limited; preferably, it lacks substantial homology (e.g., 50% to 99.9%) with a known nucleotide sequence; this limits undesired hybridization of the complementary nucleic acid and the target nucleic acid.

[0179] Figure 1 Shown is a diagram of an exemplary sequencing probe of the present disclosure comprising an exemplary barcode domain. Figure 1 The exemplary barcode domain depicted in comprises three attachment positions R1, R2, and R3. Each attachment position corresponds to a specific dinucleotide present within the 6-mer sequence (b1 to b6) of the target binding domain. In this example, R1 corresponds to positions b1 and b2, R2 corresponds to positions b3 and b4, and R3 corresponds to positions b5 and b6. Thus, each position encodes a specific dinucleotide present in the 6-mer sequence of the target binding domain, allowing identification of the specific two bases (A, C, G, or T) present in each specific dinucleotide.

[0180] exist Figure 1In the exemplary barcode domain depicted in , each attachment position comprises a single attachment region integrated with a synthetic backbone. Each attachment region of the three attachment positions contains a specific nucleotide sequence that corresponds to a specific dinucleotide encoded by each attachment position. For example, attachment position R1 comprises an attachment region having a specific sequence corresponding to the identity of dinucleotides b1-b2.

[0181] The barcode domain may further comprise one or more binding regions. The barcode domain may comprise at least one single-stranded nucleic acid sequence adjacent to or flanking at least one attachment site. The barcode domain may comprise at least two single-stranded nucleic acid sequences adjacent to or flanking at least two attachment sites. The barcode domain may comprise at least three single-stranded nucleic acid sequences adjacent to or flanking at least three attachment sites. These flanking portions are called "toe-holds," which can accelerate the exchange rate of oligonucleotides hybridized adjacent to the toe-hold by providing additional binding sites for single-stranded oligonucleotides (e.g., "toe-hold" probes; see, e.g., Seeling et al., "Catalyzed Relaxation of a Metastable DNA Fuel"; J. Am. Chem. Soc . 2006, 128(37), pp. 12211-12220).

[0182] At least one attachment region within the barcode domain can be flanked on at least one side by a double-stranded nucleic acid sequence. At least two attachment regions within the barcode domain can be flanked on at least one side by a double-stranded nucleic acid sequence. At least three attachment regions within the barcode domain can be flanked on at least one side by a double-stranded nucleic acid sequence.

[0183] Any attachment region within the barcode domain can be separated from any adjacent attachment sites by a double-stranded nucleic acid sequence called a "pocket oligonucleotide." Fig.28 An example of a sequencing probe having a barcode domain comprising three attachment positions is shown. Attachment position 1 is separated from adjacent attachment position 2 by a pocket oligonucleotide. Attachment position 2 is further separated from adjacent attachment position 3 by another pocket oligonucleotide.

[0184] Each nucleic acid comprising a pocket oligonucleotide can be a canonical base or a modified nucleotide or nucleic acid analog. Common modified nucleotides or nucleic acid analogs that can be used in pocket oligonucleotides are isoguanine and isocytosine. Alternatively, each nucleic acid comprising a pocket oligonucleotide can be independently L-DNA. The pocket oligomer can include at least one super T base (5-hydroxybutyne-2'-deoxyuridine). The pocket oligonucleotide can be about 25 nucleotides in length.

[0185] In some aspects, at least one, at least two, or at least three attachment positions in the barcode domain can be adjacent to at least one flanking double-stranded polynucleotide. At least one flanking double-stranded polynucleotide can comprise at least one modified nucleotide or nucleic acid analog. At least one flanking double-stranded polynucleotide can comprise L-DNA. At least one flanking double-stranded polynucleotide can comprise at least one super T base (5-hydroxybutyne-2'-deoxyuridine). At least one flanking double-stranded polynucleotide can be about 25 nucleotides in length.

[0186] At least one attachment region within a barcode domain can be flanked on at least one side by any polymer having similar mechanical properties to double-stranded DNA. Typical polymer-based spacers include polyethylene glycol (PEG) type polymers. At least two attachment regions within a barcode domain can be flanked on at least one side by any polymer having similar mechanical properties to double-stranded DNA. At least three attachment regions within a barcode domain can be flanked on at least one side by any polymer having similar mechanical properties to double-stranded DNA.

[0187] Any attachment region within the barcode domain can be separated from any adjacent attachment site by any polymer that has similar mechanical properties to double-stranded DNA. Common polymer-based spacers include polyethylene glycol (PEG) type polymers. Fig.29 An example of a sequencing probe having a barcode domain comprising three attachment positions is shown. Attachment position 1 is separated from the adjacent attachment position 2 by a PEG-linker. Attachment position 2 is further separated from the adjacent attachment position 3 by another PEG-linker.

[0188] At least one attachment region within the barcode domain can be flanked on at least one side by an abasic single-stranded nucleic acid molecule. An abasic nucleic acid molecule is a nucleic acid molecule that has neither purine bases nor pyrimidine bases. At least two attachment regions within the barcode domain can be flanked on at least one side by an abasic single-stranded nucleic acid molecule. At least three attachment regions within the barcode domain can be flanked on at least one side by an abasic single-stranded nucleic acid molecule.

[0189] Any attachment region within the barcode domain can be separated from any adjacent attachment site by an abasic single-stranded nucleic acid molecule. Fig.30 An example of a sequencing probe having a barcode domain comprising three attachment sites is shown. Attachment site 1 is separated from adjacent attachment site 2 by an abasic single-stranded nucleic acid molecule. Attachment site 2 is further separated from adjacent attachment site 3 by another abasic single-stranded nucleic acid molecule.

[0190] Any attachment region within the barcode domain may be separated from any adjacent attachment position by a 3' terminal guanosine nucleotide. In some aspects, at least one attachment region of at least two attachment positions of the barcode domain may comprise a 3' terminal guanosine nucleotide. Fig.53 An example of a sequencing probe having a barcode domain comprising three attachment positions is shown, each of which is separated by a terminal LG nucleotide. Attachment position 1 is separated from the adjacent attachment position 2 by a LG nucleotide. Attachment position 2 is further separated from the adjacent attachment position 3 by another LG nucleotide. Attachment position 3 is terminated with a LG nucleotide on the 3' end.

[0191] The sequencing probe of the present disclosure can have an overall length of about 20 nanometers to about 50 nanometers (including the target binding domain, the barcode domain, and any optional domains). The backbone of the sequencing probe can be a polynucleotide molecule comprising about 120 nucleotides, about 60 nucleotides, about 52 nucleotides, or about 27 nucleotides.

[0192] The sequencing probe may include a cleavable joint modification. The cleavable joint modification may include at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten or any number of cleavable parts. Any cleavable joint modification or cleavable part known to those skilled in the art may be utilized. Non-limiting examples of cleavable joint modifications and cleavable parts include but are not limited to UV light cleavable joints, reductant cleavable joints and enzymatic cleavable joints. An example of an enzymatic cleavable joint is the insertion of deoxyuracil for cleavage by USER™ enzyme. The cleavable joint modification may be located at any position along the length of the sequencing probe, including but not limited to the region between the target binding domain and the barcode domain. Figure 7 The right panel of depicts exemplary cleavable linker modifications that can be incorporated into the probes of the present disclosure.

[0193] Reporter Probe

[0194] A nucleic acid molecule that binds (e.g., hybridizes) to a complementary nucleic acid sequence within at least one attachment region within at least one attachment location of a barcode domain of a sequencing probe of the present disclosure and contains a (directly or indirectly) detectable label is referred to herein as a "reporter probe" or "reporter probe complex," and these terms are used interchangeably herein. The reporter probe can be DNA, RNA, or PNA. Preferably, the reporter probe is DNA.

[0195] The reporter probe may comprise at least two domains: a first domain capable of binding to at least a first complementary nucleic acid molecule, and a second domain capable of binding to a first detectable label and at least a second detectable label. Figure 3 A schematic diagram of an exemplary reporter probe of the present disclosure is shown, which is bound to the first attachment position of the barcode domain of an exemplary sequencing probe. Figure 3 In the figure, the first domain of the reporter probe (shown in shaded maroon) binds to a complementary nucleic acid sequence within attachment position R1 of the barcode domain, while the second domain of the reporter probe (shown in grey) binds to two detectable labels (one green and one red).

[0196] Alternatively, the reporter probe may comprise at least two domains: a first domain capable of binding to at least one first complementary nucleic acid molecule, and a second domain capable of binding to at least one second complementary nucleic acid molecule. The at least one first complementary nucleic acid molecule and the at least one second complementary nucleic acid molecule may be different (having different nucleic acid sequences).

[0197] A "primary nucleic acid molecule" is a reporter probe comprising at least two domains: a first domain capable of binding (e.g., hybridizing) to a complementary nucleic acid sequence within at least one attachment region within at least one attachment position of a barcode domain of a sequencing probe, and a second domain that binds (e.g., hybridizes) to at least one additional complementary nucleic acid. The primary nucleic acid molecule can directly bind to a complementary nucleic acid sequence within at least one attachment region within at least one attachment position of a barcode domain of a sequencing probe. The primary nucleic acid molecule can indirectly bind to a complementary nucleic acid sequence within at least one attachment region within at least one attachment position of a barcode domain of a sequencing probe via a nucleic acid linker. Such a nucleic acid linker is referred to as a "linker oligonucleotide."

[0198] The linker oligonucleotide can comprise at least two domains: a first domain capable of binding (e.g., hybridizing) to at least one first complementary nucleic acid sequence within at least one attachment region within at least one attachment location of the barcode domain, and a second domain capable of binding (e.g., hybridizing) to the first domain of the primary nucleic acid molecule. Fig.31 A sequencing probe is shown coupled to a reporter probe via a linker oligonucleotide.

[0199] Each nucleic acid comprising the first domain or the second domain of the linker oligonucleotide can be a canonical base or a modified nucleotide or nucleic acid analog. The commonly modified nucleotides or nucleic acid analogs that can be used in the first domain or the second domain of the linker oligonucleotide are isoguanine and isocytosine. For example, the use of modified nucleotides or nucleotide analogs such as isoguanine and isocytosine can improve the binding efficiency and accuracy of the first domain of the linker oligonucleotide with the appropriate complementary nucleic acid sequence in at least one attachment region within at least one attachment position of the barcode domain of the sequencing probe, while minimizing the binding elsewhere (including with the target). For example, the use of modified nucleotides or nucleotide analogs such as isoguanine and isocytosine can improve the binding efficiency and accuracy of the second domain of the linker oligonucleotide with the appropriate first domain of the reporter probe, while minimizing the binding elsewhere (including with the target). Alternatively, each nucleic acid comprising the first domain or the second domain of the linker oligonucleotide can be independently L-DNA. In one example of a linker oligonucleotide, the first domain comprises D-DNA and the second domain comprises L-DNA. In another example of a linker oligonucleotide, the first domain comprises D-DNA and the second domain comprises isoguanine and / or isocytosine.

[0200] The first domain of the linker oligonucleotide can be about 8 to about 16 nucleotides in length. Preferably, the first domain of the linker oligonucleotide is 14 nucleotides in length. The second domain of the linker oligonucleotide can be about 4-12 nucleotides in length. Preferably, the second domain of the linker oligonucleotide can be about 8 nucleotides in length.

[0201] In aspects comprising a linker oligonucleotide, the attachment region can be referred to as partially double-stranded. The partially double-stranded attachment region can include a double-stranded region and a single strand. The single-stranded region of the partially double-stranded attachment region can include at least one nucleic acid sequence that binds (e.g., hybridizes) to at least one complementary nucleic acid sequence. The at least one complementary nucleic acid sequence that binds (e.g., hybridizes) to the single-stranded region of the partially double-stranded attachment region can be a primary nucleic acid molecule.

[0202] Each nucleic acid in the double-stranded region of the attachment region comprising a partially double-stranded region can independently be a canonical base or a modified nucleotide or nucleic acid analog. At least one, two, at least three, at least four, at least five, at least six, at least seven or at least eight nucleotides in the double-stranded region of the attachment region of the partially double-stranded region can be a modified nucleotide or nucleotide analog. The usual ratio of modified nucleotides or nucleotide analogs to canonical bases in the barcode domain is 1:2 to 1:8. Common modified nucleotides or nucleic acid analogs that can be used in the first domain of the primary nucleic acid molecule are isoguanine and isocytosine. Alternatively, each nucleic acid in the double-stranded region of the attachment region comprising a partially double-stranded region can independently be L-DNA.

[0203] Each nucleic acid in the single-stranded region of the attachment region of the partial double strand can independently be a canonical base or a modified nucleotide or nucleic acid analog. At least one, two, at least three, at least four, at least five, at least six, at least seven or at least eight nucleotides in the single-stranded region of the attachment region of the partial double strand can be a modified nucleotide or nucleic acid analog. The usual ratio of the modified nucleotide or nucleic acid analog to the canonical base in the barcode domain is 1:2 to 1:8. The commonly modified nucleotides or nucleic acid analogs that can be used in the single-stranded region of the attachment region of the partial double strand are isoguanine and isocytosine. For example, the use of modified nucleotides or nucleic acid analogs such as isoguanine and isocytosine can improve the binding efficiency and accuracy of the single-stranded region of the attachment region of the partial double strand with the appropriate complementary nucleic acid sequence of the primary nucleic acid molecule, while minimizing the binding elsewhere (including with the target). Alternatively, each nucleic acid in the first domain of the primary nucleic acid molecule can independently be L-DNA.

[0204] The primary nucleic acid molecule may comprise a cleavable linker. The cleavable linker may be located between the first domain and the second domain. Preferably, the cleavable linker is photocleavable. The cleavable linker may comprise at least one or at least two cleavable portions. The at least one or at least two cleavable portions may be photocleavable.

[0205] The first domain of the primary nucleic acid molecule may be about 6 to 16 nucleotides in length. Preferably, the first domain of the primary nucleic acid molecule is about 8 nucleotides in length.

[0206] Each nucleic acid comprising the first domain of the primary nucleic acid molecule can independently be a canonical base or a modified nucleotide or nucleic acid analog. At least one, two, at least three, at least four, at least five, at least six, at least seven or at least eight nucleotides in the first domain of the primary nucleic acid molecule can be a modified nucleotide or nucleotide analog. The usual ratio of the modified nucleotide or nucleotide analog to the canonical base in the barcode domain is 1:2 to 1:8. The commonly modified nucleotides or nucleic acid analogs that can be used in the first domain of the primary nucleic acid molecule are isoguanine and isocytosine. For example, the use of modified nucleotides or nucleotide analogs such as isoguanine and isocytosine can improve the binding efficiency and accuracy of the first domain of the primary nucleic acid molecule and the appropriate complementary nucleic acid sequence in at least one attachment region within at least one attachment position of the barcode domain of the sequencing probe, while minimizing the binding elsewhere (including to the target). Alternatively, each nucleic acid comprising the first domain of the primary nucleic acid molecule can independently be L-DNA.

[0207] In some aspects, the first domain of the primary nucleic acid molecule can consist entirely of L-DNA, while the second domain of the primary nucleic acid molecule can consist entirely of D-DNA.

[0208] In some aspects, the first domain of the primary nucleic acid molecule may comprise a 3' terminal cytosine nucleotide. In some aspects, the first domain of the primary nucleic acid molecule may comprise a 3' terminal cytosine nucleotide, wherein the 3' terminal cytosine nucleotide is L-DNA.

[0209] In some aspects, the first domain of the primary nucleic acid molecule may comprise a 5' terminal cytosine nucleotide. In some aspects, the first domain of the primary nucleic acid molecule may comprise a 5' terminal cytosine nucleotide, wherein the 5' terminal cytosine nucleotide is L-DNA.

[0210] In some aspects, the first domain of a primary nucleic acid molecule may comprise at least one adenine nucleotide, at least one thymine nucleotide, at least one guanine nucleotide or any combination thereof and a 3' terminal cytosine nucleotide. In some aspects, the first domain of a primary nucleic acid molecule may consist of at least one adenine nucleotide, at least one thymine nucleotide, at least one guanine nucleotide or any combination thereof and a 3' terminal cytosine nucleotide. In some aspects, the first domain of a primary nucleic acid molecule may consist essentially of at least one adenine nucleotide, at least one thymine nucleotide, at least one guanine nucleotide or any combination thereof and a 3' terminal cytosine nucleotide.

[0211] In some aspects, the first domain of a primary nucleic acid molecule may comprise at least one adenine nucleotide, at least one thymine nucleotide, at least one guanine nucleotide or any combination thereof and a 5' terminal cytosine nucleotide. In some aspects, the first domain of a primary nucleic acid molecule may consist of at least one adenine nucleotide, at least one thymine nucleotide, at least one guanine nucleotide or any combination thereof and a 5' terminal cytosine nucleotide. In some aspects, the first domain of a primary nucleic acid molecule may consist essentially of at least one adenine nucleotide, at least one thymine nucleotide, at least one guanine nucleotide or any combination thereof and a 5' terminal cytosine nucleotide.

[0212] At least one additional complementary nucleic acid that binds to a primary nucleic acid molecule is referred to herein as a "secondary nucleic acid molecule". A primary nucleic acid molecule can bind (e.g., hybridize) to at least one, at least two, at least three, at least four, at least five, or more secondary nucleic acid molecules. Preferably, a primary nucleic acid molecule binds (e.g., hybridizes) to four secondary nucleic acid molecules.

[0213] The secondary nucleic acid molecule can include at least two domains: a first domain capable of binding (e.g., hybridizing) to at least one complementary sequence in at least one primary nucleic acid molecule; and a second domain capable of binding (e.g., hybridizing) to: (a) a first detectable label and at least a second detectable label, (b) at least one other complementary nucleic acid, or (c) a combination thereof. In some aspects, the first domain of the secondary nucleic acid molecule can be composed entirely of L-DNA, and the second domain of the secondary nucleic acid molecule can be composed entirely of D-DNA. In some aspects, both the first domain and the second domain of the secondary nucleic acid molecule can be composed entirely of D-DNA.

[0214] The secondary nucleic acid molecule may comprise a cleavable linker. The cleavable linker may be located between the first domain and the second domain. Preferably, the cleavable linker is photocleavable.

[0215] Each nucleic acid comprising the first domain of the secondary nucleic acid molecule can independently be a canonical base or a modified nucleotide or nucleic acid analog. At least one, two, at least three, at least four, at least five or at least six nucleotides in the first domain of the secondary nucleic acid molecule can be a modified nucleotide or nucleotide analog. The usual ratio of the modified nucleotides or nucleotide analogs to the canonical bases in the barcode domain is 1:2 to 1:8. Common modified nucleotides or nucleic acid analogs that can be used in the first domain of the secondary nucleic acid molecule are isoguanine and isocytosine. For example, the use of modified nucleotides or nucleotide analogs such as isoguanine and isocytosine can improve the binding efficiency and accuracy of the first domain of the secondary nucleic acid molecule with the appropriate complementary nucleic acid sequence in the second domain of the primary nucleic acid molecule, while minimizing the binding elsewhere.

[0216] The at least one additional complementary nucleic acid that binds to the secondary nucleic acid molecule is referred to herein as a "tertiary nucleic acid molecule". The secondary nucleic acid molecule may bind (e.g., hybridize) to at least one, at least two, at least three, at least four, at least five, at least six, at least seven, or more tertiary nucleic acid molecules. Preferably, at least one secondary nucleic acid molecule binds (e.g., hybridizes) to one tertiary nucleic acid molecule.

[0217] The tertiary nucleic acid molecule comprises at least two domains: a first domain capable of binding (e.g., hybridizing) to at least one complementary sequence in at least one secondary nucleic acid molecule, and a second domain capable of binding (e.g., hybridizing) to a first detectable label and at least a second detectable label. Alternatively, the second domain may include a first detectable label and at least a second detectable label via direct or indirect attachment of a label during oligonucleotide synthesis using, for example, phosphoramidite or NHS chemistry. In some aspects, the first domain of the tertiary nucleic acid molecule may be composed entirely of L-DNA, while the second domain of the tertiary nucleic acid molecule may be composed entirely of D-DNA. In some aspects, both the first domain and the second domain of the tertiary nucleic acid molecule may be composed entirely of D-DNA. The tertiary nucleic acid molecule may include a cleavable joint. The cleavable joint may be located between the first domain and the second domain. Preferably, the cleavable joint is photocleavable.

[0218] Each nucleic acid comprising the first domain of a tertiary nucleic acid molecule can independently be a canonical base or a modified nucleotide or nucleic acid analog. At least one, two, at least three, at least four, at least five or at least six nucleotides in the first domain of a tertiary nucleic acid can be a modified nucleotide or nucleotide analog. The usual ratio of the modified nucleotide or nucleotide analog to the canonical base in the first domain of a tertiary nucleic acid molecule is 1:2 to 1:8. Common modified nucleotides or nucleic acid analogs that can be used in the first domain of a tertiary nucleic acid molecule are isoguanine and isocytosine. For example, the use of modified nucleotides or nucleotide analogs such as isoguanine and isocytosine can improve the binding efficiency and accuracy of the first domain of a tertiary nucleic acid molecule with the appropriate complementary nucleic acid sequence in the second domain of a second nucleic acid molecule, while minimizing the binding elsewhere.

