System and method for supporting multiple automated workflows

Abstract

Systems and methods for automating workflows include assigning a first set of targets to an uncompiled first workflow. The uncompiled first workflow specifies a first set of processing modules. Each such module is associated with a subset of unit operations. Each unit operation includes a time interval and specifies an instrument. For each target in the first set of targets, the uncompiled workflow is translated into an instance of a compiled first workflow that includes a linear time sequence of unit operations, each unit operation including an execution instruction for an addressed instrument. A second set of targets is obtained and a second uncompiled workflow is assigned to it. Compilation of the second uncompiled workflow for each second target produces a different instance of a compiled second workflow. Each second compiled workflow includes a linear time sequence of unit operations, wherein each unit operation includes an execution instruction for an addressed instrument and specifies a time interval.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to U.S. Patent Application No. 16 / 045,647, filed on July 25, 2018, entitled “Systems and Methods for Supporting Multiple Automated Work-Flows,” which in turn claims priority to U.S. Provisional Patent Application No. 62 / 448,948, filed on January 20, 2017, entitled “Systems and Methods for Supporting Multiple Automated Work-Flows and Changing Between Them,” each of which is hereby incorporated by reference in its entirety.

[0003] Sequence Listing

[0004] This application contains a sequence listing, which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. The ASCII copy created on January 22, 2018 is named 120568-5001-WO_ST25.txt and is 559 bytes in size. Technical Field

[0005] The present disclosure relates to systems and methods for supporting a biofoundry. More specifically, the present disclosure relates to systems and methods for a fully automated workflow using a biofoundry. Background Art

[0006] Electronic devices and components (hereinafter referred to as "instruments") have found numerous applications in chemistry and biology (more generally, the "life sciences"), particularly for detecting and measuring various chemical and biological reactions and for identifying, detecting and measuring various compounds, as well as synthesizing these compounds, to name just a few applications. Biofoundries, which contain laboratory instruments that communicate electronically with each other, are increasingly being used to automate and process these applications. Biofoundries can be complex and expensive. In addition, the efficient use of these foundries presents difficult scheduling problems. For example, two different processes operated at a foundry may require the use of the same instrument. Without regard to scheduling, conflicts may arise when two different processes require the same instrument. In addition, without regard to scheduling, foundries may be underutilized because foundries handle tasks at some form of minimum standard associated with the foundry.

[0007] During foundry operations, instruments must be precisely controlled to ensure proper use, while research materials require careful handling to prevent contamination or spills. Typically, research scientists are responsible for manually handling samples and actively operating instruments. Research scientists must plan, weigh, and dispense sample batches; sterilize and clean instruments; and then place sample batches into various instruments. Due to human nature, these sample batches are often inefficiently planned, inaccurately weighed, contaminated, or dripped; any of which can compromise workflow.

[0008] Given the depth and complexity that foundries can handle, consider the use of transcription activator-like effector nucleases (TALENs), a highly efficient and programmable genome editing tool that has been applied to a wide range of organisms (Sun et al., 2012, "Recent Advances in Targeted Genome Organic Engineering in Mammalian Systems", Biotechnol J 7(9), p. 1074). TALENs contain a FokI DNA cleavage domain and a DNA binding domain (DBD) with tandem repeats of a 33-35 amino acid (aa) motif. The twelfth and thirteenth amino acid residues within each repeat are called repeat variable diresidues (RVDs), and they determine the DNA binding specificity of the repeat. By sequentially assembling repeats with specific RVDs, the TAL effector DBD can bind to specific DNA sequences (Boch, 2011, "TALEs of genome targeting", Nat Biotechnol 29(2), p. 135). Because the FokI cleavage domain functions as a dimer, TALENs are often used in tail-to-tail heterodimer pairs to generate double-strand breaks for genome editing (Miller et al., 2011, "A TALE nuclease architecture for efficient genome editing", Nature Biotechnology 29(2), p. 143). This heterodimer design produces high editing efficiency and improves specificity, but also poses challenges in TALEN synthesis and use.Many methods have been developed to synthesize TALEN expression DNA vectors (Briggs et al., 2012, "Iterative capped assembly: rapid and scalable synthesis of repeat-module DNA such as TAL effectors from individual monomers", Nucleic Acids Research, 40(15), e117; Reyon et al., 2012, "FLASH assembly of TALENs for high-throughput genome editing", Nature Biotechnology, 30(5), p. 460; Ding et al., 2013, "A TALEN genome-editing system for generating human stem cell-based disease models", Cell Stem Cell. (Kim et al., 2013, “A library of TAL effector nucleases spanning the human genome”, Nature Biotechnology, 31(3), p. 251; Schmid-Burgk et al., 2013, “A ligation-independent cloning technique for high-throughput assembly of transcription activator-like effector genes”, Nature Biotechnology, 31(1), p. 76).

[0009] Using an optimized set of four-base pair linkers and a pre-assembled library of double repeat segments, a one-step assembly protocol was developed based on the Golden Gate method using the foundry (Liang et al., 2014, "FairyTALE: A High-throughput TAL Effector Synthesis Platform", ACS Synth Biol, 3(2), p. 67). Custom TALEN vectors can be constructed within 24 hours with a 96% success rate and a material cost of five dollars. However, these methods can only assemble vectors containing a single TALE-FokI monomer. Since TALEN requires heterodimers for cleavage, the two monomers are introduced into the host cell on two separate vectors or a single subcloning vector with two monomers. Either option has obvious disadvantages. For example, they both require the synthesis of vectors with twice the number of target sequences. When the monomers are on separate vectors, the number of cells transfected or transformed with the two monomers can be reduced. More importantly, the dual vector protocol makes it very difficult to perform high-throughput genetic screening. Due to fluorescence activated cell sorting (FACS) and next generation sequencing, a large number of cells with different genotypes can be screened for target phenotypes and sequenced (Shalem et al., 2014, "Genome-scale CRISPR-Cas9 knockout screening in human cells", Science, 343(6166), p. 84; Wang et al., 2014, "Genetic Screens in Human Cells Using the CRISPR-Cas9 System", Science, 343(6166), p. 80). As a precise genome editing tool, TALEN can potentially be used to generate genome knockout libraries. However, because the two monomers of each TALEN pair need to be introduced into the same cell, library transfection or transformation is not possible using a dual vector system. In addition, the current method of constructing a single vector TALEN requires a lengthy and complex subcloning process, which makes it difficult to scale up the synthesis process. High-throughput synthesis methods of single-carrier TALENs using the Foundry will open up new possibilities.

[0010] Therefore, prior to the present disclosure, there was a need for a fully automated platform for customizing TALENs in a general purpose biofoundry. This is just one example of the many needs for an improved biofoundry.

[0011] The information disclosed in this Background section is only for enhancement of understanding of the general background of the invention and should not be considered as an acknowledgement or any form of suggestion that this information forms the prior art already known to a person skilled in the art. Summary of the invention

[0012] Advantageously, the systems and methods for supporting a fully automated workflow detailed in the present disclosure address the shortcomings of the prior art discussed above.

[0013] Transcription activator-like effector nuclease (TALEN) is a programmable genome editing tool with wide application. Since TALEN cuts DNA in the form of heterodimers, a pair of TALEN must be synthesized for each target genomic locus. Typically, TALEN pairs are expressed on separate vectors or synthesized separately and then subcloned into the same vector. Both methods do not allow high-throughput construction of TALEN libraries for large-scale applications. Here, we propose a single-step assembly scheme to synthesize and express a pair of TALEN in a single transcription format with the help of a P2A self-cleavage sequence. In addition, we have developed a fully automated platform for customizing TALEN in a general biological foundry. Using the systems and methods disclosed in the present invention, each pair can synthesize four hundred pairs of TALEN at a reasonable material cost with a success rate of more than 96.2%. This platform opens the door to TALEN-based whole genome studies and many other applications in life sciences.

[0014] Based on our previously published “FairyTALE” protocol (Liang et al., 2014, “FairyTALE: A high-throughput TAL effector synthesis platform”, ACS Synthetic Biology, 3(2), p. 67), we attempted to assemble a pair of TALEN monomers onto a single vector in a one-step reaction. In previous work, 2A self-cleaving peptides (Donnelly et al., 2004, “Multiple gene products from a single vector: ‘self-cleaving’ 2A peptides,” Gene Ther, 11(23), p. 1673; Kim et al., 2011, “High Cleavage Efficiency of a 2A Peptide Derived from Porcine Teschovirus-1 in Human Cell Lines, Zebrafish and Mice,” PLoS One, 6(4)) were used to co-transcribe a pair of TALENs as one mRNA molecule but translate into separate functional proteins (Cermak et al., 2015, “High-frequency, precise modification of the tomato genome,” Genome Biol. Biol, 16, p. 232; Mariano et al., 2014, “Highly efficient genome editing via 2A-coupled co-expression of two TALEN monomers”. BMC Res Notes, 7, p. 628; Xu et al., 2013, “Targeted myostatin gene editing in multiple mammalian species directed by a single pair of TALE nucleases”, Mol Ther Nucleic Acids, 2, e112).We implemented this co-expression strategy in a 15-insert one-pot assembly protocol and assembled single-plasmid TALENs in one step with over 87.7% fidelity. TALENs synthesized using this one-step single transcription design have comparable cleavage activity in mammalian cells to those synthesized using a dual-plasmid design. We performed the synthesis on iBioFAB (Illinois Biofoundry for Advanced Biomanufacturing), an integrated and versatile robotic system to fully automate the synthesis process. According to the present disclosure, four hundred pairs of TALENs can be generated per day at a material cost of $2.1 per pair with minimal human intervention. We envision that whole-genome studies using TALENs can be scaled up to screen hundreds of loci in parallel with this simplified design and automated synthesis.

[0015] Accordingly, various aspects of the present disclosure are directed to providing systems and methods for supporting multiple automated workflows in a biofoundry.

[0016] One aspect of the present disclosure provides a non-transitory computer-readable storage medium for implementing a workflow. The non-transitory computer-readable storage medium stores instructions that, when executed by a first device, cause the first device to obtain a first plurality of organic engineering targets and assign the first plurality of organic engineering targets to a first uncompiled workflow. The first uncompiled workflow is configured to generate a first plurality of organic engineering targets and is associated with a first subset of processing modules in a plurality of processing modules. Each corresponding processing module in a plurality of processing modules is associated with a different subset of unit operation definitions in a plurality of unit operation definitions. Each corresponding unit operation definition in a plurality of unit operation definitions is independently associated with a corresponding time interval. Each corresponding unit operation definition in a plurality of unit operations is independently associated with a first subset of instruments in a plurality of instruments (e.g., a biofoundry).

[0017] The instructions further cause the first device to translate the first uncompiled workflow into a corresponding instance of the compiled first workflow of the corresponding organic engineering target for each corresponding organic engineering target in the first plurality of organic engineering targets. The corresponding instance of the compiled first workflow includes the address of the corresponding instrument and one or more execution instructions for the corresponding instrument, and the first plurality of unit operations for each corresponding instrument in the first subset of instruments. The first plurality of unit operations are organized into a linear time sequence in time. Each corresponding unit operation in the first plurality of unit operations is characterized by a time interval defined by the corresponding unit operation, thereby forming a plurality of instances of the compiled first workflow.

[0018] In addition, the instruction further causes the first device to obtain a second plurality of organic engineering targets and assign the second plurality of organic engineering targets to the second uncompiled workflow. The second uncompiled workflow is configured to generate a second plurality of organic engineering targets and is associated with a second subset of processing modules in a plurality of processing modules. The instruction further causes the first device to translate the second uncompiled workflow into a corresponding instance of the compiled second workflow of the corresponding organic engineering target for each corresponding organic engineering target in the second plurality of organic engineering targets. The corresponding instance of the compiled second workflow contains the address of the corresponding instrument and one or more execution instructions for the corresponding instrument, and a second plurality of unit operations for each corresponding instrument in the second subset of instruments. The second plurality of unit operations are organized into a linear time sequence in time. Each corresponding unit operation in the second plurality of unit operations is characterized by a time interval defined by the corresponding unit operation. The time interval of the unit operation in the second plurality of unit operations is adjusted by a certain amount from the time interval defined by the corresponding unit operation according to the determination of the interlocking condition with the unit operation in the first compiled workflow, thereby forming multiple instances of the compiled second workflow.

[0019] In some embodiments, the first or second uncompiled workflow is selected from the group consisting of cloning, evolutionary organismal engineering, genome organismal engineering, genotyping, library screening, pathway construction, and protein organismal engineering.

[0020] In some embodiments, the plurality of processing modules comprises two or more processing modules selected from the group consisting of cell culture, DNA assembly, DNA purification, DNA quantification, standardization, polymerase chain reaction (PCR), protein extraction, sample analysis, sample preparation, sampling and transformation. In some embodiments, the plurality of processing modules comprises three or more processing modules selected from the group consisting of the above processing modules.

[0021] In some embodiments, the plurality of unit operation definitions include two or more unit operation definitions from the set of centrifugation, cryoincubation, chromatography, colony selection, colony isolation, partitioning, electrophoresis, electroporation, heat incubation, labeling, magnetic separation, mass spectrometry, stripping, pipetting, plate reading, sealing, shaking incubation, spectrophotometry, and thermal cycling. In some embodiments, the plurality of unit operation definitions include three or more unit operation definitions from the above set of unit operation definitions.

[0022] In some embodiments, the plurality of instruments comprises two or more instruments from a collection of a liquid handling robot, a temperature control block, a microplate reader, a refrigerated incubator, a heated incubator, a shaking incubator, a reagent dispenser, a plate centrifuge, a storage carousel, a decapsulation station, a hair dryer, a plate sealer, a label printer, a pipetting device, a vibrator, a light box, and a camera. In some embodiments, the plurality of instruments comprises three or more instruments from the above-mentioned instrument collection. In some embodiments, the plurality of instruments comprises four or more instruments from the above-mentioned instrument collection. In some embodiments, the plurality of instruments comprises five or more instruments from the above-mentioned instrument collection.

[0023] In some embodiments, the address of the corresponding instrument comprises the Cartesian coordinates, polar coordinates, spherical coordinates, joint coordinates or tool coordinates of the corresponding instrument. In some embodiments, the address of the corresponding instrument comprises the physical location of the corresponding instrument. In some embodiments, the address of the corresponding instrument comprises the unique electronic address of the corresponding instrument.

[0024] In some embodiments, the corresponding instance of the corresponding compilation workflow further includes an operation condition of the corresponding instruction.

[0025] In some embodiments, the non-transitory computer-readable storage medium further stores instructions for enabling a user of the first device (e.g., via a graphical user interface) to adjust the linear time order of the first plurality of unit operations. In some embodiments, the non-transitory computer-readable storage medium further stores instructions for enabling a user of the first device to adjust the linear time order of the first plurality of unit operations without using a graphical user interface.

[0026] In some embodiments, the translating further comprises validating the plurality of unit operations according to a predetermined validation list. The predetermined validation list comprises one or more criteria of the compiled second workflow. In some embodiments, the one or more criteria of the compiled second workflow comprises a priority of each unit operation in the second plurality of unit operations, a weight of each unit operation in the second plurality of unit operations, a completion time of the second plurality of unit operations, compatibility of the second plurality of unit operations with a different plurality of unit operations, attributes of each unit operation in the second plurality of unit operations, and one or more constraints of the second plurality of unit operations.

[0027] In some embodiments, the attribute of each unit operation in the second plurality of unit operations is selected from the group consisting of a viscosity value, a purity value, a composition value, a temperature value, a weight value, a mass value, and a volume value.

[0028] In some embodiments, the first device is in electronic communication with at least one transport path coupled to a plurality of instruments for receiving samples from the plurality of instruments and returning samples to the plurality of instruments. In some embodiments, the transport path comprises at least one transport device configured to move around the transport path, and a physical storage medium disposed on at least one transport device. In some embodiments, at least one transport device comprises a robotic arm, a ground vehicle, an unmanned aircraft, a conveyor belt, a transfer station, an elevator, a crane, a lift, or a combination thereof. In some embodiments, at least one transport device further comprises a liquid handling robot.

[0029] In some embodiments, a second plurality of organic engineering targets is determined based on the compiled outputs of the plurality of instances of the first workflow.

[0030] In some embodiments, each organic engineered target of the first plurality of organic engineered targets is an input to a corresponding instance of the compiled first workflow of the plurality of instances of the compiled first workflow.

[0031] In some embodiments, each organic engineered target in the first plurality of organic engineered targets is an output of a corresponding instance of the compiled first workflow in the plurality of instances of the compiled first workflow.

[0032] In some embodiments, each organically engineered target in the first plurality of organically engineered targets is a composition of nucleic acid components.

[0033] In some embodiments, each of the first plurality of organically engineered targets is a plurality of agents of nucleic acid composition.

[0034] In some embodiments, each corresponding compiled workflow in the plurality of instances of the compiled first workflow is a scheme for synthesizing and expressing a pair of TALENs in a single transcript format by a P2A self-cleaving sequence. In some embodiments, at least 400 pairs of TALENs are expressed at a 24 hour interval.

[0035] In some embodiments, when executed by the first device, the instructions further cause the first device to export the output of the corresponding instance of the compiled first workflow to the second device.

[0036] In some embodiments, the first device communicates with at least one external control server or an external database server.

[0037] In some embodiments, when executed by the first device, the instructions further cause the first device to save workflow data describing the data of the executed instructions.

[0038] In some embodiments, the non-transitory computer-readable storage medium further includes instructions for concurrently executing the one or more instances of the compiled first workflow and the one or more instances of the compiled second workflow.

[0039] In some embodiments, the non-transitory computer-readable storage medium further comprises instructions for simulating the remaining portion of each of the one or more instances of the compiled first workflow at each corresponding time step in the looping series of time steps, thereby forming one or more first simulations. The non-transitory computer-readable storage medium further comprises instructions for simulating the remaining portion of each of the one or more instances of the compiled second workflow at each corresponding time step in the looping series of time steps, thereby forming one or more second simulations. In such embodiments, the non-transitory computer-readable storage medium further comprises instructions for initiating an interlock condition error handler associated with a first unit operation in an instance of the one or more instances of the compiled first workflow, the interlock condition error handler forming an interlock condition with a second unit operation in an instance of the one or more instances of the compiled second workflow.

[0040] In some embodiments, initiating an interlock condition error handler adjusts one or more time intervals of one or more unit operations that have not yet been executed in the instance of the compiled first workflow or the instance of the compiled second workflow.

[0041] In some embodiments, initiating an interlock condition error handler adjusts the weight of one or more unit operations that have not yet been executed in an instance of the compiled first workflow or an instance of the compiled second workflow based on a priority assigned to the compiled first workflow versus a priority assigned to the compiled second workflow.

[0042] In some embodiments, initiating an interlock condition error handler adjusts one or more time intervals of one or more unit operations that have not yet been executed in an instance of the compiled first workflow or an instance of the compiled second workflow based on a priority assigned to the compiled first workflow versus a priority assigned to the compiled second workflow.

[0043] In some embodiments, initiating the interlock condition error handler aborts the compiled instance of the first workflow or the compiled instance of the second workflow.

[0044] In some embodiments, the interlock condition error handler is a mutual exclusion error handler.

[0045] In some embodiments, the interlock condition error handler pauses the compiled instance of the first workflow or the compiled instance of the second workflow.

[0046] In some embodiments, each time step in the cyclic series of time steps occurs periodically.

[0047] In some embodiments, each time step in the cyclic series of time steps occurs in response to the occurrence of an event in a plurality of event classes. In some embodiments, the event class is an instrument error, a power failure, a sample drop, or an interlock condition.

[0048] In some embodiments, each time step in the cyclic series of time steps occurs once every five minutes. In some embodiments, each time step in the cyclic series of time steps occurs once every 30 seconds, every minute, every 15 minutes, every 30 minutes, or every hour.

[0049] In some embodiments, the non-transitory computer-readable storage medium further comprises instructions for concurrently executing two or more instances of the compiled first workflow and two or more instances of the compiled second workflow. In some embodiments, the non-transitory computer-readable storage medium further comprises instructions for concurrently executing three or more instances of the compiled first workflow and three or more instances of the compiled second workflow.

