A method for regulating plant growth by inhibiting gibberellin signaling through blue light and cry1
By hybridizing mutants of Arabidopsis thaliana blue light receptor CRY1 and GA receptor GID1, the molecular link between blue light and gibberellin signaling was established, thereby regulating plant growth. This solved the problem of unclear communication mechanism between blue light and gibberellin signaling and achieved effective regulation of plant growth.
Patent Information
- Application Number
- CN202110346599.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2021-03-31
- Publication Date
- 2025-11-07
- Estimated Expiration
- 2041-03-31
AI Technical Summary
In the current technology, the communication mechanism between blue light and gibberellin signals in regulating plant growth and development is not yet clear, making it difficult to effectively regulate plant photomorphogenesis and growth status.
The method of regulating plant growth through the Arabidopsis blue light receptor CRY1 involves the following steps: treating Arabidopsis seeds with gibberellin and germinating them in the dark, followed by irradiation under blue light to inhibit the effect of gibberellin, and establishing the molecular link between blue light and gibberellin signaling by hybridizing a CRY1 mutant and a double mutant of the GA receptor GID1.
A molecular link between blue light signaling and gibberellin signaling was successfully established, which regulates photomorphogenesis in plants, inhibits hypocotyl elongation, promotes anthocyanin accumulation, and improves the plant's environmental adaptability and growth health.
Smart Images

Figure CN113068608B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of biotechnology and genetic engineering. Specifically, the present application relates to a method for mediating blue light signal to inhibit gibberellin signal to regulate plant growth by Arabidopsis thaliana blue light receptor CRY1. BACKGROUND
[0002] During the whole life cycle of plants, its growth and development is regulated by both external environmental signals such as light quality and intensity, and internal signals such as plant hormones. Therefore, the coordination of light signal and hormone signal is crucial for balancing the growth state of plants.
[0003] Gibberellins (GA) is a class of tetracyclic diterpenoid plant hormones that play a major role in various key developmental processes in plants, including seed germination, hypocotyl and stem elongation, leaf and epidermal hair growth, pollen maturation and induction of flowering, etc. During the second green revolution, breeders selected dwarf wheat by exploiting mutants in gibberellin synthesis and signaling pathways, which greatly increased the planting density and ultimately improved food production. There is a relatively conserved GA signaling pathway in plants, and important components of the GA signaling pathway have been found by screening GA-insensitive dwarf mutants, mainly including: GA receptor protein GID1 (three homologous proteins GID1a-c in Arabidopsis thaliana), important regulatory factor DELLA protein, and F-box protein SLY for ubiquitination modification of DELLA protein.
[0004] Among the seven colors of the sun's spectrum, blue light (400-500 nm) and red light (600-700 nm) are the most important light wave regions for regulating plant growth and development. During evolution, plants have evolved photoreceptors to perceive blue light and red light: blue light receptor cryptochrome (CRY) and red light receptor phytochrome (PHY). They are involved in the regulation of multiple important physiological processes such as photomorphogenesis, flowering time, stomatal development, and plant biological rhythms.
[0005] The seeds of dicotyledonous plants undergo a dark morphogenesis in soil after germination, i.e. the hypocotyl elongates rapidly and the cotyledons are hooked, which promotes the seedling to break through the soil. After the seedling is exposed to light, the light signal mediated by the light receptor promotes the photomorphogenesis of the plant, i.e. the hypocotyl elongation is inhibited, the cotyledon area is expanded, and a large amount of chlorophyll and anthocyanin is accumulated, which lays the foundation for the plant to carry out photosynthesis and realize the transformation from heterotrophy to autotrophy. Anthocyanin has an important function for the plant itself. First, anthocyanin in flowers and fruits can attract the attention of pollinators and foragers, which is of great significance to the reproductive success of the plant; and in photosynthetic tissues such as leaves and some stems, anthocyanin can act as a "sunscreen" for the plant, protecting the plant from high light intensity and ultraviolet radiation, and also protecting the plant from photosynthetic inhibition. The effect of GA is just the opposite, but little is known about how the two signals communicate. SUMMARY
[0006] The purpose of the present application is to establish the molecular level connection between the blue light signal and the gibberellin signal, and to regulate the application of GA signal in regulating the photomorphogenesis of plants.