[0219] The reporter probe is combined with a first detectable label and at least a second detectable label to produce a two-color combination. This dual combination of fluorescent dyes can include duality of a single color, such as blue-blue. As used herein, the term "label" includes a single portion capable of producing a detectable signal, or multiple portions capable of producing the same or substantially the same detectable signal. For example, a label includes a single yellow fluorescent dye such as ALEXA FLUOR™, or multiple yellow fluorescent dyes such as ALEXA FLUOR™ 532.

[0220] The reporter probe can be combined with a first detectable label and at least a second detectable label, wherein each detectable label is one of the following four fluorescent dyes: blue (B); green (G); yellow (Y); and red (R). The use of these four dyes produces 10 possible two-color combinations: BB; BG; BR; BY; GG; GR; GY; RR; RY; or YY. In some aspects, the reporter probe of the present disclosure is labeled with one of the following 8 possible color combinations: BB; BG; BR; BY; GG; GR; GY; or YY, such as Figure 3 The detectable label and the at least second detectable label may have the same emission spectrum, or may have different emission spectra.

[0221] In aspects comprising a sequencing probe and a primary nucleic acid molecule, the disclosure provides a sequencing probe comprising a target binding domain and a barcode domain; wherein the target binding domain comprises any of the constructs described in Table 1. An exemplary target binding domain comprises at least eight nucleotides and is capable of hybridizing to a target nucleic acid, wherein at least six nucleotides in the target binding domain are capable of identifying corresponding (complementary) nucleotides in the target nucleic acid molecule, and wherein at least two nucleotides in the target binding domain do not identify corresponding nucleotides in the target nucleic acid molecule; wherein any of the at least six nucleotides in the target binding domain may be a modified nucleotide or nucleotide analog, and wherein at least two nucleotides in the target binding domain that do not identify corresponding nucleotides in the target nucleic acid molecule may be any of the four canonical bases that are not specific to a target determined by the at least six nucleotides in the target binding domain, or universal bases or degenerate bases. An exemplary barcode domain comprises a synthetic backbone, the barcode domain comprising at least three attachment positions, each attachment position comprising at least one attachment region comprising at least one nucleic acid sequence, the at least one nucleic acid sequence being bound by at least one complementary primary nucleic acid molecule, wherein the complementary primary nucleic acid molecule comprises a first detectable label and at least a second detectable label, wherein each of the at least three attachment positions corresponds to two nucleotides of the at least six nucleotides in the target binding domain, and each of the at least three attachment positions has a different nucleic acid sequence, and wherein the at least first detectable label and the at least second detectable label of each complementary primary nucleic acid molecule bound to each of the at least three attachment positions determine the position and identity of the corresponding two nucleotides of the at least six nucleotides bound by the target binding domain in the target nucleic acid. The at least two nucleotides in the target binding domain that do not identify the corresponding nucleotides in the target nucleic acid molecule can be any of the four canonical bases that are not specific to the target determined by the at least six nucleotides in the target binding domain, or universal bases or degenerate bases.

[0222] In some aspects, at least one nucleotide in the target binding domain that does not identify a corresponding nucleotide in the target nucleic acid molecule can be before a nucleotide in the target binding domain that identifies a corresponding nucleotide in the target nucleic acid molecule. In some aspects, at least one nucleotide in the target binding domain that does not identify a corresponding nucleotide in the target nucleic acid can be after a nucleotide in the target binding domain that identifies a corresponding nucleotide in the target nucleic acid molecule.

[0223] In other aspects, an exemplary target binding domain can comprise at least six nucleotides capable of hybridizing to a target nucleic acid, wherein the at least six nucleotides in the target binding domain are capable of identifying corresponding (complementary) nucleotides in the target nucleic acid molecule; wherein none of the at least six nucleotides in the target binding domain, or any one of the at least six nucleotides, can be a modified nucleotide or a nucleotide analog.

[0224] In aspects comprising a sequencing probe and a primary nucleic acid molecule, the present disclosure also provides a sequencing probe comprising a target binding domain and a barcode domain; wherein the target binding domain comprises at least ten nucleotides and is capable of binding to a target nucleic acid, wherein at least six nucleotides in the target binding domain are capable of identifying corresponding (complementary) nucleotides in the target nucleic acid molecule, and wherein at least four nucleotides in the target binding domain do not identify corresponding nucleotides in the target nucleic acid molecule; wherein the barcode domain comprises a synthetic backbone, the barcode domain comprising at least three attachment positions, each attachment position comprising at least one attachment region comprising at least one nucleic acid sequence, the at least one nucleic acid sequence being bound by at least one complementary primary nucleic acid molecule, wherein the complementary primary nucleic acid molecule comprises a first detectable label and at least a second detectable label, wherein each of the at least three attachment positions corresponds to two nucleotides of the at least six nucleotides in the target binding domain, and each of the at least three attachment positions has a different nucleic acid sequence, wherein the at least first detectable label and the at least second detectable label of each complementary primary nucleic acid molecule bound to each of the at least three attachment positions determines the position and identity of corresponding two nucleotides of the at least six nucleotides bound by the target binding domain in the target nucleic acid.

[0225] In aspects comprising a sequencing probe, a primary nucleic acid molecule, and a secondary nucleic acid molecule, the disclosure provides a sequencing probe comprising a target binding domain and a barcode domain; wherein the target binding domain comprises any of the constructs described in Table 1. An exemplary target binding domain comprises at least eight nucleotides and is capable of hybridizing to a target nucleic acid, wherein at least six nucleotides in the target binding domain are capable of identifying a corresponding (complementary) nucleotide in a target nucleic acid molecule, and wherein at least two nucleotides in the target binding domain do not identify a corresponding nucleotide in a target nucleic acid molecule; wherein any of the at least six nucleotides in the target binding domain may be a modified nucleotide or a nucleotide analog, and wherein at least two nucleotides in the target binding domain that do not identify a corresponding nucleotide in a target nucleic acid molecule may be any of the four canonical bases that are not specific to a target determined by the at least six nucleotides in the target binding domain, or a universal base or a degenerate base. An exemplary barcode domain comprises a synthetic backbone comprising at least three attachment locations, each attachment location comprising at least one attachment region comprising at least one nucleic acid sequence that is bound by at least one complementary primary nucleic acid molecule, wherein the complementary primary nucleic acid molecule is further bound by at least one complementary secondary nucleic acid molecule that comprises a first detectable label and at least a second detectable label, wherein each of the at least three attachment locations corresponds to two nucleotides of at least six nucleotides in the target binding domain, and each of the at least three attachment locations has a different nucleic acid sequence, and wherein the at least first detectable label and the at least second detectable label of each complementary secondary nucleic acid molecule bound to each of the at least three attachment locations determine the position and identity of corresponding two nucleotides of the at least six nucleotides bound by the target binding domain in the target nucleic acid.

[0226] In other aspects, an exemplary target binding domain can comprise at least six nucleotides capable of hybridizing to a target nucleic acid, wherein the at least six nucleotides in the target binding domain are capable of identifying corresponding (complementary) nucleotides in the target nucleic acid molecule; wherein none of the at least six nucleotides in the target binding domain, or any one of the at least six nucleotides, can be a modified nucleotide or a nucleotide analog.

[0227] In aspects comprising a sequencing probe, a primary nucleic acid molecule, and a secondary nucleic acid molecule, the disclosure also provides a sequencing probe comprising a target binding domain and a barcode domain; wherein the target binding domain comprises at least ten nucleotides and is capable of binding to a target nucleic acid, wherein at least six nucleotides in the target binding domain are capable of identifying a corresponding (complementary) nucleotide in a target nucleic acid molecule, and wherein at least four nucleotides in the target binding domain do not identify a corresponding nucleotide in a target nucleic acid molecule; wherein the barcode domain comprises a synthetic backbone, the barcode domain comprising at least three attachment sites, each attachment site comprising at least one attachment region comprising at least one nucleic acid sequence, the at least one nucleic acid sequence being at least one complementary primary nucleic acid molecule is bound, wherein the complementary primary nucleic acid molecule is further bound by at least one complementary secondary nucleic acid molecule, the complementary secondary nucleic acid molecule comprising a first detectable label and at least a second detectable label, wherein each of the at least three attachment positions corresponds to two nucleotides of the at least six nucleotides in the target binding domain, and the at least three attachment positions each have a different nucleic acid sequence, wherein the at least first detectable label and the at least second detectable label of each complementary secondary nucleic acid molecule bound to each of the at least three attachment positions determine the position and identity of corresponding two nucleotides of the at least six nucleotides in the target nucleic acid bound by the target binding domain.

[0228] In aspects comprising a sequencing probe, a primary nucleic acid molecule, a secondary nucleic acid molecule, and a tertiary nucleic acid molecule, the disclosure provides a sequencing probe comprising a target binding domain and a barcode domain; wherein the target binding domain comprises any of the constructs described in Table 1. An exemplary target binding domain comprises at least eight nucleotides and is capable of hybridizing to a target nucleic acid, wherein at least six nucleotides in the target binding domain are capable of identifying a corresponding (complementary) nucleotide in a target nucleic acid molecule, and wherein at least two nucleotides in the target binding domain do not identify a corresponding nucleotide in a target nucleic acid molecule; wherein any of the at least six nucleotides in the target binding domain may be a modified nucleotide or a nucleotide analog, and wherein at least two nucleotides in the target binding domain that do not identify a corresponding nucleotide in a target nucleic acid molecule may be any of the four canonical bases that are not specific to a target determined by the at least six nucleotides in the target binding domain, or a universal base or a degenerate base. An exemplary barcode domain comprises a synthetic backbone comprising at least three attachment sites, each attachment site comprising at least one attachment region comprising at least one nucleic acid sequence that is bound by at least one complementary primary nucleic acid molecule, wherein the complementary primary nucleic acid molecule is further bound by at least one complementary secondary nucleic acid molecule, and wherein the at least one complementary secondary nucleic acid molecule is further bound by at least one complementary tertiary nucleic acid molecule that comprises a first detectable label and at least a second detectable label, wherein each of the at least three attachment sites corresponds to two nucleotides of the at least six nucleotides in the target binding domain, and each of the at least three attachment sites has a different nucleic acid sequence, and wherein the at least first detectable label and the at least second detectable label of each complementary tertiary nucleic acid molecule bound to each of the at least three attachment sites determines the position and identity of corresponding two nucleotides of the at least six nucleotides bound by the target binding domain in the target nucleic acid.

[0229] In other aspects, an exemplary target binding domain can comprise at least six nucleotides capable of hybridizing to a target nucleic acid, wherein the at least six nucleotides in the target binding domain are capable of identifying corresponding (complementary) nucleotides in the target nucleic acid molecule; wherein none of the at least six nucleotides in the target binding domain, or any one of the at least six nucleotides, can be a modified nucleotide or a nucleotide analog.

[0230] In aspects comprising a sequencing probe, a primary nucleic acid molecule, a secondary nucleic acid molecule, and a tertiary nucleic acid molecule, the disclosure also provides a sequencing probe comprising a target binding domain and a barcode domain; wherein the target binding domain comprises at least ten nucleotides and is capable of binding to a target nucleic acid, wherein at least six nucleotides in the target binding domain are capable of identifying a corresponding (complementary) nucleotide in a target nucleic acid molecule, and wherein at least four nucleotides in the target binding domain do not identify a corresponding nucleotide in a target nucleic acid molecule; wherein the barcode domain comprises a synthetic backbone, the barcode domain comprising at least three attachment sites, each attachment site comprising at least one attachment region comprising at least one nucleic acid sequence, the at least one nucleic acid sequence being bound by at least one complementary primary nucleic acid molecule, wherein the complementary primary nucleic acid molecule is further bound by at least one complementary secondary nucleic acid molecule, and wherein the at least one complementary secondary nucleic acid molecule is further bound by at least one complementary tertiary nucleic acid molecule, the complementary tertiary nucleic acid molecules comprising a first detectable label and at least a second detectable label, wherein each of the at least three attachment positions corresponds to two nucleotides of the at least six nucleotides in the target binding domain, and the at least three attachment positions each have a different nucleic acid sequence, wherein the at least first detectable label and the at least second detectable label of each complementary tertiary nucleic acid molecule bound to each of the at least three attachment positions determine the position and identity of corresponding two nucleotides of the at least six nucleotides in the target nucleic acid bound by the target binding domain.

[0231] The disclosure also provides sequencing probes and reporter probes that all have detectable labels on both secondary nucleic acid molecules and tertiary nucleic acid molecules.For example, the secondary nucleic acid molecule can be in conjunction with the primary nucleic acid molecule, and the secondary nucleic acid molecule can comprise the first detectable label and at least the second detectable label, and also be combined with at least one tertiary molecule that comprises the first detectable label and at least the second detectable label.The first detectable label and at least the second detectable label that are positioned at the secondary nucleic acid molecule can have the same emission spectrum, or can have different emission spectra.The first detectable label and at least the second detectable label that are positioned at the tertiary nucleic acid molecule can have the same emission spectrum, or can have different emission spectra.The emission spectrum of the detectable label on the secondary nucleic acid molecule can be identical or different with the emission spectrum of the detectable label on the tertiary nucleic acid molecule.

[0232] Figure 4is an illustrative schematic diagram of an exemplary reporter probe of the present disclosure, the reporter probe comprising an exemplary primary nucleic acid molecule, a secondary nucleic acid molecule, and a tertiary nucleic acid molecule. At the 3' end, the primary nucleic acid comprises a first domain, wherein the first domain comprises a twelve nucleotide sequence that hybridizes to a complementary attachment region within the attachment position of the sequencing probe barcode domain. At the 5' end is a second domain that hybridizes to six secondary nucleic acid molecules. The depicted exemplary secondary nucleic acid molecule in turn comprises a first domain that hybridizes to the primary nucleic acid molecule in the 5' end, and a domain that hybridizes to five tertiary nucleic acid molecules in the 3' portion.

[0233] The tertiary nucleic acid molecule comprises at least two domains. The first domain can be combined with the secondary nucleic acid molecule. The second domain of the tertiary nucleic acid can be combined with the first detectable label and at least the second detectable label. By directly incorporating one or more fluorescently labeled nucleotide monomers into the sequence of the second domain of the tertiary nucleic acid, the second domain of the tertiary nucleic acid can be combined with the first detectable label and at least the second detectable label. By hybridizing the short polynucleotides of the label with the second domain of the secondary nucleic acid, the second domain of the secondary nucleic acid molecule can be combined with the first detectable label and at least the second detectable label. These short polynucleotides called "labeled oligonucleotides" can be labeled by directly incorporating fluorescently labeled nucleotide monomers or by other methods of labeled nucleic acids known to those skilled in the art. Figure 4 The exemplary tertiary nucleic acid molecule depicted in (which may be considered a "labeled oligonucleotide") comprises a first domain that hybridizes to a secondary nucleic acid molecule and a second domain that is fluorescently labeled by indirect attachment of a label during oligonucleotide synthesis using, for example, NHS chemistry, or by incorporation of one or more fluorescently labeled nucleotide monomers during synthesis of the tertiary nucleic acid molecule. The labeled oligonucleotide may be DNA, RNA, or PNA.

[0234] The labeled oligonucleotide may comprise a cleavable linker between the fluorescent moiety and the polynucleotide molecule. Preferably, the cleavable linker is photocleavable. The cleavable linker may also be chemically or enzymatically cleavable.

[0235] In alternative aspect, the second domain of secondary nucleic acid can be combined with the first detectable label and at least the second detectable label.In the sequence of the second domain of secondary nucleic acid directly mixed by one or more fluorescently-labeled nucleotide monomers, the second domain of secondary nucleic acid can be combined with the first detectable label and at least the second detectable label.By making the short polynucleotide of mark hybridize with the second domain of secondary nucleic acid, the second domain of secondary nucleic acid molecule can be combined with the first detectable label and at least the second detectable label.These short polynucleotides called the oligonucleotide of mark can be marked by directly mixing fluorescently-labeled nucleotide monomers or by other methods of labeled nucleic acid well known by persons skilled in the art.

[0236] The primary nucleic acid molecule may comprise about 100, about 95, about 90, about 85, about 80, or about 75 nucleotides. The primary nucleic acid molecule may comprise about 100 to about 80 nucleotides. The primary nucleic acid molecule may comprise about 90 nucleotides. The secondary nucleic acid molecule may comprise about 90, about 85, about 80, about 75, or about 70 nucleotides. The secondary nucleic acid molecule may comprise about 90 to about 80 nucleotides. The secondary nucleic acid molecule may comprise about 87 nucleotides. The secondary nucleic acid molecule may comprise about 25, about 20, about 15, or about 10 nucleotides. The tertiary nucleic acid molecule may comprise about 20 to about 10 nucleotides. The tertiary nucleic acid molecule may comprise about 15 nucleotides.

[0237] The reporter probes of the present disclosure can have various designs. For example, a primary nucleic acid molecule can hybridize with at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) secondary nucleic acid molecule. Each secondary nucleic acid molecule can hybridize with at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) tertiary nucleic acid molecule. In order to produce a reporter probe labeled with a specific two-color combination, the reporter probe is designed so that the probe comprises a secondary nucleic acid molecule, a tertiary nucleic acid molecule, a labeled oligonucleotide, or any combination of a secondary nucleic acid molecule, a tertiary nucleic acid molecule, and a labeled oligonucleotide, which is labeled with each color of a specific two-color combination. For example, Figure 4 Depicted is a reporter probe of the present disclosure comprising a total of 30 dyes, 15 of which are used for color 1 and 15 of which are used for color 2. To prevent color exchange or cross-hybridization between different fluorescent dyes, each tertiary nucleic acid or labeled oligonucleotide bound to a specific label or fluorescent dye comprises a unique nucleotide sequence.

[0238] In some aspects, the disclosure provides a 5x5 reporter probe. The 5x5 reporter probe comprises a primary nucleic acid, wherein the primary nucleic acid comprises a first domain of 12 nucleotides. The primary nucleic acid also comprises a second domain, wherein the second domain comprises a nucleotide sequence that can hybridize with 5 secondary nucleic acid molecules. Each secondary nucleic acid comprises such a nucleotide sequence that 5 tertiary nucleic acids bound by a detectable label can hybridize with each secondary nucleic acid.

[0239] In some aspects, the disclosure provides a 4x3 reporter probe. The 4x3 reporter probe comprises a primary nucleic acid, wherein the primary nucleic acid comprises a first domain of 12 nucleotides. The primary nucleic acid also comprises a second domain, wherein the second domain comprises a nucleotide sequence that can hybridize with four secondary nucleic acid molecules. Each secondary nucleic acid comprises such a nucleotide sequence that three tertiary nucleic acids combined with a detectable label can hybridize with each secondary nucleic acid.

[0240] In some aspects, the disclosure provides 3x4 reporter probes. The 3x4 reporter probe comprises a primary nucleic acid, wherein the primary nucleic acid comprises a first domain of 12 nucleotides. The primary nucleic acid also comprises a second domain, wherein the second domain comprises a nucleotide sequence that can hybridize with three secondary nucleic acid molecules. Each secondary nucleic acid comprises such a nucleotide sequence that four tertiary nucleic acids combined with a detectable label can hybridize with each secondary nucleic acid.

[0241] In some aspects, the disclosure provides a spacer 3x4 reporter probe. The spacer 3x4 reporter probe comprises a primary nucleic acid, wherein the primary nucleic acid comprises a first domain of 12 nucleotides. Between the first domain and the second domain of the primary nucleic acid is a spacer region consisting of 20 to 40 nucleotides. The spacer is identified as 20 to 40 nucleotides long; however, the length of the spacer is non-restrictive, and it can be shorter than 20 nucleotides or longer than 40 nucleotides. The second domain of the primary nucleic acid comprises a nucleotide sequence that can hybridize with 3 secondary nucleic acid molecules. Each secondary nucleic acid comprises such a nucleotide sequence that the 4 tertiary nucleic acids combined with a detectable label can hybridize with each secondary nucleic acid.

[0242] In some aspects, the primary nucleic acid can include a first domain that is 12 nucleotides long. However, the length of the first domain of the primary nucleic acid is unrestricted and can be less than 12 or more than 12 nucleotides. In one example, the first domain of the primary nucleic acid is 14 nucleotides. In another example, the first domain of the primary nucleic acid is 9 nucleotides. In a further example, the first domain of the primary nucleic acid is 8 nucleotides. Exemplary sequences of 9 nucleotide first domains of the primary nucleic acid of the reporter probe include those in Table 15.

