A method for creating herbicide-resistant plants using single-base editing technology

Abstract

The present invention relates to the technical field of herbicides, and discloses a method for creating herbicide-resistant plants by using single-base editing technology, comprising the following steps: 1) designing sgRNA of GhEPSP gene: selecting upland cotton 5-enolpyruvylshikimate-3-phosphate synthase (EPSP synthase) as a verification gene, designing sgRNA target sequence in gene exon region by using online software CRISPR-P (http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR) (Lei et al 2014), and changing the target point of amino acid function by C-T mutation within the editing window, and finally selecting one sgRNA to construct a single-base system plant expression vector. This method of using single-base editing technology to create herbicide-resistant plants successfully applied the single-base editing system of cotton genome characteristics for the first time in cotton to achieve single-base mutation of cotton GhEPSP. The mutation site has not been reported in other crops. Through the glyphosate smear experiment on leaves, it showed a certain degree of glyphosate tolerance, which improved the weed control efficiency in cotton fields, reduced the cost of manual weed control, and prevented super weeds in cotton fields.

Description

Technical Field

[0001] The present invention relates to the field of herbicide technology, and specifically to a method for creating herbicide-resistant plants using single-base editing technology. Background Art

[0002] Herbicide resistance is an important direction of crop breeding. The planting area of ​​herbicide-resistant crops accounts for 47% of the global total planting area. On the one hand, herbicide-resistant breeding obtains resistant gene mutant plants after physical or chemical treatment of crops (including somatic cell mutagenesis, irradiation and chemical mutagens, etc.). On the other hand, the introduction of exogenous genes through genetic engineering to obtain herbicide-resistant crops is also one of the most important means at present. Recently, with the development of gene editing technology, the CRISPR-Cas9 system is used to direct the modification of herbicide-resistant target genes in other crops to obtain herbicide-resistant materials, providing a new approach for molecular breeding of crops.

[0003] Since glyphosate was registered in the United States in 1974, it has become the world's largest-selling and most widely used pesticide. Glyphosate reacts with 5-enolpyruvylshikimate-3-phosphate synthase (5-Enolpyruvylshikimate-3-phosphate The mechanism of action of glyphosate is as follows: glyphosate and phosphoenolpyruvate (PEP) are very similar in structure. In the shikimate pathway, glyphosate occupies the connection site of EPSP synthase and PEP to form an EPSP synthase-S3P-glyphosate complex, which stops the process of EPSP synthase catalyzing the conversion of the enolpyruvate group from PEP to S3P to form EPSP, competitively inhibits the activity of EPSP synthase, thereby blocking the biosynthesis of compounds such as coenzyme Q, folic acid and aromatic amino acids in plants, affecting plant cell division, chlorophyll synthesis, transpiration, respiration and protein metabolism, and ultimately leading to metabolic disorders of some key metabolites and hormones such as phenolic compounds and lignin, making the organism unable to carry out normal nitrogen metabolism and die. In addition, the process of EPSP synthase entering chloroplasts is also inhibited by glyphosate.