[0007] Specifically, the present application provides a method for regulating plant growth by Arabidopsis thaliana blue light receptor CRY1, characterized in that the method comprises the following steps:
[0008] Step (1) treating the target Arabidopsis thaliana seeds with gibberellin and then growing them in dark conditions to promote seed germination and elongation;
[0009] Step (2) irradiating the Arabidopsis thaliana seeds treated with gibberellin with blue light when the seeds are completely germinated and the hypocotyls are significantly elongated, to inhibit the effect of gibberellin and thereby inhibit the elongation of the hypocotyls.
[0010] Preferably, the step (1) comprises soaking or spraying the Arabidopsis thaliana seeds with a 100 mmol / L gibberellin solution for 1-2 days.
[0011] Preferably, the step (2) makes the germinated Arabidopsis thaliana seeds grow under continuous blue light irradiation of 30 μmol / m 2 / s for 5 days.
[0012] Preferably, the method further comprises crossing the GA receptor GID1B and GID1C double mutant gid1b / c (gid1b-3gid1c-1) with the cry1 mutant to obtain a cry1 gid1b / c triple mutant, wherein the sequence of the gid1b-3 is shown as SEQ ID No. 4 in the sequence listing, and the sequence of the gid1c-1 is shown as SEQ ID No. 5 in the sequence listing. The DNA sequence of the cry1 mutant is shown as SEQ ID No. 2 in the sequence listing.
[0013] Preferably, the method further comprises crossing the GA receptor GID1A mutant gid1a-2 with the gid1b / c and the cry1 gid1b / c to obtain a gid1a / c double mutant and a cry1 gid1a / c triple mutant. The sequence of the gid1a-2 is shown as SEQ ID No. 3 in the sequence listing.
[0014] The present application first obtains the triple mutants cry1 gid1a / c and cry1 gid1b / c of the GA receptor of Arabidopsis thaliana and the blue light receptor.
[0015] The present application first detects the hypocotyl phenotype and anthocyanin content of the gid1a / c, the gid1b / c, the cry1 gid1a / c, and the cry1 gid1b / c under blue light.
[0016] The present application obtains the double mutants gid1b / c and gid1a / c and the triple mutants cry1 gid1b / c and cry1 gid1a / c, and finds that the hypocotyl length of the double mutants gid1b / c and gid1a / c under blue light is significantly shorter than that of the wild type (WT), but more anthocyanins are accumulated. The hypocotyl of the triple mutants cry1 gid1b / c and cry1 gid1a / c is significantly shorter than that of the cry1 mutant, but the anthocyanin content is increased. Therefore, GID1 is located downstream of CRY1 to promote the elongation of the hypocotyl and inhibit the synthesis of anthocyanins under blue light, and CRY1 is located upstream of GID1 to inhibit the elongation of the hypocotyl and promote the synthesis of anthocyanins by inhibiting the GA signal. BRIEF DESCRIPTION OF DRAWINGS
[0017] Figure 1 Figure 1: Phenotypes of WT, cry1, gid1a / c, gid1b / c, cry1 gid1a / c and cry1 gid1b / c mutant seedlings grown under continuous blue light (30 μmol / m 2 / s) for 5 days. Scale bar, 5 mm.
[0018] Figure 2 Figure 2: Phenotypes of WT, cry1, gid1a / c, gid1b / c, cry1 gid1a / c and cry1 gid1b / c mutant seedlings grown under continuous blue light (30 μmol / m 2Figure 6 is a histogram of hypocotyl length of WT, cryl, gidl a / c, gidlb / c, crylgidla / c and crylgidlb / c mutant seedlings grown under continuous blue light (30 pmol / m2 / s) for 5 days. Letters "a" to "d" indicate statistical significant difference of the indicated values determined by one-way analysis of variance (ANOVA) followed by Tukey's least significant difference (LSD) test (P < 0.05).