[0050] In some embodiments, the non-transitory computer-readable storage medium further comprises instructions, for each integer k in the set {1, ..., k, ..., n}, where n is a positive integer of two or greater, the instructions are used to obtain the kth plurality of organic engineering targets and assign the kth plurality of organic engineering targets to the kth uncompiled workflow. The kth uncompiled workflow is configured to generate the kth plurality of organic engineering targets, and the kth uncompiled workflow is associated with the kth subset of processing modules in the plurality of processing modules. The instructions further cause the first device to translate the kth uncompiled workflow into a corresponding instance of the compiled kth workflow of the corresponding organic engineering target for each corresponding organic engineering target in the kth plurality of organic engineering targets. The corresponding instance of the compiled kth workflow includes the address of the corresponding instrument and one or more execution instructions for the corresponding instrument, as well as the kth plurality of unit operations for each corresponding instrument in the kth subset of the instrument. The kth plurality of unit operations are organized in time into a kth linear time sequence, and each corresponding unit operation in the kth plurality of unit operations is characterized by a time interval defined by the corresponding unit operation. The time intervals of unit operations in the kth plurality of unit operations are adjusted by a certain amount from the corresponding unit operation definitions according to the determination of interlocking conditions with the unit operations in the first compiled workflow and the unit operations in the second compiled workflow, thereby forming multiple instances of the compiled kth workflow.

[0051] In some embodiments, the first subset of instruments includes two or more different instrument classes and the second subset of instruments includes two or more different instrument classes.

[0052] In some embodiments, a first instrument class and a second instrument class are used by multiple instances of a compiled first workflow and multiple instances of a compiled second workflow. The first instrument class has a first reuse value, and the second instrument class has a second reuse value different from the first reuse value. In addition, the non-transitory computer-readable storage medium stores instructions for formulating a scheduler that maximizes the number of instances in the multiple instances of the compiled first workflow, the number of instances in the multiple instances of the compiled second workflow, or the number of instances in the combination of the instances of the compiled first workflow and the compiled second workflow, at which instruments of the first instrument class and instruments of the second instrument class can be used simultaneously given the first reuse value and the second reuse value.

[0053] In some embodiments, the scheduler is maximized at least in part by calling a first number of instances of a first instrument class based on a first reuse value of the first instrument class and calling a second number of instances of a second instrument class based on a second reuse value of a second instrument class to be run simultaneously to support simultaneously running instances of a compiled first workflow and a compiled second workflow.

[0054] In some embodiments, the scheduler maximizes at least in part by concurrently running a first number of instances of a first compilation workflow and a second number of instances of a second compilation workflow.

[0055] In some embodiments, the scheduler maximizes at least in part by adjusting a time interval of a corresponding unit operation in a first plurality of unit operations of an instance of a first compilation workflow by a certain amount from a time interval defined for the corresponding unit operation, or adjusting a time interval of a corresponding unit operation in a second plurality of unit operations of an instance of a second compilation workflow by a certain amount from a time interval defined for the corresponding unit operation.

[0056] In some embodiments, the method further includes instructions to concurrently execute two or more of the plurality of instances of the compiled first workflow and two or more of the plurality of instances of the compiled second workflow.

[0057] In some embodiments, the method further comprises instructions for concurrently executing two or more of the plurality of instances of the compiled first workflow and two or more of the plurality of instances of the compiled second workflow. In such embodiments, the first subset of instruments comprises two or more instruments, the second subset of instruments comprises two or more instruments, and at least one instrument in the first subset of instruments is in the second subset of instruments.

[0058] In some embodiments, the method further comprises instructions for concurrently executing three or more of the plurality of instances of the compiled first workflow and three or more of the plurality of instances of the compiled second workflow. In such embodiments, the first subset of instruments comprises three or more instruments, the second subset of instruments comprises three or more instruments, and at least two of the instruments in the first subset of instruments are in the second subset of instruments.

[0059] In some embodiments, two or more instances of the compiled first workflow are executed when performing the translation.

[0060] In some embodiments, the non-transitory computer-readable storage medium further stores instructions for converting a first organic engineered target of the first plurality of organic engineered targets into one or more first inputs of a first uncompiled workflow.

[0061] In some embodiments, the first organic engineering target is synthesis of a first nucleic acid, and the one or more first inputs of the first uncompiled workflow are a set of nucleic acid bases for synthesizing the first nucleic acid.

[0062] In some embodiments, the first uncompiled workflow includes a branch condition, a loop condition, or a nested condition, and wherein the translation resolves values ​​associated with the branch condition, the loop condition, or the nested condition to form a linear time order of the first plurality of unit operations.

[0063] Another aspect of the present disclosure provides a method for implementing a workflow at a first device, the first device comprising one or more processors, a memory storing one or more programs executed by the one or more processors, a controller, a communication interface, a power supply, and one or more peripheral devices. One or more programs use one or more processors to execute the method individually or collectively. The method includes obtaining a first plurality of organic engineering targets through one or more peripheral devices, and assigning the first plurality of organic engineering targets to a first uncompiled workflow through a controller. The first uncompiled workflow is configured to generate a first plurality of organic engineering targets. The first uncompiled workflow is associated with a first subset of processing modules in a plurality of processing modules. Each corresponding processing module in a plurality of processing modules is associated with a different subset of unit operation definitions in a plurality of unit operation definitions. Each corresponding unit operation definition in a plurality of unit operation definitions is independently associated with a corresponding time interval. Each corresponding unit operation definition in a plurality of unit operations is independently associated with a first subset of instruments in a plurality of instruments. The method further includes, by a controller, for each corresponding organic engineering target in a first plurality of organic engineering targets, translating the first uncompiled workflow into a corresponding instance of the compiled first workflow of the corresponding organic engineering target. The corresponding instance of the compiled first workflow includes the address of the corresponding instrument and one or more execution instructions for the corresponding instrument, and the first plurality of unit operations for each corresponding instrument in the first subset of instruments. The first plurality of unit operations are organized into a linear time sequence in time. Each corresponding unit operation in the first plurality of unit operations is characterized by the time interval defined by the corresponding unit operation. In this way, multiple instances of the compiled first workflow are formed. The method further includes obtaining a second plurality of organic engineering targets through one or more peripheral devices, and assigning the second plurality of organic engineering targets to the second uncompiled workflow through a controller. The second uncompiled workflow is configured to generate a second plurality of organic engineering targets. The second uncompiled workflow is associated with a second subset of processing modules in a plurality of processing modules. In addition, the method further includes, by the controller, for each corresponding organic engineering target in the second plurality of organic engineering targets, translating the second uncompiled workflow into a corresponding instance of the compiled second workflow of the corresponding organic engineering target. The corresponding instance of the compiled second workflow includes the address of the corresponding instrument and one or more execution instructions for the corresponding instrument, and the second plurality of unit operations for each corresponding instrument in the second subset of instruments. The second plurality of unit operations are organized into a linear time sequence in time. Each corresponding unit operation in the second plurality of unit operations is characterized by a time interval defined by the corresponding unit operation. In addition, the method includes adjusting, by the controller, the time intervals of the unit operations in the second plurality of unit operations by a certain amount from the time intervals defined by the corresponding unit operations based on the determination of the interlocking conditions with the unit operations in the first compiled workflow. In this manner, a plurality of instances of the compiled second workflow are formed.

[0064] Another aspect of the present disclosure provides a system for implementing a workflow comprising a first device. The first device comprises a display, a power supply, a communication interface, one or more peripheral devices, one or more processors, a memory, and one or more programs stored in the memory non-transiently. The one or more programs are configured to be executed by one or more processors. The one or more programs include instructions for obtaining a first plurality of organic engineering targets and assigning the first plurality of organic engineering targets to a first uncompiled workflow. The first uncompiled workflow is configured to generate a first plurality of organic engineering targets. The first uncompiled workflow is associated with a first subset of processing modules in a plurality of processing modules. Each corresponding processing module in a plurality of processing modules is associated with a different subset of unit operation definitions in a plurality of unit operation definitions. Each corresponding unit operation definition in a plurality of unit operation definitions is independently associated with a corresponding time interval. Each corresponding unit operation definition in a plurality of unit operations is independently associated with a first subset of instruments in a plurality of instruments. The one or more programs further include instructions for translating the first uncompiled workflow into a corresponding instance of a compiled first workflow of the corresponding organic engineering target for each corresponding organic engineering target in the first plurality of organic engineering targets. The corresponding instance of the compiled first workflow includes the address of the corresponding instrument and one or more execution instructions for the corresponding instrument, and the first plurality of unit operations for each corresponding instrument in the first subset of instruments. The first plurality of unit operations are organized into a linear time sequence in time, and each corresponding unit operation in the first plurality of unit operations is characterized by the time interval defined by the corresponding unit operation. In this way, multiple instances of the compiled first workflow are formed. One or more programs further include instructions for obtaining a second plurality of organic engineering targets and assigning the second plurality of organic engineering targets to a second uncompiled workflow. The second uncompiled workflow is configured to generate a second plurality of organic engineering targets. The second uncompiled workflow is associated with a second subset of processing modules in a plurality of processing modules. The one or more programs further include instructions for translating the second uncompiled workflow into the corresponding instance of the compiled second workflow of the corresponding organic engineering target for each corresponding organic engineering target in the second plurality of organic engineering targets. The corresponding instance of the compiled second workflow includes the address of the corresponding instrument and one or more execution instructions for the corresponding instrument, and the second plurality of unit operations for each corresponding instrument in the second subset of instruments. The second plurality of unit operations are temporally organized into a linear temporal sequence, and each corresponding unit operation in the second plurality of unit operations is characterized by a time interval defined by the corresponding unit operation. In addition, the one or more programs further include instructions for adjusting the time intervals of unit operations in the second plurality of unit operations by a certain amount from the time intervals defined by the corresponding unit operations based on the determination of interlocking conditions with the unit operations in the first compiled workflow to form a plurality of instances of the compiled second workflow.

[0065] Another aspect of the present disclosure provides a method for implementing a workflow comprising a first device. The first device comprises a display, a power supply, a communication interface, one or more peripheral devices, one or more processors, a memory, and one or more programs stored in the memory non-transiently. The one or more programs are configured to be executed by the one or more processors. The one or more programs include instructions for obtaining a first plurality of organic engineering targets and assigning the first plurality of organic engineering targets to a first uncompiled workflow. The first uncompiled workflow is configured to generate a first plurality of organic engineering targets. The first uncompiled workflow is associated with a first subset of processing modules in a plurality of processing modules. Each corresponding processing module in a plurality of processing modules is associated with a different subset of unit operation definitions in a plurality of unit operation definitions. Each corresponding unit operation definition in a plurality of unit operation definitions is independently associated with a corresponding time interval. Each corresponding unit operation definition in a plurality of unit operations is independently associated with a first subset of instruments in a plurality of instruments. The one or more programs further include instructions for translating the first uncompiled workflow into a corresponding instance of a compiled first workflow of the corresponding organic engineering target for each corresponding organic engineering target in the first plurality of organic engineering targets. The corresponding instance of the compiled first workflow includes, for each corresponding instrument in the first subset of instruments, the address of the corresponding instrument and one or more execution instructions for the corresponding instrument, as well as a first plurality of unit operations. The address of the corresponding instrument includes a coarse-grained address associated with the label of the corresponding instrument. One or more instructions including a coarse traverse instruction and a fine traverse instruction are executed. The coarse traverse instruction commands the conveying device to traverse to the corresponding label of the corresponding instrument. The fine traverse instruction commands the articulated manipulation robot associated with the transport device to move to at least one spatial coordinate associated with the corresponding instrument (e.g., move the articulated manipulation robot). The first plurality of unit operations are organized in time into a linear time sequence, and each corresponding unit operation in the first plurality of unit operations is characterized by a time interval defined by the corresponding unit operation. In this way, multiple instances of the compiled first workflow are formed.

[0066] In some embodiments, the transport device includes a positioning system configured to position and guide the transport device within a transport path.

[0067] In some embodiments, the positioning system comprises a global positioning system. Therefore, the corresponding markings of the corresponding instruments are global positioning system coordinates.

[0068] In some embodiments, the positioning system includes a representation of the surrounding environment of the transport path (e.g., a map). In addition, in some embodiments, the representation of the marked positioning of the transport path is an image feed or video feed, which can have a low pass filter or Gaussian blur function applied to the representation of the marked positioning of the transport path.

[0069] In some embodiments, the transport device includes an inertial measurement unit configured to verify and correct each execution of a coarse traverse command of a corresponding instrument.

[0070] In some embodiments, the articulated manipulation robot includes various sensors, each of which provides information related to the spatial position of the articulated manipulation robot and the surrounding environment of the articulated manipulation robot.

[0071] In some embodiments, the transport device includes a proportional integral derivative (PID) controller. The PID controller communicates with the sensor to maintain the spatial position of the transport device through a control loop.

[0072] In some embodiments, the articulated manipulation robot transfers the first tray to the first instrument using a safe transfer procedure. When the reading from the sensor fails to meet a threshold proximity value relative to the actual position of the first instrument, the safe transfer procedure is activated or initiated. When the reading from the sensor meets a threshold proximity value relative to the actual physical position of the first instrument, the articulated manipulation robot activates or initiates a default transfer procedure. In some embodiments, the threshold proximity value is a distance (e.g., millimeters) or a degree of rotation / orientation (e.g., degrees or gradient) or a combination thereof.

[0073] Another aspect of the present disclosure provides a system for implementing a workflow including a first device. The first device includes a display, a power supply, a communication interface, and one or more peripheral devices including a reagent processing device. The reagent processing device includes a cleaning manifold, a main valve for adjusting an internal flow path in the reagent processing device, and various reagent containers. Each reagent container includes a valve for controlling the flow from the corresponding reagent container to the main valve. In addition, the reagent processing device includes a disinfection container for containing a disinfectant. Similar to the reagent container, the disinfection container includes a valve for regulating the flow of the disinfection fluid flowing to the main valve or the cleaning manifold. The cleaning manifold is connected to the corresponding valve of each reagent container and regulates the flow of the disinfection fluid from the disinfection container to the reagent container. In addition, the distribution manifold is connected to the main valve. The distribution manifold includes a variety of distributors and controls the flow from the main valve to the distributor. The first device further includes one or more processors, a memory, and one or more programs. The one or more programs are stored in the memory and are configured to be executed by the one or more processors. The one or more programs are configured to be executed by the one or more processors. The one or more programs include instructions for obtaining a first plurality of organic engineering targets and assigning the first plurality of organic engineering targets to a first uncompiled workflow. The first uncompiled workflow is configured to generate a first plurality of organic engineering targets. The first uncompiled workflow is associated with a first subset of processing modules in a plurality of processing modules. Each corresponding processing module in a plurality of processing modules is associated with a different subset of unit operation definitions in a plurality of unit operation definitions. Each corresponding unit operation definition in a plurality of unit operation definitions is independently associated with a corresponding time interval. Each corresponding unit operation definition in a plurality of unit operations is independently associated with a first subset of instruments in a plurality of instruments. The one or more programs further include instructions for translating the first uncompiled workflow into a corresponding instance of the compiled first workflow of the corresponding organic engineering target for each corresponding organic engineering target in the first plurality of organic engineering targets. The corresponding instance of the compiled first workflow contains the address of the corresponding instrument and one or more execution instructions for the corresponding instrument, as well as the first plurality of unit operations, for each corresponding instrument in the first subset of instruments.

[0074] In some embodiments, the pressure regulator is connected to each of the sterilization container, the main valve and each reagent container. In addition, in some embodiments, each pressure regulator further includes a filter to prevent contamination. And, in some embodiments, each pressure regulator further includes a check valve to prevent reagent evaporation or steam release.

[0075] In some embodiments, the reagent handling device includes a pump coupled to the main valve. The pump drives an internal flow path of the reagent handling device.

[0076] In some embodiments, the reagent handling device includes a distribution cycle. The distribution cycle distributes selected reagents from a collection of reagent containers. In some embodiments, the reagent handling device includes a first disinfection cycle for disinfecting a portion of the system. Similarly, in some embodiments, the reagent handling device includes a second disinfection cycle for decontaminating a portion of the system.

[0077] In some embodiments, each component of the reagent handling device (e.g., each container, valve, etc.) is connected by a removable conduit.

[0078] In some embodiments, human intervention is only required to replenish the reagent containers and / or to replenish the sterilization fluid of the sterilization container.

[0079] Another aspect of the present disclosure provides a method for implementing a workflow comprising a first device. The first device comprises a display, a power supply, a communication interface, one or more peripheral devices, one or more processors, a memory, and one or more programs stored in the memory non-transiently. The one or more programs are configured to be executed by one or more processors. The one or more programs include instructions for obtaining a first plurality of organic engineering targets and assigning the first plurality of organic engineering targets to a first uncompiled workflow. The first uncompiled workflow is configured to generate a first plurality of organic engineering targets. The first uncompiled workflow is associated with a first subset of processing modules in a plurality of processing modules. Each corresponding processing module in a plurality of processing modules is associated with a different subset of unit operation definitions in a plurality of unit operation definitions. Each corresponding unit operation definition in a plurality of unit operation definitions is independently associated with a corresponding time interval. Each corresponding unit operation definition in a plurality of unit operations is independently associated with a first subset of instruments in a plurality of instruments. The one or more programs further include instructions for translating the first uncompiled workflow into a corresponding instance of a compiled first workflow of the corresponding organic engineering target for each corresponding organic engineering target in the first plurality of organic engineering targets. The corresponding instance of the first workflow of compilation comprises the address of the corresponding instrument and one or more execution instructions for the corresponding instrument, and the first plurality of unit operations for each corresponding instrument in the first subset of the instrument. One or more execution instructions include instructions for the multi-well plate centrifugal instrument. These instructions include measuring the mass of each multi-well plate in the first multi-well plate set. Each multi-well plate is placed in the multi-well plate centrifuge. In addition, each corresponding multi-well plate has a corresponding balance block in the balance block set, and the balance block is placed in the multi-well plate centrifuge at a position relative to the corresponding multi-well plate. In the absence of human intervention, the mass of each corresponding balance block is adjusted to be equal to the corresponding multi-well plate. Then operate the multi-well centrifuge. The first plurality of unit operations are organized into a linear time sequence in time, and each corresponding unit operation in the first plurality of unit operations is characterized by the time interval defined by the corresponding unit operation. In this way, multiple instances of the first workflow of compilation are formed.

[0080] In some embodiments, the first multiwell plate set is a single multiwell plate.

[0081] In some embodiments, the first set of multiwell plates is a set of from two multiwell plates to five multiwell plates.

[0082] In some embodiments, adjusting includes pumping a fluid (eg, water, mineral oil, gas) to the respective balancing weights to adjust the mass therein.

[0083] In some embodiments, adjusting includes drawing fluid from the corresponding balancing weight to adjust the mass therein.

[0084] In some embodiments, each balancing mass includes a bottom portion configured to collect fluid therein.

[0085] In some embodiments, the determining and adjusting are performed simultaneously.

[0086] In some embodiments, adjusting includes storing the adjusted mass of each balancing mass.

[0087] In some embodiments, one or more instructions for a multiwell plate centrifuge instrument include determining the mass of each multiwell plate in a second multiwell plate set, placing each multiwell plate in the second set in a centrifuge, adjusting the mass of each balance block in a second balance block set to be equal to the mass of a corresponding multiwell plate in the second multiwell plate set without human intervention, and operating the multiwell plate centrifuge.

[0088] In some embodiments, the second multiwell plate assembly is the first multiwell plate assembly.