[0243] Table 15

[0244] Report object location 9-mer sequence color Report object location 9-mer sequence color 1 CATTGGGTT BB 2 CGGGGTTTA GR 1 CTGGTATGT BG 2 CAAATTGGT GY 1 CAGTGAGTG BR 2 CGAAGTGGT RR 1 CAGGAAGGT BY 2 CTGTTAGGG Y 1 CGATGGATG GG 2 CGTGTTGTG YY 1 CGGTGGAAT GR 3 CTTTGGTTT BB 1 CAAAAGAGG GY 3 CGAGTGGGA BG 1 CAGGAGAAA RR 3 CTAGTAGGG BR 1 CAAGGGTAG Y 3 CTTTGTGTT BY 1 CGAGATGAG YY 3 CATGGGGTG GG 2 CTTGTGATG BB 3 CGAAGTTGA GR 2 CGGGTTAGA BG 3 CGGTGATTT GY 2 CGTATGGTT BR 3 CTATTGTGG RR 2 CGATTGGTA BY 3 CTTAGGGAG Y 2 CATGGTGTA GG 3 CGGTGGAGG YY

[0245] Any feature of the specific reporter probe design of the present disclosure can be combined with any feature of another reporter probe design of the present disclosure. For example, a 5x5 reporter probe can be modified to contain a spacer region of about 20 to 40 nucleotides between the complementary nucleic acid and the primary nucleic acid. In another example, a 4x3 reporter probe can be modified so that 4 secondary nucleic acids contain nucleotide sequences that allow 5 tertiary nucleic acids combined with a detectable label to hybridize with each secondary nucleic acid, thereby producing a 4x5 reporter probe.

[0246] Without wishing to be bound by theory, the 5x5 reporter (25) contains more fluorescent labels than the 4x3 reporter (12), and therefore the fluorescence intensity of the 5x5 reporter will be greater. The fluorescence detected in any given field of view FOV is a function of various variables, including the fluorescence intensity of a given reporter probe, and the number of target molecules optionally bound within the FOV. The number of target molecules optionally bound per field of view (FOV) can be 1 to 2.5 million targets per FOV. Typical numbers of bound target molecules per FOV are 20,000 to 40,000, 220,000 to 440,000, or 1 to 2 million target molecules. Typical FOVs are .05 mm 2 Up to 1mm 2 A further example of a common FOV is .05 mm 2 Up to .65mm 2 .

[0247] In some aspects, the present disclosure provides a reporter probe design in which the secondary nucleic acid molecule includes an "extra handle" that is not hybridized with the tertiary nucleic acid molecule and is at the distal end of the primary nucleic acid molecule. In some aspects, the "extra handle" can be 12 nucleotides long ("12-mer"); however, their length is unrestricted and can be less than 12 or more than 12 nucleotides. The "extra handle" can each include the nucleotide sequence of the first domain of the primary nucleic acid molecule to which the secondary nucleic acid molecule hybridizes. Therefore, when the reporter probe includes an "extra handle", the reporter probe can hybridize with the sequencing probe via the first domain of the primary nucleic acid molecule or via the "extra handle". Accordingly, the possibility of the reporter probe combining with the sequencing probe is increased. The "extra handle" design can also improve hybridization kinetics. Without being bound by any theory, the "extra handle" can increase the effective concentration of the complementary nucleic acid of the reporter probe. It is estimated that 5x4 "extra handle" reporter probes produce approximately 4750 fluorescence counts / standard FOV. It is expected that 5x3 "extra handle" reporter probes, 4x4 "extra handle" reporter probes, 4x3 "extra handle" reporter probes, and 3x4 "extra handle" reporter probes will all produce approximately 6000 fluorescence counts per standard FOV. Any reporter probe design of the present disclosure can be modified to include an "extra handle".

[0248] Each secondary nucleic acid molecule of the reporter probe can hybridize to a tertiary nucleic acid molecule, all of which are labeled with the same detectable label. Figure 5 The left figure of depicts a "5x6" reporter probe. The 5x6 reporter probe includes a primary nucleic acid comprising a second domain, wherein the second domain comprises a nucleotide sequence that hybridizes with 6 secondary nucleic acid molecules. Each secondary nucleic acid comprises such a nucleotide sequence that 5 tertiary nucleic acid molecules bound to a detectable label hybridize with each secondary nucleic acid. The 5 tertiary nucleic acid molecules bound to a particular secondary nucleic acid molecule are each labeled with the same detectable label. For example, three secondary nucleic acid molecules bind to a tertiary nucleic acid molecule labeled with a yellow fluorescent dye, while the other three secondary nucleic acids bind to a tertiary nucleic acid molecule labeled with a red fluorescent dye.

[0249] Each secondary nucleic acid molecule of the reporter probe can hybridize to a tertiary nucleic acid molecule that is labeled with a different detectable label. Figure 5The middle figure of depicts a "3x2x6" reporter probe design. The "3x2x6" reporter probe includes a primary nucleic acid comprising a second domain, wherein the second domain comprises a nucleotide sequence that hybridizes to 6 secondary nucleic acid molecules. Each secondary nucleic acid comprises a nucleotide sequence such that 5 tertiary nucleic acids bound to a detectable label hybridize to each secondary nucleic acid. Each secondary nucleic acid binds to both a tertiary nucleic acid molecule labeled with a yellow fluorescent dye and a tertiary nucleic acid molecule labeled with a red fluorescent dye. In this specific example, three secondary nucleic acid molecules bind to two red and three yellow tertiary nucleic acid molecules, while the other three secondary nucleic acid molecules bind to two red and three yellow tertiary nucleic acid molecules. Each secondary nucleic acid molecule can bind to any number of tertiary nucleic acid molecules, which are bound by different detectable labels. In Figure 5 In the middle figure, the tertiary nucleic acid molecules bound to the respective secondary nucleic acid molecules are arranged such that the colors of the labels alternate (i.e., red-yellow-red-yellow-red or yellow-red-yellow-red-yellow).

[0250] In any of the described reporter probe designs, the tertiary nucleic acids labeled with different detectable labels can be arranged in any order along with the secondary nucleic acid. For example, Figure 5 The right figure depicts a "Fret Resistant 3x2x6" reporter probe, which is similar to the 3x2x6 reporter probe design, except for the arrangement (e.g., linear order or grouping) of the red and yellow tertiary nucleic acid molecules along each secondary nucleic acid molecule.

[0251] Figure 6 Describe the more exemplary reporter probe designs of the present disclosure, it includes each secondary nucleic acid molecule combined with different tertiary nucleic acid molecules.Left figure depicts " 6x1x4.5 " reporter probe comprising a primary nucleic acid molecule, wherein the primary nucleic acid molecule comprises the second domain, wherein the second domain comprises the nucleotide sequence hybridized with six secondary nucleic acid molecules.Each secondary nucleic acid molecule is hybridized with five tertiary nucleic acid molecules.Four of the five tertiary nucleic acid molecules hybridized with each secondary nucleic acid molecule are directly marked with the detectable label of the same color.The fifth tertiary nucleic acid indicated as branched tertiary nucleic acid is combined with the oligonucleotide of 5 marks of another color of the dual-color combination.In these six secondary nucleic acids, three of them are combined with the branched tertiary nucleic acid marked with a color (red in this example) of the dual-color combination, and the other three secondary nucleic acids are combined with the branched tertiary nucleic acid marked with another color (yellow in this example) of the dual-color combination.In general, the 6x1x4.5 reporter probe is marked with a total of 54 dyes, 27 dyes of each color. Figure 6The middle panel depicts a "4x1x4.5" reporter probe, which shares the same overall structure as the 6x1x4.5 reporter probe, except that the primary nucleic acid of the 4x1x4.5 reporter probe only binds 4 secondary nucleic acids, making for a total of 36 dyes, 18 of each color.

[0252] The reporter probe can contain the same number of dyes for each color of the two-color combination. The reporter probe can contain a different number of dyes for each color of the two-color combination. The choice of which color has more dye in the reporter probe can be made based on the energy levels of light absorbed by the two dyes. For example, Figure 6 The right figure of depicts a "5x5 energy optimized" reporter probe design. This reporter probe design contains 15 yellow dyes (which have higher energy) and 10 red dyes (which have lower energy). In this example, 15 yellow dyes can constitute the first label, and 10 red dyes can constitute the second label.

[0253] The detectable moiety, label or reporter can be combined with the secondary nucleic acid molecule, the tertiary nucleic acid molecule or the labeled oligonucleotide in various ways, including directly or indirectly attaching a detectable moiety, such as a fluorescent moiety, a colorimetric moiety, etc. Those skilled in the art can consult references related to labeled nucleic acids. Examples of fluorescent moieties include, but are not limited to, yellow fluorescent protein (YFP), green fluorescent protein (GFP), cyan fluorescent protein (CFP), red fluorescent protein (RFP), umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazineamine fluorescein, cyanine, dansyl chloride, phycocyanin, phycoerythrin, etc.

[0254] Fluorescent labels and their attachment to nucleotides and / or oligonucleotides are described in many reviews, including Haugland, Handbook of Fluorescent Probes and Research Chemicals, Ninth Edition (Molecular Probes, Inc., Eugene, 2002); Keller and Manak, DNA Probes, 2nd Edition (Stockton Press, New York, 1993); Eckstein, ed., Oligonucleotides and Analogues: A Practical Approach (IRL Press, Oxford, 1991); and Wetmur, Critical Reviews in Biochemistry and Molecular Biology, 26:227-259 (1991). Specific methodologies suitable for use in the present disclosure are disclosed in the following references for example: U.S. Pat. Nos. 4,757,141; 5,151,507; and 5,091,519. One or more fluorescent dyes can be used as labels for labeled target sequences, for example, as disclosed in U.S. Pat. Nos. 5,188,934 (4,7-dichlorofluorescein dye); 5,366,860 (spectrally resolvable rhodamine dye); 5,847,162 (4,7-dichlororhodamine dye); 4,318,846 (ether-substituted fluorescein dye); 5,800,996 (energy transfer dye); Lee et al. 5,066,580 (xanthine dye); 5,688,648 (energy transfer dye); etc. Labeling can also be performed with quantum dots, as disclosed in the following patents and patent publications: U.S. Patent Nos. 6,322,901; 6,576,291; 6,423,551; 6,251,303; 6,319,426; 6,426,513; 6,444,143; 5,990,479; 6,207,392; 2002 / 0045045; and 2003 / 0017264. As used herein, the term "fluorescent label" includes a signal transduction moiety that transmits information through the fluorescence absorption and / or emission characteristics of one or more molecules. Such fluorescence characteristics include fluorescence intensity, fluorescence lifetime, emission spectral characteristics, energy transfer, and the like.

[0255] Commercially available fluorescent nucleotide analogs that are readily incorporated into nucleotide and / or oligonucleotide sequences include, but are not limited to, Cy3-dCTP, Cy3-dUTP, Cy5-dCTP, Cy5-dUTP (Amersham Biosciences, Piscataway, NJ), fluorescein-12-dUTP, tetramethylrhodamine 6-dUTP, TEXAS RED™-5-dUTP, CASCADE BLUE™-7-dUTP, BODIPY TMFL-14-dUTP, BODIPY TMR-14-dUTP, BODIPY TMTR-14-dUTP, RHODAMINE GREEN™-5-dUTP, OREGON GREENR™ 488-5-dUTP, TEXAS RED™- 12-dUTP, BODIPY TM 630 / 650- 14-dUTP, BODIPY TM 650 / 665- 14-dUTP, ALEXA FLUOR™ 488-5-dUTP, ALEXA FLUOR™ 532-5-dUTP, ALEXA FLUOR™ 568-5-dUTP, ALEXA FLUOR™ 594-5-dUTP, ALEXA FLUOR™ 546- 14-dUTP, Fluorescein-12-UTP, Tetramethylrhodamine-6-UTP, TEXAS RED™-5-UTP, mCherry, CASCADE BLUE™-7-UTP, BODIPY TM FL-14-UTP, BODIPY TMR-14-UTP, BODIPY TM TR-14-UTP, RHODAMINEGREEN™-5-UTP, ALEXA FLUOR™ 488-5-UTP, LEXA FLUOR™ 546- 14-UTP (Molecular Probes, Inc. Eugene, OR) and the like. Alternatively, the above fluorophores and those mentioned herein can be added during oligonucleotide synthesis using, for example, phosphoramidite or NHS chemistry. Protocols for custom synthesis of nucleotides with other fluorophores are known in the art (see, Henegariu et al. (2000) Nature Biotechnol. 18:345). 2-aminopurine is a fluorescent base that can be directly incorporated into the oligonucleotide sequence during synthesis. Nucleic acids can also be stained in advance with intercalating dyes such as DAPI, YOYO-1, ethidium bromide, cyanine dyes (e.g., SYBR Green), and the like.

[0256] Other fluorophores that can be used for post-synthesis attachment include, but are not limited to, ALEXA FLUOR™ 350, ALEXA FLUOR™ 405, ALEXA FLUOR™ 430, ALEXA FLUOR™ 532, ALEXA FLUOR™ 546, ALEXA FLUOR™ 568, ALEXA FLUOR™ 594, ALEXA FLUOR™ 647, BODIPY 493 / 503, BODIPY FL, BODIPY R6G, BODIPY 530 / 550, BODIPY TMR, BODIPY 558 / 568, BODIPY 558 / 568, BODIPY 564 / 570, BODIPY576 / 589, BODIPY 581 / 591, BODIPY TR, BODIPY 630 / 650, BODIPY 650 / 665, Cascade Blue, Cascade Yellow, Dansyl, Lissamine Rhodamine B, Ocean Blue, Oregon Green 488, Oregon Green 514, Pacific Blue, Pacific Orange, Rhodamine 6G, Rhodamine Green, Rhodamine Red, Tetramethylrhodamine, Texas Red (available from Molecular Probes, Inc., Eugene, OR), Cy2, Cy3, Cy3.5, Cy5, Cy5.5, Cy7 (Amersham Biosciences, Piscataway, NJ), etc. FRET tandem fluorophores may also be used, including but not limited to PerCP-Cy5.5, PE-Cy5, PE-Cy5.5, PE-Cy7, PE-Texas Red, APC-Cy7, PE-Alexa dyes (610, 647, and 680), APC-Alexa dyes, etc.

[0257] Metallic silver or gold particles can be used to enhance the signal from fluorescently labeled nucleotide and / or oligonucleotide sequences (Lakowicz et al. (2003) BioTechniques 34:62).

[0258] Other suitable labels for oligonucleotide sequences may include fluorescein (FAM, FITC), digoxigenin, dinitrophenol (DNP), dansyl, biotin, bromodeoxyuridine (BrdU), hexahistidine (6xHis), phospho-amino acids (e.g., P-tyr, P-ser, P-thr), etc. The following hapten / antibody pairs may be used for detection, wherein each antibody is derivatized with a detectable label: biotin / a-biotin, digoxigenin / a-digoxigenin, dinitrophenol (DNP) / a-DNP, 5-carboxyfluorescein (FAM) / a-FAM.

[0259] The detectable labels described herein are spectrally resolvable. "Spectrally resolvable" referring to multiple fluorescent labels means that the fluorescence emission bands of the labels are sufficiently different, i.e., sufficiently non-overlapping, so that the molecular tags to which the respective labels are attached can be distinguished by a standard light detection system based on the fluorescence signals generated by the respective labels, the light detection system, for example, using a system of bandpass filters and photomultiplier tubes, etc., such as by U.S. Patent No. 4,230,558; 4,811,218; etc., or Wheeless et al., Flow Cytometry: Instrumentation and Data Analysis (Academic Press, New York, 1985) The system exemplified on pages 21-76. Spectrally resolvable organic dyes, such as fluorescein, rhodamine, etc., mean that the wavelength emission maxima are spaced apart by at least 20 nm, and in another aspect, spaced apart by at least 40 nm. For chelated lanthanide compounds, quantum dots, etc., spectrally resolvable means that the wavelength emission maxima are spaced apart by at least 10 nm or at least 15 nm.

[0260] There are three attachment sites in the barcode domain, each with up to 10 potential two-color combinations, allowing up to 1000 color combinations. If the reporter probes are combined in less than 1000 probes / pool, the ability to use parity to overcome errors can be exploited. There can be many potential parity schemes that allow parity, Fig.32 An exemplary scheme is shown in . In this example, the actual color present is not used as parity, but a single (S) color reporter probe (e.g., red) and a multicolor (M) reporter probe (e.g., red / yellow) present at each attachment position in the barcode domain are used. As can be seen in the parity design, the knowledge of the state (S or M) of any two reporter positions allows prediction of the third position. In the example shown, observing S in any two positions requires that the unobserved position is M, observing S and M in any two positions means that the other position must be S, and observing two M reporter probes requires that the other position is M. This means that in order to obtain a code for three reporter probes with incorrectly detected reporter colors, incorrect identification must be performed twice. Fig.32 Simulation results at 5% reported probe error are shown, which shows the increase in error filtering when parity is applied. There are multiple parity systems that can be applied, this is just one example.

[0261] Another error correction procedure is to exchange color palettes for each reporter probe pool. Color palettes are the reporter probe sets actually used to measure the pool. Multiple reporter probes are not used in any one pool. If there are 500 reporter probes in the pool, only ½ possible color combinations are needed. The simplest way to achieve this is to have two palettes, palette A containing 500 reporter probes and palette B containing other 500 reporter probes. Therefore, if sequencing pools 1, 3, 5, 7 have palette A, and pools 2, 4, 6, 8 have palette B, then running pools in order 1, 2, 3, 4, 5, 6, 7, 8 means that each sequential sequencing pool has a separate palette. Therefore, the barcode from pool 2 does not exist in the pools before and after (e.g., pools 1 and 3). This allows simple automatic troubleshooting and the limitation of detecting errors.

[0262] The reporter probe may comprise one or more cleavable linker modifications. One or more cleavable linker modifications may be placed at any position in the reporter probe. The cleavable linker modification may be located between the first domain and the second domain of the primary nucleic acid molecule of the reporter probe. The cleavable linker modification may be present between the first domain and the second domain of the secondary nucleic acid molecule of the reporter probe. The cleavable linker modification may be present between the first domain and the second domain of the primary nucleic acid molecule and the secondary nucleic acid molecule of the reporter probe. Figure 7 The left figure of depicts an exemplary reporter probe of the present disclosure, which comprises a cleavable linker modification between the first domain and the second domain of the primary nucleic acid, and between the first domain and the second domain of the secondary nucleic acid. Figure 7 In this case, illustrated in the left figure of , the cleavable linker modification may include one or more cleavable moieties, such as Figure 7 Those illustrated in the left figure of .

[0263] The cleavable linker modifier may be a compound of formula (I) or a stereoisomer or salt thereof:

[0264]

[0265] (I)

[0266] Where: R1 is hydrogen, halogen, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, wherein the C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Each alkynyl group is independently optionally substituted by at least one substituent R 10 Substituted; R2 is O, NH or N(C 1-6 alkyl); R3 is cycloalkyl, heterocycloalkyl, aryl or heteroaryl, each optionally substituted by at least one R10 Substituted; each R4 and R7 is independently C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, wherein the C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Each alkynyl group is independently optionally substituted by at least one substituent R 10 R5 and R9 are each independently cycloalkyl, heterocycloalkyl, aryl or heteroaryl, each optionally substituted by at least one substituent R 10 Substitution; R6 is O, NH or N(C 1-6 alkyl); R8 is O, NH or N(C 1-6 alkyl); each R 10 are independently hydrogen, halogen, -C 1-6 Alkyl, -C 2-6 Alkenyl, -C 2-6 Alkynyl, halo C 1-6 Alkyl, halogenated C 2-6 Alkenyl, halogenated C 2-6 Alkynyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, -CN, -NO2, oxo, -OR 11 、-SO2R 11 、-SO3 - 、-COR 11 、-CO2R 11 、-CONR 11 R 12 、-C(=NR 11 )NR 12 R 13 、-NR 11 R 12 、-NR 12 COR 12 、-NR 11 CONR 12 R 13 、-NR 11 CO2R 12 、-NR 11 SONR 12 R 13 、-NR 11 SO2NR 12 R 13 or -NR 11 S02R 12 ; and can be the same or different R 11 , R 12 and R 13 are independently hydrogen, -C 1-6 Alkyl, -C 2-6 Alkenyl, -C2-6 Alkynyl, halo C 1-6 Alkyl, halogenated C 2-6 Alkenyl, halogenated C 2-6 Alkynyl, C 1- 6 Alkoxy C 1-6 Alkyl-, cycloalkyl-, heterocyclyl-, aryl- or heteroaryl-.

[0267] In one aspect, R1 is C 1-6 Alkyl, preferably C 1-3 Alkyl, for example methyl, ethyl, propyl or isopropyl; R2 is NH or N(C 1-6 alkyl); R3 is a 5- to 6-membered cycloalkyl, preferably a cyclohexyl group; R4 is C 1-6 Alkyl, preferably C 1-3 R5 is a 5- to 6-membered heterocyclic group comprising 1 nitrogen atom and 0 or 1 additional heteroatoms selected from N, O and S, wherein the heterocyclic group is optionally substituted by 1 or 2 R 10 Substitution; R6 is O; R7 is C 1-6 Alkyl, preferably C 1-3 R8 is O; R9 is a 5- to 6-membered heterocyclic group containing 1 nitrogen atom and 0 or 1 additional heteroatom selected from N, O and S, wherein the heterocyclic group is optionally composed of 1 or 2 R 10 Replace; and each R 10 are independently halogen, C 1-6 Alkyl, halogenated C 1-6 Alkyl, oxo, -SO2H or -SO3 - .