[0019] Figure 3 Figure 7 is a histogram of anthocyanin content of WT, cryl, gidl a / c, gidlb / c, crylgidla / c and crylgidlb / c mutant seedlings grown under continuous blue light (30 pmol / m2 / s) for 5 days. Letters "a" to "c" indicate statistical significant difference of the indicated values determined by one-way analysis of variance (ANOVA).
[0020] Figure 4 Figure 8 is the growth of Arabidopsis thaliana in the application: from left to right are wild type Arabidopsis thaliana treated with GA without irradiation of blue light (BL, 30 pmol / m2 / s), without treatment of GA with irradiation of blue light, and the phenotype of seedlings treated with GA with irradiation of blue light for 5 days. Scale bar, 5 mm. 2 / s), without treatment of GA with irradiation of blue light, and the phenotype of seedlings treated with GA with irradiation of blue light for 5 days. Scale bar, 5 mm. DETAILED DESCRIPTION
[0021] The inventors of the present application obtained a large fragment deletion cryl mutant in Arabidopsis thaliana Col-0 ecotype by physical mutagenesis in the previous research (the mutant used in the comparative experiment in the present embodiment), the gene sequence of which is shown in SEQ ID No. 2 in the sequence listing, and the normal sequence of CRY1 is shown in SEQ ID No. 1 in the sequence listing. The gidlb / c (GA receptor GID1B and GID1C double mutant, gidl b-3 gidl c-1) was obtained in the Arabidopsis thaliana mutant library. The gidl b-3 is a single base mutant of GID1b which terminates expression prematurely after mutation of the coding sequence of the 174th amino acid, and the gene sequence of the mutation is shown in SEQ ID No. 3 in the sequence listing. The gidl c-1 is a T-DNA insertion mutant of GID1c with an intron insertion, and the gene sequence of the mutation is shown in SEQ ID No. 4 in the sequence listing. After obtaining these mutants, they were introduced into Arabidopsis thaliana tissue cells respectively to obtain Arabidopsis thaliana seeds containing the above mutants.
[0022] First, the above seeds were planted on MS medium, and the seedlings germinated for 5 days were transplanted into vermiculite to grow for about 40 days, and then the plants were induced to bloom. The inventors used cryl as the female parent, and after emasculation of the unopened flower buds, pollen of gidlb / c was applied to the stigma of cryl. After maturation, the F1 seeds were collected. After planting the F1 generation, the F2 seeds were harvested, and after the F2 generation was planted in soil, the DNA was extracted after four true leaves emerged. PCR detection was performed using the following primers:
[0023] GID1c-1F ATGGCTGGAAGTGAAGAAGTTAATCT
[0024] GID1c-1R CAGGGCGACGCAGGAG
[0025] LBa1 TGGTTCACGTAGTGGGCCATCG
[0026] PCR amplification was performed using the above primers, wild-type genome was amplified using the primer set GID1c-1F and GID1c-1R, and T-DNA insertion was amplified using the combination of GID1c-1F and LBa1. Only plants in which the combination of GID1c-1F and LBa1 could amplify a band were considered as pure gid1c mutants.
[0027] cry1-F GGGAGAGATGTCTTAGTATGCCTTATG
[0028] cry1-R CCCCTCGAGCCCGGTTTGTGAAAGCCGTCT
[0029] Only plants in which the combination of cry1-F and cry1-R could not amplify a band were considered as pure cryl mutants.
[0030] GID1b-F ATGGCTGGTGGTAACGAAGTCAAC
[0031] GID1b-R TAAGGAGTAAGAAGCACAGGACTTGA
[0032] PCR amplified fragments were identified by sequencing.
[0033] After the pure mutants cryl gidlb / c were identified by the above method, the single plant seeds were collected after maturation.
[0034] In addition, the inventors obtained a gidla-2 mutant from the Arabidopsis mutant library, which is a T-DNA insertion mutant in which GID1a is inserted in the second exon. The sequence of the mutated gene is shown in SEQ ID No. 3 in the sequence listing. The gidla mutant was detected by PCR amplification using the following primers.