[0089] The automated biofoundry of the present invention has other features and advantages that will become apparent or be more fully elucidated from the accompanying drawings and the following detailed description incorporated herein, which together serve to explain certain principles of exemplary embodiments of the invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0090] Figure 1A , 1B , 1C and 1D illustrate computer systems according to embodiments of the present disclosure;

[0091] Figure 2A and 2B shows the system topology and hardware layout according to various embodiments of the present disclosure;

[0092] Figure 3A , 3B , 3C, 3D, 3E, 3F, 3G, 3H, 3I, 3J, 3K and 3L collectively show a flow chart of a method for using a first device to support an automated workflow according to an embodiment of the present disclosure, wherein optional steps or embodiments are indicated by dashed boxes;

[0093] Figure 4A The overall design of the single transcription TALEN synthesis according to an embodiment of the present disclosure is shown;

[0094] Figure 4B An assembly scheme for the design and preliminary testing of single transcription TALEN synthesis according to an embodiment of the present disclosure is shown;

[0095] Figure 4C Shown are test compositions of single transcription TALEN pairs according to embodiments of the present disclosure;

[0096] Figure 5A Shows single transcript expression of a TALEN pair according to an embodiment of the present disclosure;

[0097] Figure 5B shows genome editing in HEK293T cells according to an embodiment of the present disclosure;

[0098] Figure 5C , 5D and 5E show disruption of the Oct4 enhancer in H1 hESCs according to an embodiment of the present disclosure;

[0099] Fig. 6A and 6B shows a breakdown of the unit operations of the iBioFAB system according to an embodiment of the present disclosure;

[0100] Figure 6C and 6D shows various control levels of the iBioFAB system according to an embodiment of the present disclosure;

[0101] Fig. 7A The general workflow of the DNA assembly pipeline based on the Golden Gate method according to an embodiment of the present disclosure is shown;

[0102] Figure 7B A process flow chart showing construction steps according to an embodiment of the present disclosure is shown;

[0103] Figure 7C and 7D Detection of high-throughput synthetic single transcription TALENs according to embodiments of the present disclosure is shown;

[0104] Fig. 8A and 8B shows the plasmid design of a single plasmid TALEN assembly according to an embodiment of the present disclosure;

[0105] Fig. 9A , 9B , 9C, 9D, 9E, 9F, 9G and 9H show disruption of EGFP in HEK293 cells according to embodiments of the present disclosure;

[0106] Fig.10 A Gantt chart showing an automated Golden Gate DNA assembly workflow according to an embodiment of the present disclosure;

[0107] Fig.11A and 11B shows a list of substrates according to an embodiment of the present disclosure;

[0108] Fig.12shows a table of results of a T7E1 assay according to an embodiment of the present disclosure;

[0109] Fig.13 A fluid management system according to an embodiment of the present disclosure is shown;

[0110] Fig.14A , 14B and 14C illustrate a vacuum manifold compatible with a centrifuge according to an embodiment of the present disclosure;

[0111] Fig.15 shows a pipette tip according to an embodiment of the present disclosure;

[0112] Fig.16A and 16B shows a scattered pattern and a scribe pattern according to an embodiment of the present disclosure;

[0113] Fig. 16C and 16D Another scattered pattern and a scribe pattern according to an embodiment of the present disclosure are shown;

[0114] Fig.17A and 17B shows a scribing cone according to an embodiment of the present disclosure;

[0115] Fig.18 An automated centrifuge processing system according to an embodiment of the present disclosure is shown; and

[0116] Fig.19 A positioning system according to an embodiment of the present disclosure is shown;

[0117] The specific design features of the present invention as disclosed herein, including, for example, specific dimensions, orientations, locations, and shapes will be determined in part by the particular intended application and use environment.

[0118] In the drawings, reference numbers refer to the same or equivalent parts of the present invention throughout the several views. DETAILED DESCRIPTION

[0119] Reference will now be made in detail to various embodiments of the present invention, examples of which are shown in the accompanying drawings and described below. Although the present invention will be described in conjunction with exemplary embodiments, it should be understood that this description is not intended to limit the present invention to those exemplary embodiments. On the contrary, the present invention is intended to cover not only the exemplary embodiments, but also various replacements, modifications, equivalents and other embodiments that may be included within the spirit and scope of the present invention as defined by the appended claims.

[0120] As used herein, in some embodiments, the term "set" means two or more, three or more, or four or more.

[0121] It should also be understood that although the terms first, second, etc. may be used herein to describe various elements, these elements should not be limited by these terms. These terms are only used to distinguish one element from another. For example, without departing from the scope of the present disclosure, a first workflow may be referred to as a second workflow, and similarly, a second workflow may be referred to as a first workflow. The first workflow and the second workflow are both workflows, but they are not the same workflow.

[0122] The terms used in this disclosure are only used for the purpose of describing specific embodiments and are not intended to limit the present invention. As used in the specification of the present invention and the appended claims, the singular forms "one", "an" and "said" are also intended to include plural forms, unless the context clearly indicates otherwise. It should also be understood that the term "and / or" used herein refers to and encompasses any and all possible combinations of one or more of the associated listed items. It should also be understood that when used in this specification, the term "comprising" specifies the presence of the features, integers, steps, operations, elements and / or components, but does not exclude the presence or addition of one or more other features, integers, steps, operations, elements, components and / or combinations thereof.

[0123] For the sake of clarity, not all routine features of the embodiments described herein are shown and described. It should be understood that in the development of any such actual embodiment, many specific implementation decisions are made to achieve the designer's specific goals, such as meeting use case and business-related constraints, and these specific goals will vary from one embodiment to another and from one designer to another. In addition, it should be understood that such design work may be complex and time-consuming, but is still a routine engineering task for those skilled in the art who have the benefit of this disclosure.

[0124] As used herein, the term "if" may be interpreted to mean "when" or "based on" or "in response to determining" or "in response to detecting," depending on the context. Similarly, the phrases "if it is determined" or "if [a stated condition or event] is detected" may be interpreted to mean "upon determination" or "in response to determination" or "upon detecting [a stated condition or event]" or "in response to detecting [a stated condition or event]," depending on the context.

[0125] In some embodiments, a system and method for supporting automated workflows according to the present disclosure obtains a first target set and assigns these targets to a first uncompiled workflow type. This first uncompiled workflow type is configured to generate targets. In addition, the first uncompiled workflow includes processing modules, each of which is further associated with a subset of unit operation definitions. Each unit operation definition is associated with a time interval. Each unit operation is further associated with a subset of instruments. The present disclosure translates the first uncompiled workflow into an instance of a first compiled workflow for each target in the first target set. The instance of the first compiled workflow includes the address of the instrument and the execution instructions of the instrument. The unit operations are organized into a linear time sequence.

[0126] The systems and methods of the present disclosure further support obtaining a second set of targets and assigning them to an uncompiled second workflow. This uncompiled second workflow may be the same or different from the uncompiled first workflow. The uncompiled second workflow is configured to produce a second target. The uncompiled second workflow is associated with a processing module different from the first uncompiled workflow. The second uncompiled workflow is translated into an instance of a compiled second workflow for each corresponding target in the second target set. In addition, when determining an interlocking condition with a unit operation in the first compiled workflow, the time interval of the unit operation in the second workflow is adjusted by a certain amount from the corresponding unit operation definition. In this way, one or more of the second compiled workflows can be executed in the same foundry while executing one or more of the first compiled workflows. In fact, in some embodiments, two or more of the second compiled workflows are executed simultaneously with two or more of the first compiled workflows in the same foundry.

[0127] In this way, multiple workflows can be run in the same foundry in an efficient manner. Although a mechanism for compiling two different types of workflows and running them in the same foundry has been disclosed, the present disclosure is not limited thereto. In some embodiments, by adjusting the time intervals of the unit operations in the corresponding workflows to avoid interlocking conditions, two or more instances of three or more, four or more, five or more, ten or more, twenty or more, or one hundred or more different types of compiled workflows are run simultaneously in the same foundry.

[0128] Figure 1A-Figure 1D Such an exemplary system 11 for supporting multiple workflows in a biofoundry is detailed. The system preferably comprises a computer system 10 having:

[0129] Central processing unit (CPU) 22;

[0130] A main non-volatile (non-transitory) storage unit 14 for storing software and data, such as a hard disk drive, the storage unit 14 being controlled by the storage controller 12;

[0131] ● System memory 36 for storing system control programs, data and application programs, preferably a high-speed random access memory (RAM), which contains programs and data loaded from the non-volatile storage unit 14; the system memory 36 may also include a read-only memory (ROM);

[0132] A user interface 32 including one or more input devices (e.g., keyboard 28, mouse) and display 26 or other output devices;

[0133] - Optionally, a network interface card 20 (communication interface) for connecting to any wired or wireless communication network 34 (e.g., a wide area network such as the Internet);

[0134] ● A power supply 24 for supplying power to the above components; and

[0135] - An internal bus 30 for interconnecting the above-mentioned elements of the system.

[0136] The operation of the computer 10 is primarily controlled by an operating system 40, which is executed by the central processing unit 22. The operating system 40 may be stored in the system memory 36. In a typical embodiment, the system memory 36 also includes:

[0137] A file system 42 for controlling access to various files and data structures;

[0138] = Unit operation definitions 44, which include instructions for the execution of multiple instruments and physical or chemical processes to achieve an organic engineering target performed by a single instrument;

[0139] Instruments 46, which include the address of each instrument;

[0140] = A laboratory information management system 48, which includes feature support modules for managing the operations of the laboratory;

[0141] An engineering target library 50, which contains a list of plausible and / or stored engineering targets;

[0142] = A workflow library 52, which contains tables of pre-defined workflows, workflow templates, and stored workflows;

[0143] A processing module library 54, which contains tables of predetermined processing modules and stored processing modules;

[0144] ● Scheduler 56, which helps manage and organize the operation of the workflow; and

[0145] ●Compile workflow 58, including the data of the compiled workflow.

[0146] like Figure 1A As shown, computer 10 contains data such as unit operation definitions 44, engineering target library 50, workflow library 52, etc. Such data can be stored in any form of data storage system, including but not limited to flat files, relational databases (SQL), or online analytical processing (OLAP) databases (MDX and / or its variants). In some embodiments, the associated data is stored in a single database. In other embodiments, the associated data is also stored in multiple databases, which may or may not all be hosted by the same computer 10. In such embodiments, some components and associated data are stored in Figure 1A On a computer system not shown but addressable by wide area network 34.

[0147] In some embodiments, Figure 1A The unit operation definitions 44 and the associated data of such instruments 46, engineered target libraries 50, workflow libraries 52, processing modules 54, and related software modules are shown on a single computer (e.g., computer 10), and in other embodiments, they are hosted by several computers (not shown). In practice, the unit operation definitions 44, instruments 46, engineered target libraries 50, workflow libraries 52, processing modules 54, and related software modules on one or more computers are hosted by multiple computers (not shown). Figure 1A All possible permutations of the modules shown in are within the scope of the present disclosure, as long as the components are addressable relative to each other via the computer network 34 or by other electronic means. Thus, the present disclosure fully encompasses a wide array of computer systems.

[0148] Now that a system for supporting multiple automated workflows according to various exemplary embodiments of the present disclosure has been described, the following will now disclose a system for supporting multiple automated workflows according to various exemplary embodiments of the present disclosure. Figure 3A-Figure 3L Some details of the process. Figure 3A-Figure 3L 1 and 2 show a flowchart of a method for supporting multiple automated workflows according to an exemplary embodiment of the present disclosure. In the flowchart, a preferred part of the method is shown in a solid box, while an optional variant of the method or an optional device used by the method is shown in a dotted box. Figure 3A-Figure 3L A method for supporting multiple automated workflows is shown.

[0149] Certain steps are performed by various modules in the memory 36. It will be understood that Figure 3A-Figure 3L The steps described in can be encoded in a single module or in any combination of modules.

[0150] In the description Figure 3A-Figure 3LWhen describing the method, in many embodiments, a first workflow and a second workflow are described. However, it should be understood that according to the present disclosure, for each integer k in the set {1, ..., k, ..., n}, where n is a positive integer of two or greater, there are a total of n workflows. In addition, n refers to the maximum number in a given set. Therefore, the kth workflow is a common workflow in the set of n workflows. In this way, the theoretical limit or bottleneck to multiple active workflows is the throughput of multiple instruments in a given system or a given instrument or instrument class.

[0151] refer to Figure 3A In blocks 1002-1006 of the present invention, a method for implementing a workflow will now be described. In a computer system including one or more processors, a memory storing one or more programs executed by the one or more processors, a controller (e.g., Figure 1A Controller 12), communication interface (e.g., Figure 1A communication circuit 20), power supply (e.g., Figure 1A power supply 24) and one or more peripheral devices (e.g., Figure 1A A first device (eg, a keyboard 28 and a display 26) Figure 1A At a computer 10), the one or more programs individually or collectively perform a given method.

[0152] In some embodiments, the first device communicates with at least one external control server or external database server. In some embodiments, data is saved by the first device, and the data describes the workflow and / or the data of the executed instructions. For example, in some embodiments, the data is exported as one or more tab-delimited files, CSV files, EXCEL spreadsheets, GOOGLE tables, or in a form suitable for SQL databases. In addition, this communication can be used for multiple purposes, including but not limited to communicating with the first device of other systems, saving the data of the workflow to an external website server or database server, saving data describing the execution instructions of the instrument, etc. Examples of networks include, but are not limited to, the World Wide Web (WWW), intranets and / or wireless networks, such as cellular telephone networks, wireless local area networks (LANs) and / or metropolitan area networks (MANs), and other devices via wireless communications. Wireless communication optionally uses any of a variety of communication standards, protocols and technologies, including, but not limited to, Global System for Mobile Communications (GSM), Enhanced Data GSM Environment (EDGE), High Speed ​​Downlink Packet Access (HSDPA), High Speed ​​Uplink Packet Access (HSUPA), Evolution, Data-Only (EV-DO), HSPA, HSPA+, Dual Cell HSPA (DC-HSPDA), Long Term Evolution (LTE), Near Field Communication (NFC), Wideband Code Division Multiple Access (W-CDMA), Code Division Multiple Access (CDMA), Time Division Multiple Access (TDMA), Bluetooth, Wireless Fidelity (Wi-Fi) (e.g., IEEE 802.11a, IEEE 802.11ac, IEEE 802.11ax, IEEE 802.11b, IEEE 802.11g and / or IEEE 802.11n), Voice over Internet Protocol (VoIP), Wi-MAX, protocols for email (e.g., Internet Message Access Protocol (IMAP) and / or Post Office Protocol (POP)), instant messaging (e.g., Extensible Messaging and Presence Protocol (XMPP), Session Initiation Protocol for Instant Messaging and Presentation Extensions (SIMPLE), Instant Messaging and Presence Service (IMPS)), and / or Short Message Service (SMS), or any suitable communications protocol, including communications protocols that have not been developed as of the filing date of this document (1004, 1006).

[0153] refer to Figure 3A In blocks 1008 to 1012, the method further requires that one or more peripheral devices (e.g. Figure 1AKeyboard 28) obtains the first plurality of organic engineering targets. In some embodiments, such as an automated workflow in a biofoundry, each of the first plurality of organic engineering targets is a plurality of reagents of a nucleic acid component. In some embodiments, each of the first plurality of organic engineering targets is a composition of a nucleic acid component. For example, in some embodiments, each of the first plurality of organic engineering targets is a plasmid, and the nucleic acid component is a predetermined promoter, repressor, stop codon, and exon. In some embodiments, each of the first plurality of organic engineering targets is a different predetermined nucleic acid with a different predetermined nucleic acid sequence. In some embodiments, each of the first plurality of organic engineering targets is a different predetermined ribonucleic acid (mRNA) with a different predetermined nucleic acid sequence. In some embodiments, each of the first plurality of organic engineering targets is a different predetermined deoxyribonucleic acid (DNA) with a different predetermined nucleic acid sequence. In some embodiments, each of the first plurality of organic engineering targets is a different predetermined polymer. In some embodiments, each of the first plurality of organic engineering targets is a different predetermined peptide. In some embodiments, each of the first plurality of organic engineering targets is a different predetermined protein.

[0154] In some embodiments, each of the first plurality of organic engineering targets comprises a different heteropolymer (copolymer). Copolymers are polymers derived from two (or more) monomeric substances, in contrast to homopolymers using only one monomer. Copolymerization refers to a method for chemically synthesizing copolymers. Examples of copolymers include, but are not limited to, ABS plastics, SBR, nitrile rubber, styrene-acrylonitrile, styrene-isoprene-styrene (SIS) and ethylene-vinyl acetate. Since copolymers are composed of at least two types of constituent units (also structural units or particles), copolymers can be classified based on how these units are arranged along the chain. These include alternating copolymers with regular alternating A and B units. See, for example, Jenkins, 1996, "Glossary of Basic Terms in Polymer Science", Pure and Applied Chemistry 68 (12): 2287-2311, which are incorporated herein by reference in their entirety. An additional example of a copolymer is a periodic copolymer having A and B units arranged in a repeating sequence (e.g., (ABABBAAAABBB) n). Additional examples of copolymers are statistical copolymers, in which the sequence of monomer residues in the copolymer follows statistical rules. If the probability of finding a given type of monomer residue at a specific point in the chain is equal to the mole fraction of the monomer residue in the chain, then the polymer can be called a true random copolymer. See, for example, Painter, 1997, "Fundamentals of Polymer Science", CRC Press, 1997, page 14, which are all incorporated herein by reference. Other examples of copolymers that can be evaluated using the disclosed system and method are block copolymers comprising two or more homopolymer subunits connected by covalent bonds. The combination of homopolymer subunits may require an intermediate non-repeating subunit, referred to as a connecting block. Block copolymers with two or three different blocks are referred to as diblock copolymers and triblock copolymers, respectively.

[0155] In some embodiments, each of the first plurality of organic engineering targets comprises a plurality of polymers, wherein the corresponding polymers in the plurality of polymers do not all have the same molecular weight. In these embodiments, the polymers in the plurality of polymers fall within the weight range with corresponding chain length distribution. In some embodiments, the polymer is a branched polymer molecular system comprising a main chain with one or more substituent side chains or branches. The types of branched polymers include but are not limited to star polymers, comb polymers, brush polymers, branched polymers, ladder polymers and dendritic polymers. See, for example, Rubinstein et al., 2003, Polymer Physics, Oxford University; New York: Oxford University Press, page 6, which are all incorporated herein by reference.

[0156] In some embodiments, each of the first plurality of organic engineering targets comprises a polypeptide. As used herein, the term "polypeptide" refers to two or more amino acids or residues connected by a peptide bond. The terms "polypeptide" and "protein" are used interchangeably herein and include oligopeptides and peptides. "Amino acid," "residue" or "peptide" refers to any of the twenty standard structural units of proteins known in the art, including imino acids, such as proline and hydroxyproline. The naming of amino acid isomers may include D, L, R and S. The definition of amino acids includes non-natural amino acids. Therefore, selenocysteine, pyrrolysine, lanthionine, 2-aminoisobutyric acid, γ-aminobutyric acid, dehydroalanine, ornithine, citrulline and homocysteine ​​are all considered amino acids. Other variants or analogs of amino acids are known in the art. Therefore, polypeptides may include synthetic mimetic peptide structures, such as peptoids. See Simon et al., 1992, Proceedings of the National Academy of Sciences USA, 89, 9367, which are all incorporated herein by reference. See also Chin et al., 2003, Science 301, 964; and Chin et al., 2003, Chemistry & Biology 10, 511, each of which is hereby incorporated by reference in its entirety.

[0157] In certain embodiments, each organic engineering target in the first plurality of organic engineering targets comprises a polypeptide with any number of post-translational modifications. Therefore, polypeptides include additions of cofactors (such as heme, flavin, metals, etc.) by acylation, alkylation, amidation, biotinylation, formylation, γ-carboxylation, glutamylation, glycosylation, glycosylation, hydroxylation, iodination, isoprenylation, lipidation, cofactor addition (such as heme, flavin, metals, etc.), nucleosides and derivatives thereof, oxidation, reduction, pegylation, phosphatidylinositol addition, phosphopantetheinization, phosphorylation, pyroglutamate formation, racemization, addition of amino acids (such as arginylation) by tRNA, sulfation, selenization, ISGization, SUMOization, ubiquitination, chemical modification (such as citrullination and deamidation) and the use of other enzymes (such as proteases, phosphatases and kinases). Other types of post-translational modifications are known in the art and are also included.

[0158] In some embodiments, each of the first plurality of organic engineering targets comprises an organometallic complex. An organometallic complex is a compound containing a bond between carbon and a metal. In some cases, the organometallic compound is distinguished by the prefix "organic", such as an organopalladium compound. Examples of such organometallic compounds include all Gilman reagents containing lithium and copper. Nickel tetracarbonyl and ferrocene are examples of organometallic compounds containing transition metals. Other examples include organomagnesium compounds, such as (methyl) magnesium iodide MeMgI, diethyl magnesium (Et2Mg) and all Grignard reagents; organolithium compounds such as n-butyl lithium (n-BuLi), such as diethyl zinc (Et2Zn) and chloro (ethoxycarbonylmethyl) zinc (ClZ n CH2C(=O)OEt); and organic zinc compounds such as lithium dimethyl cuprate (Li + [CuMe2] – In addition to the traditional metals, lanthanides, actinides and semimetals, elements such as boron, silicon, arsenic and selenium are considered to form organometallic compounds, for example organoborane compounds such as triethylborane (Et3B).