[0268] In one aspect, R3 is cyclohexyl, R4 is methylene, R5 is 1H-pyrrole-2,5-dione, and R9 is pyrrolidine-2,5-dione, optionally substituted by SO3 - replace.

[0269] The linker compound can be

[0270] or a stereoisomer or a salt thereof.

[0271] The linker compound can be

[0272] or a stereoisomer or a salt thereof.

[0273] The linker compound or linker modification can be , , or .

[0274] The linker compound or linker modification can be

[0275] .

[0276] The cleavable linker modification or cleavable moiety can be .

[0277] The reporter probe can be assembled by mixing three stock solutions together along with water. One stock solution contains primary nucleic acid molecules, one stock solution contains secondary nucleic acid molecules, and the last stock solution contains tertiary nucleic acid molecules. Table 2 depicts exemplary amounts of each stock solution that can be mixed to assemble a specific reporter probe design.

[0278] Table 2

[0279] Reporter probe design Volume of primary nucleic acid molecule (10 μM stock solution) (μl) Volume of secondary nucleic acid molecule (10 μM stock solution) (μl) Volume of tertiary nucleic acid molecule (10 μM stock solution) (μl) Volume of water (μl) 5x4 1 4.5 2.25 92.25 5x3 1 4.5 1.8 92.7 4x4 1.28 4.5 2.25 91.97 4x3 1.28 4.5 1.8 92.42 3x4 1.8 4.5 2.25 91.45

[0280] Target nucleic acid

[0281] The present disclosure provides methods for sequencing nucleic acids using sequencing probes disclosed herein. Nucleic acids to be sequenced using the methods of the present disclosure are referred to herein as "target nucleic acids". The term "target nucleic acid" shall mean a nucleic acid molecule (DNA, RNA or PNA) whose sequence is to be determined by the probes, methods and apparatus of the present disclosure. In general, the terms "target nucleic acid", "target nucleic acid molecule", "target nucleic acid sequence", "target nucleic acid fragment", "target oligonucleotide" and "target polynucleotide" are used interchangeably and are intended to include, but are not limited to, nucleotides (deoxyribonucleotides or ribonucleotides) or their analogs in polymeric form that may have various lengths. Non-limiting examples of nucleic acids include genes, gene fragments, exons, introns, intergenic DNA (including but not limited to heterochromatic DNA), messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, small interfering RNA (siRNA), non-coding RNA (ncRNA), cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of sequences, isolated RNA of sequences, nucleic acid probes and primers. Prior to sequencing using the methods of the present disclosure, the identity and / or sequence of the target nucleic acid is known. Alternatively, the identity and / or sequence is unknown. It is also possible that a portion of the sequence of the target nucleic acid is known before sequencing using the method of the present disclosure. For example, the method can involve determining point mutations in a known target nucleic acid molecule.

[0282] The present method directly sequences nucleic acid molecules obtained from a sample (e.g., a sample from an organism), and preferably without a conversion (or amplification) step. For example, for direct RNA-based sequencing, the present method does not require the RNA molecule to be converted to a DNA molecule (i.e., via the synthesis of cDNA) before the sequence is obtained. Since no amplification or conversion is required, the nucleic acid sequenced in the present disclosure will retain any unique bases and / or epigenetic markers present in the nucleic acid when the nucleic acid is in the sample or when it is obtained from the sample. Such unique bases and / or epigenetic markers are lost in sequencing methods known in the art.

[0283] The present method can be used to perform sequencing at single molecule resolution. In other words, the present method allows the user to generate a final sequence based on data collected from a single target nucleic acid molecule, rather than having to combine data from different target nucleic acid molecules, preserving any unique features of that particular target.

[0284] Target nucleic acid can be derived from any sample or source of nucleic acid, such as any cell, tissue or organism, in vitro, chemical synthesizer, etc. Target nucleic acid can be obtained by any field-recognized method. Nucleic acid can be obtained from a blood sample of a clinical subject. Methods and kits well known in the art can be used to extract, separate or purify nucleic acid from a source or sample.

[0285] The target nucleic acid can be fragmented by any means known in the art. Preferably, fragmentation is performed by enzymatic or mechanical means. Mechanical means can be ultrasonic treatment or physical shearing. Enzymatic means can be performed by digestion with nucleases (e.g., deoxyribonuclease I (DNase I)) or one or more restriction endonucleases.

[0286] When the nucleic acid molecule comprising the target nucleic acid is an intact chromosome, measures should be taken to avoid fragmenting the chromosome.

[0287] The target nucleic acid may comprise natural or non-natural nucleotides, including modified nucleotides or nucleic acid analogs, as is well known in the art.

[0288] The target nucleic acid molecule can include DNA, RNA and PNA molecules up to hundreds of kilobases in length (e.g., 1, 2, 3, 4, 5, 10, 20, 30, 40, 50, 100, 200, 500 or more kilobases). The target nucleic acid molecule can contain about 50 to about 400 nucleotides, or about 90 to about 350 nucleotides.

[0289] Capture probe

[0290] The target nucleic acid can be immobilized (e.g., at one, two, three, four, five, six, seven, eight, nine, ten, or more locations) to the substrate.

[0291] Exemplary useful substrates include those comprising a binding portion selected from a ligand, an antigen, a carbohydrate, a nucleic acid, a receptor, a lectin, and an antibody. The capture probe comprises a substrate binding portion that can bind to the binding portion of the substrate. Exemplary useful substrates comprising reactive moieties include, but are not limited to, surfaces comprising: epoxy, aldehyde, gold, hydrazide, sulfhydryl, NHS-ester, amine, alkyne, azide, thiol, carboxylate, maleimide, hydroxymethylphosphine, imidoester, isocyanate, hydroxyl, pentafluorophenyl ester, psoralen, pyridyl disulfide or vinyl sulfone, polyethylene glycol (PEG), hydrogel, or a mixture thereof. Such surfaces can be obtained from commercial sources or prepared according to standard techniques. Exemplary useful substrates comprising reactive moieties include, but are not limited to, OptArray-DNA NHS groups (Accler8), Nexterion Slide AL (Schott), and Nexterion Slide E (Schott).

[0292] The substrate can be any solid support known in the art, such as a coated glass slide and a microfluidic device, which can fix the target nucleic acid. The substrate can be a surface, a film, a bead, a porous material, an electrode or an array. For example, the substrate can be a polymeric material, a metal, silicon, glass or quartz. The target nucleic acid can be fixed to any substrate that is apparent to those skilled in the art.

[0293] When the substrate is an array, the substrate may include holes whose size and spacing vary according to the target nucleic acid molecules to be attached. In one example, the substrate is constructed so that an ultra-dense, ordered target nucleic acid array is attached. Examples of target nucleic acid array densities on the substrate include 500,000 to 10,000,000 target nucleic acid molecules / mm 2 , 1,000,000 to 4,000,000 target nucleic acid molecules / mm 2 , or 850,000 to 3,500,000 target nucleic acid molecules / mm 2 .

[0294] The holes in the substrate are locations for the target nucleic acid molecules to attach. The surface of the hole can be functionalized with the above-mentioned reactive moieties to attract and bind specific chemical groups present on the target nucleic acid molecules, or to capture probes bound to the target nucleic acid molecules to attract, fix and bind the target nucleic acid molecules. It is well known that these functional groups can specifically attract and bind biomolecules through various conjugation chemistries.

[0295] For sequencing of single nucleic acid molecules on a substrate such as an array, a universal capture probe or a universal sequence complementary to the substrate binding portion of the capture probe is attached to each well. A single target nucleic acid molecule is then bound to the universal capture probe or a universal sequence complementary to the substrate binding portion of the capture probe to which the capture probe is bound, and sequencing can begin.

[0296] For single nucleic acid molecule sequencing on substrates such as arrays, single target nucleic acid molecules can be combined with capture probes. The substrate binding portion of the capture probe can then be combined with adapter oligonucleotides. The adapter nucleotides are then combined with lawn oligonucleotides attached to each hole, and sequencing can begin. An exemplary sequence of lawn oligonucleotides has been shown in Table 8.

[0297] Table 8

[0298]

[0299] 5amMC6 = 5' amine with 6-carbon linker; isodG = isoguanine; 3AmMO = 3' ; 5[Biotin-TEG] = 5'Biotin-TEG

[0300] Each nucleic acid comprising lawn oligonucleotides or adapter oligonucleotides can independently be a canonical base or a modified nucleotide or nucleic acid analog. Common modified nucleotides or nucleic acid analogs that can be used in lawn oligonucleotides or adapter oligonucleotides are isoguanine and isocytosine. Alternatively, each nucleic acid comprising lawn oligonucleotides can independently be L-DNA. In some aspects, lawn oligonucleotides can comprise L-DNA. Lawn oligonucleotides can consist of L-DNA. Lawn oligonucleotides can consist essentially of L-DNA. For example, the use of modified nucleotides or nucleotide analogs such as isoguanine and isocytosine or L-DNA can improve the binding efficiency and accuracy of the adapter oligonucleotide to the appropriate complementary nucleic acid sequence in the lawn oligonucleotide, while minimizing the binding elsewhere.

[0301] The lawn oligonucleotide may further comprise a 5' amine with a 6 carbon linker referred to herein as 5AmMC6. 5AmMC6 may be used to attach the lawn oligonucleotide to a substrate.

[0302] Examples of capture probe, adapter oligonucleotide, and lawn oligonucleotide complexes are shown in Fig.33In this figure, the hybridized exemplary adapter sequence and exemplary capture probe sequence are in green, the sequence which is the reverse complement of the exemplary lawn oligonucleotide is in blue, and the exemplary sequence in red on the capture probe hybridizes to the target gene, which in this example is the gene TP53.1. The sequence of the exemplary capture probe is 3'-CCGGTCAACCGTTTTGTAGAACAACTCCCGTCCCCTCACTCACTAGCCTCCAGTACCGAAAGC-5' (SEQ ID No: 111). The sequence of the exemplary adapter sequence is 5'-GAGTGATCGGAGGTCATGGCTTTCGAC / iMe-isodC / CTA / iMe-isodC / AAA / iMe-isodC / TCA / iMe-isodC / TA / iMe-isodC / TA / iMe-isodC / CAA / iMe-isodC / AAC / iMe-isodC / TCA / iMe-isodC / CA-3' (SEQ ID No: 110). The sequence of an exemplary lawn oligonucleotide is TG / iisodG / GAT / iisodG / TTT / iisodG / AGT / iisodG / AT / iisodG / AT / iisodG / GTT / iisodG / TTG / iisodG / AGT / iisodG / GT / 5AmMC6 (SEQ ID NO: 108).

[0303] In some aspects, the lawn oligonucleotide can comprise at least one affinity moiety, at least two affinity moieties, at least three affinity moieties, at least four affinity moieties, at least five affinity moieties, at least six affinity moieties, at least seven affinity moieties, at least eight affinity moieties, at least nine affinity moieties, or at least ten affinity moieties. The affinity moiety can be biotin. Thus, the lawn oligonucleotide can comprise at least one biotin moiety, at least two biotin moieties, at least three biotin moieties, at least four biotin moieties, at least five biotin moieties, at least six biotin moieties, at least seven biotin moieties, at least eight biotin moieties, at least nine biotin moieties, or at least ten biotin moieties.

[0304] In some aspects, the capture probe of the present disclosure hybridized with the target nucleic acid can include at least one first affinity moiety, such as but not limited to a biotin moiety. Then, the capture probe hybridized with the target nucleic acid can be directly or indirectly hybridized with at least one lawn oligonucleotide on the substrate, wherein the at least one lawn oligonucleotide includes at least one first affinity moiety, such as but not limited to a biotin moiety. After the capture probe is hybridized with the lawn oligonucleotide, the resulting capture probe-target nucleic acid-lawn oligonucleotide complex can be incubated with a second affinity moiety, wherein the second affinity moiety is capable of binding to the first affinity moiety located on the capture probe and the first affinity moiety located on the lawn oligonucleotide. In a non-limiting example, if the first affinity moiety located on the capture probe and the first affinity moiety located on the lawn oligonucleotide are both biotin, then neutral avidin can be used as the second affinity moiety. The second affinity moiety will bind to the first affinity moiety located on the capture probe and the first affinity moiety located on the lawn oligonucleotide, producing a protein bridge referred to herein as a "protein lock". The protein lock can be used to more stably fix the target nucleic acid to the substrate. Fig.67 Schematic diagram of protein lock using biotinylated capture probes and lawn oligonucleotides and neutravidin is shown.

[0305] The target nucleic acid can be bound by one or more capture probes (i.e., two, three, four, five, six, seven, eight, nine, ten or more capture probes). The capture probe comprises a domain complementary to a portion of the target nucleic acid, and a domain comprising a substrate binding portion. The portion of the target nucleic acid to which the capture probe is complementary can be an end of the target nucleic acid or not toward the end. The capture probe can include a cleavable portion between a domain complementary to a portion of the target nucleic acid and a domain comprising a substrate binding portion.

[0306] Alternatively, the capture probe may comprise a first domain complementary to a portion of the target nucleic acid, a second domain comprising a substrate binding moiety, and a third domain comprising a different substrate binding moiety.The capture probe may comprise a cleavable portion between any of the domains.

[0307] The capture probe may be phosphorylated at the 5' end. Alternatively, the capture probe may comprise at least one phosphorothioate bond. The capture probe may comprise at least two phosphorothioate bonds. Preferably, at least one or at least two phosphorothioate bonds are located at the 5' end of the capture probe.

[0308] The substrate binding portion of the capture probe can be biotin, and the substrate can be avidin (e.g., streptavidin). Useful substrates containing avidin are commercially available, including TB0200 (Accelr8), SAD6, SAD20, SAD100, SAD500, SAD2000 (Xantec), SuperAvidin (Array-It), streptavidin slides (catalog # MPC 000, Xenopore) and STREPTAVIDINn slides (catalog # 439003, Greiner Bio-one). The substrate binding portion of the capture probe can be avidin (e.g., streptavidin), and the substrate can be biotin. Commercially available useful substrates containing biotin include, but are not limited to, Optiarray-biotin (Accler8), BD6, BD20, BD100, BD500, and BD2000 (Xantec).

[0309] The substrate binding portion of the capture probe can be a reactive portion capable of binding to the substrate by photoactivation. The substrate can include a photoreactive portion, or the first portion of the nanoreporter can include a photoreactive portion. Some examples of photoreactive portions include aryl azides, such as N-((2-pyridyldithio)ethyl)-4-azido salicylamide; fluorinated aryl azides, such as 4-azido-2,3,5,6-tetrafluorobenzoic acid; benzophenone-based reagents, such as succinimidyl ester of 4-benzoylbenzoic acid; and 5-bromo-deoxyuridine.

[0310] The substrate binding portion of the capture probe can be a nucleic acid that can hybridize with the binding portion of the complementary substrate. Each nucleic acid that comprises the substrate binding portion of the capture probe can independently be a canonical base or a modified nucleotide or nucleic acid analog. At least one, at least two, at least three, at least four, at least five or at least six nucleotides in the substrate binding portion of the capture probe can be a modified nucleotide or nucleotide analog. The usual ratio of modified nucleotides or nucleotide analogs to canonical bases in the substrate binding portion of the capture probe is 1:2 to 1:8. Common modified nucleotides or nucleic acid analogs that can be used in the substrate binding portion of the capture probe are isoguanine and isocytosine.

[0311] The substrate binding portion of the capture probe can be fixed to the substrate via other binding pairs that are obvious to those skilled in the art. After binding to the substrate, the target nucleic acid can be elongated by applying a force (e.g., gravity, hydrodynamic force, electromagnetic force "electrostretching", flow stretching, receding meniscus technology and combinations thereof) sufficient to extend the target nucleic acid. The capture probe can include or be associated with a detectable label, i.e., a reference site.

[0312] The target nucleic acid can be bound by a second capture probe comprising a domain complementary to a second portion of the target nucleic acid. The second portion of the target nucleic acid bound by the second capture probe is different from the first portion of the target nucleic acid bound by the first capture probe. The portion can be an end of the target nucleic acid or not toward the end. The binding of the second capture probe can occur after or during the elongation of the target nucleic acid, or to a target nucleic acid that has not yet been elongated. The second capture probe can have a binding as described above.

[0313] The target nucleic acid can be bound by a third, fourth, fifth, sixth, seventh, eighth, ninth or tenth capture probe, which comprises a domain complementary to a third, fourth, fifth, sixth, seventh, eighth, ninth or tenth portion of the target nucleic acid. The portion can be the end of the target nucleic acid or not toward the end. The binding of the third, fourth, fifth, sixth, seventh, eighth, ninth or tenth capture probe can occur after or during the elongation of the target nucleic acid, or to a target nucleic acid that has not yet been elongated. The third, fourth, fifth, sixth, seventh, eighth, ninth or tenth capture probe can have a binding as described above.

[0314] Capture probe can separate target nucleic acid from sample.Here, capture probe is added to the sample containing target nucleic acid.Capture probe binds target nucleic acid via the region of capture probe complementary to the region of target nucleic acid.When target nucleic acid contacts the substrate containing the part of substrate binding portion binding capture probe, nucleic acid becomes fixed to substrate.

[0315] Figure 8Target nucleic acid capture using a dual capture probe system of the present disclosure is shown. Genomic DNA is denatured at 95°C and hybridized with a capture reagent pool. The capture reagent pool comprises oligonucleotide probe A, probe B, and an antisense blocking probe. Probe A comprises a biotin moiety at the 3' end of the probe, and a sequence complementary to the 5' end of the target nucleic acid. Probe B comprises a purification binding sequence that can be bound by paramagnetic beads at the 5' end of the probe, and a nucleotide sequence complementary to the 3' end of the target nucleic acid. The antisense blocking probe comprises a nucleotide sequence complementary to the antisense strand of a portion of the target nucleic acid to be sequenced. After hybridization with the capture reagent, a sequencing window is generated on the target nucleic acid between the hybridized probe A and probe B. The target nucleic acid is purified using paramagnetic beads bound to the 5' sequence of probe B. Any excess capture reagent or complementary antisense DNA strand is washed off, resulting in purification of the desired target nucleic acid. The purified target nucleic acid is then flowed through a flow chamber comprising a surface, such as streptavidin, that can bind to the biotin moiety on the hybridized probe A. This results in one end of the target nucleic acid being tethered to the surface of the flow chamber. To capture the other end, the target nucleic acid is flow stretched and a biotinylated probe complementary to the purified binding sequence of probe B is added. After hybridization with the purified binding sequence of probe B, the biotinylated probe can bind to the surface of the flow chamber, resulting in the captured target nucleic acid molecule being elongated and bound to the flow chamber surface at both ends.

[0316] In order to ensure that the user "captures" as many target nucleic acid molecules as possible from a highly fragmented sample, it is helpful to include a variety of capture probes, each of which is complementary to different regions of the target nucleic acid. For example, there may be 3 capture probe pools, wherein the first pool is complementary to the region of the target nucleic acid close to its 5' end, the second pool is complementary to the middle region of the target nucleic acid, and the third pool is complementary to the region close to the 3' end. This can be analogized to the "n target regions" of each target nucleic acid. In this example, each individual pool of fragmented target nucleic acid is combined with a capture probe containing or in combination with a biotin label. For each pool chamber, 1 / n (where n = the number of different regions in the target nucleic acid) of the input sample is divided. The capture probe binds the target nucleic acid of interest. The target nucleic acid is then fixed to the avidin molecule adhered to the substrate via the biotin of the capture probe. Optionally, the target nucleic acid is stretched, for example, via flow or electrostatic force. All n pools can be stretched and bound simultaneously, or, to maximize the number of fully stretched molecules, pool 1 (which captures the 5'-most region) can be stretched and bound first; then pool 2 (which captures the middle region of the target) can be stretched and bound; and finally pool 3 can be stretched and bound.

[0317] The target nucleic acid can be captured using the "two-bead-based step purification" system of the present disclosure. There are four capture probes: probe A, probe B, probe C, and probe D. Probe A comprises an OA sequence, a nucleic acid sequence complementary to the 5' end of the target nucleic acid, and a nucleic acid sequence attached to a biotin portion. The OA sequence can comprise the nucleotide sequence CGAAAGCCATGACCTCCGATCACTC (SEQ ID NO: 109) and can bind to a lawn oligonucleotide. The nucleic acid sequence attached to the biotin portion is connected to the nucleic acid sequence complementary to the 5' end of the target nucleic acid via a cleavable linker. Probe B and probe C comprise a nucleic acid sequence complementary to the target nucleic acid, and a nucleic acid sequence attached to the biotin portion. The nucleic acid sequence attached to the biotin portion is connected to the nucleic acid sequence complementary to the target nucleic acid via a cleavable linker. Probe D comprises a nucleic acid sequence complementary to the 3' end of the target nucleic acid, a purification binding sequence called the G sequence, and a biotin portion. The biotin portion is connected to the G sequence via a cleavable linker. The four capture probes are first hybridized to the target nucleic acid. All probes hybridize at non-overlapping positions along the target nucleic acid, with probe B and probe C hybridizing between probe A and probe D. The target nucleic acid is then purified using streptavidin paramagnetic beads, which bind to the biotin portion on the capture probe. Excess non-target genomic DNA is washed away from the beads. The target nucleic acid-capture probe complex is then released from the streptavidin magnetic beads by cutting the cleavable linker within each capture probe. The target nucleic acid-capture probe complex is further purified using paramagnetic beads that bind to the purified G sequence on probe D. Excess capture probe is washed away, and the target nucleic acid-capture probe complex is eluted from the paramagnetic beads.