[0035] GID1a-1F GAATTATCGGCGTGCACCA
[0036] GID1a-1R TGATTGTTATTAGGCAAGAGGTAAAACC
[0037] SAIL-Lb3 TAGCATCTGAATTTCATAACCAATCTCGATACAC
[0038] The wild type genome was amplified with GID1a-1F and GID1a-1R, and the T-DNA insertion was amplified with the combination of GID1a-1F and SAIL-Lb3. Only the plants with the band amplified by the combination of GID1a-1F and SAIL-Lb3 were the pure mutants of gid1a.
[0039] The gid1a was crossed with gid1b / c and cry1 gid1b / c respectively, and the final double mutants of gid1a / c and triple mutants of cry1 gid1a / c were obtained by the same way as above.
[0040] Seedling planting and hypocotyl length determination
[0041] The seeds of WT, cry1, gid1a / c, gid1b / c, cry1 gid1a / c and cry1 gid1b / c were put in 1.5 mL centrifuge tube, 1 mL 20% bleach was added, the seeds were shaken to make them contact with the bleach, then the tube was placed for 15 min, 1 mL sterile water was added to wash the seeds for three times, then the seeds were suspended in 1 mL pipette and transferred to 1 / 2MS (containing 1% sucrose) solid medium, then 1 / 2MS medium was added, the plate was shaken to make the seeds evenly distributed on the medium, then the plate was placed for 30 min, sealed with sealing film, placed in 4°C for 4 d, then moved to white light for 6 h, then moved to continuous blue light (30 μmol / m2s) for 5 d, photographed and analyzed the hypocotyl length by Image J software. 2 Figure 1 and Figure 2 It is shown that cry1 presents the phenotype of high hypocotyl under blue light, and the gid1a / c and gid1b / c present the phenotype of short hypocotyl under blue light, while the cry1 gid1a / c and cry1 gid1b / c triple mutants can partially recover the phenotype of high hypocotyl of cry1. This indicates that CRY1 is located upstream of GID1 and can regulate the elongation of hypocotyl.
[0042] Anthocyanin content determination
[0043] Take 10-20 seedlings of Arabidopsis under blue light and place them in a 1.5 mL centrifuge tube. Weigh and record the weight on an analytical balance, then add 600 μl of 1% HC1 solution dissolved in methanol, mix well, and place at 4°C overnight. Take 3 samples of each material. Add 400 μl of double distilled water, mix well, and centrifuge. Transfer the supernatant to a 2 mL Eppendorf tube. Add an equal volume of chloroform, mix well, and let stand for a while. Centrifuge to separate the water phase from the chloroform phase to remove the interference of chlorophyll on the determination. After centrifugation, the water phase becomes clear. At this time, anthocyanins are dissolved in the water phase, and chlorophyll is dissolved in the chloroform phase. Take the water phase to a glass cuvette to measure the A530 (absorbance) and A657 (modified value) two light absorption values. Calculate (A530-A657) / FW(g) as the index of anthocyanin content. As shown in the figure, the trend of the hypocotyl is exactly the opposite, the cry1 has less anthocyanin content under blue light, and the gid1a / c and gid1b / c accumulate anthocyanin content under blue light, while the anthocyanin content of the cry1 gid1a / c and cry1 gid1b / c triple mutants is more than that of cry1. Further, it is shown that CRY partially regulates the accumulation of anthocyanins in plant seedlings through GID1.
[0044] By integrating the changes of the two important light morphogenesis indicators, hypocotyl and anthocyanin, in the mutants, it can be found that GID1 is located downstream of CRY1, and CRY1 partially regulates the plant light morphogenesis phenotype under blue light through GID1, while CRY1 is located upstream of GID1, thereby inhibiting the action of GA.
[0045] Application Example
[0046] A certain amount of ordinary Arabidopsis seeds (containing CRY1 conventional sequence, non-mutant) are soaked with 100 mmol / L gibberellin solution, i.e. GA treatment in the dark to accelerate early growth of the plant), and after the Arabidopsis seeds germinate, they are irradiated with blue light for 5 days to inhibit the action of GA, promote the accumulation of anthocyanins in seedlings, and improve the adaptability of the environment. It has been verified by experiments that the Arabidopsis seedlings obtained in this way grow more vigorously. Figure 4 ). Figure 4 Figures 1-3 respectively show the phenotypes of wild-type Arabidopsis seedlings treated with GA without blue light irradiation (BL, 30 μmol / m 2 / s), without GA treatment with blue light irradiation, and with GA treatment with blue light irradiation for 5 days.