[0159] In some embodiments, each of the first plurality of organically engineered targets comprises two different types of polymers, such as a nucleic acid bound to a polypeptide. In some embodiments, the polymer comprises two polypeptides bound to each other. In some embodiments, the polymer under investigation comprises one or more metal ions (e.g., a metalloprotease having one or more zinc atoms) and / or is bound to one or more organic small molecules (e.g., an inhibitor). In this case, the metal ions and / or organic small molecules can be represented as {p1, ..., p K}One or more additional particles in the particle collection.

[0160] In some embodiments, each of the first plurality of organic engineering targets comprises a protein. The basic structural elements of proteins are well known in the art. Non-terminal amino acids generally have the structure -NH-C α HR-CO-, wherein R represents an amino acid side chain as known in the art. Atoms not in the side chain (such as N, C α , C o and O) represent main chain atoms. Side chain atoms, particularly side chain heteroatoms, are referred to as "terminal" atoms. Thus, for example, terminal atoms include C β , S in cysteine γ and N in tryptophan ε1 and C η1 Such terminal atoms may be unique. C-alpha or C αThe carbon atom at the center of each amino acid. The protein backbone consists of N, C-α, C, and O atoms. The main chain dihedral angle of a protein is called φ (φ, which involves the main chain atoms C'-NC α -C'), (ψ, involving the main chain atoms NC α -C'-N) and ω(ω, involving the main chain atoms C α -C'-NC α ). Therefore, ψ controls the C'-C' distance, ψ controls the NN distance, and ω controls C α -C α distance. The planarity of the peptide bond usually constrains ω to 180° (the typical trans case) or 0° (the rare cis case). Side chain dihedral angles tend to cluster around 180°, 60°, and -60°, which are called trans, high-cut+, and high-cut- conformations. The choice of side chain dihedral angles is influenced by the adjacent main chain and side chain dihedral angles. The Ramachandran plot (Ramachandran, Ramakrishnan, and Sasisekharan 1963) is a representation of the stereochemically allowed protein backbone geometry as a function of its variable torsion angles.

[0161] There are different levels for describing protein structure. Primary structure refers to the linear sequence of amino acids that make up a polypeptide chain. The bond between two amino acids is a peptide bond. The amino acid sequence determines the positioning of the different R groups relative to each other. This positioning determines the way the protein folds and the final structure of the molecule. The secondary structure of a protein molecule refers to the twists or kinks that form a regular pattern of polypeptide chains. The regularity is due to the formation of hydrogen bonds between the atoms of the amino acid backbone of the polypeptide chain. The two most common types of secondary structure are called "alpha-helices" and "beta-pleated sheets." Tertiary structure refers to the three-dimensional globular structure that is formed by the bending and twisting of polypeptide chains. This process usually means that the linear sequence of amino acids is folded into a compact globular structure. The folding of the polypeptide chain is stabilized by multiple weak non-covalent interactions. These interactions include hydrogen bonds, electrostatic interactions, hydrophobic interactions, and sometimes covalent bonds. Quaternary structure refers to the fact that some proteins contain more than one polypeptide chain, adding an extra level of structural organization: the association of polypeptide chains. Each polypeptide chain in a protein is called a subunit. Subunits can be the same polypeptide chain or different polypeptide chains. For example, the enzyme beta-galactosidase is a tetramer, meaning it is made up of four subunits, and in this case, the subunits are identical—each polypeptide chain has the same amino acid sequence. Hemoglobin, the oxygen-carrying protein in the blood, is also a tetramer, but it is made up of two polypeptide chains of one type (141 amino acids) and two different types (146 amino acids).

[0162] In some embodiments, each of the first plurality of organic engineering targets comprises a compound that satisfies the Lipinski rule of five criteria. In some embodiments, the compound is an organic compound that satisfies two or more rules, three or more rules, or all four rules in the Lipinski five rules: (i) no more than five hydrogen bond donors (e.g., OH and NH groups), (ii) no more than ten hydrogen bond acceptors (e.g., N and O), (iii) molecular weight less than 500 Daltons, and (iv) LogP less than 5. The so-called "five rules" are because three of the four criteria involve the number five. See Lipsinski, 1997, "Advanced Drug Delivery Review (Adv.Drug Del.Rev.)" 23, 3, which are all incorporated herein by reference. In some embodiments, the organic engineering target satisfies one or more criteria in addition to the Lipinski five rules. For example, in some embodiments, the test perturbation is a compound with five or fewer aromatic rings, four or fewer aromatic rings, three or fewer aromatic rings, or two or fewer aromatic rings.

[0163] Therefore, in the context of bioengineering, the organic engineering target is one of the targets of the research and development project that defines the desired biological property to be realized. The organic engineering target can be quantitative or qualitative. For example, in one embodiment, the organic engineering target can be the genetic configuration of a biosynthetic pathway, which produces more compounds of interest than the current level. In another embodiment, the organic engineering target is the genetic configuration of the microbial host with the tolerance exceeding X mg / L to an inhibitor. In addition, in some embodiments, the organic engineering target is a polynucleotide or a nucleic acid sequence. The terms "polynucleotide" and "nucleic acid sequence" interchangeably refer to the polymer composed of nucleotide units as understood by those skilled in the art. Preferred nucleotide units include but are not limited to those nucleotide units comprising adenine (A), guanine (G), cytosine (C), thymine (T) and uracil (U). Useful modified nucleotide units include, but are not limited to, 4-acetylcytosine, 5-(carboxyhydroxymethyl)uridine, 2-O-methylcytidine, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylamino-methyluridine, dihydrouridine, 2-O-methylpseudouridine, 2-O-methylguanosine, inosine, N6-isopentyladenosine, 1-methyladenosine, 1-methylpseudouridine, 1-methylguanosine, 1-methylinosine, 2,2-dimethylguanosine, 2-methyladenosine, 2-methylguanosine, 3-methylcytidine, 5-methylcytidine, N6-methyladenosine, 7-methylguanosine, 5-methylcytidine, -methylaminomethyl, 5-methoxyaminomethyl-2-thiouridine, 5-methoxyuridine, 5-methoxycarbonylmethyl-2-thiouridine, 5-methoxycarbonylmethyl uridine, 2-methylthio-N6-isopentyl adenosine, uridine-5-hydroxyacetic acid-methyl ester, uridine-5-hydroxyacetic acid, wybutoxosine, wybutoxosine, pseudouridine, queosine, 2-mercaptocytidine, 5-methyl-2-thiouridine, 2-thiouridine, 4-thiouridine, 5-methyluridine, 2-O-methyl-5-methyluridine, 2-O-methyluridine, etc. Polynucleotides include naturally occurring nucleic acids such as deoxyribonucleic acid ("DNA") and ribonucleic acid ("RNA"), as well as nucleic acid analogs. Nucleic acid analogs include those that include non-naturally occurring bases, nucleotides linked to other nucleotides other than naturally occurring phosphodiester bonds, or nucleic acid analogs that include bases linked by bonds other than phosphodiester bonds. Thus, nucleotide analogs include, for example but not limited to, phosphorothioates, phosphorodithioates, phosphotriesters, phosphoramidates, boranophosphates, methylphosphonates, chiral methylphosphonates, 2-O-methyl ribonucleotides, peptide-nucleic acids (PNAs), and the like.

[0164] In addition, in some embodiments, the organic engineering target refers to a polynucleotide sequence that can be assembled together to form an "engineered nucleic acid structure" using the polynucleotide assembly method described herein. "Component polynucleotide" is also referred to as "position" herein, which refers to any separated or separable DNA molecule. Useful examples include, but are not limited to, protein coding sequences, reporter genes, fluorescent marker coding sequences, promoters, enhancers, terminators, introns, exons, poly-A tails, multiple cloning sites, nuclear localization signals, mRNA stabilization signals, selection markers, integration loci, epitope tag coding sequences, degradation signals or any other naturally occurring or synthetic DNA molecules. In some embodiments, the DNA fragment is of natural origin. Alternatively, the DNA fragment can be a completely synthetic source produced in vitro. In addition, the DNA fragment can include any combination of separated naturally occurring DNA molecules, or any combination of separated naturally occurring DNA molecules and synthetic DNA molecules. For example, the DNA fragment can include a heterologous promoter operatively connected to a protein coding sequence, a protein coding sequence connected to a poly-A tail, a protein coding sequence connected in frame to an epitope tag coding sequence, and the like. Working examples of various organic engineering targets are described below (1008, 1010, 1012).

[0165] refer to Figure 3A In box 1014, after selecting a first plurality of engineering targets, the method includes assigning the first plurality of organic engineering targets to a first uncompiled workflow. Typically, a workflow is a general laboratory process that includes a series of unit operations to achieve an engineering target. The workflow can be applied to different samples or batches of organic engineering targets with different parameter sets. The first uncompiled workflow is configured to produce a first plurality of organic engineering targets, and the first uncompiled workflow is associated with a first subset of processing modules among a plurality of processing modules. A processing module is a general laboratory process consisting of a series of unit operations. In most cases, processing modules are typically executed in a workflow and shared by research projects. When developing a workflow, a processing module can be called from a library (e.g., a processing module library 54) and the processing module can be configured with an appropriate set of parameters to simplify and standardize programming practices. Processing modules can be nested to form complex workflows. For example, referring to Fig. 6A, an exemplary evolutionary engineering workflow is associated with a subset of processing modules including cell culture and samples, while a library screening workflow is associated with standardization, transformation, cell culture, and sample processing modules. Each respective processing module in the plurality of processing modules is associated with a different subset of unit operation definitions in the plurality of unit operation definitions. Each respective unit operation definition in the plurality of unit operation definitions is independently associated with a corresponding time interval, and each respective unit operation definition in the plurality of unit operations is independently associated with a first subset of instruments in the plurality of instruments. In bioengineering, unit operations are basic steps in laboratory processes. A unit operation involves a physical or chemical procedure performed on a sample by a single instrument. In scheduling, a unit operation or action is the largest inseparable unit that can be composed of a sequence of microsteps (e.g., other procedures or delays cannot be eliminated in these microsteps). As Fig. 6A As shown, the exemplary processing module "Standardization" includes the unit operation Pipetting, while the processing module "DNA Quantification" includes the unit operations "Spectrophotometry" and "Pipetting" (1014).

[0166] A subset of instruments includes, but is not limited to, systems and / or devices that perform unit operations. Fig.18 In some embodiments, a subset of the instruments includes an automated centrifuge handling system 1800. The automated centrifuge handling system 1800 includes a robotic arm that operates the various instruments of the system and processes samples.

[0167] In some embodiments, the robot arm is a Cartesian robot arm. In some embodiments, the robot arm is an articulated robot arm, including a four-axis robot arm, a five-axis robot arm, a six-axis robot arm, and a seven-axis robot arm. For example, in some embodiments, the robot arm is a Kuka KR 3R540 AGILUS robot arm or a Kuka KR 1000titan F robot arm. In some embodiments, the robot arm is a selective flexibility assembly robot arm (SCARA). In some embodiments, the robot arm is the aforementioned transport device. In some embodiments, the robot arm is a conveyor belt, a linear conveyor, a gantry, or a lift.

[0168] Robotic arm 1802 transfers sample from storage device 1804 to perforated plate or similar device, and described perforated plate or similar device is used by centrifuge 1818, such as vial, bottle, screw cap tube, snap cap tube, open tube, flip cap tube etc. Once perforated plate or multiple perforated plates in some embodiments are filled, the quality of each perforated plate is determined.In certain embodiments, these perforated plates form the first perforated plate set (for example, the perforated plate of the first operation of centrifuge).The number of perforated plates in perforated plate set is determined by the type and size of centrifuge 1818.For example, in some embodiments, centrifuge is configured to keep a perforated plate, is configured to keep two groups of perforated plates, three groups of perforated plates, four groups of perforated plates, five groups of perforated plates etc.The number of perforated plates and the type of perforated plates depend on the centrifuge type used in the present disclosure.Therefore, in some embodiments, perforated plates are 6-well plates, 12-well plates, 24-well plates, 48-well plates, 96-well plates, 384-well plates or 1536-well plates. Similarly, in some embodiments, the plates are formed with a U-shaped bottom portion, a V-shaped bottom portion, or a flat bottom portion. For example, in some embodiments, the multiwell plate is a Fisherbrand 96-well plate No. N95029340FP; Thermo Fisher Scientific Nunc U96 microplate, PS; Thermo Fisher Scientific Nunc V96 microplate, clear, PS; CELLTREAT 96-well untreated microplate, F-bottom, clear, sterile; iSci d75-712 microplate; or Corning 3370 plate, 96-well, PS, flat, 100 / cs, clear. However, the present disclosure is not limited thereto.

[0169] Centrifuges of the present disclosure include but are not limited to small desktop centrifuges, microcentrifuges (e.g., microcentrifuges), high-speed centrifuges, or ultracentrifuges. In certain embodiments, the centrifuge is an Eppendorf 5430 centrifuge R, an Eppendorf 5920R centrifuge, a Jouan Robotics GR4 Auto centrifuge, or a Thermo Fisher Scientific Heraeus Multifuge X3 series centrifuge. However, the present disclosure is not limited thereto.

[0170] Each porous plate has a corresponding balancing block 1814, which ensures that centrifuge 1818 is stable during operation. In the absence of human intervention, the mass of each balancing block 1814 is adjusted to be equal to the mass of the corresponding porous plate. This adjustment is achieved by pumping fluid (for example, water, mineral oil, aqueous solution, organic solution, etc.) from container 1806 to balancing block 1814 through pump 1810, and the container includes a pressure regulator 1808, or includes an air inlet in some embodiments. In certain embodiments, pump 1808 is a siphon. What is connected to the pump is a nozzle, which either distributes fluid from container 1806 to balancing block 1814, or extracts fluid from balancing block 1814 to container 1806. In certain embodiments, the bottom portion of each balancing block 1814 is formed with a slope to allow the fluid of container 1806 to be collected in balancing block 1814. The collection of fluid in balancing block 1814 ensures that the entire fluid can be completely removed from the balancing block. In certain embodiments, the slope is formed into a V-shape, a U-shape or an inclined plane. Additionally, in some embodiments, each balancing weight 1814 is configured to have a relatively low empty mass (e.g., a few grams) to allow for greater accuracy and precision in determining the mass of the balancing weight while minimizing the energy expenditure required to move the balancing weight. Each balancing weight has a high internal volume or capacity to ensure that sufficient mass can be added thereto, and has a high tolerance to centrifugation to ensure that the balancing weight survives operation in a centrifuge.

[0171] In certain embodiments, porous plate and corresponding balancing weight 1814 are placed on balance 1816 or scale, to ensure that the mass of porous plate and corresponding balancing weight 1814 is equal. This also ensures that measurement is carried out simultaneously. Similarly, in certain embodiments, scale 1816 is used to measure the mass of porous plate and store for later use. Porous plate is placed in centrifuge 1818 by mechanical arm 1802. Then the mass of corresponding balancing weight is determined by scale 1816, and adjusted according to the stored mass of porous plate. In certain embodiments, the mass of corresponding balancing weight is stored for later use, so that the adjustment of the mass of balancing weight in the subsequent operation of centrifuge does not need so much adjustment (for example, adjusting the mass of previous 20g to 21g instead of adjusting the mass of 0g to 21g). Once the mass of porous plate and the mass of corresponding balancing weight 1814 are equal, and both devices are arranged in centrifuge 1818, just operate centrifuge.

[0172] In some embodiments, after operating the centrifuge 1818 with the first multi-well plate set and the corresponding balancing weight 1814, a second multi-well plate set is prepared accordingly. In some embodiments, the second multi-well plate set is a pre-sterilized first multi-well plate set. The mass of each multi-well plate in the second set is measured, and the mass of the corresponding balancing weight 1814 is measured according to the above description of the first multi-well plate set (e.g., simultaneously or continuously). Therefore, the automated centrifuge system used in the present disclosure enables the centrifuge 1818 to be fully operated without human intervention (e.g., producing multi-well plates and determining and adjusting the mass of the balancing weight).

[0173] Workflows may include processes for pathway construction, expression fine-tuning, genome editing, and cell adaptation, but the disclosure is not limited thereto. Other workflows include cloning, evolutionary organic engineering, genome organic engineering, genotyping, library screening, pathway construction, and protein organic engineering (1016).

[0174] Examples of processing modules include, but are not limited to, cell culture, DNA assembly, DNA purification, DNA quantification, standardization, polymerase chain reaction (PCR), sample preparation, sampling, sample analysis, protein extraction, and transformation; however, the present disclosure is not limited thereto. For example, in other embodiments, such as a surgical pathology system or a toxicology system, the processing modules can vary between systems (1018, 1020).

[0175] Examples of unit operations include, but are not limited to, centrifugation, freezing cultivation, heating cultivation, magnetic separation, stripping, pipetting, distribution, sealing, shaking cultivation, spectrophotometry, chromatography, mass spectrometry, microscopic imaging, electrophoresis, electroporation, cloning separation, colony selection, and thermal cycling. Other unit operations include freezing, purification, heating, low temperature storage, ultrasonic treatment, grinding, sterilization, etc. (1022, 1024).

[0176] An instrument is a device that performs one or more specific functions in an automated system. In most cases, an instrument is a device that performs one or more unit operations on a sample or an organic engineering target. Examples of instruments include, but are not limited to, centrifuges, Peltier temperature controllers, incubators, shaking incubators, magnetic separators, strippers, liquid handling robots, distributors, sealers, plate readers, liquid chromatography systems, gas chromatography systems, mass spectrometry systems, microscopes, electrophoresis devices, electroporation devices, clone separation devices, clone selection devices, and thermal cyclers. Figure 6B Exemplary unit operations and the relationships between multiple instruments are described. Other instruments include, but are not limited to, fume hoods, glove boxes, stabilization chambers, sterilizers, grinders, burners, water baths, coolers, and similar instruments found in scientific laboratories and bio-foundries (1026, 1028).

[0177] For example, refer to Fig.13 In some embodiments, the apparatus includes a reagent handling device 1300. The reagent handling device 1300 of the present disclosure is configured to store and dispense a variety of reagents (e.g., liquid and / or gaseous reagents) for a long period of time. For example, if the reagent is honey, which has an indefinite shelf life, the reagent handling device can store and dispense the honey as long as power is provided to the robot 1300.

[0178] Fig.13 The reagent handling device 1300 includes a main switch 1302 (e.g., a main valve), which is configured as the main control of the robot. The control of the reagent handling device 1300 is carried out by one or more pumps (e.g., a plurality of independent pumps, multichannel pumps or a combination thereof), which allows control of distribution cycles and sterilization cycles. The main switch 1302 is programmatically controlled to allow the robot 1300 to operate automatically in the workflow. However, in some embodiments, the manual control main switch 1302 and / or the main switch 1302 are multiple selective valves. In certain embodiments, the main switch 1302 includes at least a first port 1302-1 and a second port 1302-2, which are dedicated ports for various cycles of the reagent handling device 1300, which will be described in more detail below.

[0179] The distribution cycle includes distribution manifold 1310 and reagent container part. The inlet of distribution manifold 1310 is connected to the outlet of main switch 1302, allowing reagent to flow or traverse to distribution manifold from reagent container part. The outlet of distribution manifold 1310 is connected to one or more distributors 1312. This diagram describes six distributors (for example, distributor 1312-1, distributor 1312-2, ..., distributor 1312-6). However, the disclosure is not limited to this. For example, in some embodiments, there is a one-to-one relationship between the distributor 1312 of reagent and reagent processing device 1300. In certain embodiments, there are multiple distributors 1312, to allow to distribute every kind of reagent and combination thereof by special distributor 1312.

[0180] In addition, in this illustration, there is one connection from the main switch to the distribution manifold. In some embodiments, there are multiple connections from the main switch to the distribution manifold. Multiple connectors for dedicated connections to the distribution manifold 1302 for each reagent that the reagent handling device 1300 is configured to distribute. Each connection or connector of the reagent handling device 1300 is a conduit that allows the reagent to be sterile. In some embodiments, these connectors are removable.