[0318] The "single bead-based step purification with lambda exonuclease" system of the present disclosure can be used to capture target nucleic acids. There are four capture probes: probe A, probe B, probe C, and probe D. Probe A contains a sequence complementary to the 5' end of the target nucleic acid sequence. The 5' end of probe A contains two thiophosphate bonds. Probe B, probe C, and probe D contain a nucleic acid sequence attached to a biotin moiety at the 3' end of the probe, and a nucleic acid sequence complementary to the target nucleic acid at the 5' end of the probe. The 5' ends of probes B, probe C, and probe D are phosphorylated. Probe A, probe B, probe C, and probe D hybridize along the target nucleic acid at non-overlapping positions. After the probes hybridize with the target nucleic acid, the target nucleic acid is purified using streptavidin paramagnetic beads. Excess gDNA and capture probes are washed off. The target nucleic acid-capture probe complex is eluted from the beads. Probe B, probe C, and probe D are then digested using lambda exonuclease, which preferentially degrades double-stranded DNA phosphorylated at the 5' end.

[0319] The target nucleic acid can be captured using the "single bead-based step purification with FEN1" system of the present disclosure. There are four capture probes: probe A, probe B, probe C, and probe D. Probe A comprises a 3' nucleic acid sequence that does not hybridize with the target nucleic acid, a nucleic acid sequence that is complementary to the 5' end of the nucleic acid, and a 5' nucleic acid sequence that does not hybridize with the target nucleic acid and comprises a biotin moiety. Probes B and probe C comprise a 3' nucleic acid sequence that does not hybridize with the target nucleic acid, a nucleic acid sequence that is complementary to the target nucleic acid, and a 5' nucleic acid sequence that does not hybridize with the target nucleic acid and comprises a biotin moiety. Probe D comprises a 3' sequence that does not hybridize with the target nucleic acid and a 5' sequence that is complementary to the target nucleic acid. Probe A, probe B, probe C and probe D are hybridized with the target nucleic acid, so that probe A is adjacent to probe B, so that probe A does not hybridize with the target nucleic acid sequence and contains a 5' nucleic acid sequence of the biotin moiety, and probe B does not hybridize with the target nucleic acid on the 3' nucleic acid sequence, forming a branched double-stranded DNA substrate with a 5' DNA flap, and probe B is adjacent to probe C, so that probe B does not hybridize with the target nucleic acid sequence and contains a 5' nucleic acid sequence of the biotin moiety, and probe C does not hybridize with the target nucleic acid on the 3' nucleic acid sequence, forming a branched double-stranded DNA substrate with a 5' DNA flap, and probe C is adjacent to probe D, so that probe C does not hybridize with the target nucleic acid sequence and contains a 5' nucleic acid sequence of the biotin moiety, and probe D does not hybridize with the target nucleic acid on the 3' nucleic acid sequence, forming a branched double-stranded DNA substrate with a 5' DNA flap. After the probe is hybridized with the target nucleic acid sequence, the target nucleic acid is purified using streptavidin paramagnetic beads. Excess genomic DNA and excess probe are washed off from the beads. Target nucleic acids are eluted from the beads by incubation with thermostable flap endonuclease 1 (FEN1). FEN1 cleaves the 5' DNA flap, thereby separating the biotin moiety from the hybridized capture probe, releasing the target nucleic acid-capture probe complex.

[0320] The present disclosure also allows users to capture and sequence multiple target nucleic acids simultaneously, and multiple capture probes can hybridize with mixed samples of target nucleic acids.Multiple target nucleic acids can include a group of more than one nucleic acid in which each nucleic acid contains the same sequence, or a group of more than one nucleic acid in which each nucleic acid does not necessarily contain the same sequence.Similarly, multiple capture probes can include a group of more than one capture probes that are equivalent in sequence, or a group of more than one capture probes that are not necessarily equivalent in sequence.For example, using multiple capture probes that all contain the same sequence, users can be allowed to capture multiple target nucleic acids that all contain the same sequence.By sequencing this multiple target nucleic acid containing the same sequence, due to data redundancy, a higher level of sequencing accuracy can be achieved.In another example, a group of capture probes including a capture probe complementary to each target gene can be used to capture and sequence two or more specific target genes simultaneously.This allows users to perform multiplex sequencing of specific genes. Fig. 9Shown are results from an experiment using FFPE samples to capture and detect a multiplexed cancer panel consisting of 100 targets using the present method.

[0321] The capture probe may also include a domain that binds (e.g., hybridizes) to a "multiplexed oligonucleotide". The multiplexed oligonucleotide may include at least three domains. The first domain may include a nucleic acid sequence that hybridizes to the capture probe. The second domain may include a unique nucleic acid sequence for identifying a sample. The third domain may include a substrate binding portion. A variety of multiplexed oligonucleotides may be used in combination with the capture probe of the present disclosure to simultaneously sequence a variety of target nucleic acids from at least two samples. The multiplexed oligonucleotide may be used to simultaneously sequence a variety of target nucleic acids from at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 100, or at least 1000 samples.

[0322] An example of using multiplexed oligonucleotides to simultaneously sequence three target nucleic acid molecules from three samples is as follows: Target nucleic acids from each of the three samples (sample 1, sample 2, and sample 3) are hybridized with two capture probes: probe A and probe B. Probe A comprises two domains. The first domain comprises a substrate binding portion. The second domain comprises a sequence complementary to the 5' end of the target nucleic acid. Probe B comprises two domains. The first domain comprises a sequence complementary to the 3' end of the target nucleic acid. The second domain comprises a sequence complementary to the multiplexed oligonucleotide. After the two capture probes are hybridized with the target nucleic acid, the second domain of probe B is hybridized with the multiplexed oligonucleotide. The multiplexed oligonucleotide comprises three domains. The first domain comprises a sequence complementary to the second domain of probe B. The second domain comprises a unique nucleic acid sequence for identifying the sample. The third domain comprises a substrate binding portion. After the multiplexed oligonucleotides are hybridized, an endonuclease cleavage step is performed to remove any protruding DNA on the target nucleic acid so that probe A hybridizes with the 5' end of the target nucleic acid and probe B hybridizes with the 3' end of the target nucleic acid. After endonuclease treatment, the multiplexing oligonucleotide is ligated to the 3' end of the target nucleic acid, and then probe B is removed. The target nucleic acid-probe A complex is further purified and then sequenced. Since each target nucleic acid from each sample is ligated to the multiplexing oligonucleotide, the sample from which the target nucleic acid is derived can be identified by sequencing the multiplexing oligonucleotide.

[0323] When complete sequencing coverage is required, the number of different capture probes required is inversely proportional to the size of the target nucleic acid fragment. In other words, more capture probes will be needed for highly fragmented target nucleic acids. For sample types with highly fragmented and degraded target nucleic acids (e.g., formalin-fixed paraffin-embedded tissues), it may be useful to include multiple capture probe pools. On the other hand, for samples with long target nucleic acid fragments, such as isolated nucleic acids obtained in vitro, a single capture probe at the 5' end may be sufficient.

[0324] The region of the target nucleic acid between two capture probes, or after a capture probe and before the end of the target nucleic acid, is referred to herein as the "sequencing window". Figure 8 The sequencing window generated when two capture probes are used to capture the target nucleic acid is marked in FIG. The sequencing window is a portion of the target nucleic acid that is available for binding by the sequencing probe. The minimum sequencing window is the target binding domain length (e.g., 4 to 10 nucleotides), while the maximum sequencing window is most of the entire chromosome.

[0325] When using the present method to sequence a large target nucleic acid molecule, a "blocker oligonucleotide" or multiple blocker oligonucleotides can be hybridized along the length of the target nucleic acid to control the size of the sequencing window. The blocker oligonucleotide hybridizes with the target nucleic acid at a specific position, thereby preventing the binding of the sequencing probe at those positions, resulting in a smaller sequencing window of interest. By generating a smaller sequencing window, the sequencing reaction is confined to the specific target region on the target DNA molecule, increasing the speed and accuracy of sequencing. When sequencing a specific mutation at a known position in the target nucleic acid, the use of blocker oligonucleotides is particularly useful because there is no need to sequence the entire target nucleic acid. In a non-limiting example, the method of the present disclosure can be used for targeted sequencing of two heterozygous sites to distinguish between two different haplotypes.

[0326] The capture probe may comprise a nucleic acid molecule complex. The nucleic acid molecule complex may comprise a partially double-stranded nucleic acid molecule. In some aspects, the partially double-stranded nucleic acid molecule may comprise a target-specific domain, a duplex domain, a single-stranded purification sequence, a cleavable portion, a single-stranded overhang domain, a sample-specific domain, a substrate-specific domain, or any combination thereof.

[0327] In some aspects, either strand of the partially double-stranded nucleic acid molecule can comprise about 40 to about 150 nucleotides, or about 60 to about 135 nucleotides, or about 10 to about 90 nucleotides, or about 25 to about 75 nucleotides, about 60 nucleotides, or about 50 to about 100 nucleotides.

[0328] In some aspects, either strand of the partially double-stranded nucleic acid molecule can comprise at least one, or at least two, or at least three, or at least four, or at least five, or at least six, or at least seven, or at least eight, or at least nine, or at least ten affinity moieties.

[0329] In some aspects, any strand of the partially double-stranded nucleic acid molecule can include at least one cross-linking moiety. The cross-linking moiety can be a chemical cross-linking moiety or a photoreactive cross-linking moiety.

[0330] The capture probe may comprise a single-stranded nucleic acid molecule. In various aspects, the single-stranded nucleic acid molecule may comprise a target-specific domain, a duplex domain, a single-stranded purification sequence, a cleavable portion, a single-stranded overhang domain, a sample-specific domain, a substrate-specific domain, or any combination thereof.

[0331] The target-specific domain, duplex domain, single-stranded purification sequence, cleavable portion, single-stranded overhang domain, sample-specific domain or substrate-specific domain may contain at least one natural base or may not contain a natural base. In some aspects, the target-specific domain, duplex domain, single-stranded purification sequence, cleavable portion, single-stranded overhang domain, sample-specific domain or substrate-specific domain may contain at least one modified nucleotide or nucleic acid analog or may not contain a modified nucleotide.

[0332] The target-specific domain, duplex domain, single-stranded purification sequence, cleavable portion, single-stranded overhang domain, sample-specific domain, or substrate-specific domain can comprise any combination of natural bases (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more natural bases) and modified nucleotides or nucleic acid analogs (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more modified). When present in combination, the natural bases and modified nucleotides or nucleic acid analogs can be arranged in any order.

[0333] The target-specific domain can include a nucleic acid sequence that is complementary to a portion of a target nucleic acid molecule and hybridizes to the target nucleic acid molecule. In some aspects, the target-specific domain can include about 10 to about 150 nucleotides, or about 25 to about 100 nucleotides, or about 35 to about 100 nucleotides, or about 25 to about 125 nucleotides, or about 15 to about 100 nucleotides.

[0334] In some aspects, the target-specific domain can hybridize within at least about 100 base pairs of the 3' end of the target nucleic acid molecule. In some aspects, the target-specific domain can hybridize within at least about 100 base pairs of the 5' end of the target nucleic acid molecule.

[0335] The duplex domain can comprise a nucleic acid sequence that is capable of annealing to another nucleic acid strand to form a partially or completely double-stranded nucleic acid molecule. In some aspects, the duplex domain can comprise about 14 to about 45 nucleotides, or about 25 to about 35 nucleotides, or about 30 nucleotides, or about 10 to about 60 nucleotides, or about 30 to about 50 nucleotides.

[0336] The single-stranded purification sequence may comprise a nucleic acid sequence suitable for use in purification. The single-stranded purification sequence may comprise an F tag. The single-stranded purification may comprise an F-like tag. The single-stranded purification sequence may comprise the nucleotide sequence AACATCACACAGACC (SEQ ID NO: 112). The single-stranded purification sequence may comprise the nucleotide sequence GTCTATCATCACAGC (SEQ ID NO: 113).

[0337] The single-stranded purification sequence can comprise at least one affinity moiety, or at least two affinity moieties, or at least three affinity moieties, or at least four affinity moieties, or at least five affinity moieties, or at least six affinity moieties, or at least seven affinity moieties, or at least eight affinity moieties, or at least nine affinity moieties, or at least ten affinity moieties. The affinity moiety can be biotin. Thus, in some aspects, the single-stranded purification sequence can comprise at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, or at least ten biotin moieties.

[0338] The single-stranded purification sequence may comprise at least 50 nucleotides, or from about 15 to about 50 nucleotides.

[0339] The cleavable portion may comprise an enzymatically cleavable portion. The enzymatically cleavable portion may comprise a USER sequence for cleavage by a USER enzyme. Alternatively, the cleavable portion may comprise a photocleavable portion.

[0340] The single-stranded overhang domain may comprise a single-stranded nucleic acid sequence that is capable of forming a 5' overhanging flap structure together with the target nucleic acid molecule.

[0341] The sample-specific domain may comprise a nucleic acid sequence that identifies a biological sample from which the target nucleic acid molecule is obtained. The sample-specific domain may comprise L-DNA. The sample-specific domain may comprise D-DNA. The sample-specific domain may comprise a combination of L-DNA and D-DNA. The sample-specific domain may hybridize with any probe of the present disclosure. The sample-specific domain may comprise about 28 nucleotides.

[0342] In some aspects, the sample-specific domain can comprise at least one attachment site or at least two attachment sites. In aspects where the sample-specific domain comprises at least one attachment site or at least two attachment sites, the attachment sites can comprise about 14 nucleotides, or about 10 nucleotides, or about 8 nucleotides.

[0343] The substrate-specific domain may comprise a nucleic acid sequence that hybridizes to a complementary nucleic acid molecule attached to the substrate. The substrate may be an array. The substrate-specific domain may comprise a nucleic acid sequence that hybridizes to a lawn oligonucleotide.

[0344] The substrate-specific domain may comprise a poly A sequence. The substrate-specific domain may comprise a poly T sequence. The substrate-specific domain may comprise an L-poly A sequence, wherein the nucleotides of the poly A sequence are L-DNA. The substrate-specific domain may comprise an L-poly T sequence, wherein the nucleotides of the poly T sequence are L-DNA. The substrate-specific domain may comprise an L-DNA. The substrate-specific domain may comprise about 30 nucleotides.

[0345] Fig.34 A schematic diagram of an exemplary capture probe is shown, which comprises a nucleic acid molecule complex called a "c5 probe complex" that binds to a target nucleic acid. The c5 probe complex comprises a partially double-stranded nucleic acid molecule. One chain of the partially double-stranded nucleic acid molecule comprises a target-specific domain that hybridizes with the target nucleic acid, a duplex domain that anneals to the other chain of the partially double-stranded nucleic acid molecule, a first single-stranded purification sequence, and a cleavable portion located between the target-specific domain and the duplex domain. In this non-limiting example, the single-stranded purification sequence comprises an F-like tag, and the cleavable portion comprises an enzymatically cleavable USER sequence. The other chain of the partially double-stranded nucleic acid molecule comprises a duplex domain that anneals to the other chain of the partially double-stranded nucleic acid molecule, and a single-stranded overhang domain. In this non-limiting example, the single-stranded overhang domain and the target nucleic acid molecule form a 5' protruding flap structure.

[0346] Fig.34Also shown is a schematic diagram of an exemplary capture probe, which comprises a nucleic acid molecule complex called a "c3 probe complex" that binds to a target nucleic acid. The c3 probe complex comprises a partially double-stranded nucleic acid molecule. One chain of the partially double-stranded nucleic acid molecule comprises a target-specific domain that hybridizes with the target nucleic acid, a duplex domain that anneals to the other chain of the partially double-stranded nucleic acid molecule, and a cleavable portion located between the target-specific domain and the duplex domain. In this non-limiting example, the cleavable portion comprises an enzymatically cleavable USER sequence. The other chain of the partially double-stranded nucleic acid molecule comprises a duplex domain that anneals to the other chain of the partially double-stranded nucleic acid molecule, a sample-specific domain, a substrate-specific domain, a single-stranded purification sequence, and a cleavable portion located between the single-stranded purification sequence and the substrate-specific domain. In this non-limiting example, the sample-specific domain comprises L-DNA, the substrate-specific domain comprises L-DNA, the single-stranded purification sequence comprises an F tag, and the cleavable portion is a photo-cleavable portion.

[0347] Fig.41 A schematic diagram of an exemplary capture probe is shown, which comprises a nucleic acid molecule complex called a "c3.2 probe complex" that is bound to a target nucleic acid molecule. The c3.2 probe complex comprises a partially double-stranded nucleic acid molecule. One strand of the partially double-stranded nucleic acid molecule comprises a target-specific domain that hybridizes with the target nucleic acid, and a duplex domain that anneals to the other strand of the partially double-stranded nucleic acid molecule. In some aspects, this strand may optionally comprise at least one first affinity portion. In some aspects, this strand may optionally comprise a cleavable portion located between the target-specific domain and the duplex domain. The other strand of the partially double-stranded nucleic acid molecule comprises a duplex domain that anneals to the other strand of the partially double-stranded nucleic acid molecule, and a substrate-specific domain. In some aspects, this strand may optionally comprise at least one, or at least two, or at least three second affinity portions.

[0348] Fig.41Also shown is a schematic diagram of an exemplary capture probe comprising a nucleic acid molecule complex called a "c5.2 probe complex" bound to a target nucleic acid molecule. The c5.2 probe complex comprises a partially double-stranded nucleic acid molecule. One strand of the partially double-stranded nucleic acid molecule comprises a target-specific domain that hybridizes to the target nucleic acid, a duplex domain that anneals to the other strand of the partially double-stranded nucleic acid molecule. In some aspects, this strand may optionally comprise a cleavable portion located between the target-specific domain and the duplex domain. The other strand of the partially double-stranded nucleic acid molecule comprises a duplex domain that anneals to the other strand of the partially double-stranded nucleic acid molecule, a sample-specific domain and a first single-stranded purification sequence, a first cleavable portion located between the duplex domain and the sample-specific domain, and a second cleavable portion located between the sample-specific domain and the first single-stranded purification sequence. In some aspects, the first single-stranded purification sequence may comprise at least one affinity portion, such as at least one biotin portion. In some aspects, the first single-stranded purification sequence can be replaced with at least one biotin moiety such that the other strand of the partially double-stranded nucleic acid molecule comprises a duplex domain that anneals to the other strand of the partially double-stranded nucleic acid molecule, a sample-specific domain, at least one biotin moiety, a first cleavable moiety positioned between the duplex domain and the sample-specific domain, and a second cleavable moiety positioned between the sample-specific domain and the at least one biotin moiety.

[0349] Sample preparation methods of the present disclosure

[0350] The present disclosure provides methods of sample preparation, which include immobilizing target nucleic acid molecules to a substrate.

[0351] The sample preparation methods of the present invention may include a CRISPR-based fragmentation step (see, e.g., Baker and Mueller, "CRISPR-mediated isolation of specific megabase segments of genomic DNA," Nucleic Acids Research 2017, 45(19), e165; Tsai et al., "Amplification-free, CRISPR-Cas9 targeted enrichment and SMRT sequencing of repeat-expansiondisease causative genomic regions", bioRxiv203919; doi: https: / / doi.org / 10.1101 / 203919; Nachmanson et al., “Targeted genome fragmentation with CRISPR / Cas9 improves hybridization capture, reduces PCR bias, and enables efficient high-accuracy sequencing of small targets”, bioRxiv 207027; doi: https: / / doi.org / 10.1101 / 207027). CRISPR fragmentation can include in vitro fragmentation of genomic DNA (gDNA) obtained from a biological sample by cleavage proximal to a protospacer adjacent motif (PAM) site located within the gDNA. The PAM site can comprise the nucleotide sequence NGG, wherein N is any nucleobase. Alternatively, the PAM site can comprise the nucleotide sequence NGA, wherein N is any nucleobase. Fragments generated by CRISPR-based fragmentation can be purified using a biotinylated CRISPR complex or with an anti-CAS9 antibody.

[0352] The method for capturing a target nucleic acid may include: (1) fragmenting gDNA using a CRISPR-based fragmentation step; (2) contacting the fragmented gDNA with at least two capture probes, wherein at least one of the at least two capture probes is the c5 probe complex described above, and at least one of the at least two capture probes is the c3 probe complex described above, such that the c3 probe complex and the c5 probe complex hybridize with the target nucleic acid to form a Fig.34 The invention relates to a method for preparing a complex shown in the claims; (3) removing the 5' protruding flap structure by contacting the composition with FEN1; (4) connecting the 3' end of the target nucleic acid to the 5' end of the chain of the c3 probe complex comprising a substrate-specific domain; (5) binding the single-stranded purification sequence of the c5 probe complex to a first substrate; (6) cleaving the cleavable portion located between the duplex domain and the target-specific domain of each of the c3 and c5 probe complexes; (7) binding the single-stranded purification sequence of the c3 probe complex to a second substrate; (8) cleaving the cleavable portion located between the single-stranded purification sequence of the connected c3 probe complex and the substrate-specific domain; and (9) hybridizing the substrate-specific domain with a complementary nucleic acid molecule attached to a third substrate.