[0047] Although the principles of the present application have been described in detail above with respect to preferred embodiments thereof, it is to be understood that the above examples are merely illustrative of the present application and are not to be construed as limiting thereof. The details of the embodiments are not intended to limit the scope of the present application, and any changes in the details of the embodiments which do not depart from the spirit and scope of the present application are intended to be included in the present application. Any equivalent changes in the details of the present application are intended to be included in the present application. SEQUENCE LIST <110> SHANGHAI NORMAL UNIVERSITY <120> A method for regulating plant growth by inhibiting gibberellin signal through blue light and CRY1 <160> 5 <170> SIPOSequenceListing 1.0 <210> 1 <211> 2046 <212> DNA <213> CRY1 <400> 1 atgtctggtt ctgtatctgg ttgtggttct ggtggttgta gtattgtatg gtttagaaga 60 gatcttaggg ttgaagataa tccagcttta gcagcagcag taagagctgg tccagtgatt 120 gctctgtttg tttgggcacc agaagaagaa ggacactatc atccaggtag ggtttctagg 180 tggtggctca agaacagttt ggctcagctt gattcttctc ttagaagtct tggtacttgt 240 cttatcacca agagatctac tgatagtgtt gcttctcttc ttgatgttgt taaatccact 300 ggtgcttctc agatcttctt caaccatttg tatgatccat tgtctttggt gcgtgatcac 360 cgagctaaag atgttttgac ggcgcaaggc atagcggttc gatcattcaa cgcagacttg 420 ttttgggaga gatgtcttag tatgccttat gaccctgagt ctcctcttct tccacctaag 540 ttttgggaga gatgtcttag tatgccttat gaccctgagt ctcctcttct tccacctaag 540 ttttgggaga gatgtcttag tatgccttat gaccctgagt ctcctcttct tccacctaag 540 ttttgggaga gatgtcttag tatgccttat gaccctgagt ctcctcttct tccacctaag 540 ttttgggaga gatgtcttag tatgccttat gaccctgagt ctcctcttct tccacctaag 540 ttttgggaga gatgtcttag tatgccttat gaccctgagt ctcctcttct tccacctaag 540 ttttgggaga gatgtcttag tatgccttat gaccctgagt ctcctcttct tccacctaag 540 ttttgggaga gatgtcttag tatgccttat gaccctgagt ctcctcttct tccacctaag 540 ttttgggaga gatgtcttag tatgccttat gaccctgagt ctcctcttct tccacctaag 540 ttttgggaga gatgtcttag tatgccttat gaccctgagt ctcctcttct tccacctaag 540 ttttgggaga gatgtcttag tatgccttat gaccctgagt ctcctcttct tccacctaag 540 ttttgggaga gatgtcttag tatgccttat gaccctgagt ctcctcttct tccacctaag 540 atgaagtatt tctgggacac acttcttgat gcggatttag aaagcgatgc tcttggttgg 1200 caatacatta ccggtactct cccggatagc cgggagtttg atcgcataga taaccctcag 1260 tttgaagggt acaagtttga tccaaatggt gaatacgtaa ggcgatggct tcctgaactc 1320 tctagactcc cgacagactg gatacatcat ccgtggaacg cacctgagtc cgttcttcaa 1380 gctgctggta tcgagcttgg atcaaactat cctctaccaa ttgtaggatt agacgaagca 1440 aaagcacggc ttcatgaagc gctttcacag atgtggcaac tagaagctgc ttcaagagct 1500 gcaataga acggatccga agaaggactt ggagattctg ctgaggtaga