[0181] The reagent container portion includes various reagent containers 1304 (e.g., reagent container 1304-1, reagent container 1304-2, ..., reagent container 1304-6, ... reagent container 1304-i), each of which stores a unique reagent. In some embodiments, the reagent container is formed of a sterile material, is sealed from the external environment, and resists electromagnetic radiation (e.g., ultraviolet light, visible light, infrared light, etc.) or a combination thereof. In addition, there is no maximum or minimum number of reagent containers 1304 that can be used by the reagent processing device 1300 because the robot is configured to store and distribute any number of reagents.

[0182] In certain embodiments, each reagent container 1304 is connected to a pressure regulator 1316. Pressure regulator 1316 allows the pressure in the reagent container to be controlled, so as to increase the pressure of the reagent container or reduce the pressure. The pressure control in the reagent container 1304 enables the internal reagent to be replaced by air or other fluids. In certain embodiments, pressure regulator 1316 includes an air filter that prevents the reagent container 1304 from being polluted. Air filter should be appropriately selected to prevent microorganisms and particulate contaminants from entering the reagent container. In certain embodiments, pressure regulator 1316 includes a check valve that prevents the reagent in the reagent container 1304 from evaporating and / or steam release. In addition, each reagent container 1304 is connected to a valve 1314 (e.g., a selector valve), and the valve controls the material to flow into / out of the reagent container and the main valve 1302 or the cleaning manifold 1308.

[0183] The disinfection cycle includes a cleaning manifold 1308 and a disinfection container 1306. The cleaning manifold 1308 controls the flow of disinfection fluid from the disinfection container 1306 to each reagent container 1304. In some embodiments, the disinfection container is a reagent container 1304 dedicated to storing disinfection fluid. The disinfectant includes a liquid chemical disinfectant, disinfectant water (e.g., high-content disinfectant water), distilled water, detergents, and similar cleaning solutions such as buffers. In some embodiments, the disinfection fluid is a thermally disinfected fluid, such as steam. In some embodiments, the disinfection fluid is a cryogenic gas, steam, or plasma. The disinfection container 1306 is configured in a manner similar to the reagent container 1306, with a valve 1314 and a pressure regulator 1316 connected thereto.

[0184] When describing the cycle of the liquid handling robot 1300, the first position of the valve 1314, hereinafter referred to as "P1", refers to the valve position 1314-P1, as indicated by Fig.13 The second position of valve 1314, hereinafter referred to as "P2", refers to valve position 1314-P2, as shown and described by Fig.13 The third position of the valve, hereinafter referred to as "P3", refers to the valve position 1314-P3, as shown and described by Fig.13 An exemplary reagent container 1304-5 is shown and described.

[0185] In some embodiments, the disinfection cycle is a two-part cycle (e.g., a first disinfection cycle and a second disinfection cycle). The first cycle is configured to disinfect selected portions of the reagent handling device 1300 that require or previously required attention (e.g., repair or replacement), while the second cycle is configured to disinfect portions of the reagent handling device during automated use of the robot.

[0186] In some embodiments, the second cycle is configured to sterilize a selected portion of the reagent handling device 1300 that was recently dispensed or activated and purge the selected portion of the reagent handling device 1300 with air, gas, distilled water, or a similar medium.

[0187] When describing the cycle of the liquid handling robot 1300, the first position of the valve 1314, hereinafter referred to as "P1", refers to the valve position 1314-P1, as indicated by Fig.13 The second position of valve 1314, hereinafter referred to as "P2", refers to valve position 1314-P2, as shown and described by Fig.13 The third position of the valve, hereinafter referred to as "P3", refers to the valve position 1314-P3, as shown and described by Fig.13 An exemplary reagent container 1304-5 is shown and described.

[0188] A first sterilization cycle (e.g., an initial sterilization cycle) is performed by selecting a portion of the reagent handling apparatus 1300 (e.g., reagent containers 1304-5) for sterilization. The main valve 1302 is switched to the selected reagent container, the valve 1314 of the selected reagent container 1304 is switched to P1 and P2 (e.g., P1 is open, P2 is open, and P3 is closed), and the valve 1314 of the selected sterilization container 1306 is switched to P2 and P3. This first sterilization cycle allows, in part, different amounts of sterilization fluid to be dispensed to the various dispensers 1312, from the sterilization container 1306 through the purge manifold 1308 to the selected reagent container 1304.

[0189] A second sterilization cycle (e.g., an automatic sterilization cycle) is performed by switching the master valve 1302 to the second port 1302-2. The second sterilization cycle allows, in part, different amounts of sterilization fluid to be dispensed to the various dispensers 1312 from the sterilization container 1306 through the purge manifold 1308 to the selected dispenser 1304. To purge the master valve 1302 and dispensers 1312, the master valve switches to port one 1302-1, which allows gas or air to be pumped through portions of the system.

[0190] The dispensing cycle is performed by switching each reagent container 1304 to P1 and P3. The main valve 1302 switches to the selected reagent container 1304, which allows the material to flow from the selected reagent container to the predetermined dispenser 1312.

[0191] refer to Figure 14A-Figure 14C In some embodiments, the apparatus includes a vacuum manifold compatible with a centrifuge. The vacuum manifold compatible with a centrifuge drives the fluid through the resin or filter column. Figure 14A-Figure 14C As shown, in some embodiments, the centrifuge vacuum manifold includes a plate-shaped gasket 1402 that seals a portion of the manifold (e.g., the top portion). The manifold also includes a channel plug 1404 that controls and prevents fluid from flowing out of the container body 1406 of the manifold. The container body includes one or more fluid channels formed therein that guide the fluid to flow toward the channel plug 1404. In some embodiments, the fluid channel is formed with an inclined slope on the bottom surface of the container body 1406 to help the fluid flow. The channel of the container body 1406 is configured so that the first opening of the container body 1406 is located at the lowest point of the container body, at least a portion of the one or more channels is located at a point higher than the lowest point of the container body, and the second opening at the outer portion of the container body 1406 is connected to the external vacuum. In addition, a vacuum connector gasket 1408 is connected to the manifold to seal the manifold to an external vacuum, and the external vacuum rests in the vacuum nest 1410. Then, the vacuum is removably connected to the manifold and supports or connects to the external vacuum. In some embodiments, the manifold is configured to have a footprint according to the guidelines of the Society for Biomolecular Screening (SBS). ANSI SLAS1-2004 (R2012), which is incorporated herein by reference in its entirety. In addition, in some embodiments, the manifold is configured to have a low profile so that the manifold is assembled into various centrifuges and distributors. The low profile allows the manifold to be connected to a centrifuge, which may have a column array attached thereto. In some embodiments, the vacuum gasket 1408 and the vacuum nest 1410 have chamfered and / or rounded border portions to enable matching and positioning the container body 1406. As previously described, the chamfered and / or filled border portions of the instrument and its components are preferred so as to allow an automated robot to assemble trays, multiwell plates, samples, etc. into the instrument without hard collisions. For example, if the tray is mismatched by 0.1 mm, and the radius of the fillet is greater than the misalignment, the tray will follow the curve of the fillet and be assembled into the container. Additionally, in some embodiments, vacuum gasket 1408 and vacuum nest 1410 are removably coupled to container body 1406. In some embodiments, each component of the manifold is removably coupled so that the entire manifold can be disassembled into its component parts. Thus, the centrifuge-compatible vacuum manifold of the present disclosure can be operated by a robotic arm (e.g., Fig.18 Robotic arm 1802, Fig.19The robotic arm 1902) operates as a vacuum manifold and stores any fluid that drips from the column array until vacuum is applied.

[0192] refer to Fig.15 , Figures 16A-16D arrive Figure 17A-17B In some embodiments, the apparatus includes a clonal isolation device that allows for automated microbial culture generation. Fig.15 As shown, pipette 1500 is used to draw distilled water 1502 or similar buffer or dilution medium, and air 1504 or similar gas or medium in an alternating manner. According to the design of the present disclosure, these alternative expectations are repeated a predetermined number of times. For example, in some embodiments, there are five alternations, ten alternations, twenty alternations or fifty alternations in total. In some embodiments, the amount of each suction is uniform (for example, suction amount 1502-1 is equal to suction amount 1504-1, which is equal to suction amount 1502-2, etc.). In some embodiments, the amount of each type of suction is uniform (for example, suction amount 1502-1 is equal to suction amount 1502-2, which is equal to suction amount 1502-3, etc.). In addition, in some embodiments, the amount of each suction is uneven (for example, suction amount 1502-1 is not equal to suction amount 1504-1 or suction amount 1502-2, which is not equal to suction amount 1502-3, etc.). Once the final draw of air 1504-i is drawn, the final portion of diluent 1502-Z is drawn. However, the present invention is not so limited, as in some embodiments the final draw 1502-Z is omitted. Finally, the cell culture 1506 is drawn.

[0193] refer to Figures 16A-16D Once the contents of the pipette 1500 are completely aspirated, the contents are gradually dispensed into the cell culture medium 1602 (e.g., a culture dish). The dispensing direction is determined by Fig.16A and Fig. 16C 1 or 1604-2. In some embodiments, the dispensing directions 1606-1 and 1606-2 are lines, predetermined curves (e.g., sinusoids, parabolas, cubic functions, etc.), or a series of curves (e.g., parabolic functions coupled to linear lines). When dispensing the contents of the pipette 1500, the diluent 1502, air 1504, and cell culture 1506 exhibit piston flow. However, the present disclosure is not limited thereto, as it will be appreciated by those skilled in the art that other flow types are exhibited during the dispensing of the contents of the pipette 1500. In some embodiments, the density of the dispensed contents decreases as the contents are dispensed, such that the initial dispensing area has a high density, while the final dispensing area has a low density. Similarly, in some embodiments, the initial dispensing area has a lower density, while the final dispensing area has a high density.

[0194] refer to Figure 17A-17B, the scribing cone 1700 is coupled to the pipette 1500 or similar device via the coupling portion 1706 of the scribing cone. In some embodiments, the coupling portion 1706 includes a cavity 1708 configured to receive the pipette 1500. The scribing cone 1700 or a device coupled thereto (e.g., the pipette 1500) is then moved from the first position to the second position in a continuous motion. In some embodiments, the scribing cone is moved from the first position to the second position in a first continuous motion and then moved from the third position to the fourth position in a second continuous motion. Fig. 16B and Fig.16D Various spiral continuous motions of the scribing cone 1700 according to an embodiment of the present disclosure are shown. However, the present invention is not limited thereto. For example, in some embodiments, scribing is performed in a concentric pattern (e.g., concentric circles, concentric rectangles, concentric triangles) or in an array (e.g., a linear array, a circular array, etc.). The continuous motion of the scribing cone is configured to spread the dispensed contents of the pipette 1500 using the tip 1702 of the scribing cone. The tip 1702 of the scribing cone can be designed to various shapes that promote various diffusions of cell cultures. In addition, in some embodiments, the scribing cone 1700 includes an elastic or flexible portion 1704 that allows movement on the vertical axis of the scribing cone. In this illustration, the flexible portion 1704 is formed as a spring type. However, in some embodiments, the flexible portion 1704 is formed as a damper or similar energy absorbing device. Therefore, the cloning separation device of the present disclosure can achieve a full range of dilution ratios, which ensures the generation of multiple single bacterial colonies.

[0195] In some embodiments, the first device is electronically communicated with at least one transport path connected to multiple instruments for receiving samples from multiple instruments and returning samples to multiple instruments. The transport path is used to transfer samples or organic engineering targets from instruments, unit operations or processing modules to another instrument, unit operation and / or processing module. In many embodiments, the transport path allows a given sample or organic engineering target to traverse three dimensions in the laboratory without human input. In many embodiments, the transport path is the net volume in the system, and the transport device can operate the net volume without hindrance. The transport path can include a multi-channel path or a path grid (1030).

[0196] In many embodiments, the transport path includes at least one transport device configured to move around the transport path. A physical storage medium or buffer is placed on at least one transport device. The buffer is configured to temporarily hold a sample or an organic engineering target to release or allow additional operations in the system. For example, when a sample needs to be placed in an incubator, but the incubator is occupied for 10 minutes and the instrument previously placed by the sample needs to be used immediately by another second sample, the original sample can be temporarily placed in a buffer to release the arm of the instrument or transport device for further use. In many embodiments, at least one transport device includes a robotic arm, a ground vehicle, a friction-reduced orthogonal multi-lane pipeline, an unmanned aircraft, a conveyor belt, a transfer station, an elevator, a crane, a lift, or a combination thereof. The present disclosure is not limited thereto, and the technicians in the field of the present disclosure can utilize many types of transport devices. In many embodiments, at least one transport device includes a liquid handling robot. In such an embodiment, a typical transport device configuration requires a first transport device as a general transport device and a second transport device as a liquid handling robot. The transport device can utilize a series or parallel route, as well as a combination route selection of series and parallel processing routes. These combinations can reduce travel time by optimizing flexible routing between unit operations and / or instruments. In addition, the transport device and transport path should be configured to reduce friction, thereby minimizing operating forces to increase the smoothness of transportation. This reduces the risk of sample dripping, spilling, cross contamination, etc. (1032, 1034, 1036).

[0197] The method further requires translating the first uncompiled workflow into a corresponding instance of the compiled first workflow of the corresponding organic engineering target for each corresponding organic engineering target in the first plurality of organic engineering targets. Typically, the uncompiled workflow is the workflow before obtaining a specific sample input. An instance of a compiled workflow is a single iteration of the workflow in multiple iterations of the workflow (1038).

[0198] In some embodiments, such as a biofoundry, each respective compiled workflow in the plurality of instances of the compiled first workflow is a scheme for synthesizing and expressing a pair of TALENs in a single transcript format via a P2A self-cleaving sequence (1040).

[0199] In such embodiments, at least 400 pairs of TALEN are expressed at 24 hour intervals. However, the disclosure is not limited thereto. In some embodiments, at least 200 pairs of TALEN are expressed at 24 hour intervals, and in another embodiment, at least 600 pairs of TALEN are expressed at 24 hour intervals. The exact number of completed workflows or expressed organic engineering targets can vary (1042) depending on the number of environments, workflows, and system conditions.

[0200] In some embodiments, a first organic engineered target in the first plurality of organic engineered targets is converted into one or more first inputs of a first uncompiled workflow. For example, when the first organic engineered target is a final target or desired output, such as salt (NaCl), the engineered target is converted into reagent components of the output, such as sodium (Na) and chlorine (Cl) (1044).

[0201] In some embodiments, the first organic engineering target is synthesis of a first nucleic acid, and the one or more first inputs of the first uncompiled workflow are a set of nucleic acid bases for synthesizing the first nucleic acid (1046).

[0202] In some embodiments, the first uncompiled workflow includes branch conditions, loop conditions, or nested conditions, and the translation is based on the value associated with the branch conditions, loop conditions, or nested conditions to parse the branch conditions, loop conditions, or nested conditions to form a linear time sequence of the first plurality of unit operations. In some embodiments, the loop condition is a logical criterion for exiting the loop. In some embodiments, the branch condition is a logical criterion for determining the branch at which the program continues at the fork. The logical condition usually requires input from the experiment or the workflow itself. For example, after running a sample batch in processing module A, when all measurements exceed threshold value X, branch N is executed. (1048).

[0203] Each corresponding instrument in the first subset of instruments includes an address of the corresponding instrument and one or more execution instructions for the corresponding instrument. The instrument execution instructions are at least a set of parameters used in the programming of unit operations, processing modules, and workflows. The set of instrument execution instructions is the configuration and process conditions of the machine. Such machine configuration and process conditions include, but are not limited to, adjusting the revolutions per minute (RPM) of the machine, changing the state of the machine between ON and OFF, etc. Another interpretation of the instrument execution instructions is the logical dependency (1050) of the unit operations in the workflow that defines the process of processing the sample.

[0204] For example, instrument executable instructions may include, but are not limited to:

[0205] ● Run unit operation 1 using parameter set 1 for sample ID AZ

[0206] ● Run Processing Module 1 using Parameter Set 2 for Sample ID AZ

[0207] ● If the result from processing module 1 ≥ threshold 1, then

[0208] ● Run Processing Module 2 using Parameter Set 3 for Sample ID AZ

[0209] Otherwise

[0210] ● Run processing module 3 using parameter set 4 for sample ID AZ

[0211] Instrument execution instructions can be interpreted as specific values ​​or coordination instructions, for example:

[0212] ●Parameter sets 1 to n

[0213] ●Sample 1 to n

[0214] ●Threshold 1 to n

[0215] Additionally, instrument execution instructions can be interpreted as dependencies within a process, for example:

[0216] ●Execute 2) after 1)

[0217] ●Execute 3) after 2)

[0218] ●Execute 4) after logical decision 3)

[0219] ●Execute 6 after logical decision 3)

[0220] In some embodiments, the address of the corresponding instrument includes spatial coordinates, including but not limited to Cartesian coordinates, polar coordinates, spherical coordinates, joint coordinates or tool coordinates of the corresponding instrument. In some embodiments, the address of the corresponding instrument includes the physical location of the corresponding instrument. In many embodiments, the address of the corresponding instrument includes a unique electronic address of the corresponding instrument so that a first device such as computer 10 can communicate electronically with the instrument. The corresponding instance of the corresponding compiled workflow further includes an operating condition of the corresponding instruction. The operating condition of the corresponding instruction may include parameters of the instruction, such as a final value check or an initial inspection. (1052, 1054, 1056, 1058).

[0221] refer to Fig.19 , various instrument positioning and control methods and systems will be described with respect to a sample foundry 1900. The foundry 1900 includes a transport device 1902, various instruments 1904-1 to 1904-4, and various markers 1906-1 to 1906-6. In some embodiments, the transport device 1902 includes an articulated manipulator robot or extension that manipulates the various samples and subassemblies of the instruments 1904-1 to 1904-4. In some embodiments, the articulated manipulator robot is Fig.18 Manipulation robot 1802.

[0222] Each instrument 1904-1 to 1904-4 of the foundry 1900 includes a corresponding address, which is a coarse-grained address identified by a corresponding mark 1906-1 to 1906-6. The coarse-grained address allows the transport 1902 to position itself in a position suitable for operating the corresponding instrument within a tolerance of 1 millimeter (mm) to 20 mm. The marks 1906-1 to 1906-6 provide position information for positioning the transport 1902. Therefore, the positioning system uses the coarse-grained address to position and guide the transport 1902 to a position close to the marks 1906-1 to 1906-6 of the corresponding instrument 1904-1 to 1904-4.

[0223] In some embodiments, instruments 1904-1 to 1904-4 and corresponding tags 1906-1 to 1906-6 exist in a one-to-one relationship (e.g., instrument 1904-1 is unique to tag 1906-1), a many-to-one relationship (e.g., instruments 1904-3 and 1904-4 are associated with tag 1906-2), or a one-to-many relationship (e.g., instrument 1904-2 is associated with tags 1906-3 to 1906-6, which correspond to different orientations of the instruments). In some embodiments, when the address or position of tags 1906-1 to 1906-6 is determined, the address is stored for later use by the user. For example, when the position of the first tag is detected, the detected position is stored so that when the first tag is called in a later instance of the workflow, the position of the tag does not need to be re-detected. In some embodiments, the position is stored in a non-volatile memory. In some embodiments, the position is stored in a volatile memory. Therefore, the position of the tag is re-determined for each workflow.

[0224] In some embodiments, the positioning system is a global positioning system (GPS), and each tag 1906-1 to 1906-6 is a GPS coordinate. Similarly, in some embodiments, the positioning system is a radio frequency (RF) system, and each tag 1906-1 to 1906-6 is an RF signal generator. In addition, in some embodiments, each tag 1906-1 to 1906-6 is a two-dimensional (2D) tag (e.g., a barcode, a quick reference (QR) code, a color code, etc.), which is detected and captured using various sensors (e.g., light detection and ranging (LIDAR) sensors, ultrasonic sensors, encoders, compasses, etc.) or cameras (e.g., high-resolution cameras, such as JS1080p, 120 degrees, distortion-free cameras or RerVision USB8MP02G cameras) attached to the transport device 1902. These sensors and / or cameras feed real-time information to the controller and provide information related to the spatial position of the articulated manipulation robot of the transport device and / or the transport device and its surrounding environment. For example, in some embodiments, the transport device includes one or more LIDAR sensors or detectors that use electromagnetic waves to detect obstacles in a three-dimensional environment (e.g., a bio-foundry). In some embodiments, the LIDAR sensor is a SICK LMS-111 LIDAR sensor. The LIDAR sensor operates at a wavelength of 905 nanometers (nm) (e.g., infrared), has an aperture angle of 270°, and a scanning frequency of 25 Hertz (Hz) to 50 Hz. However, the present disclosure is not limited thereto. For example, in some embodiments, the wavelength of light used by the sensor is 10 microns to 250 nm.