[0353] In some aspects of the foregoing method, step (9) may be performed before step (8).

[0354] In some aspects of the foregoing method, steps (3) and (4) can be performed simultaneously. In some aspects of the foregoing method, steps (3) and (4) can be performed simultaneously.

[0355] In some aspects, the foregoing method can optionally include a step between steps (6) and (7) in which target nucleic acid-capture probe complexes derived from different biological samples are combined together. In this aspect, the target nucleic acid-capture probe complexes derived from different samples will include a c3 probe complex comprising a unique sample-specific domain, such that the target-specific domain identifies the biological sample from which each target nucleic acid was obtained.

[0356] Figure 34-40 An example of a sample preparation method of the present disclosure is shown in FIG. In this non-limiting example, gDNA obtained from a biological sample is first fragmented using CRISPR-based fragmentation. After fragmentation, the target nucleic acid is hybridized with two capture probes, such as Fig.34 As shown in . In this non-limiting example, the two capture probes are the c3 probe complex and the c5 probe complex as described above. The c3 probe complex and the c5 probe complex hybridize to the target nucleic acid at non-overlapping positions along the target nucleic acid. The c3 probe complex hybridizes to the target nucleic acid via the target-specific domain within no more than 8 nucleotides of the 3' end of the target nucleic acid, while the c5 probe complex hybridizes to the target nucleic acid via the target-specific domain, such that the c5 probe complex hybridizes to the 5' of the c3 probe complex. The single-stranded overhang domain of the c5 probe complex and the target nucleic acid molecule form a 5'-protruding flap structure. After the two capture probes are hybridized, the target nucleic acid-capture probe complex is incubated with FEN1 and a ligase. FEN1 removes the 5'-protruding flap structure, and the 3' end of the target nucleic acid is connected to the chain of the c3 probe complex containing the substrate-specific domain by a ligase, such as Fig.35 as shown in . Fig.36 The resulting complex shown in is bound to F-like beads that hybridize to the F-like tag present in the c5 probe complex. The beads are washed and USER enzyme is added. USER enzyme cleaves the cleavable portion located between the target-specific domain and the duplex domain of both the c3 probe complex and the c5 probe complex, thereby releasing the target nucleic acid from the F-like beads, as shown in Fig.37 As shown in Fig.38 The eluted complex shown in is further purified using SPRI beads. The purified complex is then bound to F beads, which hybridize to the F tag present in the c3 probe complex. After washing, the target nucleic acid is eluted from the F beads by exposing the beads to UV light, thereby cleaving the photocleavable portion of the c3 probe complex located between the substrate-specific domain and the F tag, as shown in FIG. Fig.39The resulting complex is then bound to the substrate by hybridizing the substrate-specific domain of the ligated c3 probe complex to a complementary nucleic acid attached to the substrate, as shown in Fig.40 as shown in .

[0357] Figures 41-46 Another example of a sample preparation method of the present disclosure is shown in FIG. In this non-limiting example, gDNA obtained from a biological sample is first fragmented, for example, by CRISPR-based fragmentation. After fragmentation, the target nucleic acid is hybridized with two capture probes, such as Fig.41 As shown in . In this non-limiting example, the two capture probes are the c3.2 probe complex and the c5.2 probe complex as described above. The c3 probe complex and the c5 probe complex hybridize to the target nucleic acid at non-overlapping positions along the target nucleic acid. The c5.2 probe complex hybridizes to the target nucleic acid via the target-specific domain, such that the c5.2 probe complex hybridizes to the 5' of the c3.2 probe complex. After the two capture probes are hybridized, the target nucleic acid is linked to one strand of the c3.2 probe complex and one strand of the c5.2 complex, as shown in . Fig.42 As shown in . Ligation can include enzymatic ligation, self-ligation, chemical ligation, or any combination thereof. In aspects including enzymatic ligation, enzymatic ligation can be performed using a high-fidelity, template-directed nick ligase. Fig.42 The resulting complex shown in is bound to beads comprising at least one oligonucleotide that is hybridized to the single-stranded purification sequence. The beads can be washed, and the cleavable portion located between the sample-specific domain and the single-stranded purification sequence can be cleaved to release the target nucleic acid from the beads, as shown in Fig.43 The resulting complex can then be immobilized on a substrate by hybridizing the substrate-specific domain to an oligonucleotide attached to the substrate, as shown in Fig.44 The substrate / oligonucleotide complex can be any array of the disclosure.

[0358] The aforementioned method may further include hybridizing at least one reporter probe to the sample-specific domain, wherein the reporter probe comprises a first detectable label and a second detectable label. The first detectable label and the second detectable label can then be identified, thereby identifying the sample from which the target nucleic acid originates based on the identity of the first detectable label and the second detectable label.

[0359] Alternatively, the aforementioned method may further include hybridizing a first reporter probe with a sample-specific domain, wherein the reporter probe comprises a first detectable label and a second detectable label. The first detectable label and the second detectable label can then be identified. The first detectable label and the second detectable label can then be removed, and the second reporter probe comprising a third detectable label and a fourth detectable label can be hybridized with the sample-specific domain. The third detectable label and the fourth detectable label can then be identified, thereby identifying the sample from which the target nucleic acid originates based on the identity of the first detectable label, the second detectable label, the third detectable label and the fourth detectable label.

[0360] After identification of the sample from which the target nucleic acid originates, the cleavable portion located between the sample-specific domain and the duplex domain can be cleaved, such as Fig.45 As shown in , thereby releasing the sample-specific domain.

[0361] Methods of the present disclosure

[0362] The sequencing methods of the present disclosure comprise reversibly hybridizing at least one sequencing probe disclosed herein to a target nucleic acid.

[0363] The method for sequencing a nucleic acid may include (1) hybridizing a sequencing probe described herein to a target nucleic acid. The target nucleic acid may optionally be fixed to a substrate at one or more locations. An exemplary sequencing probe may include a target binding domain and a barcode domain; wherein the target binding domain includes any of the constructs described in Table 1. An exemplary target binding domain includes at least eight nucleotides that hybridize with a target nucleic acid, wherein at least six nucleotides in the target binding domain can identify corresponding nucleotides in a target nucleic acid molecule (e.g., the six nucleotides identify the complementary six nucleotides of the target molecule to which it hybridizes), and wherein at least two nucleotides in the target binding domain do not identify corresponding nucleotides in a target nucleic acid molecule (e.g., the at least two nucleotides do not identify the complementary two nucleotides of the target molecule to which it hybridizes); wherein any of the at least six nucleotides in the target binding domain may be a modified nucleotide or a nucleotide analog, and wherein at least two nucleotides in the target binding domain that do not identify corresponding nucleotides in a target nucleic acid molecule may be any base of the four canonical bases that are not specific to a target determined by the at least six nucleotides in the target binding domain, or a universal base or a degenerate base. An exemplary barcode domain comprises a synthetic backbone comprising at least three attachment positions, each attachment position comprising at least one attachment region comprising at least one nucleic acid sequence capable of being bound by a complementary nucleic acid molecule, wherein each of the at least three attachment positions corresponds to two nucleotides of at least six nucleotides in a target binding domain, and wherein each of the at least three attachment positions has a different nucleic acid sequence, and wherein the nucleic acid sequence of each of the at least three attachment positions determines the position and identity of corresponding two nucleotides of the at least six nucleotides in a target nucleic acid bound by the target binding domain.

[0364] In other aspects, an exemplary target binding domain can comprise at least six nucleotides that hybridize to a target nucleic acid, wherein the at least six nucleotides in the target binding domain can identify corresponding nucleotides in the target nucleic acid molecule (e.g., when the target binding domain sequence is exactly six nucleotides, these six nucleotides identify the complementary six nucleotides of the target molecule to which it hybridizes); wherein none of the at least six nucleotides in the target binding domain, or any one of the at least six nucleotides, can be a modified nucleotide or a nucleotide analog.

[0365] After the sequencing probe is hybridized to the target nucleic acid, the method includes (2) binding a first complementary nucleic acid molecule comprising a first detectable label and at least a second detectable label to a first attachment site of at least three attachment sites of the barcode domain; (3) detecting the first detectable label and at least the second detectable label of the bound first complementary nucleic acid molecule; and (4) identifying the position and identity of at least two nucleotides in the immobilized target nucleic acid. For example, when the first complementary nucleic acid molecule comprises two detectable labels, the two detectable labels identify at least two nucleotides in the immobilized target nucleic acid.

[0366] After detecting at least two detectable labels, at least two detectable labels are removed from the first complementary nucleic acid molecule. Thus, the method further comprises (5) binding the first hybrid nucleic acid molecule lacking the detectable label to the first attachment site, thereby releasing the binding of the first complementary nucleic acid molecule comprising the detectable label, or contacting the first complementary nucleic acid molecule comprising the detectable label with a force sufficient to release the first detectable label and at least the second detectable label. Thus, after step (5), no detectable label is bound to the first attachment site. The method further comprises (6) binding a second complementary nucleic acid molecule comprising a third detectable label and at least a fourth detectable label to a second attachment site of the at least three attachment sites of the barcode domain; (7) detecting the third detectable label and at least the fourth detectable label of the bound second complementary nucleic acid molecule; (8) identifying the position and identity of at least two nucleotides in the optionally fixed target nucleic acid; (9) repeating steps (5) to (8) until each of the at least three attachment sites in the barcode domain has been bound by a complementary nucleic acid molecule comprising two detectable labels and the two detectable labels of the bound complementary nucleic acid molecules have been detected, thereby identifying the linear order of at least six nucleotides of at least the first region of the fixed target nucleic acid hybridized by the target binding domain of the sequencing probe; and (10) removing the sequencing probe from the optionally fixed target nucleic acid.

[0367] The method may further include (11) hybridizing a second sequencing probe to a target nucleic acid optionally fixed to a substrate at one or more locations, and wherein the target binding domains of the first sequencing probe and the second sequencing probe are different; (12) binding a first complementary nucleic acid molecule comprising a first detectable label and at least a second detectable label to a first attachment location of at least three attachment locations of the barcode domain; (13) detecting the first detectable label and at least the second detectable label of the bound first complementary nucleic acid molecule; (14) identifying the position and identity of at least two nucleotides in the optionally fixed target nucleic acid; (15) binding a first hybrid nucleic acid molecule lacking a detectable label to the first attachment location, thereby releasing the binding of the first complementary nucleic acid molecule or complex comprising the detectable label, or binding a first complementary nucleic acid molecule or complex comprising the detectable label to a sufficient amount to release the first detectable label and at least the second detectable label; (16) allowing a second complementary nucleic acid molecule comprising a third detectable label and at least a fourth detectable label to bind to a second attachment site of the at least three attachment sites of the barcode domain; (17) detecting the third detectable label and at least the fourth detectable label of the bound second complementary nucleic acid molecule; (18) identifying the position and identity of at least two nucleotides in the immobilized target nucleic acid; (19) repeating steps (15) to (18) until each of the at least three attachment sites in the barcode domain has been bound by a complementary nucleic acid molecule comprising two detectable labels and the two detectable labels of the bound complementary nucleic acid molecules have been detected, thereby identifying the linear order of at least six nucleotides of at least a second region of the immobilized target nucleic acid hybridized by the target binding domain of the second sequencing probe; and (20) removing the second sequencing probe from the optionally immobilized target nucleic acid.

[0368] The method may further include assembling each identified linear order of nucleotides in at least the first region and at least the second region of the immobilized target nucleic acid, thereby identifying the sequence of the immobilized target nucleic acid.

[0369] Steps (5) and (6) may occur sequentially or simultaneously. The first detectable label and at least the second detectable label may have the same emission spectrum, or may have different emission spectra. The third detectable label and at least the fourth detectable label may have the same emission spectrum, or may have different emission spectra.

[0370] The first complementary nucleic acid molecule may comprise a cleavable linker. The second complementary nucleic acid molecule may comprise a cleavable linker. The first complementary nucleic acid molecule and the second complementary nucleic acid molecule may each comprise a cleavable linker. Preferably, the cleavable linker is photocleavable. The release force may be light. Preferably, UV light. The light may be provided by a light source selected from an arc lamp, a laser, a focused UV light source, and a light emitting diode.

[0371] The first complementary nucleic acid molecule and the first hybrid nucleic acid molecule lacking a detectable label can comprise the same nucleic acid sequence. For example, the first hybrid nucleic acid molecule lacking a detectable label can comprise a nucleic acid sequence that is identical to a portion of the first complementary nucleic acid molecule that binds to a first attachment site of at least three attachment sites of the barcode domain. The first hybrid nucleic acid molecule lacking a detectable label can comprise a nucleic acid sequence that is complementary to a flanking single-stranded polynucleotide that is adjacent to the first attachment site in the barcode domain.

[0372] The second complementary nucleic acid molecule and the second hybrid nucleic acid molecule lacking a detectable label may comprise the same nucleic acid sequence. The second hybrid nucleic acid molecule lacking a detectable label may comprise a nucleic acid sequence complementary to a flanking single-stranded polynucleotide adjacent to a second attachment position in the barcode domain.

[0373] The present disclosure also provides a method for sequencing a nucleic acid, comprising (1) hybridizing a sequencing probe described herein to a target nucleic acid. The target nucleic acid may optionally be fixed to a substrate at one or more locations. An exemplary sequencing probe may comprise a target binding domain and a barcode domain; wherein the target binding domain comprises any of the constructs described in Table 1. An exemplary target binding domain comprises at least eight nucleotides that hybridize with a target nucleic acid, wherein at least six nucleotides in the target binding domain can identify a corresponding nucleotide in a target nucleic acid molecule (e.g., the six nucleotides identify the complementary six nucleotides of the target molecule to which it hybridizes), and wherein at least two nucleotides in the target binding domain do not identify a corresponding nucleotide in a target nucleic acid molecule (e.g., the at least two nucleotides do not identify the complementary two nucleotides of the target molecule to which it hybridizes); wherein any of the at least six nucleotides in the target binding domain may be a modified nucleotide or a nucleotide analog, and wherein at least two nucleotides in the target binding domain that do not identify a corresponding nucleotide in a target nucleic acid molecule may be any base of the four canonical bases that are not specific to a target determined by the at least six nucleotides in the target binding domain, or a universal base or a degenerate base. An exemplary barcode domain comprises a synthetic backbone comprising at least three attachment positions, each attachment position comprising at least one attachment region comprising at least one nucleic acid sequence capable of being bound by a complementary nucleic acid molecule, wherein each of the at least three attachment positions corresponds to two nucleotides of at least six nucleotides in a target binding domain, and wherein each of the at least three attachment positions has a different nucleic acid sequence, and wherein the nucleic acid sequence of each of the at least three attachment positions determines the position and identity of corresponding two nucleotides of the at least six nucleotides in a target nucleic acid bound by the target binding domain.

[0374] In other aspects, an exemplary target binding domain can comprise at least six nucleotides that hybridize to a target nucleic acid, wherein the at least six nucleotides in the target binding domain can identify corresponding nucleotides in the target nucleic acid molecule (e.g., when the target binding domain sequence is exactly six nucleotides, these six nucleotides identify the complementary six nucleotides of the target molecule to which it hybridizes); wherein none of the at least six nucleotides in the target binding domain, or any one of the at least six nucleotides, can be a modified nucleotide or a nucleotide analog.

[0375] After the sequencing probe is hybridized to the target nucleic acid, the method includes (2) allowing a first complementary nucleic acid molecule comprising a first detectable label and at least a second detectable label to bind to a first attachment position of at least three attachment positions of the barcode domain; and (3) detecting and recording the first detectable label and at least the second detectable label of the bound first complementary nucleic acid molecule.

[0376] After detecting and recording the at least two detectable labels, the at least two detectable labels are removed from the first complementary nucleic acid molecule. Thus, the method further comprises (4) binding the first hybrid nucleic acid molecule lacking the detectable label to the first attachment site, thereby releasing the binding of the first complementary nucleic acid molecule comprising the detectable label, or contacting the first complementary nucleic acid molecule comprising the detectable label with a force sufficient to release the first detectable label and at least the second detectable label. Thus, after step (4), no detectable label is bound to the first attachment site. The method further comprises (5) binding a second complementary nucleic acid molecule comprising a third detectable label and at least a fourth detectable label to a second attachment site of at least three attachment sites of the barcode domain; (6) detecting and recording the third detectable label and at least the fourth detectable label of the bound second complementary nucleic acid molecule; (7) repeating steps (4) to (6) until each of the at least three attachment sites in the barcode domain has been bound by a complementary nucleic acid molecule comprising two detectable labels, and the two detectable labels of the bound complementary nucleic acid molecule have been detected and recorded; (8) using the detectable labels recorded in steps (3), (6), and (7), identifying the position and identity of at least six nucleotides of at least a first region of the immobilized target nucleic acid that are hybridized to the target binding domain of the sequencing probe; and (9) removing the sequencing probe from the optionally immobilized target nucleic acid.

[0377] The method may further include (10) allowing a second sequencing probe to hybridize to a target nucleic acid that is optionally fixed to a substrate at one or more locations, and wherein the target binding domains of the first sequencing probe and the second sequencing probe are different; (11) allowing a first complementary nucleic acid molecule comprising a first detectable label and at least a second detectable label to bind to a first attachment site of at least three attachment sites of the barcode domain; (12) detecting and recording the first detectable label and at least the second detectable label of the bound first complementary nucleic acid molecule; (13) allowing a first hybrid nucleic acid molecule lacking a detectable label to bind to the first attachment site, thereby releasing the binding of the first complementary nucleic acid molecule or complex comprising the detectable label, or allowing the first complementary nucleic acid molecule or complex comprising the detectable label to contact with a force sufficient to release the first detectable label and at least the second detectable label; (14) allowing a first hybrid nucleic acid molecule lacking a detectable label to bind to the first attachment site, thereby releasing the binding of the first complementary nucleic acid molecule or complex comprising the detectable label, or allowing the first complementary nucleic acid molecule or complex comprising the detectable label to contact with a force sufficient to release the first detectable label and at least the second detectable label; (15) allowing a first hybrid nucleic acid molecule lacking a detectable label to bind to the first attachment site, thereby releasing the binding of the first complementary nucleic acid molecule or complex comprising the detectable label, or allowing the first complementary nucleic acid molecule or complex comprising the detectable label to contact with a force sufficient to release the first detectable label and at least the second detectable label; (16) allowing a first hybrid nucleic acid molecule lacking a detectable label to bind to the first attachment site, thereby releasing the binding of the first complementary nucleic acid molecule or complex comprising the detectable label. A second complementary nucleic acid molecule having a third detectable label and at least a fourth detectable label is bound to a second attachment position of the at least three attachment positions of the barcode domain; (15) the third detectable label and at least the fourth detectable label of the bound second complementary nucleic acid molecule are detected and recorded; (16) steps (13) to (15) are repeated until each of the at least three attachment positions in the barcode domain has been bound by a complementary nucleic acid molecule comprising two detectable labels, and the two detectable labels of the bound complementary nucleic acid molecule have been detected and recorded; (17) using the detectable labels recorded in steps (12), step (15) and step (16), the position and identity of at least six nucleotides of at least a second region of the immobilized target nucleic acid hybridized by the target binding domain of the second sequencing probe are identified; and (18) the second sequencing probe is removed from the optionally immobilized target nucleic acid.

[0378] The method may further include assembling each identified linear order of nucleotides in at least the first region and at least the second region of the immobilized target nucleic acid, thereby identifying the sequence of the immobilized target nucleic acid.

[0379] Steps (4) and (5) may occur sequentially or simultaneously. The first detectable label and at least the second detectable label may have the same emission spectrum, or may have different emission spectra. The third detectable label and at least the fourth detectable label may have the same emission spectrum, or may have different emission spectra.

[0380] The first complementary nucleic acid molecule may comprise a cleavable linker. The second complementary nucleic acid molecule may comprise a cleavable linker. The first complementary nucleic acid molecule and the second complementary nucleic acid molecule may each comprise a cleavable linker. Preferably, the cleavable linker is photocleavable. The release force may be light. Preferably, UV light. The light may be provided by a light source selected from an arc lamp, a laser, a focused UV light source, and a light emitting diode.

[0381] The first complementary nucleic acid molecule and the first hybrid nucleic acid molecule lacking a detectable label can comprise the same nucleic acid sequence. For example, the first hybrid nucleic acid molecule lacking a detectable label can comprise a nucleic acid sequence that is identical to a portion of the first complementary nucleic acid molecule that binds to a first attachment site of at least three attachment sites of the barcode domain. The first hybrid nucleic acid molecule lacking a detectable label can comprise a nucleic acid sequence that is complementary to a flanking single-stranded polynucleotide that is adjacent to the first attachment site in the barcode domain.