[0004] The glyphosate-resistant EPSP synthase gene originated from the glyphosate-resistant mutant gene aroA, which was isolated and cloned from Salmonella typhimurium by Comai et al. in 1983. Since then, many researchers have conducted in-depth and extensive research on glyphosate-resistant genes. With the rapid development of molecular biology technology and in-depth research on EPSP synthase, in 1996, Monsanto Company of the United States developed the first glyphosate-resistant crop - glyphosate-resistant soybean (Roundup) using the coding gene of glyphosate-resistant EPSP synthase of CP4 Agrobacterium. There are two main ways to obtain glyphosate-resistant EPSP synthase encoding genes: the first is to clone and isolate glyphosate-resistant genes or mutant genes from naturally glyphosate-resistant species or mutants. Among the natural glyphosate-resistant genes, the soil Agrobacterium tumefaciens CP4-EPSP synthase gene is the most widely used glyphosate-resistant EPSP synthase gene and has formed commercial production. In addition, researchers have cloned and isolated glyphosate-resistant mutant genes from mutants of some species, such as researchers cloning glyphosate-resistant EP from soybean, rapeseed, potato and Arabidopsis. SP synthase mutation gene discovery, soybean EPSP synthase gene encoding 104Gly mutation to Ala, rape EPSP synthase gene encoding Gly96 mutation to Ala, potato and Arabidopsis EPSP synthase 101 Gly to Ala, Shah et al. cloned EPSP synthase cDNA from the screened glyphosate-resistant petunia mutant MP4-G cell line, after the cDNA was introduced into the wild-type petunia leaves, the resistance to glyphosate was significantly improved, Scott et al. found that the EPSP synthase gene of cattlegrass Mutation: After the 101st proline mutates to tryptophan, it has a very low sensitivity to glyphosate and exhibits resistance to glyphosate. The second is to use genetic methods to modify the EPSP synthase encoding gene to improve glyphosate resistance. Site-directed mutagenesis can reduce the affinity of the enzyme to glyphosate or increase the affinity of the enzyme to the substrate, thereby improving glyphosate resistance. Tian et al. used site-directed mutagenesis to change Thr101 encoded by the apple EPSP synthase gene to Ala and Ala187 to Thr. Kinetic analysis confirmed that the mutation of the two amino acids increased resistance to glyphosate. In order to develop resistance to glyphosate, Ming et al. used error-prone PCR random mutagenesis technology to mutate and recombinate the aroA gene from Escherichia coli and Salmonella, and obtained four mutants, aroM1, aroM2, aroM3 and aroM4. The kinetic analysis of EPSP synthase activity showed that the activity of EPSP synthase encoded by the four mutant genes of the four mutants was 2-10 times higher than before mutation, the affinity with enolpyruvate was increased by 2.5-19 times, and the inhibition constant Ki value with glyphosate was increased by 0.4-8 times.

[0005] In 2016, Komor et al. from Harvard University in the United States used APOBEC1 and dCas9 to create the first-generation base editor BE1 (POBEAC1-XTEN-dCas9), and found that the BE1 base editor has an active editing window of 5 bases (nucleotides 4-8 far from the PAM on the target sequence).

[0006] Single-base editing technology can also perform site-specific editing on crop genomes, thereby improving the accuracy of crop gene editing. Currently, the CRISPR-Cas9 system has successfully achieved gene editing in plants such as Arabidopsis, rice, wheat, corn and cotton, providing a platform for plant genetic research and crop genetic improvement. Zong et al. created two base editing systems based on the CRISPR-Cas9 system: nCas9-PBE and dCas9-PBE, which are composed of rat cytidine deaminase APOBEC1, Cas9 variants (nCas9 or dCas9) and uracil glycosylase inhibitor (UGI). This fusion vector is codon-optimized according to the codon preference of cereal plants and overcomes Long produced pnCas9-PBE and pdCas9-PBE under the promoter of the maize ubiquitin (Ubi) gene. At the same C site mutation, the editing efficiency of pnCas9-PBE was significantly higher than that of pdCas9-PBE. They used wild-type Cas9 (pCas9) to produce deletion or insertion mutations (indel) as a control and found that the deletions or insertions produced by pnCas9-PBE and pdCas9-PBE were the same and relatively low, but much less than pCas9. They evaluated gene editing in the protoplasts of each plant by deep sequencing and found that pnCas9-PBE had the highest efficiency in causing CT replacement at the 7th target site and adjacent positions, and the activity of cytosine deaminase was The editing window is 7 nucleotides, which is wider than the editing window in animals (5). At the same time, Li and Lu et al. also independently studied the application of single-base editing systems in rice, and showed that the base editing system can effectively edit single bases. Ren Bin et al. successfully developed rice single-base editing systems rBE3 and rBE4, and on this basis introduced human AID cytosine deaminase to develop upgraded versions of the single-base editing system rBE5 and rBE9, which successfully achieved efficient site-specific editing of multiple target genes in rice. This system avoids the problem of APOBEC1's preference for CT, and also has high editing efficiency for AC, GC, and CC, which greatly promotes rice functional genomics and modern molecular breeding of plants. Research progress, these studies have shown that this technology can efficiently edit single bases in crops, and the editing range is larger, thereby improving crop quality and obtaining crops with excellent traits. Zhu Jiankang's team at the Shanghai Center for Plant Stress Biology Research has developed new adenine and cytosine base editors by using variants of SpCas9 and SaCas9, which has greatly expanded the targetable sites in the genome. In addition, the study also simultaneously edited cytosine and adenine base editors in rice, and obtained CT and GA editing types at the same time, in order to achieve single base mutations in cotton itself (non-transgenic exogenous genes) to create glyphosate-resistant cotton materials, improve weed control efficiency in cotton fields, reduce the cost of manual weed control, and prevent super weeds in cotton fields.Therefore, a method for creating herbicide-resistant plants using single-base editing technology is proposed. Summary of the invention