ggaagctcct 1560 atagagttcc caagggagat tacaatggaa gagactgaac caaccagact caacccaaac 1620 aggagatatg aggatcagat ggttccaagc attacttctt ctttgatcag acctgaagaa 1680 gacgaagagt cgtctcttaa tttgagaaat tcagtaggag atagcagagc agaggttcca 1740 aggaacatgg ttaacaccaa ccaagctcag cagcggagag cagaaccggc ttcaaaccaa 1800 gtcactgcta tgattccaga atttaatatc agaattgttg cagagagcac tgaagactca 1860 GAGAAGAAGA AGAAGAAGAA GAAGAAGAAG AAGAAGAAGA AGAAG 48 TCTCCAGGGT ACTCAGAGCA GTTCCCTAGT GAAGAAAATG GTATTGGAGG AGGAAGTACA 1980 ACGTCTAGCT ACTTGCAGAA TCACC ATGAA ATACTGAAC TGGAGACGGC TTTCACAAAC C 2040 GGGTA A 2046 <210> 2 <211> 851 <212> DNA <213> CRY1 mutant <400> 2 ATGTCTGGTT CTGTATCTGG TTGTGGTTCT GGTGGTTGTA GTATTGTATG GTT TAGAAGA 60 GATCTTAGGG TTGAAGATAA TCCAGCTTTA GCAGCAGCAG TAAGAGCTGG TCCAGTGATT 120 GCTCTGTTTG TTTGGGCACC AGAAGAAGAA GGACACTATC ATCCAGGTAG GGTTC TAGG 180 TGGTGGCTCA AGAACAGTTT GGCTCAGCTT GATTCTTCTC TTAGAAGTCT TGGTACTTGT 240 CTTATCACCA AGAGATCTAC TGATAGTTGT TCTCTCTTCT TGATGTGTGT TAAATCCACT 300 GGTGCTTCTC AGATCTTCTT CAACCATTTG TATGATCCAT GTCTTTGGTG CGTGATCAC 360 CGAGCTAAAG ATGTTTTGAC GGC GCAAGGC ATAGCGGTTC GATCATTCAA CGCAGACTTG 420 ctttatgagc catgggaagt gactgatgaa ttaggccgtc ctttctctat gtttgctgcg 480 ttttgggaga gatgtcttag tatgccttat gaccctgagt ctcctcttct tccacctaag 540 aagatcattt caggggatgt gtctaaatgt gttgcggatc cattggtgtt tgaggatgac 600 tctgagaaag gaagcaatgc acttctggct cgtgcttggt ctcctggatg gagtaatggt 660 gataaagctc tcacaacgtt tataaacggt ccattgcttg aatactctaa gaaccgcaga 720 aaagccgata gtgctacaac ctcgtttctt tctccacact tgcattttgg ggaagtgagt 780 gtgagaaaag tttttcatct tgttcggatc aaacaggtcg cgtgggcaaa cgaaggaaac 840 gaggccgggg a 851 <210> 3 <211> 927 <212> DNA <213> GID1a mutant <400> 3 [[ID=##]]atggctgcga gcgatgaagt taatcttatt gagagcagaa cagtggttcc tctcaataca 60 tgggttttaa tatccaactt caaagtagcc tacaatatcc ttcgtcgccc tgatggaacc 120 tttaaccgac acttagctga gtatctagac cgtaaagtca ctgcaaacgc caatccggtt 180 GATGGGTTTT TCTCGTTTCA GTATCTTTGA TTGATCGTGG ATCAATCTTC TAAACAGAGT C 240 TATAGACCAA GTTATGCAGA TCAAGAGCAA CCTCCTAGTA TTTTAGATCT CGAGAAGCCT 300 GTTGATGGCG ACATTGTCCC TGTATATTTG TTCTTCCATG GAGGTAGCTT TGCTCATTCT 360 TCTGCAAACA GTGCCATCTA CGATACTCTT TGTGCGAGGT TTGTTGGTTT GTGCAAGTGT 420 GTTGTTGTC TCTGTGAATT ATCGGCGTGC ACCAGAGAAT CCATACCCTT GTGCTTATGA T 480 GATGGTTGGA TTGCTCTTAATTGGGTAACTCGAGATCTT GGCTTAAATCCAAGAAAGAC 540 TCAAAGGTCC ATATTTCCTT GGCTGGTGAT AGCTCTGGAG GTAACATCGCG CATAATGTG 600 GCTTTCGAGC GGTTGAATCG GGAATCGATGTTTTGGGGA ACATTCTGCT GAATCCTATG 660 TTTGGTGGGA ATGAGAGAAC GGAGTCTGAG AAAAGTTTGG ATGGGAAATA CTTTGTGACG 720 GTTCGAGACC GCGATTGGTA CTGGAAAGCG TTTTTACCCG AGGGAGAGAT AGAGAGCAT 780 CCAGCGTGTA ATCCGTTTAG CCCGAGAGGG AAAAGCTTAG AAGGAGTGAG TTTCCCAAG 840 AGTCTTGTGG TTGTCGCGGT TTGGATTTGA TTAGAGATTC GGCAGTTGGC