[0382] The second complementary nucleic acid molecule and the second hybrid nucleic acid molecule lacking a detectable label may comprise the same nucleic acid sequence. The second hybrid nucleic acid molecule lacking a detectable label may comprise a nucleic acid sequence complementary to a flanking single-stranded polynucleotide adjacent to a second attachment position in the barcode domain.

[0383] The aforementioned method may further include a medium suitable for recording the detectable label. Such a medium may be a suitable computer-readable medium.

[0384] The present disclosure further provides methods for sequencing nucleic acids using a plurality of sequencing probes disclosed herein. For example, a target nucleic acid is hybridized with more than one sequencing probe, and each probe can sequence a portion of the target nucleic acid to which it is hybridized.

[0385] The present disclosure also provides a method for sequencing a nucleic acid, comprising (1) hybridizing at least a first population of a first sequencing probe comprising a plurality of sequencing probes described herein to a target nucleic acid, optionally fixed to a substrate at one or more locations; (2) binding a first complementary nucleic acid molecule comprising a first detectable label and at least a second detectable label to a first attachment location of at least three attachment locations of a barcode domain; (3) detecting the first detectable label and at least the second detectable label of the bound first complementary nucleic acid molecule; (4) identifying the location and identity of at least two nucleotides in the fixed target nucleic acid; (5) binding a first hybrid nucleic acid molecule lacking the detectable label to the first attachment location, thereby releasing the binding of the first complementary nucleic acid molecule comprising the detectable label, or binding a first complementary nucleic acid molecule comprising the detectable label to a first attachment location sufficient to release the first detectable label and at least the second detectable label; (6) allowing a second complementary nucleic acid molecule comprising a third detectable label and at least a fourth detectable label to bind to a second attachment site of at least three attachment sites of the barcode domain; (7) detecting the third detectable label and at least the fourth detectable label of the bound second complementary nucleic acid molecule; (8) identifying the position and identity of at least two nucleotides in the optionally fixed target nucleic acid; (9) repeating steps (5) to (8) until each of the at least three attachment sites in the barcode domain has been bound by a complementary nucleic acid molecule comprising two detectable labels and the two detectable labels of the bound complementary nucleic acid molecules have been detected, thereby identifying the linear order of at least six nucleotides of at least a first region of the fixed target nucleic acid hybridized by the target binding domain of the sequencing probe; and (10) removing at least a first population of the first sequencing probe from the optionally fixed target nucleic acid.

[0386] The method may further include (11) hybridizing at least a second population of second sequencing probes comprising a plurality of sequencing probes disclosed herein to a target nucleic acid optionally fixed to a substrate at one or more locations, and wherein the target binding domains of the first sequencing probe and the second sequencing probe are different; (12) binding a first complementary nucleic acid molecule comprising a first detectable label and at least a second detectable label to a first attachment location of at least three attachment locations of a barcode domain; (13) detecting the first detectable label and at least the second detectable label of the bound first complementary nucleic acid molecule; (14) identifying the location and identity of at least two nucleotides in the optionally fixed target nucleic acid; (15) binding a first hybrid nucleic acid molecule lacking a detectable label to the first attachment location, thereby releasing the binding of a first complementary nucleic acid molecule or complex comprising a detectable label, or binding a first complementary nucleic acid molecule or complex comprising a detectable label to a first attachment location sufficient to release the first complementary nucleic acid molecule or complex; (16) allowing a second complementary nucleic acid molecule comprising a third detectable label and at least a fourth detectable label to bind to a second attachment site of the at least three attachment sites of the barcode domain; (17) detecting the third detectable label and at least the fourth detectable label of the bound second complementary nucleic acid molecule; (18) identifying the position and identity of at least two nucleotides in the immobilized target nucleic acid; (19) repeating steps (15) to (18) until each of the at least three attachment sites in the barcode domain has been bound by a complementary nucleic acid molecule comprising two detectable labels and the two detectable labels of the bound complementary nucleic acid molecules have been detected, thereby identifying the linear order of at least six nucleotides of at least a second region of the immobilized target nucleic acid hybridized by the target binding domain of the sequencing probe; and (20) removing at least a second population of second sequencing probes from the optionally immobilized target nucleic acid.

[0387] The method may further include assembling each identified linear order of nucleotides in at least the first region and at least the second region of the immobilized target nucleic acid, thereby identifying the sequence of the immobilized target nucleic acid.

[0388] Steps (5) and (6) may occur sequentially or simultaneously. The first detectable label and at least the second detectable label may have the same emission spectrum, or may have different emission spectra. The third detectable label and at least the fourth detectable label may have the same emission spectrum, or may have different emission spectra.

[0389] The first complementary nucleic acid molecule may comprise a cleavable linker. The second complementary nucleic acid molecule may comprise a cleavable linker. The first complementary nucleic acid molecule and the second complementary nucleic acid molecule may each comprise a cleavable linker. Preferably, the cleavable linker is photocleavable. The release force may be light. Preferably, UV light. The light may be provided by a light source selected from an arc lamp, a laser, a focused UV light source, and a light emitting diode.

[0390] The first complementary nucleic acid molecule and the first hybrid nucleic acid molecule lacking a detectable label may comprise the same nucleic acid sequence. The first hybrid nucleic acid molecule lacking a detectable label may comprise a nucleic acid sequence complementary to a flanking single-stranded polynucleotide adjacent to a first attachment position in the barcode domain.

[0391] The second complementary nucleic acid molecule and the second hybrid nucleic acid molecule lacking a detectable label may comprise the same nucleic acid sequence. The second hybrid nucleic acid molecule lacking a detectable label may comprise a nucleic acid sequence complementary to a flanking single-stranded polynucleotide adjacent to a second attachment position in the barcode domain.

[0392] The present disclosure also provides a method for sequencing a nucleic acid, comprising (1) hybridizing at least a first population of a first sequencing probe comprising a plurality of sequencing probes described herein to a target nucleic acid, optionally fixed to a substrate at one or more locations; (2) binding a first complementary nucleic acid molecule comprising a first detectable label and at least a second detectable label to a first attachment site of at least three attachment sites of a barcode domain; (3) detecting and recording the first detectable label and at least the second detectable label of the bound first complementary nucleic acid molecule; (4) binding a first hybrid nucleic acid molecule lacking a detectable label to the first attachment site, thereby releasing the binding of the first complementary nucleic acid molecule comprising the detectable label, or contacting the first complementary nucleic acid molecule comprising the detectable label with a force sufficient to release the first detectable label and at least the second detectable label; (5) binding a first hybrid nucleic acid molecule lacking a detectable label to the first attachment site, thereby releasing the binding of the first complementary nucleic acid molecule comprising the detectable label, or contacting the first complementary nucleic acid molecule comprising the detectable label with a force sufficient to release the first detectable label and at least the second detectable label; (6) detecting and recording the third detectable label and the at least fourth detectable label of the bound second complementary nucleic acid molecule; (7) repeating steps (4) to (6) until each of the at least three attachment positions in the barcode domain has been bound by a complementary nucleic acid molecule comprising two detectable labels, and the two detectable labels of the bound complementary nucleic acid molecule have been detected and recorded; (8) using the detectable labels recorded in steps (3), (6), and (7), identifying the position and identity of at least six nucleotides of at least a first region of the immobilized target nucleic acid hybridized by the target binding domain of the sequencing probe; and (9) removing at least a first population of the first sequencing probe from the optionally immobilized target nucleic acid.

[0393] The method may further include (10) hybridizing at least a second population of second sequencing probes comprising a plurality of sequencing probes disclosed herein to a target nucleic acid optionally fixed to a substrate at one or more locations, and wherein the target binding domains of the first sequencing probe and the second sequencing probe are different; (11) binding a first complementary nucleic acid molecule comprising a first detectable label and at least a second detectable label to a first attachment site of at least three attachment sites of a barcode domain; (12) detecting and recording the first detectable label and at least the second detectable label of the bound first complementary nucleic acid molecule; (13) binding a first hybrid nucleic acid molecule lacking a detectable label to the first attachment site, thereby releasing the binding of the first complementary nucleic acid molecule or complex comprising the detectable label, or contacting the first complementary nucleic acid molecule or complex comprising the detectable label with a force sufficient to release the first detectable label and at least the second detectable label; (14) allowing a second complementary nucleic acid molecule comprising a third detectable label and at least a fourth detectable label to bind to a second attachment site of the at least three attachment sites of the barcode domain; (15) detecting and recording the third detectable label and at least the fourth detectable label of the bound second complementary nucleic acid molecule; (16) repeating steps (13) to (15) until each of the at least three attachment sites in the barcode domain has been bound by a complementary nucleic acid molecule comprising two detectable labels, and the two detectable labels of the bound complementary nucleic acid molecule have been detected and recorded; (17) using the detectable labels recorded in steps (12), (15), and (16), identifying the position and identity of at least six nucleotides of at least a second region of the immobilized target nucleic acid hybridized by the target binding domain of the second sequencing probe; and (18) removing at least a second population of the second sequencing probe from the optionally immobilized target nucleic acid.

[0394] The method may further include assembling each identified linear order of nucleotides in at least the first region and at least the second region of the immobilized target nucleic acid, thereby identifying the sequence of the immobilized target nucleic acid.

[0395] Steps (4) and (5) may occur sequentially or simultaneously. The first detectable label and at least the second detectable label may have the same emission spectrum, or may have different emission spectra. The third detectable label and at least the fourth detectable label may have the same emission spectrum, or may have different emission spectra.

[0396] The first complementary nucleic acid molecule may comprise a cleavable linker. The second complementary nucleic acid molecule may comprise a cleavable linker. The first complementary nucleic acid molecule and the second complementary nucleic acid molecule may each comprise a cleavable linker. Preferably, the cleavable linker is photocleavable. The release force may be light. Preferably, UV light. The light may be provided by a light source selected from an arc lamp, a laser, a focused UV light source, and a light emitting diode.

[0397] The first complementary nucleic acid molecule and the first hybrid nucleic acid molecule lacking a detectable label may comprise the same nucleic acid sequence. The first hybrid nucleic acid molecule lacking a detectable label may comprise a nucleic acid sequence complementary to a flanking single-stranded polynucleotide adjacent to a first attachment position in the barcode domain.

[0398] The second complementary nucleic acid molecule and the second hybrid nucleic acid molecule lacking a detectable label may comprise the same nucleic acid sequence. The second hybrid nucleic acid molecule lacking a detectable label may comprise a nucleic acid sequence complementary to a flanking single-stranded polynucleotide adjacent to a second attachment position in the barcode domain.

[0399] The aforementioned method may further include a medium suitable for recording the detectable label. Such a medium may be a suitable computer-readable medium.

[0400] Sequencing methods are further described herein.

[0401] Fig.10 A schematic overview of a single exemplary sequencing cycle of the present disclosure is shown. Although the method does not require immobilization of the target nucleic acid prior to sequencing, in this example, the method begins with a target nucleic acid that has been captured and bound to the surface of a flow chamber using a capture probe, as shown in the upper leftmost figure. A pool of sequencing probes is then flowed into the flow chamber to allow the sequencing probes to hybridize with the target nucleic acid. In this example, the sequencing probes are Figure 1 Those depicted in . These sequencing probes contain 6-mer sequences that hybridize with the target nucleic acid within the target binding domain. The 6-mer is flanked on either side by (N) bases, which can be universal / degenerate bases, or composed of any of the four canonical bases that are not specific to the target determined by the bases b1-b2-b3-b4-b5-b6. Using the 6-mer sequence, a collection of 4096 (4^6) sequencing probes enables sequencing of any target nucleic acid. For this example, a collection of 4096 sequencing probes is hybridized with the target nucleic acid in 8 pools of 512 sequencing probes each. The 6-mer sequence in the target binding domain of the sequencing probe will hybridize along the length of the target nucleic acid at a position where there is a complete complementary match between the 6-mer and the target nucleic acid, such as Fig.10 . In this example, a single sequencing probe is hybridized to a target nucleic acid. Any unbound sequencing probe is washed out of the flow cell.

[0402] These sequencing probes also comprise a barcode domain having three attachment positions R1, R2 and R3 as described above. The attachment region within attachment position R1 comprises one or more nucleotide sequences corresponding to the first dinucleotide of the 6-mer of the sequencing probe. Thus, only reporter probes comprising complementary nucleic acids corresponding to the identity of the first dinucleotide present in the target binding domain of the sequencing probe hybridize to attachment position R1. Similarly, the attachment region within attachment position R2 of the sequencing probe corresponds to the second dinucleotide present in the target binding domain, and the attachment region within attachment position R3 of the sequencing probe corresponds to the second dinucleotide present in the target binding domain.

[0403] This method uses Fig.10 Continuing from the upper right figure. A pool of reporter probes is flowed into the flow chamber. Each reporter probe in the pool of reporter probes contains a detectable label in a two-color combination and a complementary nucleic acid that can hybridize to a corresponding attachment region within the attachment position R1 of the sequencing probe. As described above, the two-color combination and complementary nucleic acid of a particular reporter probe corresponds to one of 16 possible dinucleotides. Each reporter probe pool is designed so that a two-color combination corresponding to a specific dinucleotide is established prior to sequencing. For example, in Fig.10 In the sequencing experiment shown in , for the first reporter probe pool hybridized to the attachment position R1, the two-color combination yellow-red can correspond to the dinucleotide adenine-thymine. After the reporter probe hybridizes to the attachment position R1, as shown in Fig.10 As shown in the upper right panel of , any unbound reporter probe is then washed out of the flow chamber and the detectable label of the bound reporter probe is recorded to determine the identity of the first dinucleotide of the 6-mer.

[0404] Remove the detectable label attributed to the reporter probe hybridized to the attachment position R1. In order to remove the detectable label, the reporter probe can include a cleavable linker and an appropriate cleavage agent can be added. Alternatively, a complementary nucleic acid lacking a detectable label is hybridized to the attachment position R1 of the sequencing probe and replaces the reporter probe with a detectable label. Regardless of the method for removing the detectable label, the attachment position R1 no longer emits a detectable signal. The process by which the attachment position of the barcode domain that previously emitted a detectable signal is rendered no longer able to emit a detectable signal is referred to as "dimming" in this article.

[0405] A second pool of reporter probes is flowed into the flow chamber. Each reporter probe in the reporter probe pool contains a detectable label in a two-color combination and a complementary nucleic acid that can hybridize to a corresponding attachment region in attachment position R2 of the sequencing probe. The two-color combination and complementary nucleic acid of a particular reporter probe correspond to one of 16 possible dinucleotides. It is possible that a particular two-color combination corresponds to one dinucleotide in the context of the first reporter probe pool and to a different dinucleotide in the context of the second reporter probe pool. After the reporter probe hybridizes to attachment position R2, as Fig.10 As shown in the lower right panel of , any unbound reporter probe is then washed out of the flow cell and the detectable label is recorded to determine the identity of the second dinucleotide of the 6-mer present in the sequencing probe.

[0406] In order to remove the detectable label at position R2, the reporter probe can include a cleavable linker and an appropriate cleavage agent can be added. Alternatively, a complementary nucleic acid lacking a detectable label is hybridized to the attachment position R2 of the sequencing probe and the reporter probe with a detectable label is replaced. Regardless of the method for removing the detectable label, the attachment position R2 no longer emits a detectable signal.

[0407] Then the third pool of reporter probes is flowed into the flow chamber. Each reporter probe in the third pool of reporter probes contains a detectable label in a two-color combination and a complementary nucleic acid that can hybridize to a corresponding attachment region in attachment position R3 of the reporter probe. The two-color combination and complementary nucleic acid of a particular reporter probe correspond to one of 16 possible dinucleotides. After the reporter probe hybridizes to position R3, as Fig.10 As shown in the lower figure of , any unbound reporter probe is then washed out of the flow cell and the detectable label is recorded to determine the identity of the third dinucleotide of the 6-mer present in the sequencing probe. In this way, all three dinucleotides of the target binding domain are identified and can be assembled together to reveal the sequence of the target binding domain and therefore the sequence of the target nucleic acid.

[0408] In order to continue sequencing the target nucleic acid, any bound sequencing probe can be removed from the target nucleic acid. The sequencing probe can be removed from the target nucleic acid even if the reporter probe is still hybridized to position R3 of the barcode domain. Alternatively, the reporter probe hybridized to position R3 can be removed from the barcode domain before the sequencing probe is removed from the target binding domain, for example by using a dimming procedure as described above for the reporter at positions R1 and R2.

[0409] Fig.10The sequencing cycles shown in can be repeated any number of times, with each sequencing cycle starting with hybridization of the same sequencing probe pool to the target nucleic acid molecule, or hybridization of different sequencing probe pools to the target nucleic acid. It is possible that the position where the second sequencing probe pool binds to the target nucleic acid overlaps the position where the first sequencing probe or sequencing probe pool binds during the first sequencing cycle. Thus, certain nucleotides within the target nucleic acid can be sequenced more than once and using more than one sequencing probe.

[0410] Fig.11 A schematic diagram of a complete cycle of the sequencing method of the present disclosure is depicted, as well as the corresponding imaging data collected during the cycle. In this example, the sequencing probe used is Figure 1 Those depicted in , and the sequencing steps were the same as Fig.10 The same as those described above are depicted in FIG. After the sequencing domain of the sequencing probe is hybridized to the target nucleic acid, the reporter probe is hybridized to the first attachment position (R1) of the sequencing probe. The first reporter probe is then imaged to record the colored dots. Fig.11 In the figure, the colored dots are marked with dotted circles. The colored dots correspond to a single sequencing probe recorded during a complete cycle. In this example, 7 sequencing probes (1 to 7) are recorded. The first attachment position of the barcode domain is then dimmed, and the dual fluorescent reporter probe is hybridized with the second attachment position (R2) of the sequencing probe. The second reporter probe is then imaged to record the colored dots. The second attachment position of the barcode domain is then dimmed, and the dual fluorescent reporter probe is hybridized with the third attachment position (R3) of the sequencing probe. The third reporter probe is then imaged to record the colored dots. The three colored dots from each sequencing probe 1 to 7 are then arranged in order. Each color spot is then mapped to a specific dinucleotide using a decoding matrix to reveal the sequence of the target binding domain of sequencing probes 1 to 7.

[0411] During a single sequencing cycle, the number of reporter probe pools required to determine the target binding domain sequence of any sequencing probe bound to the target nucleic acid is equal to the number of attachment positions in the barcode domain. Thus, for a barcode domain with three positions, three reporter probe pools are cycled through the sequencing probe.

[0412] The sequencing probe pool may include multiple sequencing probes that are all identical in sequence, or multiple sequencing probes that are not all identical in sequence. When the sequencing probe pool includes multiple sequencing probes that are not all identical in sequence, each different sequencing probe may be present in the same number, or different sequencing probes may be present in different numbers.

[0413] Fig.12An exemplary sequencing probe pool configuration of the present disclosure is shown, wherein the 8 color combinations specified above are used to design 8 different sequencing probe pools when the sequencing probe contains: (a) a target binding domain having 6 nucleotides (6-mers) that specifically bind to a target nucleic acid, and (b) three attachment positions (R1, R2, and R3) in the barcode domain. There are 4096 possible unique 6-mer sequences (4x4x4x4x4x4x4=4096). Given that each of the three attachment positions in the barcode domain can hybridize with a complementary nucleic acid bound by one of the 8 different color combinations, there are 512 unique sets of possible 3-color combinations (8*8*8=512). For example, for a probe in which R1 hybridizes with a complementary nucleic acid bound by color combination GG, R2 hybridizes with a complementary nucleic acid bound by color combination BG, and R3 hybridizes with a complementary nucleic acid bound by color combination YR, the set of 3-color combinations is GG-BG-YR accordingly. In the sequencing probe pool, each unique set of 3-color combinations corresponds to a unique 6-mer in the target binding domain. Given that each pool contains 512 unique 6-mers and there are a total of 4096 possible 6-mers, 8 pools are required to sequence all possible 6-mers (4096 / 512=8). Determine the specific sequencing probes placed in each of the 8 pools to ensure optimal hybridization of each sequencing probe with the target nucleic acid. To ensure optimal hybridization, take several precautions including the following: (a) separate the complete 6-mer complement into different pools; (b) separate the 6-mers with high Tm and low Tm into different pools; and (c) separate the 6-mers into different pools based on empirically known hybridization patterns.