[0007] 1. Technical issues to be solved

[0008] In view of the shortcomings of the prior art, the present invention provides a method for creating herbicide-resistant plants using single-base editing technology, which has the advantage that the mutant cotton material has good glyphosate tolerance, and solves the problem that the cotton material created by the cotton's own single-base mutation (non-transgenic exogenous gene) does not have glyphosate resistance.

[0009] (II) Technical solution

[0010] In order to achieve the purpose of making the above-mentioned mutant cotton material have better glyphosate tolerance, the present invention provides the following technical solution: a method for creating herbicide-resistant plants using single-base editing technology, comprising the following steps:

[0011] 1) sgRNA design for GhEPSP gene: 5-Enolpyruvylshikimate-3-phosphate synthase (EPSP synthase) of upland cotton was selected as the verification gene, and the sgRNA target sequence was designed in the exon region of the gene using the online software CRISPR-P (http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR) (Lei et al 2014), and the target site where the CT mutation changed the amino acid function within the editing window was finally selected to construct a single base system plant expression vector;

[0012] 2) Connection between sgRNA and GhBE3 vector: The target insertion GhBE3 vector sequence is a repeating sequence of tRNA-sgRNA-gRNA, which requires intermediate vector conversion. The primers for the first PCR are as follows:

[0013] pRGEB32-7 / S: AAGCATCAGATGGGCAAACAAAGCACCAGTGGTCTAG, add sgRNA to the linker of the reverse primer, GhEPSP / AS: TTCCACCGGGAAGACCACCCTGCACCAGCCGGGAAT, the underlined bases are sgRNA sequences, tRNA sequences were amplified by PCR using the PGTR vector (Xie et al. 2015) as a template to obtain tRNA+sgRNA. The tRNA+sgRNA fragments were connected to the BsaI restriction site of the pGREB32-GhU6-7 vector using a one-step cloning kit (Vazyme, C112-01 / 02), pGREB32-GhU6-7 was double-digested with HpaI and SbfI, and the target fragment was connected to the HpaI and SbfI double-digested sites of the GhBE3 vector;

[0014] 3) Agrobacterium-mediated genetic transformation:

[0015] A. Sterilize the peeled cotton seeds (variety Jin668, patent application number 201510833618.0) with 0.1% mercuric chloride, wash them with sterile water several times, put them into sterile seedling culture medium, culture them in the dark at 28°C for 1 day, remove the seed coat, straighten the seedlings, and culture them in the dark at 28°C for 4 days;

[0016] B. Cut the hypocotyl into small stem segments, infect with activated Agrobacterium, discard the bacterial solution, and blow dry;

[0017] C. Spread the hypocotyls flat on the co-cultivation medium with filter paper and culture them in the dark at 20°C for 1 day;

[0018] D. Transfer the hypocotyls to a callus induction medium supplemented with 2,4-D, place them in a light culture room, and subculture them once with fresh callus induction medium for about 25 days;

[0019] E. When the callus grows into rice-like particles, it is transferred to differentiation medium and further differentiated into embryoids;

[0020] F. Subculture the differentiated seedlings into rooting medium until they grow into healthy seedlings with good roots;

[0021] G. Transfer the seedlings to clean water for hardening. After one week, transfer them to the greenhouse.