[0225] In some embodiments, the positioning system is a set of predetermined paths. An inertial measurement unit (IMU) sensor is coupled to the transport device 1902 to detect disturbances to the transport device and correct the disturbances. The IMU sensor includes an accelerometer, a gyroscope, and a magnetometer. When a disturbance is detected by the IMU sensor, the transport device 1902 adjusts its position to accommodate the disturbance and remains in a stationary position, or remains on its current transport path. In some embodiments, the IMU sensor is a LordSensing 3DM-GX5-25I MU sensor. In addition, in some embodiments, the positioning system includes a series of magnetic scales, wherein the marks 1906-1 to 1906-6 are magnetic marks. Therefore, the transport device 1902 traverses the magnetic scale and locates the instrument by the magnetic marks 1906-1 to 1906-6. In some embodiments, the sensor of the present disclosure has an appropriate range so that all instruments of the foundry are within the range of the sensor.

[0226] In some embodiments, the positioning system described above is used to form a map or representation of the surroundings of the foundry 1900 in order to generate a predetermined path for the transporter 1902. In some embodiments, the positioning system described above is used to form a map or representation of the markers located in the foundry 1900 in order to generate a predetermined path for the transporter 1902. In addition, in some embodiments, a Gaussian blur function or low pass filter is applied to the representation or captured feed to de-noise the image and limit the error range in determining the location of each marker 1906-1 to 1906-6. In some embodiments, the representation is formed so that the transporter 1902 is the origin or zero point of the representation. Similarly, in some embodiments, the representation is formed so that the center of the surroundings of the transporter 1902 is the origin or zero point of the representation.

[0227] Based on the determination that the transport device is at the correct coarse-grained address (e.g., labels 1906-1 to 1906-6) of the corresponding instrument 1904-1 to 1904-4, the transport device is held in place. In some embodiments, the transport device is held in place by lifting one or more extended linear actuators. Similarly, in some embodiments, the transport device is held in place by feedback from a proportional-integral-derivative loop controller in communication with a sensor.

[0228] In some embodiments, when the transport device 1902 is actively moving, sensors (e.g., LIDAR sensors and / or IMU sensors) actively detect the surrounding environment and the location of the markers of the transport device. Thus, the transport device 1902 is able to react to disturbances in its transport path (e.g., detecting a person or obstacle moving through the transport path or standing in the transport path). This reaction allows the transport device to slow down, stop, or reroute to a different transport path according to each disturbance and workflow.

[0229] The articulated human hand is moved to at least one spatial coordinate of the corresponding instrument using the fine traverse instruction. For example, in some embodiments, the fine traverse instruction is a command to extend the articulated arm in a horizontal line.

[0230] In some embodiments, while processing various samples, the articulated manipulation robot uses a safe transfer procedure to transfer the tray (or similar components of the instrument or workflow, such as vials or containers) to instruments 1904-1 to 1904-4, and the safe transfer procedure is a fine lateral movement instruction. When the reading from the sensor or similar positioning system cannot meet the threshold proximity position of the actual position of the instrument (e.g., a threshold of 1mm, a threshold of 5mm, a threshold of 20mm, a threshold of 100mm, a threshold of 0.1 degree rotation, a threshold of 0.25 degree rotation, a threshold of 0.5 degree rotation, a threshold of 1 degree rotation, etc.), the safe transfer procedure is performed. Similarly, when the threshold proximity position is met, the default transfer procedure is performed. For example, in some embodiments, the transport device 1902 determines that it is in the correct position relative to the corresponding mark 1906-1 to 1906-6. However, the sensor detects that the transport device 1902 is in an incorrect position, which enables the safe transfer procedure to be performed.

[0231] In some embodiments, the safe transfer process includes the use of a force detection sensor that allows compliance of the robot's motion. In some embodiments, the force detection sensor is a torque sensor. The safe transfer process initiates a small (e.g., tightly grouped), slow oscillating motion to gradually load the container into the receiving portion of the instrument. The oscillating motion includes a simple oscillation, a Lissajous oscillation, or a spiral oscillation. For example, in some embodiments, the articulated arm extends in one direction with a small (e.g., radius 2mm) spiral oriented around the extension direction. When the force sensor detects a force, the extension path is modified to be consistent with the detected force. Because the robot adapts to the detected force and disturbance, the oscillating motion is constrained to the boundaries and baffles of the instrument, which allows the articulated manipulation robot to find the container and assemble the container into the instrument without hard collisions caused by incorrect positioning.

[0232] The method also requires that the first plurality of unit operations be organized in a linear time sequence in time. Each corresponding unit operation in the first plurality of unit operations is characterized by a time interval defined by the corresponding unit operation. For example, referring to Fig. 6A , the processing module DNA quantification includes the unit operations spectrophotometry and pipetting. The unit operation definition of spectrophotometry defines a time interval of 40 minutes, while the unit operation definition for pipetting defines a time interval of 10 minutes. Therefore, the first plurality of unit operations will require at least 50 minutes and have at least two plausible workflows. In this way, multiple instances of the compiled first workflow are formed (1060).

[0233] In some embodiments, the method enables a user of the first device to adjust the linear time sequence of the first plurality of unit operations through a graphical user interface or other means. Such a graphical user interface includes but is not limited to Fig.10 The Gantt chart shown. Fig.10 In the example of FIG. 1062 , “Batch 1” refers to the first workflow, and “Batch 2” refers to the second workflow. A user of the first device may adjust and order the unit operations of the workflow at their discretion. In some embodiments, a predetermined contingency check may prevent a user from ordering unit operations in a configuration that is less than optimal or triggers a predetermined alarm ( 1062 ).

[0234] In some embodiments, each organic engineered target of the first plurality of organic engineered targets is an input to a corresponding instance of the compiled first workflow of the plurality of instances of the compiled first workflow.

[0235] In some alternative embodiments, each organic engineered target of the first plurality of organic engineered targets is an output of a corresponding instance of the compiled first workflow of the plurality of instances of the compiled first workflow.

[0236] Typically, at any given point in time, an engineering target can be an input or output of an instance of the same compilation workflow. Likewise, an input to a workflow can be an input to another workflow (1064, 1066, 1068).

[0237] In some embodiments, the method further requires obtaining a second plurality of organic engineered targets through one or more peripheral devices. As previously described, the second plurality of engineered targets or samples can exist in a variety of forms, including but not limited to the form of the first plurality of organic engineered targets (1070).

[0238] In some embodiments, a second plurality of organic engineering targets is determined based on outputs of the plurality of instances of the compiled first workflow. In such embodiments, the second workflow can begin to subsequently complete the compiled first workflow (1072).

[0239] Furthermore, in some embodiments, the method assigns a second plurality of organic engineered targets to a second uncompiled workflow. Similar to the first uncompiled workflow, the second uncompiled workflow is configured to generate a second plurality of organic engineered targets, and the second uncompiled workflow is associated with a second subset of the processing modules in the plurality of processing modules (1074).

[0240] In some embodiments, the method further performs a second translation on each respective organic engineered target in the second plurality of organic engineered targets, translating the second uncompiled workflow into a corresponding instance of the compiled second workflow for the respective organic engineered target (1076).

[0241] In many embodiments, two or more instances of the compiled first workflow are executed when the second translation is executed. (1078) As used herein, a compiled workflow is "executed" when at least one unit operation of the compiled workflow is currently being serviced by an instrument specified by the unit operation. For example, consider a case where a unit operation in the compiled workflow specifies aspiration of an aliquot of fluid into a tube. In some embodiments, a compiled workflow containing a unit operation is "executed" during an actual physical pipetting operation specified by the unit operation, and the instrument performs the pipetting as directed by the unit operation. In some embodiments, a compiled workflow containing a unit operation is "executed" during the entire time interval in the unit operation containing the pipetting operation, rather than just the actual physical amount of time it takes the instrument to perform the pipetting. Thus, in such embodiments, a compiled workflow is considered to be "executed" during the entire time interval of the unit operation, even if the physical instructions of the unit operation are completed by the specified instrument before the entire time interval is completed. More generally, a compiled workflow is considered to be executing in some embodiments when the execution instructions of any corresponding unit operation of the compiled workflow are currently controlling an instrument in a plurality of instruments within the time interval specified by the corresponding unit operation.

[0242] Each corresponding instrument in the second subset of instruments includes an address of the corresponding instrument and one or more execution instructions for the corresponding instrument. Similar to the instruments of the first subset of instruments, the corresponding address may exist in a variety of forms, including a physical address and a unique electronic address (1080).

[0243] The second plurality of unit operations are temporally organized into a linear time sequence. Each respective unit operation in the second plurality of unit operations is characterized by a time interval defined by the corresponding unit operation. Similar to the linear time sequence of the first plurality of unit operations, the second plurality of unit operations can be manipulated by a user of the device or computer via a graphical interface.

[0244] (1082).

[0245] In some embodiments, two or more of the plurality of instances of the compiled first workflow and two or more of the plurality of instances of the compiled second workflow are executed simultaneously. As used herein, a "simultaneous run" element refers to a unit operation (1084) of a workflow currently being formulated on an instrument in the plurality of instruments.

[0246] In some embodiments, the first subset of instruments includes two or more instruments, the second subset of instruments includes two or more instruments, and at least one instrument in the first subset of instruments is in the second subset of instruments (1086).

[0247] In some embodiments, the method requires concurrently executing three or more of the plurality of instances of the compiled first workflow and three or more of the plurality of instances of the compiled second workflow, wherein the first subset of instruments includes three or more instruments, the second subset of instruments includes three or more instruments, and at least two instruments in the first subset of instruments are in the second subset of instruments. (1088)

[0248] In some embodiments, the method requires validating the second plurality of unit operations according to a predetermined validation list. The predetermined validation list includes one or more criteria of the compiled second workflow. The one or more criteria of the compiled second workflow include a priority of each unit operation in the second plurality of unit operations, a weight of each unit operation in the second plurality of unit operations, a completion time of the second plurality of unit operations, compatibility of the second plurality of unit operations with a different plurality of unit operations, an attribute of each unit operation in the second plurality of unit operations, and one or more constraints of the second plurality of unit operations. The attribute of each unit operation in the second plurality of unit operations is selected from the group consisting of a viscosity value, a purity value, a composition value, a temperature value, a weight value, a mass value, and a volume value. (1090, 1092, 1094)

[0249] In some embodiments, the method requires executing one or more instances of the compiled first workflow and one or more instances of the compiled second workflow simultaneously, executing two or more instances of the compiled first workflow and three or more instances of the compiled second workflow simultaneously, or executing three or more instances of the compiled first workflow and three or more instances of the compiled second workflow simultaneously (1096, 1098, 1100).

[0250] In some embodiments, the method requires simulating the remaining portion of each of the one or more instances of the compiled first workflow at each corresponding time step in the loop series of time steps. This forms one or more first simulations, each simulating the remaining portion of each of the one or more instances of the compiled second workflow, thereby forming one or more second simulations. Simulating the remaining portion of the one or more instances of the compiled workflow allows for greater optimization in real time, and allows for adaptation to new inputs and completed workflows. Initiate an interlock condition error handler associated with a first unit operation in an instance of the one or more instances of the compiled first workflow, wherein the interlock condition error handler forms an interlock condition with a second unit operation in an instance of the one or more instances of the compiled second workflow. (1102)

[0251] In some embodiments, the interlock condition error handler is started to adjust one or more time intervals of one or more unit operations that have not been executed in the instance of the compiled first workflow or the instance of the compiled second workflow. The interlock condition is a logical conflict in scheduling when one action requires resources occupied by another action, but can only be released when the first action continues. The interlock condition error handler can adjust various parameters, including but not limited to, according to the priority assigned to the compiled first workflow to the priority assigned to the compiled second workflow, the weight of one or more unit operations that have not been executed in the instance of the compiled first workflow or the instance of the compiled second workflow, according to the priority assigned to the compiled first workflow to the priority assigned to the compiled second workflow, one or more time intervals of one or more unit operations that have not been executed in the instance of the compiled first workflow or the instance of the compiled second workflow, or the instance of the compiled first workflow or the instance of the compiled second workflow. In some embodiments, the interlock condition error handler is a mutually exclusive error handler. The interlock condition error handler can also include a race condition or a locking condition (1104, 1106, 1108, 1110, 1112).

[0252] In some embodiments, initiating the interlock condition error handler will pause the instance of the compiled first workflow or the instance of the compiled second workflow. As used herein, pausing a workflow means suspending or ending a workflow or temporarily stopping a workflow (1114).

[0253] In some embodiments, each time step in the cyclic series of time steps occurs periodically. In some embodiments, each time step in the cyclic series of time steps occurs once every five minutes. In further embodiments, each time step in the cyclic series of time steps occurs once every 10 minutes, every 15 minutes, every 25 minutes, every 30 minutes, every 45 minutes, every 60 minutes, every 120 minutes, every half a day, every day, etc. (1116, 1118).

[0254] In some embodiments, each time step in the cyclic series of time steps occurs in response to the occurrence of an event in a plurality of event classes. An event class is an event-triggered rescheduling condition. This describes a class of rescheduling conditions triggered by an event such as a device failure. Other such events include, but are not limited to, adding a new compiled workflow, instances of compiled workflows that are delayed or completed early when the actual decision or loop cycle is not included in the simulated instance or workflow, abnormal resource states such as failures, user interruptions, instrument errors, power failures, sample drops, or interlock conditions, etc. The rescheduling condition is the logical criteria for the rescheduling routine to be executed (1120, 1122).

[0255] In many embodiments, the first subset of instruments includes two or more different instrument classes, and the second subset of instruments includes two or more different instrument classes. Typically, the instrument class can refer to the type of instrument, such as the 96-well and 24-well plates (1124) mentioned above.

[0256] The first instrument class and the second instrument class are used by multiple instances of the compiled first workflow and multiple instances of the compiled second workflow. The first instrument class has a first reuse value, and the second instrument class has a second reuse value different from the first reuse value. The method formulates a scheduler, which maximizes the number of instances in multiple instances of the compiled first workflow, the number of instances in multiple instances of the compiled second workflow, or the number of instances in the combination of instances of the compiled first workflow and the compiled second workflow, and given the first reuse value and the second reuse value, the instruments of the first instrument class and the instruments of the second instrument class can be used simultaneously. The scheduler coordinates the unit operations at the container level, and the script generator (described below) processes each sample in the container in the pipetting operation. Therefore, the script generator converts the experimental design (such as DNA structure design, enzyme assay design and / or restriction digestion design) into an instrument executable instruction. When the scheduler indicates the workflow, the script generated by the script generator will be used as part of the configuration of the unit operation. In addition, when the instrument exists in various reuses, each category of the instrument can be utilized. For example, when well plates are present in a 96-well embodiment and a 24-well embodiment, the first subcategory includes each 96-well plate having a first multiplexing value of 1, and the second subcategory includes each 24-well plate having a second multiplexing value of 4. Multiplexing value (1126) is typically used when there are instruments of various configurations and the throughput of multiple devices needs to be optimized.

[0257] The scheduler is maximized at least in part by calling a first number of instances of a first instrument class based on a first reuse value of the first instrument class and calling a second number of instances of a second instrument class based on a second reuse value of a second instrument class to be run simultaneously to support simultaneously running instances of a compiled first workflow and a compiled second workflow (1128).

[0258] The scheduler maximizes at least in part by concurrently running a first number of instances of the first compilation workflow and a second number of instances of the second compilation workflow (1130).

[0259] The scheduler maximizes at least in part by adjusting a time interval of a corresponding unit operation in a first plurality of unit operations of an instance of a first compilation workflow by a certain amount from a time interval defined for the corresponding unit operation, or adjusting a time interval of a corresponding unit operation in a second plurality of unit operations of an instance of a second compilation workflow by a certain amount from a time interval defined for the corresponding unit operation (1132).

[0260] Incorporated by reference into this document is “Chao et al., 2017, “Fully Automated One-Step Synthesis of Single-Transcription TALEN pairs using a Biological Foundry”, ACS Synth Biol, 6, p. 678”.

[0261] Example I - Design of a single transcription TALEN synthesis protocol

[0262] The TALEN architecture used in this work is based on the previously reported AvrXa10 TALE from Xanthomonas oryzae pv. oryzae (Liang et al., 2014, "FairyTALE: A high-throughput TAL effector synthesis platform", ACS Synthetic Biology, 3(2), p. 67). Briefly, it utilizes an N-terminal extension of +207 amino acids and a C-terminal extension of +63 amino acids, which eliminates the 5'-T requirement and allows greater flexibility in target sequence design (Sun et al., 212, "Optimized TAL effector nucleases (TALENs) for use in treatment of sickle cell disease", Mol Biosyst, 8(4), p. 1255). Attached to the C-terminus is an engineered FokI cleavage domain that exhibits increased cleavage efficiency in yeast and human cells (Sun et al., 2014, "SunnyTALEN: a second-generation TALEN system for human genome editing", Biotechnol Bioeng, 111(4), p. 683). The central repeat domain of both TALENs is constructed from a library of double-repeat substrates, i.e., each substrate contains two TALE repeats that recognize two consecutive DNA bases. For this work, we used a library of 441 double-repeat substrates adapted from "FairyTALE", divided equally into 17 groups based on their position in the assembly (Liang et al., 2014, "FairyTALE: A high-throughput TAL effector synthesis platform", ACS Synthetic Biology, 3(2), p. 67) ( Figure 11A-11B). In addition to the 4×4 substrate covering all possible DNA dibases at each assembly site, we also included the option of encoding guanine “organic engineering targets” using NH or NN. To separate the two TALENs on a single plasmid, we used a polycistronic format utilizing the P2A self-cleaving peptide sequence (Donnelly et al., 2004, “Multiple gene products from a single vector: ‘self-cleaving’ 2A peptides,” Gene Therapy, 11(23), p. 1673; Kim et al., 2011, “High cleavage efficiency of 2A peptides derived from porcine teschovirus type 1 in human cell lines, zebrafish, and mice,” PLoS ONE, 6(4)). The two TALENs are encoded as a single transcript, but during translation, the P2A peptide will self-cleave the growing polypeptide to produce two independent TALENs ( Figure 3A ).

[0263] Using the optimized 4-bp linker set in the "fairyTALE" construction scheme, 2 sets of 7 double repeat substrates were connected to the TALEN acceptor vector in a single step by Golden Gate assembly, with the P2A linker substrate located between the 2 sets of 7 double repeat substrates. The N-terminal extension of the first TALEN and the C-terminal extension of the second TALEN were carried by the vector, while the C-terminal extension of the first TALEN and the N-terminal extension of the second TALEN were carried by the linker substrate. Since the linker substrate and the acceptor carry the last repeats of the two TALENs, 4 TALEN acceptors and 4 linker substrates were generated ( Figure 4B ). This construction scheme assembled 15 DNA fragments into a 5 kb mammalian expression vector to produce a single plasmid TALEN pair that recognizes a 30 bp DNA sequence.

[0264] Example II - One-pot assembly of TALENs

[0265] To meet the requirements of TALEN library construction, we optimized the reaction conditions to maximize assembly fidelity. For library creation applications, picking individual clones for testing will be a clear throughput bottleneck, and therefore we will need to achieve high assembly fidelity to allow skipping of clone isolation without significantly affecting the quality of the library. We picked 28 colonies from a single transcriptional TALEN assembly "organic engineering target" and evaluated them by restriction digestion followed by gel electrophoresis. Figure 4C As shown, all 28 clones gave the correct digestion pattern. We then sequenced 4 of the clones, and all 4 clones appeared to be correct. This (28 / 28) corresponds to a fidelity of at least 87.7% based on a binomial probability of 95% confidence.

[0266] Example III - Single transcription TALEN functionality in HEK293T and hESC cells

[0267] To ensure that P2A was efficiently cleaving proteins, we performed immunoblot analysis on lysates of HEK293T cells that had been transfected with single-plasmid TALENs. Figure 5A As shown, only TALEN monomers were detected and no dimers were observed, indicating that the P2A sequence efficiently cleaved proteins in HEK293T cells.