[0414] Fig.13 The differences between the sequencing probes described in U.S. Patent Publication No. 20160194701 and the sequencing probes of the present disclosure are shown. Fig.13 As shown in the left figure of , U.S. Patent Publication No. 20160194701 describes a sequencing probe with a barcode domain that contains six attachment sites for hybridization with complementary nucleic acids. Each complementary nucleic acid is bound to one of four different fluorescent dyes. In this configuration, each color (red, blue, green, yellow) corresponds to a nucleotide (A, T, C, or G) in the target binding domain. This probe design produces 4096 unique probes (4^6). Fig.13 As depicted in the right figure of , in one example of the present disclosure, the barcode domain of each sequencing probe comprises three attachment positions for hybridizing with complementary nucleic acids, such as Fig.13As depicted in the right figure of . Unlike U.S. Patent Publication No. 20160194701, these complementary nucleic acids are bound by one of 8 different color combinations (GG, RR, GY, RY, YY, RG, BB, and RB). Each color combination corresponds to a specific dinucleotide in the target binding domain. This configuration produces 512 unique probes (8^3). In order to cover all possible hexamer combinations (4096) within the target binding domain, 8 separate pools of these 512 unique probes are required to sequence the entire target nucleic acid. Since 8 color combinations are used to mark complementary nucleic acids, but there are 16 possible dinucleotides, certain color combinations will correspond to different dinucleotides, depending on which sequencing probe pool is to be used. For example, in Fig.13 In the 1st, 2nd, 3rd and 4th sequencing probe pools, the color combination BB corresponds to the dinucleotide AA, and the color combination GG corresponds to the dinucleotide AT. In the 5th, 6th, 7th and 8th sequencing probe pools, the color combination BB corresponds to the dinucleotide CA, and the color combination CT corresponds to the dinucleotide AT.

[0415] A variety of sequencing probes (i.e., more than one sequencing probe) can hybridize within the sequencing window. During sequencing, the identity and spatial position of the detectable label bound to each sequencing probe in the multiple hybridized sequencing probes are recorded. This allows both the position and identity of multiple dinucleotides to be subsequently identified. In other words, by hybridizing a variety of sequencing probes to a single target nucleic acid molecule simultaneously, multiple positions along the target nucleic acid can be sequenced simultaneously, improving sequencing speed.

[0416] In some aspects, a single sequencing probe can hybridize with the captured target nucleic acid molecule. In some aspects, multiple sequencing probes can hybridize with the captured target nucleic acid molecule. The sequencing window between the 5' and 3' capture probes of the two hybridizations can allow the hybridization of a single sequencing probe or multiple sequencing probes along the length of the target nucleic acid molecule. By hybridizing multiple sequencing probes along the length of the target nucleic acid molecule, more than one position on the target nucleic acid molecule can be sequenced simultaneously, improving the sequencing speed. The fluorescent signals of the individual probes from the multiple probes combined along the length of the target nucleic acid can be spatially resolved.

[0417] In some aspects, the sequencing probes can be bound at uniform intervals along the length of the target nucleic acid. In some aspects, the sequencing probes need not be bound at uniform intervals along the length of the target nucleic acid. The signals from the multiple sequencing probes bound along the length of the target nucleic acid can be spatially resolved to simultaneously obtain sequencing information at multiple positions of the target nucleic acid.

[0418] The distribution of probes along the length of target nucleic acid is crucial for the resolution of detectable signals. Sometimes too many probes in a certain area can cause the overlap of its detectable label, thereby preventing the resolution of two nearby probes. This is explained as follows. In view of the fact that a nucleotide length is 0.34 nm, and in view of the lateral (xy) spatial resolution of the sequencing device is about 200nm, the resolution limit of the sequencing device is about 588 base pairs (that is, 1 nucleotide / 0.34nm x 200nm). In other words, when the two probes are within about 588 base pairs of each other, the sequencing device mentioned above will not be able to distinguish the signals from the two probes hybridized with the target nucleic acid. Therefore, depending on the resolution of the sequencing device, the two probes will need to be spaced apart by about 600bp, and their detectable labels can be resolved as different "sites" afterwards. Therefore, under the optimal interval, a single probe should be present in every 600bp target nucleic acid. Preferably, every kind of sequencing probe in the probe colony will not be close to 600 nucleotides and will bind to each other. Various software methods (e.g., using fluorescence intensity values ​​and wavelength-dependent ratios) can be used to monitor, limit, and potentially deconvolute the number of probes that hybridize within a resolvable region of a target nucleic acid, and design probe populations accordingly. In addition, detectable labels (e.g., fluorescent labels) can be selected that provide more discrete signals. In addition, the literature (e.g., Small and Parthasarthy: "Superresolution localization methods." Annu. Rev. Phys Chem ., 2014; 65: 107-25), describes structured illumination and various super-resolution methods that reduce the resolution limit of sequencing microscopes to 10 nanometers. The use of higher resolution sequencing devices allows the use of probes with shorter target binding domains.

[0419] As mentioned above, the design of probe Tm can affect the number of probes hybridized with the target nucleic acid.Alternately or additionally, the sequencing probe concentration in the colony can be increased to increase the probe coverage in the specific region of the target nucleic acid.The concentration of sequencing probes can be reduced to reduce the probe coverage in the specific region of the target nucleic acid, for example, above the resolution limit of the sequencing device.

[0420] Although the resolution limit about two detectable labels is about 600 nucleotides, this does not hinder the powerful sequencing method of the present disclosure. In some aspects, a variety of sequencing probes in any population are not separated by 600 nucleotides on the target nucleic acid. However, statistically (following Poisson distribution), there is a target nucleic acid with only a kind of sequencing probe combined with it, and the sequencing probe is optically resolvable. For a target nucleic acid with multiple probes combined within 600 nucleotides (and therefore not optically resolvable), the data about these indistinguishable sequencing probes may be discarded. Importantly, the method of the present disclosure provides multiple rounds of combining and detecting a variety of sequencing probes. Therefore, it is possible to detect signals from all sequencing probes in several rounds, only detect signals from a part of sequencing probes in several rounds, and do not detect signals from any sequencing probes in several rounds. In some aspects, the distribution of the sequencing probes combined with the target nucleic acid can be manipulated (for example, by controlling concentration or dilution) so that each target nucleic acid is only combined with a kind of sequencing probe.

[0421] Stochastically, but depending in part on the length of the target binding domain, the Tm of the probe, and the applied probe concentration, it is possible for two different sequencing probes in a population to bind within 600 nucleotides of each other.

[0422] Alternatively or additionally, the sequencing probe concentration in the population can be reduced to reduce probe coverage in specific regions of the target nucleic acid, e.g., above the resolution limit of the sequencing device, thereby generating single reads from resolution-limited sites.

[0423] If the sequence or portion of the sequence of a target nucleic acid is known prior to sequencing the target nucleic acid using the methods of the present disclosure, sequencing probes can be designed and selected such that no two sequencing probes bind to the target nucleic acid within 600 nucleotides of each other.

[0424] Before the sequencing probe is hybridized with the target nucleic acid, one or more complementary nucleic acid molecules can be combined by the first detectable label, and at least the second detectable label can be hybridized with one or more attachment positions in the barcode structure domain of the sequencing probe. For example, before hybridizing with the target nucleic acid, one or more complementary nucleic acid molecules combined by the first detectable label and at least the second detectable label can be hybridized with the first attachment position of each sequencing probe. Therefore, when contacting with its target nucleic acid, the sequencing probe can emit a detectable signal from the first attachment position, and there is no need to provide a first pool of complementary nucleic acids or reporter probes pointing to the first position on the barcode structure domain. In another example, one or more complementary nucleic acid molecules combined by the first detectable label and at least the second detectable label can be hybridized with all attachment positions in the barcode structure domain of the sequencing probe. Therefore, in this example, six nucleotide sequences can be read without sequentially replacing complementary nucleic acids. Since many steps of the method are omitted, the time to obtain sequence information will be reduced using this pre-hybridized sequencing probe-reporter probe complex. However, this probe will benefit from non-overlapping detectable labels, such as fluorophores excited by non-overlapping wavelengths of light or fluorophores emitting non-overlapping wavelengths of light.

[0425] In some aspects of the methods of the present disclosure, the signal intensity from the recorded colored dots can be used to more accurately sequence the target nucleic acid. In some aspects, the site intensity of a specific color within a colored dot can be used to determine the probability that a specific colored dot corresponds to a color combination that is a repeat of one color (i.e., BB, GG, YY, or RR).

[0426] Darkening of a position within the barcode domain can be achieved by strand cleavage at a cleavable linker modification present within the reporter probe that hybridizes to that position. Fig.14 Depicted is the use of cleavable adapter modifications to darken barcode positions during sequencing cycles. Fig.14 The first step, depicted on the leftmost figure of , comprises hybridizing the primary nucleic acid of the reporter probe to the first attachment position of the sequencing probe. The primary nucleic acid hybridizes to a specific complementary sequence within the attachment region of the first position of the barcode domain. The first domain and the second domain of the primary nucleic acid are covalently linked via a cleavable linker modification. In a second step, the detectable label is then recorded to determine the identity and position of the specific dinucleotide in the target binding domain of the sequencing probe. In a third step, the first position of the barcode domain is darkened by cleaving the reporter probe at the cleavable linker modification. This releases the second domain of the primary nucleic acid and thereby the detectable label. The first domain of the primary nucleic acid molecule, now lacking any detectable label, is kept hybridized to the first attachment position of the barcode domain such that the first position of the barcode domain no longer emits a detectable signal and will not be able to hybridize with any other reporter probe in subsequent sequencing steps. In the Fig.14 In the final step, depicted in the rightmost figure, a reporter probe is hybridized to a second position of the barcode domain to continue sequencing.

[0427] The attachment position of the barcode domain can be darkened by displacing any secondary or tertiary nucleic acid in the reporter probe that is bound by a detectable label, while still allowing the primary nucleic acid molecule of the reporter probe to remain hybridized to the sequencing probe. This displacement can be achieved by hybridizing to a primary, secondary, or tertiary nucleic acid that is not bound by a detectable label. Fig.15 is an illustrative example of an exemplary sequencing cycle of the present disclosure, in which positions within the barcode domain are dimmed by displacement of a labeled secondary nucleic acid. Fig.15 The leftmost figure of depicts the beginning of a sequencing cycle, wherein the primary nucleic acid molecule of the reporter probe is hybridized to the first attachment position of the barcode domain of the sequencing probe. The secondary nucleic acid molecule bound to the detectable label is then hybridized to the primary nucleic acid molecule, and the detectable label is recorded. In order to dim the first position of the barcode domain, the secondary nucleic acid molecule bound to the detectable label is replaced by a secondary nucleic acid molecule lacking the detectable label. In the next step of the sequencing cycle, the reporter probe comprising the detectable label is hybridized to the second position of the barcode domain.

[0428] The attachment position of the barcode domain can be darkened by displacing any primary nucleic acid molecule of the reporter probe by hybridizing with the sequencing probe at the corresponding barcode domain attachment position where the nucleic acid is not bound by the detectable label. In the case where the barcode domain comprises at least one single-stranded nucleic acid sequence adjacent to or flanking at least one attachment position, the nucleic acid not bound by the detectable label can displace the primary nucleic acid molecule by hybridizing with the flanking sequence and a portion of the barcode domain occupied by the primary nucleic acid molecule. If desired, the exchange rate of the detectable label can be accelerated by incorporating a small single-stranded oligonucleotide (e.g., a "toehold" probe; see, e.g., Seeling et al., "Catalyzed Relaxation of a Metastable DNA Fuel"; J. Am. Chem. Soc . 2006, 128(37), pp. 12211-12220), which can accelerate the rate of detectable label exchange.

[0429] Complementary nucleic acid or reporter probes comprising a detectable label can be removed from the attachment region, rather than being replaced by a hybrid nucleic acid lacking a detectable label. For example, this can occur by adding a chaotropic agent, raising the temperature, changing the salt concentration, adjusting the pH and / or applying a hydrodynamic force. In these examples, less reagents (i.e., hybrid nucleic acids lacking a detectable label) are needed.

[0430] The method of the present disclosure can be used to simultaneously capture and sequence RNA and DNA molecules from the same sample, including mRNA and gDNA. Capture and sequencing of both RNA and DNA molecules from the same sample can be performed in the same flow chamber. In some aspects, the method of the present disclosure can be used to simultaneously capture, detect and sequence both gDNA and mRNA from FFPE samples.

[0431] The sequencing method of the present disclosure further comprises the following steps: assembling each identified nucleotide linear order for each region of the fixed target nucleic acid, thereby identifying the sequence of the fixed target nucleic acid. The assembling step uses a non-transitory computer-readable storage medium on which an executable program is stored. The program instructs the microprocessor to arrange each identified nucleotide linear order for each region of the target nucleic acid, thereby obtaining the sequence of the nucleic acid. Assembly can occur in "real time", that is, while collecting data from the sequencing probe, rather than after all data has been collected or after data acquisition is completed.

[0432] The original specificity of the sequencing method of the present disclosure is about 94%. The accuracy of the sequencing method of the present disclosure can be increased to about 99% by sequencing the same base in the target nucleic acid with more than one sequencing probe. Fig.16 Depicted is how the sequencing methods of the present disclosure allow the same base of a target nucleic acid to be sequenced with different sequencing probes. The target nucleic acid in this example is a fragment of NRAS exon 2 (SEQ ID NO: 1). The specific base of interest is cytosine (C) highlighted in the target nucleic acid. The base of interest will hybridize with two different sequencing probes, each probe having a unique footprint that hybridizes with the target nucleic acid. In this example, sequencing probes 1 to 4 (barcodes 1 to 4) bind to the 3 nucleotides to the left of the base of interest, while sequencing probes 5 to 8 (barcodes 5 to 8) bind to the 5 nucleotides to the left of the base of interest. Therefore, the base of interest will be sequenced by two different probes, thereby increasing the amount of base recognition for that specific position, and thereby increasing the overall accuracy at that specific position. Fig.17 It is shown how multiple different base calls recorded from one or more sequencing probes at specific nucleotide positions on a target nucleotide can be combined to form a consensus sequence (SEQ ID NO: 2), thereby increasing the accuracy of the final base call.

[0433] The terms "Hyb&Seq chemistry," "Hyb&Seq sequencing," and "Hyb&Seq" refer to the methods of the present disclosure described above.

[0434] Arrays of the present disclosure and methods of using the same

[0435] The present disclosure provides compositions and methods for immobilizing nucleic acid molecules, including arrays and methods of using the arrays, as described in detail herein.

[0436] The present disclosure provides a composition comprising: a planar solid support substrate; a first layer on the planar solid support substrate; a second layer on the first layer; wherein the second layer comprises a plurality of nanopores, wherein each nanopore provides access to an exposed portion of the first layer, wherein each nanopore comprises a plurality of first oligonucleotides covalently attached to the exposed portion of the first layer.

[0437] The present disclosure provides a composition comprising: a planar solid support substrate; a first layer on the planar solid support substrate in contact with a first surface of the planar solid support substrate; a second layer on the first layer in contact with a second surface of the first layer, wherein the second surface of the first layer is not in contact with a surface of the planar solid support substrate; wherein the second layer comprises a plurality of nanopores, wherein each nanopore provides access to an exposed portion of the first layer, wherein each nanopore comprises a plurality of first oligonucleotides covalently attached to the exposed portion of the first layer.

[0438] The first layer may include a first surface in contact with a surface of the planar solid support substrate, and a second surface in contact with the second layer but not in contact with the surface of the planar solid support substrate.

[0439] The second layer may include a first surface in contact with a surface of the first layer, and a second surface exposed to the environment.

[0440] Fig.47 is a schematic cross-section of an exemplary array of the present invention. The array includes a planar solid support substrate 101, a first layer 102 on the planar solid support substrate 101, and a se...

Claims

1. An in vitro method for identifying the presence of a predetermined nucleotide sequence in a target nucleic acid, the method comprising (1) hybridizing a target binding domain of a first probe to a first region of a target nucleic acid, wherein the probe comprises a target binding domain and a barcode domain; wherein the target binding domain is at least 6 nucleotides in length and hybridizes to at least 6 complementary nucleotides in the target nucleic acid; wherein the barcode domain comprises a synthetic backbone, the barcode domain comprises at least three attachment sites, each attachment site comprising at least one attachment region comprising at least one nucleic acid sequence that hybridizes to a complementary nucleic acid molecule, and wherein the barcode domain consists of L-DNA, wherein each of the at least three attachment positions has a different nucleic acid sequence; (2) hybridizing a first complementary nucleic acid molecule comprising at least one first detectable label and at least one second detectable label to a first attachment position of the at least three attachment positions of the barcode domain; (3) identifying at least one first detectable label and at least one second detectable label of the first complementary nucleic acid molecule hybridized to the first attachment site; (4) removing at least one first detectable label and at least one second detectable label hybridized to the first attachment site; (5) hybridizing a second complementary nucleic acid molecule comprising at least one third detectable label and at least one fourth detectable label to a second attachment site of the at least three attachment sites of the barcode domain; (6) identifying at least one third detectable label and at least one fourth detectable label of the second complementary nucleic acid molecule hybridized to the second attachment site; (7) removing at least one third detectable label and at least one fourth detectable label hybridized to the second attachment site; (8) hybridizing a third complementary nucleic acid molecule comprising at least one fifth detectable label and at least one sixth detectable label to a third attachment position of the at least three attachment positions of the barcode domain; (9) Identifying at least one fifth detectable marker and at least one sixth detectable marker of the third complementary nucleic acid molecule hybridized to the third attachment position, thereby determining the presence of a predetermined nucleotide sequence based on the identity of at least one first detectable marker, at least one second detectable marker, at least one third detectable marker, at least one fourth detectable marker, at least one fifth detectable marker and at least one sixth detectable marker.

2. The method of claim 1, wherein the probe comprises a single-stranded DNA synthetic backbone and a double-stranded DNA spacer between the target binding domain and the barcode domain.

3. The method of claim 1, wherein the target binding domain is at least 8 nucleotides in length.

4. The method of claim 1, wherein the target binding domain is at least 10 nucleotides in length.

5. The method of claim 1, wherein the target binding domain is at least 12 nucleotides in length. The method of claim 1 , wherein the barcode domain is between 10 nucleotides and 100 nucleotides in length.

7. The method of claim 1, wherein the number of nucleotides in the target binding domain is greater than the number of attachment positions in the barcode domain.

8. The method of claim 7, wherein the barcode domain comprises at least four attachment sites.

9. The method of claim 1, wherein each attachment position in the barcode domain comprises an attachment region.

10. The method of claim 1, wherein at least one nucleic acid sequence at each attachment position in the barcode domain is 6 to 20 nucleotides in length.

11. The method of claim 1, wherein at least one nucleic acid sequence at each attachment position in the barcode domain is 9 nucleotides in length.

12. The method of claim 1, wherein at least one nucleic acid sequence at each attachment position in the barcode domain is 12 nucleotides in length.

13. The method of claim 1, wherein at least one nucleic acid sequence at each attachment position in the barcode domain is 14 nucleotides in length.

14. The method of claim 1, wherein at least one nucleic acid sequence at each attachment position in the barcode domain is 16 nucleotides in length.

15. The method of claim 1, wherein at least one nucleic acid sequence at each attachment position comprises a 3' terminal guanosine nucleotide.

16. The method of claim 1, wherein at least one nucleic acid sequence of each attachment position comprises at least one adenine nucleotide, at least one thymine nucleotide, at least one cytosine nucleotide, or any combination thereof, and a 3' terminal guanosine nucleotide.

17. The method of claim 1, wherein each of the at least 12 nucleotides of the target binding domain is D-DNA.

18. The method of claim 1, wherein steps (4) and (5) occur sequentially or simultaneously.

19. The method of claim 1, wherein steps (7) and (8) occur sequentially or simultaneously.

20. The method of claim 1, wherein the first detectable label and the second detectable label have the same emission spectrum.

21. The method of claim 1, wherein the first detectable label and the second detectable label have different emission spectra.

22. The method of claim 1, wherein the third detectable label and the fourth detectable label have the same emission spectrum.

23. The method of claim 1, wherein the third detectable label and the fourth detectable label have different emission spectra.

24. The method of claim 1, wherein the fifth detectable label and the sixth detectable label have the same emission spectrum.

25. The method of claim 1, wherein the fifth detectable label and the sixth detectable label have different emission spectra.

26. The method of claim 1, wherein the first complementary nucleic acid molecule, the second complementary nucleic acid molecule, and the third complementary nucleic acid molecule each comprise a cleavable linker.

27. The method of claim 1, wherein the first complementary nucleic acid molecule comprises a reporter probe, the reporter probe comprising a primary nucleic acid, wherein the primary nucleic acid molecule comprises at least two domains, a first domain that hybridizes to the first attachment site of the barcode domain, and a second domain hybridized to six secondary nucleic acid molecules, wherein each of the secondary nucleic acid molecules hybridizes to five tertiary nucleic acid molecules, wherein each of the tertiary nucleic acid molecules comprises a detectable label.

28. The method of claim 27, wherein the primary nucleic acid molecule comprises a cleavable linker between the first domain and the second domain.

29. The method of claim 28, wherein the cleavable linker is a photocleavable linker.

30. The method of claim 27, wherein each secondary nucleic acid molecule comprises at least two domains, a first domain that hybridizes to a second domain of a primary nucleic acid molecule; and A second domain that hybridizes to five tertiary nucleic acid molecules.

31. The method of claim 30, wherein each secondary nucleic acid molecule comprises a cleavable linker between the first domain and the second domain.

32. The method of claim 31, wherein the cleavable linker is a photocleavable linker.

33. The method of any one of claims 28, 29, 31 and 32, wherein removing at least one first detectable label and at least one second detectable label hybridized to the first attachment location comprises cutting the cleavable linker between the first domain and the second domain of the primary nucleic acid, cutting the cleavable linker between the first domain and the second domain of each secondary nucleic acid, or any combination thereof.

Images