[0022] 4) Sequencing and detection editing: The positive genomic DNA of the extracted cotton young leaves was used as a template to amplify the GhEPSP gene, and then the PCR fragment was connected to the pGEM-T easy vector. The ligation product was heat-shocked and transformed into the competent E. coli TOP10. The selected single clones were tested for positive detection and Sanger sequencing, and the sequencing results were compared with the target sequence;

[0023] 5) Apply glyphosate to leaves: Dilute Roundup (Monsanto) 200 times and apply it to cotton leaves. Observe the damage of the leaves after one week.

[0024] Preferably, the culture medium components and ratios used for the transformation are as follows:

[0025] Sterile seedling culture medium: 1 / 2MS macroelements, 15g / L glucose, 2.5g / L Phytagel; pH: 6.1-6.2;

[0026] Callus induction medium: MSB+2,4-D 0.1mg / L+KT 0.1mg / L+3% Glucose+0.3% Phytagel; pH: 5.85-5.95;

[0027] Agrobacterium activation medium: tryptone 5g / L+NaCl 5g / L+MgSO4.7H2O0.1g / L+KH2PO4+0.25g / L+mannitol 5g / L+glycine 1.0g / L; pH: 5.85-5.95;

[0028] Co-culture medium: MSB + 2,4-D 0.1 mg / l + KT 0.1 mg / l + 50 mg / l AS + 3% Glucose + 0.25% Phytagel, pH 5.8;

[0029] Selection medium: MSB + 2,4-D 0.1 mg / L + KT 0.1 mg / L + 3% Glucose + 0.3% Phytagel, kanamycin 50 mg / L and cephalosporin 400 mg / L; pH: 5.85-5.95;

[0030] Differentiation medium: Remove NH4NO3 from MSB medium, double the amount of KNO3 + Gln1.0g / L + Asn 0.5g / L + IBA0.5mg / L + KT 0.15mg / L + 3% Glucose + 0.25% Phytagel, pH: 6.1-6.2;

[0031] Rooting medium: 1 / 2MS inorganic salt + B5 organic matter, 15g / L glucose, 2.5g / L Phytagel; pH: 5.90-5.95; the composition of MSB is as follows: MS medium + B5 vitamins.

[0032] (III) Beneficial effects

[0033] Compared with the prior art, the present invention provides a method for creating herbicide-resistant plants using single-base editing technology, which has the following beneficial effects:

[0034] This method of using single-base editing technology to create herbicide-resistant plants successfully applied the single-base editing system of cotton genome characteristics for the first time in cotton to achieve single-base mutation of cotton GhEPSP. The mutation site has not been reported in other crops. Through the glyphosate smear experiment on leaves, it showed a certain degree of glyphosate tolerance, which improved the weed control efficiency in cotton fields, reduced the cost of manual weed control, and prevented super weeds in cotton fields. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 This is a construction diagram of the expression vector GhBE3 for the method of creating herbicide-resistant plants using single-base editing technology proposed in the present invention;

[0036] Figure 2 The electrophoresis diagram of GhBE3, a method for creating herbicide-resistant plants using single-base editing technology proposed in the present invention;

[0037] Figure 3 A genetic transformation diagram of the GhEPSP mutation in the method for creating herbicide-resistant plants using single-base editing technology proposed in the present invention;

[0038] Figure 4 A schematic diagram of mutation sites in the method for creating herbicide-resistant plants using single-base editing technology proposed in the present invention;