ATACGCAGAA 900 gggctcaaga aagcgggtca agaggtt 927 <210> 4 <211> 522 <212> DNA <213> GID1b mutant <400> 4 atggctggtg gtaacgaagt caaccttaac gaatgcaaga gaattgtccc actcaacaca 60 tgggtcctca tttccaattt caagcttgct tacaaagtcc tccgtcgccc tgacggttct 120 ttcaaccgcg acctcgccga gttccttgac cgtaaagttc ccgccaactc tttccccctc 180 gacggcgttt tctccttcga ccacgtcgac tcaacaacta accttctcac cagaatctac 240 caacctgcgt ctctccttca tcagacccgt cacggaaccc tcgagctaac caaacctctc 300 agtactacag agatcgtccc tgttctcatt ttcttccatg gaggcagctt cactcattcc 360 tccgccaata gtgctatcta cgacactttc tgccgacgcc ttgtcaccat ttgcggtgtt 420 gttgttgtct ctgttgatta ccggagatcc cctgagcatc gctacccttg tgcttacgac 480 gatggatgga acgctctcaa ctgggtcaag tccagagtct ga 522 <210> 5 <211> 39 <212> DNA <213> GID1c mutant <400> 5 atggctggaa gtgaagaagt taatcttatt gagagcaag 39
Claims
1. A method of modulating plant growth by inhibiting gibberellin signaling through blue light and CRY1, characterized in that, The method is used for promoting anthocyanin accumulation in plants, and the method comprises the following steps: Step (1) treating target Arabidopsis seeds with gibberellin and then growing them in dark conditions to promote seed germination and elongation; Step (2) when the seeds treated with gibberellin are completely germinated and the hypocotyls are obviously elongated, irradiating them with blue light to inhibit the effect of gibberellin and thus inhibit the elongation of the hypocotyls, The seed is gid1b / c With cry1 Mutant hybridization resulted in cry1 gid1b / c Three mutants, the gid1b / c GA receptor GID1B and GID1C double mutant, gid1b-3 gid1c-1 Wherein, gid1b-3 The sequence of the GID1B gene is shown in SEQ ID No. 4 in the sequence listing, gid1c-1 The sequence of the GID1C gene is shown in SEQ ID No. 5 in the sequence listing; cry1 The DNA sequence of the mutant is shown in SEQ ID No. 2 in the sequence listing; or the seed is a GA receptor GID1A mutant gid1a-2 with gid1b / c hybridization gid1a / c double mutants, or, alternatively, gid1a-2 mutants and cry1 gid1b / c triple mutants hybridized to obtain cry1 gid1a / c triple mutants, gid1a- 2 the sequence of which is shown in SEQ ID No. 3 of the sequence listing.
2. The method of claim 1, wherein, The step (1) comprises soaking or spraying the Arabidopsis seeds with a 100 mmol / L gibberellin solution for 1-2 days.
3. The method of claim 1, wherein, The step (2) makes the germinated Arabidopsis seeds grow under the continuous blue light irradiation of 30 μmol / m 2 s for 5 days.
4. The method of claim 1, wherein, The method further comprises adjusting the time and concentration of gibberellin treatment or adjusting the irradiation time of blue light to control the growth of plants.