[0268] After confirming P2A functionality, we proceeded to compare the DNA cleavage efficiency of single transcription TALENs with that of traditional dual-plasmid TALENs previously reported. Two sites, ABL1 and BRCA2, “organic engineering targets” were selected for this comparison and a “compilation workflow” experiment was performed in HEK293T cells. Cleavage efficiency was measured using the T7E1 nuclease assay, which detects indels introduced by NHEJ following TALEN-induced double-strand breaks. Figure 5B As shown, the cutting efficiency of the two single transcription TALENs is comparable to that of traditional TALENs. The 1P-TALEN used in this experiment uses NH to recognize guanine, while traditional TALEN uses NN to recognize guanine. Based on our observations and consistent with reports by others (Streubel et al., 2012, "TAL effector RVD specificities and efficiencies", Nature Biotechnology, 30(7), p. 593), when used in large quantities, NH RVD is not conducive to TALE binding. Therefore, when there are more than 4 guanine bases in the recognition site, we recommend using NN or a mixture of NN and NH RVD ( Fig. 8A ).

[0269] We further compared the cleavage efficiency of single transcription TALENs in H1 hESC cells with an IRES-EGFP tag following endogenous Oct4 (H1Oct4-EGFP, WiCell). We targeted the OREG1393087 "organic engineered target", a site known to be an important enhancer of Oct4 expression, with either traditional dual-plasmid TALENs or single transcription TALEN "organic engineered targets" and monitored Oct4 expression levels in the stem cell population "workflow". Figure 5C -E, targeting the enhancer region using either TALEN resulted in an Oct4-reduced stem cell population. The activity generated by the single transcription TALENs was comparable to that of conventional TALENs.

[0270] Example IV - Fully automated single transcription TALEN assembly at the BioFoundry

[0271] Many genomic studies may involve screening a large number of targets, which requires large-scale synthesis of TALEN to specifically destroy these loci. Although we have improved the efficiency of TALEN synthesis and simplified the workflow, it is very tedious to manually construct hundreds of such TALENs, if not impossible. Human errors and inconsistencies will also jeopardize the quality of the library. Automation has been used to accelerate bio-organic engineering (Esvelt et al., 2011, "System for continuous directed evolution of biomolecules (A systemfor the continuous directed evolution of biomolecules)" Nature (Nature), 472 (7344), p. 499; Wang et al., 2009, "Programming cells by multiplex genome organic engineering and accelerated evolution" (Nature), 460 (7257), p. 894). The latter method has demonstrated the huge ability of full automation by producing a large number of genetic variants in a short time. To enable large-scale applications of TALEN, such as genetic screening, we sought to fully automate the TALEN synthesis process "workflow". However, existing integrated platforms are extensively customized for specific tasks and difficult to reconfigure. Building a deeply customized system specifically for TALEN synthesis would be inefficient and uneconomical. Instead, we applied a general Golden Gate assembly workflow implemented on iBioFAB.

[0272] The iBioFAB “system” consists of component instruments, a central robotic platform, and a modular computational framework ( Figure 6A-6D Twenty device “instruments” (each responsible for a unit operation such as pipetting and culturing) are connected to various processing modules such as DNA assembly and transformation by two robotic arm “transporters”, which are then further organized into workflows such as pathway construction and genome organoid engineering ( Figure 6A-6C An overall scheduler "Scheduler" was developed to coordinate unit operations and allow hierarchical programming of workflows ( Figure 6CiBioFAB is configured to perform a general automated DNA assembly workflow in which a variety of DNA constructs “organic engineering targets” can be made on demand using the Golden Gate method (Engler et al., 2008, “A one pot, one step, precision cloning method with high throughput capability”, PLoS ONE, 3(11), e3647). The unit operation sequences are designed to implement this workflow ( Fig. 7A and Figure 7B ). To streamline the process, we developed a script generator, a design tool that automatically converts DNA assembly "organic engineering target" designs into experimental routines that mix and match arbitrary DNA parts "unit operations". The script generator then generates robotic commands for iBioFAB to perform complex pipetting jobs "unit operations". Pipetting paths "unit operations and / or transport paths" are also optimized to minimize tip and time consumption. For the same substrate, as many aspiration steps "unit operations" are combined as possible and assigned to the corresponding destinations. Tips are loaded from the storage carousel "physical storage medium" to the liquid handling station as needed.

[0273] In this work, we change this DNA assembly workflow to synthesize single transcription TALEN "organic engineering targets". Add an extension to the script generator to automate the DNA assembly design, which is specifically for TALEN. Using this pipeline, the operator only needs to input the target DNA sequence "organic engineering target" into the script generator, and the iBioFAB "system" will perform the rest of the TALEN synthesis "workflow" with minimal manual intervention. It only requires the operator "user" to load reagents and consumables every day. Any number between 1 and 192 TALEN pairs can be synthesized in each batch.

[0274] Example V-19 High-throughput synthesis of 2 single transcription TALENs

[0275] To test the high-throughput synthetic pipeline "system", we fed 192 different human genomic target sites "organic engineering targets" to the script generator "first device". iBioFAB performs 3648 pipetting steps in 17 hours from 444 different DNA parts and reagents at reasonable material costs. By staggering the batches, more than 400 TALENs can be generated in a single day.

[0276] To assess the success of the synthesis, 94 randomly selected constructs "Organoengineering Targets" were tested by the polyclonal restriction digestion "workflow". All samples showed the correct digestion pattern ( Figure 7C and Fig.7D ), which corresponds to a success rate of at least 96.2% and a confidence level of 95% based on binomial probability. For activity testing, we randomly selected 22 TALENs for T7E1 assay in HEK293T cells (Mashal et al., 1995, "Detection of mutations by cleavage of DNA heteroduplexes with bacteriophage resolvases", Nat Genet, 9(2), p. 177). Here, 15 of the 22 samples showed cleavage activity. Since cleavage activity is known to be sequence-dependent, the lack of activity for some sites is not unexpected (Cermak et al., 2011, "Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting", Nucleic Acids Res, 39(12), e82). To eliminate the possibility of incorrect assembly, we sequenced all constructs that did not exhibit cleavage activity. All sequencing reads were aligned with the expected TALEN design, indicating that the TALEN was assembled correctly ( Fig.12 ).

[0277] In addition to TALEN, clustered regulatory short palindromic repeats (CRISPR)-Cas9 is another popular technology used in genome editing applications (Sander et al., 2014, "CRISPR-Cas systems for editing, regulating and targeting genomes", Nat Biotechnol, 32(4), p. 347). In contrast to using specific proteins to recognize DNA sequences, CRISPR uses RNA for recognition through base pairing. Using nucleic acids to target "organically engineered targets" has many advantages, but the most important is that large nucleic acid libraries are easily accessible through the use of microarray DNA synthesis. Thus, even though TALEN was two years ahead of CRISPR, multiplex targeting and genetic screens were first achieved using CRISPR (Shalem et al., 2014, “Genome-scale CRISPR-Cas9 knockout screening in human cells”, Science, 343(6166), p. 84; Wang et al., 2014, “Genetic screening in human cells using the CRISPR-Cas9 system”, Science, 343(6166), p. 80). Cong et al., 2013, “Multiplex Genome Engineering Using CRISPR / Cas Systems”, Science, 339(6121), p. 819). However, due to its relatively short recognition sequence, 20 bp, off-target effects are a significant issue in CRISPR (Fu et al., 2013, "High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells", Nature Bioscience, 31(9), p. 822). In genetic screens targeting structural genes, off-target effects can be compensated by targeting multiple sites within the same gene, so that high-confidence hits can be identified by looking for enrichment of sets of sites rather than any single site. However, in the case of very small functional DNA elements, such as transcriptional enhancers or miRNA genes, their length is not sufficient to fit multiple target sites. Furthermore, in the case of enhancers, the target cleavage site is a transcription factor binding site, typically about 10 bp.Given the limited range of target selection, CRISPR may not be able to find sufficiently unique sites in the genome. In addition, given the small number of selectable sites for such screening, the confidence level for any resulting hit will be low. TALEN libraries with different off-target profiles can be used in conjunction with CRISPR libraries to improve the confidence of any potential hits.

[0278] In summary, we developed a protocol for synthesizing TALEN pairs on a single support in a one-pot reaction, which greatly simplified the synthesis of TALENs while achieving a remarkable success rate. An automated process was then developed, and the resulting pipeline enables the creation of large TALEN libraries at a reasonable cost and time frame.

[0279] Methods - iBioFAB

[0280] The iBioFAB “system” consists of an F5 robotic arm “transporter” (402) on a 5-meter track “transport path” (FANUC, Oshino-Mura, Japan), an Evo200 liquid handling robot “second transporter” (404) (Tecan, Mönnedorf, Switzerland), two shaking temperature control blocks (Thermo Scientific, Waltham, MA), an M1000 microplate reader (406) (Tecan, Mönnedorf, Switzerland), a Cytomat 6000 incubator (408) (Thermo Scientific, Waltham, MA), two Cytomat2C shaking incubators (Thermo Scientific, Waltham, MA), and three Multidrop Combi reagent dispenser (412) (Thermo Scientific, Waltham, MA), four Trobot thermal cyclers (414) (Biometra, Göttingen, Germany), Vspin plate centrifuge (Agilent Technologies, Santa Clara, CA), storage carousel (416) (Thermo Scientific, Waltham, MA), decapsulation station (Thermo Scientific, Waltham, MA), Alps plate sealer (410) (Thermo Scientific, Waltham, MA), WASP plate sealer (Thermo Scientific, Waltham, MA), Xpeel seal stripper (Brooks, Chelmsford, MA), and label printer (418) (Agilent Technologies, USA). The liquid handling robot was equipped with an 8-channel independent pipette, a robotic manipulator arm, a 96-channel pipette, six Peltier temperature control blocks (Torrey Pine, Carlsbad, CA), two shakers (Q.Instruments, Jena, Germany), a light box, and a camera for colony picking “multi-instrument” (Scirobotics, Kfar Saba, Israel), as shown in Figure 2A-2B Shown in the middle part.

[0281] Momentum (Thermo Scientific, Waltham, MA) was used to communicate with peripheral devices, control the central robot and program the processing modules. The processing modules define the sample transport routes "transport paths" between unit operations and unit operations. Freedom Evoware (Tecan, Mennedorf, Switzerland) was used to control the liquid handling robot and program the pipetting module. The pipetting module specifically defines the general pipetting procedures on the liquid handling robot, such as labware obtaining "executable instructions" from the central robot "transport device", DNA part distribution, reagent distribution and temperature control "unit operation". iScheduler and ScriptGenerator were programmed in Visual Basic. iScheduler executes the processing module by sending commands in Extensible Markup Language to Momentum. ScriptGenerator converts the user-defined DNA assembly "organic engineering target" into an arrangement of components to source and destination locations based on the preloaded component storage board layout. The corresponding pipetting route "unit operation" is optimized by queuing the destination locations from the same source. The pipetting work list is compiled accordingly and sent to Freedom Evoware to control the aspiration, distribution and tip change actions. Aspirate and dispense a defined amount of each DNA portion multiple times without touching the liquid in the destination "executable instructions". When dispensing all destinations of the same source, reuse and change tips as much as possible. Constraints "interlocking conditions" such as tip volume and the maximum number of aspirations using each tip are also imposed in the algorithm.

[0282] Example VI - Plasmid

[0283] Based on the RVD segments used in previous work (Liang et al., 2014, “FairyTALE: A high-throughput TAL effector synthesis platform”, ACS Synthetic Biology, 3(2), p. 67), a new library of TALEN stock plasmids was developed for single plasmid design. The group at position 6 was replaced with the LR_N-term_FokI_P2A+C-term construct ( Fig. 8A ). The double and single RVD parts with NN were supplemented to the reserve library. The RVD and P2A fragments were inserted into the receptor plasmid with human CMV promoter and the last repeat N-terminus and FokI domain of the second TALEN monomer ( Figure 8B )middle.

[0284] Example VII - Golden Gate Assembly and Inspection

[0285] Golden Gate DNA assembly was performed using methods described in previous work (Liang et al., 2014, "FairyTALE: A high-throughput TAL effector synthesis platform", ACS Synthetic Biology, 3(2), p. 67). Competent E. coli HST08 strain (Clontech, Mountain View, CA) was prepared using a mixed E. coli transformation buffer set (Zymo Research, Irvine, CA). First, 2.5 μL of the Golden Gate reaction product was mixed with E. coli competent cells on a Peltier block maintained at 0°C and cultured for 30 minutes. The cell plate was then transferred to a second Peltier block maintained at 42°C by a plate manipulation arm. After a 1-minute heat shock, the cell plate was transferred back to the 0°C block and frozen for 2 minutes. The transformants were recovered in LB broth (BD USA, Franklin Lakes, NJ) for 1 hour. The recovered cell suspension was plated on LB agar medium containing 100 μg / mL ampicillin or used to inoculate polyclonal LB liquid medium supplemented with 200 μg / mL carbenicillin. Plasmids were extracted from polyclonal cultures using a MagJet plasmid DNA kit (Thermo Scientific, Waltham, MA) and restriction digested with EcoRI-HF (New England Biolabs, Ipswich, MA). The digestion products were analyzed by 1% agarose gel in low throughput or high throughput analysis on a fragment analyzer (Agilent Technologies, Ankeny, IA). Selected plasmids were also tested by Sanger sequencing reactions (ACGT, Wheeling, IL) using four primers. Binomial probability confidence intervals for assembly success rates were calculated using the Clopper-Pearson method (Clopper et al., 1934, "The use of confidence or fiducial limits illustrated in the case of the binomial", Biometrika, 26, p. 404).

[0286] Example VIII - Mammalian gene knockout and testing

[0287] Human embryonic kidney (HEK) cell line HEK293T was transfected with randomly selected TALEN plasmids. HEK293T cells were used because they are easy to culture and transfect. Although cell identification or mycoplasma contamination tests were not performed, we believe that the results of T7E1 assays are relatively insensitive to cell line background. Cells were maintained in Dulbecco's modified Eagle medium (DMEM) (Corning Life Sciences, Tewksbury, Massachusetts) supplemented with 10% heat-inactivated fetal bovine serum (Life Technologies, Carlsbad, California) at 37°C and 5% CO2. One day before transfection, 293T cells were seeded into 12-well BiocoatCollagen-I coated plates (Corning Life Sciences, Tewksbury, Massachusetts), with a fusion of about 50%. Transfection was performed according to the manufacturer's protocol with FuGENE HD transfection reagent (Promega, Madison, Wisconsin). Briefly, for each well of a 12-well plate, 1 μg of clone-purified TALEN plasmid was first diluted to a total volume of 100 μL in Opti-MEM (Life Technologies, Carlsbad, CA). After adding 3 μL of Fugene HD reagent and incubating at room temperature for 5 minutes, the mixture was added to the cells. Cells were collected 60 hours after transfection. Genomic DNA was extracted with QuickExtract DNA extraction solution (Epicentre, Madison, Wisconsin).

[0288] Cleavage efficiency was evaluated by T7E1 assay (Mashal et al., 1995, "Detection of mutations by cleavage of DNA heteroduplexes with bacteriophage resolvase", Nature Genetics, 9(2), p. 177). DNA amplicons were designed to have a length of 400-1000 bp flanking the nominal cleavage site by custom-developed Visual Basic scripts. A pair of primer binding sites for the genomic sequence was searched within a given range to avoid off-target, GC, AT, or long stretches of any single type of nucleotide. Terminal nucleotides, GC content, and melting temperature were optimized. The relevant genomic sequence was downloaded by searching the UCSC DAS server (www.genome.ucsc.edu / cgi-bin / das / ), while off-target checks were performed by searching the GGGenome server (www.gggenome.dbcls.jp / ). PCR amplification was performed with Q5 polymerase (New England Biolabs, Ipswich, MA) and annealing temperature drop (10 cycles at 65-55°C, 20 cycles at 55°C). In the cleavage assay, 200 ng of purified amplicons were first denatured and renatured in 10 μL NEB buffer 2 (95°C, 5 min; 95-85°C at -2°C / s; 85-25°C at -0.1°C / s; hold at 4°C). 10 U of T7 endonuclease I (New England Biolabs, Ipswich, MA) was added and incubated at 37°C for 15 min. The reaction was terminated by adding 1 μL of 0.5 M EDTA. The digestion products were analyzed using a fragment analyzer (Agilent Technologies, Ankeny, IA).

[0289] Example IX - Oct4 downregulation assay

[0290] According to the manufacturer's recommendations, the TALEN construct to be evaluated was transfected into H1-Oct4-EGFP stem cells (WiCell, Madison, Wisconsin) by nuclear transfection. After optimization, we fixed on the P4 primary cell 4D-nucleofector kit and programmed CA-137 on the 4D-nucleofector (Lonza, Cologne, Germany). Cells were delivered one day after nuclear transfection and harvested on the fourth day after nuclear transfection. After harvesting, cells were counted and Alexa Fluor 647-conjugated SSEA4 antibodies (Life Technologies, Carlsbad, California) were used to stain cells at a concentration of 5×105 cells in 50 μL PBS containing 2% BSA and 2.5 μL SSEA4 antibodies. The cells were stained in the dark at room temperature for 30 minutes and washed 3 times in PBS before flow cytometric analysis. During analysis, stem cell populations were first selected by gating SSEA4-positive cells. Within this population, we then looked at the spread of EGFP expression and gated on the population with reduced EGFP.

[0291] Figure 2A-2B An exemplary layout of the hardware of the iBioFAB is shown. In the exemplary embodiment, the iBioFAB has two robotic arm "transporters". The centralized 6-DOF arm "transporter" on a 5-meter track is used to transport labware between instrument "transport paths". The 3-DOF arm "secondary transporter" moves labware within the liquid handling station.

[0292] Figure 4A-4C Design and preliminary testing of single transcription TALEN synthetic "organically engineered targets" are shown. Figure 4A The overall design is depicted, where two TALENs are transcribed into one mRNA, but are sliced ​​to separate the translating proteins because the P2A sequence is inserted between the open reading frames. Figure 4B The assembly scheme is depicted. A library of all possible combinations of single and double TALE repeat "organic engineered targets" is preassembled with standardized Golden Gate adapters at each position. Thus, each TALEN monomer can target an 8 to 15 nucleotide "organic engineered target" with a mixture of single and double repeats. Repeats of both monomers as well as the LR-C-term-Fok-I-P2A-N-term fragment are assembled in a single Golden Gate assembly reaction. LR: last repeat. Term.: end. Figure 4C The test composition of a single transcription TALEN pair is shown. 28 independent clones were picked and digested by PvuI and StuI. All had the correct digestion pattern. The arrow indicates the correct digestion pattern.

[0293] Figure 5A-5EFunctional testing of single transcription TALENs is shown. Figure 5A Single transcript expression of TALEN pairs is depicted. Two unique TALEN pairs were expressed in HEK293T cells using a single transcript design. TALEN monomers showed visible bands on immunoblots, while no bands the size of the uncleaved doublets were detected. Figure 5B Depicted is genome editing in HEK293T cells. Single transcription TALENs (STTLN) were compared to traditional dual-plasmid TALENs (TDTLN) by targeting the BRCA2 and ABL1 loci in HEK293T cells. T7E1 assays were performed to detect indels introduced by TALEN cleavage and NHEJ. STTLN transfected samples showed comparable cleavage efficiency to TDTLN transfected samples. CTRL: Samples without TALEN transfection were used as negative controls. Figure 5C -E depicts disruption of the Oct4 enhancer in H1 hESCs. Flow cytometry was used to quantify GFP expression levels in H1-Oct4-GFP cells. The gated population was below normal GFP expression. Left: control population with no enhancer disruption, middle: enhancer disrupted by traditional 2-plasmid TALENs, right: enhancer disrupted by single transcription TALENs.