[0039] Figure 5 Schematic diagram of glyphosate tolerance testing in the method proposed in the present invention for creating herbicide-resistant plants using single-base editing technology. DETAILED DESCRIPTION

[0040] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0041] Please refer to Figure 1-5 , Figure 2 Lanes 1 and 2 are for GhBE3 detection, lane CK is a negative control, and lane M is a 5K marker. Figure 3 The Roman numbers in the figure are: I. co-cultivation stage, II. selection culture stage, III. callus stage, IV. differentiation culture stage, V. rooting culture stage, VI. nutrient solution culture and VII-IX. transgenic plants growing in greenhouse.

[0042] The method of creating herbicide-resistant plants using single base editing technology comprises the following steps:

[0043] 1) sgRNA design for GhEPSP gene: 5-Enolpyruvylshikimate-3-phosphae synthase (EPSP synthase) of upland cotton was selected as the verification gene, and the sgRNA target sequence was designed in the gene exon region using the online software CRISPR-P (http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR) (Lei et al 2014), and the target site where the CT mutation changed the amino acid function within the editing window was finally selected to construct a single base system plant expression vector;

[0044] The sequence of sgRNA is as follows:

[0045] Table 1

[0046] sgRNA sequence sgRNA1 GGGTGGTCTTCCCGGTGGAA

[0047] 2) Connection between sgRNA and GhBE3 vector: The target insertion GhBE3 vector sequence is a repeating sequence of tRNA-sgRNA-gRNA, which requires intermediate vector conversion. The primers for the first PCR are as follows:

[0048] pRGEB32-7 / S: AAGCATCAGATGGGCAAACAAAGCACCAGTGGTCTAG, add sgRNA to the linker of the reverse primer, GhEPSP / AS: TTCCACCGGGAAGACCACCC TGCACCAGCCGGGAAT, the underlined bases are sgRNA sequences, tRNA sequences were amplified by PCR using the PGTR vector (Xie et al. 2015) as a template to obtain tRNA+sgRNA. The tRNA+sgRNA fragments were connected to the BsaI restriction site of the pGREB32-GhU6-7 vector using a one-step cloning kit (Vazyme, C112-01 / 02), pGREB32-GhU6-7 was double-digested with HpaI and SbfI, and the target fragment was connected to the HpaI and SbfI double-digested sites of the GhBE3 vector;

[0049] The PCR system is as follows:

[0050] Table 2

[0051] Components volume 10× Taq Buffer 2 dNTP 0.3 Inf pRGEB32-7S 0.2 Inf CLA 2As 0.2 Taq 0.2 PCR1 0.5 PCR2 0.5 ddH20 16.1

[0052] PCR conditions were as follows:

[0053] Table 3

[0054] temperature time Pre-denaturation 95℃ 4min transsexual 95℃ 30s annealing 55℃ 30s extend 72℃ 20s cycle 3℃ transsexual 95℃ 30s annealing 60℃ 30s extend 72℃ 20s cycle 27℃ Final extension 72℃ 5min save 4℃ ∞

[0055] 3) Agrobacterium-mediated genetic transformation:

[0056] A. Sterilize the peeled cotton seeds (variety Jin668, patent application number 201510833618.0) with 0.1% mercuric chloride, wash them with sterile water several times, put them into sterile seedling culture medium, culture them in the dark at 28°C for 1 day, remove the seed coat, straighten the seedlings, and culture them in the dark at 28°C for 4 days;

[0057] B. Cut the hypocotyl into small stem segments, infect with activated Agrobacterium, discard the bacterial solution, and blow dry;

[0058] C. Spread the hypocotyls flat on the co-cultivation medium with filter paper and culture them in the dark at 20°C for 1 day;

[0059] D. Transfer the hypocotyls to a callus induction medium supplemented with 2,4-D, place them in a light culture room, and subculture them once with fresh callus induction medium for about 25 days;

[0060] E. When the callus grows into rice-like particles, it is transferred to differentiation medium and further differentiated into embryoids;

[0061] F. Subculture the differentiated seedlings into rooting medium until they grow into healthy seedlings with good roots;

[0062] G. Transfer the seedlings to clean water for hardening. After one week, transfer them to the greenhouse.

[0063] The components and ratios of the culture medium used for transformation are as follows:

[0064] Sterile seedling culture medium: 1 / 2MS macroelements, 15g / L glucose, 2.5g / L Phytagel; pH: 6.1-6.2;

[0065] Callus induction medium: MSB+2,4-D 0.1mg / L+KT 0.1mg / L+3% Glucose+0.3% Phytagel; pH: 5.85-5.95;

[0066] Agrobacterium activation medium: tryptone 5g / L+NaCl 5g / L+MgSO4.7H2O0.1g / L+KH2PO4+0.25g / L+mannitol 5g / L+glycine 1.0g / L; pH: 5.85-5.95;

[0067] Co-culture medium: MSB + 2,4-D 0.1 mg / l + KT 0.1 mg / l + 50 mg / l AS + 3% Glucose + 0.25% Phytagel, pH 5.8;

[0068] Selection medium: MSB + 2,4-D 0.1 mg / L + KT 0.1 mg / L + 3% Glucose + 0.3% Phytagel, kanamycin 50 mg / L and cephalosporin 400 mg / L; pH: 5.85-5.95;

[0069] Differentiation medium: Remove NH4NO3 from MSB medium, double the amount of KNO3 + Gln1.0g / L + Asn 0.5g / L + IBA0.5mg / L + KT 0.15mg / L + 3% Glucose + 0.25% Phytagel, pH: 6.1-6.2;

[0070] Rooting medium: 1 / 2MS inorganic salt + B5 organic matter, 15g / L glucose, 2.5g / L Phytagel; pH: 5.90-5.95; the composition of MSB is as follows: MS medium + B5 vitamins.

[0071] 4) Sequencing and detection editing: The positive genomic DNA of the extracted cotton young leaves was used as a template to amplify the GhEPSP gene, and then the PCR fragment was connected to the pGEM-T easy vector. The ligation product was heat-shocked and transformed into the competent E. coli TOP10. The selected single clones were tested for positive detection and Sanger sequencing, and the sequencing results were compared with the target sequence;

[0072] 5) Apply glyphosate to leaves: Dilute Roundup (Monsanto) 200 times and apply it to cotton leaves. Observe the damage of the leaves after one week.

[0073] The beneficial effects of the present invention are as follows: the method for creating herbicide-resistant plants using single-base editing technology successfully applies the single-base editing system of cotton genome characteristics to achieve single-base mutation of cotton GhEPSP for the first time in cotton, and the mutation site has not been reported in other crops. Through the glyphosate smear experiment on leaves, a certain glyphosate tolerance is shown, the weeding efficiency in cotton fields is improved, the cost of manual weeding is reduced, super weeds in cotton fields are prevented, and the problem that cotton materials created by single-base mutations of cotton itself (non-transgenic exogenous genes) do not have glyphosate resistance is solved.