[0294] Figure 6A-6D An overview of the iBioFAB system is depicted. Fig. 6A Depicted is a breakdown of unit operations according to an exemplary embodiment of the present disclosure. Figure 6CAn exemplary control hierarchy of iBioFAB is shown. Processing modules are developed in the system control GUI. iScheduler is responsible for workflow level control. The script generator generates pipetting routes for the liquid handling GUI. Processing modules can be quickly recombined to form different workflows. Arrows indicate the flow of processes or samples. Users can choose to intervene at any time, such as moving samples instead of transport devices, or can process samples, such as performing unit operations instead of peripheral devices. Typically, samples or organic engineering targets are processed in batches. Multiple batches can be scheduled and interleaved for parallel processing. In the programming interface, users program workflows using pre-developed and tested modules or sub-workflows. As previously described, workflows define the dependencies of unit operations for sample batches. Users design biological systems based on organic engineering targets with the help of BioCAD. The design is further converted into an experimental plan by a workflow generator, in which a script generator can be integrated. In some embodiments, the workflow generator only generates sample-level experimental scripts that will be used as parameters and / or data by the transport device. In some embodiments, the workflow generator assists in programming other unit operations or workflows. Nested sub-workflows, loops, and branches are allowed in the workflow. These structures are then linearized for the scheduler. In the case of large discrepancies between the actual runtime and the schedule, or when triggered by the user, the workflow is rescheduled in addition to the steps to be executed immediately. Both actions and microsteps, or executable instructions, are generalized for unit operations and defined in the unit operation definition. They are not specific to any model of instrument. The driver maps microsteps to commands used in a specific instrument.

[0295] Figure 7A-7D Depicted is the fully automated synthesis of a TALEN library. Fig. 7A The general workflow of a DNA assembly pipeline based on the Golden Gate method is depicted. The script generator converts project design ideas, such as replacing DNA parts with assembly designs with appropriate extensions, and other robotic commands for transferring raw plasmids to DNA mixtures. In the GoldenGate reaction, type II restriction enzymes such as BsaI generate a set of standard pre-characterized 4-bp single strain ends as adapters. The corresponding adapters are annealed and ligated with T4 ligase. Figure 7B Process flow diagram depicting the construction steps. The unit operations employed are marked in blue. Figure 7C and Fig.7D Depicted is the testing of high-throughput synthesized single transcription TALENs. 94 samples were randomly selected from 192 TALEN pairs synthesized in the full batch test. Each plasmid sample encoding a pair of TALENs was extracted from polyclonal E. coli cell culture and restriction digestion. Fragment size was analyzed by capillary electrophoresis. Digestion pattern was simulated.

[0296] An exemplary summary of the efficiency, output and cost of this biofoundry has shown the production of approximately 400 TALEN pairs per day, requiring approximately one hour of manual labor per day.

[0297] Fig. 8A and Figure 8B Plasmid design for single plasmid TALEN assembly is depicted. Fig. 8A The P2A insert is depicted. It contains the last repeat, C-terminus and FokI of the first TALEN monomer and the N-terminus of the second monomer. The two monomers are separated by the P2A sequence: GGCAGCGGAGCTACTAACTTCAGCCT GCTGAAGCAGGCTGGAGATGTGGAGGAGAACCCTGGACCTGGCATG (SEQ ID. No.: 1). Figure 8B The CMV receptor is depicted. During the Golden Gate reaction, the RVD insert replaces the ccdB fragment. The ccdB site flanks the N-terminus of the first TALEN monomer and the last repeat of the second monomer as well as the C-terminus and FokI domain. The human CMV promoter is used to express both monomers. Four versions of the P2A insert as well as the CMV receptor with different last repeats were constructed.

[0298] Fig. 9A -H depicts the disruption of EGFP in HEK293 cells. The EF1a-tdTomato-P2A-EGFP cassette was stably expressed in HEK293T cells as a reporter system. TALEN was designed to cleave the EGFP fragment. tdTomato was used to exclude non-expressing cells. Fig. 9A Only cells expressing tdTomato are depicted. Fig. 9A Depicted are cells expressing tdTomato and EGFP, separated by the P2A sequence. Fig. 9A Only cells expressing EGFP are depicted. Fig. 9A A negative control with a TALEN targeting sequence other than EGFP is depicted. Fig. 9A Depicted is a 2-plasmid TALEN targeting EGFP using the NN of guanine. Fig. 9A Depicted is a 2-plasmid TALEN targeting EGFP using the NH of guanine. Fig. 9A Depicted is a single transcriptional TALEN targeting EGFP using a NN of guanine. Fig. 9A Depicted is a single transcription TALEN targeting EGFP using the NH of guanine. The results show that 1) the single transcription TALEN has comparable efficiency to the 2-plasmid TALEN, and 2) the efficiency of TALEN with NN is better than NH.

[0299] Figure 11A-11BDepicted is a list of substrates. The nucleotide target of each DBD is represented by A, T, G, C or D, representing the RVD of NI, NG, NH, HD or NN, respectively. In the substrate plasmid, the DBD is flanked by appropriate 4-bp linkers so that they can be assembled at the appropriate position in the recipient plasmid by the Golden Gate reaction. If necessary, the 5* substrate can be used to bridge positions 4 and 8, directly leading to a shorter assembly. The A, T, G and C in P2A and the recipient substrate represent the target nucleotides of the last repetition of TALEN. CMV indicates the CMV promoter used in this particular study, and other promoters can be used by supplementing the library with new substrates. Yellow cells show substrates adapted from previous work (Liang et al., 2014, "FairyTALE: High-throughput TAL effector synthesis platform", "ACS Synthetic Biology", 3(2), page 67), while the remaining substrates are supplemented in this study.

[0300] Fig.12 Depicted is a table of results from the T7E1 assay. HEK293T cells were transfected with TALENs targeting 22 randomly selected genomic loci. Genomic DNA samples extracted from polyclonal post-transfection cultures were used for the T7E1 assay. Asterisks "*" indicate TALENs that showed no cleavage activity were verified by DNA sequencing and compared to the design.

[0301] Cited References and Alternative Examples

[0302] For ease of interpretation and accurate definition in the appended claims, the terms "above", "below", "up", "lower", "upwardly", "downwardly", "inside", "outside", "inwardly", "outwardly", "interior", "exterior", "front", "rear", "rear", "forward" and "rearward" are used to describe the features of the exemplary embodiments with reference to the locations of such features as shown in the accompanying drawings.

[0303] All references cited herein are hereby incorporated by reference in their entirety and for all purposes to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference in its entirety for all purposes.

[0304] The present invention may be implemented as a computer program product comprising a computer program mechanism embedded in a non-transitory computer readable storage medium. For example, a computer program product may comprise Figure 1A-Figure 1D or Figure 2A-2B Any combination of the following and / or Figure 3A-Figure 3L These program modules may be stored on a CD-ROM, a DVD, a magnetic disk storage product, a USB key or any other non-transitory computer-readable data or program storage product.

[0305] Many modifications and variations may be made to the present invention without departing from the spirit and scope of the present invention, which will be apparent to those skilled in the art. The specific embodiments described herein are provided as examples only. The embodiments are selected and described in order to best explain the principles of the present invention and its practical application, so that other persons skilled in the art can best utilize the various embodiments of the present invention with various modifications suitable for the intended specific use. The present invention is limited only by the terms of the appended claims and the full scope of equivalents authorized by these claims. Sequence Listing <110> Lifefoundry Chao Rao Zhao Huimin <120> System and method for supporting multiple automated workflows <130> 120568-5001-WO <150> US 62 / 448,948 <151> 2017-01-20 <160> 1 <170> PatentIn version 3.5 <210> 1 <211> 72 <212> DNA <213> Artificial sequence <220> <223> Cutter <400> 1 ggcagcggag ctactaactt cagcctgctg aagcaggctg gagatgtgga ggagaaccct 60 ggacctggca tg 72

Claims

1. A method for implementing one or more workflows: at an apparatus, the apparatus comprising one or more processors, a memory storing one or more programs for execution by the one or more processors, a controller, a transport path, a communication interface in electrical communication with at least the transport path, a power source, a plurality of peripheral devices including a transport device and an articulated manipulator robot attached to the transport device, wherein the transport device is configured to move autonomously about the transport path, and the articulated manipulator robot is configured to move a first tray between at least a first instrument and a second instrument of a plurality of instruments; The one or more programs individually or collectively use the one or more processors to perform a method, the method comprising: (A) obtaining a first plurality of organic engineering targets in electronic form, wherein The first plurality of organic engineering targets are defined by a user at the device, and Each of the first plurality of organically engineered targets is a combination of nucleic acid components, a plurality of reagents of nucleic acid components, a different predetermined polymer, a different predetermined peptide, or a different predetermined protein; (B) assigning, by the controller, the first plurality of organic engineering targets to a first uncompiled workflow, wherein The first uncompiled workflow is configured to generate the first plurality of organic engineering targets, The first uncompiled workflow is associated with a first subset of processing modules in a plurality of processing modules, Each respective one of the plurality of processing modules is associated with a different subset of unit operation definitions in the plurality of unit operation definitions, Each respective unit operation definition in the plurality of unit operation definitions is independently associated with a corresponding time interval, and Each respective unit operation definition in the plurality of unit operation definitions is independently associated with a first subset of instruments in the plurality of instruments; (C) translating, by the controller, for each respective organic engineered target in the first plurality of organic engineered targets, the first uncompiled workflow into a corresponding instance of a compiled first workflow for the respective organic engineered target by using a transport path without human input, wherein the corresponding instance of the compiled first workflow comprises: (i) for each respective instrument in said first subset of instruments: (a) the address of the corresponding device, which includes: a coarse-grained address of the respective instrument associated with a tag of the respective instrument, the tag being configured to provide location information for locating a transport device, and (b) one or more execution instructions comprising: A logical dependency of one or more unit operations in a compiled workflow, which defines the sequence of processing samples, a coarse traverse instruction commanding the transport device to traverse to the corresponding mark of the corresponding instrument, and a fine traverse instruction commanding the articulated manipulator robot to traverse to at least one spatial coordinate associated with the corresponding instrument, (ii) a first plurality of unit operations, wherein the first plurality of unit operations are temporally organized into a linear temporal sequence, and wherein each respective unit operation in the first plurality of unit operations is characterized by the time interval defined by the corresponding unit operation, Thereby, multiple instances of the compiled first workflow are formed. 2 . The method of claim 1 , wherein the transport device further comprises a positioning system configured to position and guide the transport device within the transport path.

3. The method according to claim 2, wherein: The positioning system includes a global positioning system, and The respective indicia of the respective instrument are global positioning system coordinates.

4. The method of claim 2, wherein the positioning system includes a representation of a marked location of the transport path.

5. The method of claim 4, wherein the representation of the marked locations of the transport path is an image feed or a video feed.

6. The method of claim 5, wherein a low pass filter or a Gaussian blur function is applied to the representation of the marker locations of the transport path.

7. The method of claim 2, wherein the transport device further comprises an inertial measurement unit configured to verify and correct each execution of the coarse traverse command of the corresponding instrument.

8. The method of claim 2, wherein the articulated manipulation robot further comprises a plurality of sensors, wherein each of the plurality of sensors is configured to provide information related to the spatial position of the articulated manipulation robot and the marker location of each visible marker.

9. The method of claim 8, wherein the transport device further comprises a PID controller in electrical communication with the plurality of sensors to maintain a spatial position of the transport device.

10. The method according to claim 8, wherein: the articulated manipulation robot being configured to transfer the first tray to the first instrument using a safe transfer procedure when readings from the plurality of sensors fail to satisfy a threshold proximity value relative to an actual physical location of a first instrument among the plurality of instruments; and The articulated manipulation robot is configured to transfer the first tray to the first instrument using a default transfer procedure when the readings from the plurality of sensors meet a threshold proximity value relative to an actual physical location of the first instrument.

11. The method of claim 1 , wherein the plurality of instruments comprises a centrifuge, a Peltier temperature controller, an incubator, a shaking incubator, a magnetic separator, a stripper, a liquid handling robot, a dispenser, a sealer, a plate reader, a liquid chromatography system, a gas chromatography system, a mass spectrometry system, a microscope, an electrophoresis apparatus, an electroporation apparatus, a clonal separation apparatus, a clonal selection apparatus, and a thermal cycler.

12. The method of claim 1, wherein each of the first plurality of organic engineering targets comprises a compound that satisfies five criteria of the Lipinski rule.

13. The method of claim 1, wherein the first plurality of unit operations comprises centrifugation, cryo-incubation, heated incubation, magnetic separation, stripping, pipetting, dispensing, sealing, shaking incubation, spectrophotometry, chromatography, mass spectrometry, microscopic imaging, electrophoresis, electroporation, clonal isolation, colony selection, and thermal cycling.

14. A system for implementing a workflow comprising a first device, wherein the first device comprises: monitor; power supply; Communication interface; One or more peripheral devices, including a reagent processing device, the reagent processing device comprising: Clean the manifold, a main valve that regulates an internal flow path in the reagent processing device, a plurality of reagent containers, wherein each reagent container of the plurality of reagent containers comprises a valve that controls flow from the corresponding reagent container to the main valve, a sterilization container configured to contain a sterilization fluid, the sterilization container including a valve that regulates the flow of the sterilization fluid to the main valve or the purge manifold, the purge manifold is coupled to a respective valve of each of the plurality of reagent containers, wherein the purge manifold regulates the flow of the sterilization fluid from the sterilization container to the plurality of reagent containers, and a distribution manifold coupled to the main valve and containing a plurality of distributors, the distribution manifold being configured to control flow from the main valve to the plurality of distributors; one or more processors; Memory; as well as One or more programs, wherein the one or more programs are stored in the memory and configured to be executed by the one or more processors, the one or more programs comprising instructions for: (A) obtaining a first plurality of organic engineering targets in electronic form; (B) assigning the first plurality of organic engineering targets to a first uncompiled workflow, wherein The first uncompiled workflow is configured to generate the first plurality of organic engineering targets, The first uncompiled workflow includes a branch condition, a loop condition or a nested condition, The first uncompiled workflow is associated with a first subset of processing modules in a plurality of processing modules, Each respective one of the plurality of processing modules is associated with a different subset of unit operation definitions in the plurality of unit operation definitions, Each respective unit operation definition in the plurality of unit operation definitions is independently associated with a corresponding time interval, and Each respective unit operation definition in the plurality of unit operation definitions is independently associated with a first subset of instruments in the plurality of instruments; (C) for each respective organic engineered target in the first plurality of organic engineered targets, translating the first uncompiled workflow into a corresponding instance of a compiled first workflow for the respective organic engineered target by using a transport pathway without human input, wherein the corresponding instance of the compiled first workflow comprises: (i) for each respective instrument in said first subset of instruments: (a) the address of the corresponding device, which includes: a coarse-grained address of the corresponding instrument associated with a tag of the corresponding instrument, the tag being configured to provide position information for locating a transport device to which the articulated manipulation robot is connected, and (b) one or more execution instructions, which include: A logical dependency of one or more unit operations in a compiled workflow, which defines the sequence of processing samples, a coarse traverse instruction commanding the transport device to traverse to the corresponding mark of the corresponding instrument, and fine traverse instructions commanding the articulated manipulator robot to traverse to at least one spatial coordinate associated with the corresponding instrument, and (ii) a first plurality of unit operations, wherein the first plurality of unit operations are temporally organized into a linear temporal order by resolving branch conditions, loop conditions, or nested conditions based on values ​​associated with the branch conditions, loop conditions, or nested conditions, and wherein each respective unit operation in the first plurality of unit operations is characterized by the time interval defined by the corresponding unit operation, Thereby, multiple instances of the compiled first workflow are formed.

15. The system of claim 14, wherein a pressure regulator is coupled to each of the sterilization container, the main valve, and each of the plurality of reagent containers.

16. The system of claim 15, wherein each pressure regulator further comprises a filter configured to prevent contamination of the corresponding reagent container.

17. The system of claim 15, wherein each pressure regulator further comprises a check valve.

18. The system of claim 14, wherein the reagent handling device further comprises a pump coupled to the main valve, the pump driving an internal flow path in the reagent handling device.

19. The system of claim 14, wherein the reagent handling device further comprises a dispense cycle configured to dispense a selection from a predetermined set of reagent containers among the plurality of reagent containers.

20. The system of claim 14, wherein the reagent handling device further comprises a first sterilization cycle configured to sterilize a portion of the system.

21. The system of claim 14, wherein the reagent handling device further comprises a second disinfection cycle configured to decontaminate a portion of the system.

22. The system of claim 14, wherein each component of the reagent handling device is connected by a removable conduit.

23. The system of claim 14, wherein human intervention is required only to replenish the corresponding reagent of each of the plurality of reagent containers and to replenish the sterilization fluid of the sterilization container.

24. A method for implementing one or more workflows: At the device, the device comprises one or more processors, a memory storing one or more programs for execution by the one or more processors, a controller, a plurality of instruments including a multi-well plate centrifuge instrument, a communication interface for electrical communication with at least the plurality of instruments, and a power source; The one or more programs individually or collectively use the one or more processors to perform a method, the method comprising: (A) obtaining a first plurality of organic engineering targets in electronic form; (B) assigning, by the controller, the first plurality of organic engineering targets to a first uncompiled workflow, wherein The first uncompiled workflow is configured to generate each of the first plurality of organically engineered targets in a corresponding well in a plate in a first multi-well plate set, The first uncompiled workflow includes a branch condition, a loop condition or a nested condition, The first uncompiled workflow is associated with a first subset of processing modules in a plurality of processing modules, Each respective one of the plurality of processing modules is associated with a different subset of unit operation definitions in the plurality of unit operation definitions, Each respective unit operation definition in the plurality of unit operation definitions is independently associated with a corresponding time interval, and Each respective one of the plurality of unit operation definitions is independently associated with a first subset of instruments in the plurality of instruments, wherein the first subset of instruments includes the multiwell plate centrifuge instrument; and (C) translating, by the controller, for each respective organic engineered target in the first plurality of organic engineered targets, the first uncompiled workflow into a corresponding instance of a compiled first workflow for the respective organic engineered target using a transport pathway without human input, wherein the corresponding instance of the compiled first workflow comprises: (i) for each respective instrument in the first subset of instruments, (a) an address of the respective instrument and (b) one or more execution instructions, wherein the one or more execution instructions for a multiwell plate centrifuge instrument comprise: bi) determining the mass of each multi-well plate in the first multi-well plate set, b.ii) placing each multiwell plate in the first multiwell plate set in the multiwell plate centrifuge instrument, b.ii.1) obtaining a set of balancing blocks corresponding to the first set of porous plates, b.ii.2) placing each corresponding balance block in the multiwell plate centrifuge instrument at a position opposite to the corresponding multiwell plate in the first multiwell plate set, b.iii) without human intervention, adjusting the mass of each corresponding balancing weight in the balancing weight set to be equal to the corresponding multi-well plate in the first multi-well plate set, and b.iv) operating the multiwell plate centrifuge instrument, and (ii) a first plurality of unit operations, wherein the first plurality of unit operations are temporally organized into a linear temporal order by resolving branch conditions, loop conditions, or nested conditions based on values ​​associated with the branch conditions, loop conditions, or nested conditions, and wherein each respective unit operation in the first plurality of unit operations is characterized by the time interval defined by the corresponding unit operation, Thereby, multiple instances of the compiled first workflow are formed.

25. The method of claim 24, wherein the first multiwell plate set is a set of multiwell plates.

26. The method of claim 24, wherein the first set of multiwell plates is a set of from two multiwell plates to five multiwell plates.

27. The method of claim 24, wherein said b.iii) further comprises pumping a fluid to the respective balancing weights to adjust the masses therein.

28. The method of claim 24, wherein b.iii) further comprises extracting fluid from the respective balancing weights to adjust the mass therein.

29. The method of claim 24, wherein each balancing weight in the set of balancing weights includes a bottom portion configured to funnel a fluid therein.

30. The method of claim 24, wherein said bi) and said b.iii) are performed simultaneously.

31. The method of claim 24, wherein b.iii) further comprises storing the adjusted mass of each respective balancing mass in the set of balancing masses.

32. The method of claim 24, wherein the one or more execution instructions for the multiwell plate centrifuge instrument further comprise: bv) determining the mass of each multiwell plate in the second multiwell plate set, b.vi) placing each multiwell plate in the second multiwell plate set in the multiwell plate centrifuge instrument, wherein each corresponding multiwell plate in the second multiwell plate set has a corresponding balance weight in the second balance weight set placed in the multiwell plate centrifuge instrument at a position opposite to the corresponding multiwell plate, b.vii) adjusting the mass of each balancing weight in the second balancing weight set to be equal to the mass of the corresponding multi-well plate in the second multi-well plate set without human intervention, and b.viii) operating the multiwell plate centrifuge instrument.

33. The method of claim 32, wherein the second multiwell plate set is the first multiwell plate set.

Images