[0074] Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles and spirit of the present invention, and that the scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A method for creating herbicide-resistant cotton using single base editing technology, characterized in that: The following steps are involved: 1) sgRNA design for the GhEPSP gene: Upland cotton 5-enolpyruvylshikimate-3-phosphate synthase was selected as the verification gene, and the sgRNA target sequence was designed in the gene exon region using the online software CRISPR-P. The CT mutation within the editing window changed the target site of the amino acid function, and finally one sgRNA was selected to construct a single-base system plant expression vector; 2) Connection between sgRNA and GhBE3 vector: The target insertion sequence of GhBE3 vector is a repeating sequence of tRNA-sgRNA-gRNA, which requires intermediate vector conversion. The primers for the first PCR are as follows: pRGEB32-7 / S: AAGCATCAGATGGGCAAACAAAGCACCAGTGGTCTAG, add sgRNA to the linker of the reverse primer, GhEPSP / AS: TTCCACCGGGAAGACCACCC TGCACCAGCCGGGAAT, the underlined bases are sgRNA sequences, tRNA sequences were amplified by PCR using the PGTR vector as a template to obtain tRNA+sgRNA, and the tRNA+sgRNA fragments were connected to the BsaI restriction site of the pGREB32-GhU6-7 vector using a one-step cloning kit, pGREB32-GhU6-7 was double-digested with HpaI and SbfI, and the target fragment was connected to the HpaI and SbfI double-digested sites of the GhBE3 vector; 3) Agrobacterium-mediated genetic transformation: A. Sterilize the peeled cotton seeds with 0.1% mercuric chloride, wash them several times with sterile water, put them into sterile seedling culture medium, culture them in the dark at 28℃ for 1 day, remove the seed coat, straighten the seedlings, and culture them in the dark at 28℃ for 4 days; B. Cut the hypocotyl into small stem segments, infect with activated Agrobacterium, discard the bacterial solution, and blow dry; C. Spread the hypocotyls flat on the co-cultivation medium with filter paper and culture them in the dark at 20°C for 1 day; D. Transfer the hypocotyls to callus induction medium supplemented with 2,4-D, place in a light culture room, and subculture once every 25 days with fresh callus induction medium; E. When the callus grows into rice-like particles, it is transferred to differentiation medium and further differentiated into embryoids; F. Subculture the differentiated seedlings into rooting medium until they grow into healthy rooted seedlings; G. Transfer the seedlings to clean water for hardening. After one week, transfer them to the greenhouse. 4) Sequencing and detection editing: The positive genomic DNA of the extracted cotton young leaves was used as a template to amplify the GhEPSP gene, and then the PCR fragment was connected to the pGEM-T easy vector. The ligation product was heat-shocked and transformed into the competent E. coli TOP10. The selected single clones were tested for positive detection and Sanger sequencing, and the sequencing results were compared with the target sequence; 5) Apply glyphosate to leaves: Dilute Roundup 200 times and apply it to cotton leaves. Observe the damage of the leaves after one week.

2. The method for creating herbicide-resistant cotton using single base editing technology according to claim 1, characterized in that: The components and proportions of the culture medium used for the transformation are as follows: Sterile seedling culture medium: 1 / 2MS macroelements, 15g / L glucose, 2.5g / L Phytagel; pH: 6.1-6.2; Callus induction medium: MSB + 2,4-D 0.1 mg / L + KT 0.1 mg / L + 3% Glucose + 0.3% Phytagel; pH: 5.85-5.95; Agrobacterium activation medium: tryptone 5g / L+NaCl 5g / L+MgSO4.7H2O 0.1g / L+KH2PO4+0.25g / L+mannitol 5g / L+glycine 1.0g / L; pH: 5.85-5.95; Co-culture medium: MSB + 2,4-D 0.1 mg / l + KT 0.1 mg / l + 50 mg / l AS + 3% Glucose + 0.25% Phytagel, pH 5.8; Selection medium: MSB + 2,4-D 0.1 mg / L + KT 0.1 mg / L + 3% Glucose + 0.3% Phytagel, kanamycin 50 mg / L and cephalosporin 400 mg / L; pH: 5.85-5.95; Differentiation medium: Remove NH4NO3 from MSB medium, double the amount of KNO3 + Gln 1.0g / L + Asn 0.5g / L + IBA0.5mg / L + KT 0.15mg / L + 3% Glucose + 0.25% Phytagel, pH: 6.1-6.2; Rooting medium: 1 / 2MS inorganic salt + B5 organic matter, 15g / L glucose, 2.5g / L Phytagel; pH: 5.90-5.95; The composition of MSB is as follows: MS medium + B5 vitamins.

Images