Anti-human CSF-1R antibody and its uses

Abstract

The present invention relates to an antibody or an antigen-binding fragment thereof that specifically binds to human CSF-1R, comprising: a heavy-chain variable domain that contains an HCDR1 region having the sequence of SEQ ID NO: 4, an HCDR2 region having the sequence of SEQ ID NO: 5, and an HCDR3 region having the sequence of SEQ ID NO: 6; and a light-chain variable domain that contains an LCDR1 region having the sequence of SEQ ID NO: 7, an LCDR2 region having the sequence of SEQ ID NO: 8, and an LCDR3 region having the sequence of SEQ ID NO: 9. The heavy-chain variable domain contains the sequence of SEQ ID NO: 2 and wherein the light-chain variable domain contains the sequence of SEQ ID NO: 3.

Description

Field of the Invention

[0001] The present invention generally relates to antibodies that can specifically neutralize human CSF-1R, as well as methods for their use and preparation. Specifically, the present invention relates to antibodies that can have the effect of reducing macrophages, the preparation of such antibodies, and their use in treating diseases associated with abnormal macrophage proliferation, such as tumors. Background Art

[0002] CSF-1R (M-CSFR) is the cell surface receptor for macrophage colony-stimulating factor (M-CSF or CSF-1) and IL-34. The binding of CSF-1 to its receptor activates signal transduction pathways, including the PI3K / Akt and MAPK pathways, leading to the proliferation, survival, motility, and differentiation of cells of the monocyte / macrophage lineage. CSF-1R is expressed by hematopoietic stem cells, myeloid cells, including monocytes macrophages, osteoclasts, dendritic cells, and microglial cells, and neural progenitor cells. Myeloid cells are heterogeneous and multifunctional cells that play important roles in innate and adaptive immunity. High plasticity and diversity are characteristic of the macrophage lineage. Macrophages can differentiate into different phenotypes with different biological functions depending on the microenvironment and metabolic state. In rodents and humans, macrophages have two major activation phenotypes, namely the M1 (classical or pro-inflammatory) phenotype and the M2 (alternative or anti-inflammatory) phenotype (Mantovani A et al., 2002). M2 macrophages secrete anti-inflammatory cytokines, and their functions are related to tissue repair and angiogenesis.

[0003] Increased expression or activation of CSF-1R and / or its ligand has been found in a variety of cancers, and elevated M-CSF levels are associated with poor prognosis in certain cancers (Pedersen MB et al., 2017; Zhang QW et al., 2012). M-CSF is one of several cytokines involved in the recruitment of tumor-associated macrophages (TAMs), which exhibit characteristics similar to M2 macrophages and contribute to tumor angiogenesis and tumor progression to metastasis. Activation of CSF-1R also causes the proliferation and differentiation of osteoclast precursors, thereby mediating the bone resorption process. Therefore, inhibition of CSF-1R would provide a treatment for cancer, especially cancer invasion, angiogenesis, cancer metastasis, immune tolerance, and bone metastasis. In addition, CSF-1R is an important therapeutic target for osteoporosis, inflammatory arthritis, and other inflammatory bone erosions due to its role in osteoclast biology. Therefore, targeting TAMs via CSF-1R signaling with neutralizing antibodies has become an attractive strategy for treating tumors and inflammatory / immune diseases. Summary of the Invention

[0004] Embodiments of the present invention relate to antibodies or binding fragments thereof that specifically bind to human CSF-1R. The antibodies include humanized antibodies and human antibodies. In one aspect, the present invention relates to antibodies that specifically bind to the extracellular domain (ECD) of human CSF-1R (SEQ ID NO: 1). The antibodies of the present invention comprise heavy chain variable region sequences that include HCDR1, HCDR2, and HCDR3, wherein the HCDR1 sequence is GYSFTGYNMN (SEQ ID NO: 4), the HCDR2 sequence is NIDPYYGGTTYNQKFKG (SEQ ID NO: 5), and the HCDR3 sequence is GDYSGSSYWYFDV (SEQ ID NO: 6), wherein the HCDR sequences are defined according to the Kabat method. According to some embodiments of the present invention, the heavy chain variable region of the antibody that specifically binds to human CSF-1R has the sequence of SEQ ID NO: 2.

[0005] In another aspect, the present application relates to an antibody that specifically binds to human CSF-1R and comprises a light chain variable region having LCDR1, LCDR2, and LCDR3 sequences, wherein the LCDR1 sequence is KASDHINNWLA (SEQ ID NO: 7), the LCDR2 sequence is GATSLET (SEQ ID NO: 8), and the LCDR3 sequence is QQNNEDPLT (SEQ ID NO: 9), wherein the LCDR sequences are defined according to the Kabat method. According to some embodiments of the present invention, the light chain variable region of the antibody that specifically binds to human CSF-1R has the sequence of SEQ ID NO: 3.

[0006] In another aspect, the present invention relates to an antibody that specifically binds to human CSF-1R and comprises a heavy chain variable region having HCDR1, HCDR2, and HCDR3 and a light chain variable region having LCDRl, LCDR2, and LCDR3, wherein the HCDR1 sequence is GYSFTGYNMN (SEQ ID NO: 4), the HCDR2 sequence is NIDPYYGGTTYNQKFKG (SEQ ID NO: 5), the HCDR3 sequence is GDYSGSSYWYFDV (SEQ ID NO: 6), the LCDR1 sequence is KASDHINNWLA (SEQ ID NO: 7), the LCDR2 sequence is GATSLET (SEQ ID NO: 8), the LCDR3 sequence is QQYWSTPFT (SEQ ID NO: 9), and wherein the HCDR and LCDR sequences are defined according to the Kabat method.

[0007] In some embodiments, the heavy chain variable region of an antibody that specifically binds to human CSF-1R has the sequence of SEQ ID NO:2, and the light chain variable region of the antibody that specifically binds to human CSF-1R has the sequence of SEQ ID NO:3.

[0008] In some embodiments of the present invention, the antibody that specifically binds to human CSF-1R is a full antibody, a Fab fragment, an F(ab')2 fragment, or a ScFv fragment.

[0009] In some embodiments, the antibody that specifically binds to human CSF-1R is a fully human antibody.

[0010] In some embodiments, the antibody that specifically binds to human CSF-1R further comprises a heavy chain constant region selected from IgG1, IgG2, or IgG4 isotypes and a light chain constant region selected from κ subtypes or λ isotypes.

[0011] In some embodiments, the antibody (or its binding fragment) of the present invention is conjugated with another specific binding domain against a second target to form part of a bispecific or multispecific antibody. In some embodiments, the antibody (or its binding fragment) of the present invention is conjugated with a drug (payload) to form part of an antibody-drug conjugate (ADC). The drug or payload can be selected based on its ability to modulate cells expressing CSF-1R.

[0012] Another aspect of the present invention relates to a pharmaceutical composition for treating a disease mediated by CSF-1R, wherein the pharmaceutical composition comprises a therapeutically effective amount of an antibody or its binding fragment that specifically binds to human CSF-1R. A therapeutically effective amount is an amount sufficient to produce the desired therapeutic outcome. Those skilled in the art will understand that the therapeutically effective amount will depend on the disease condition, the patient (gender, age, physical condition, etc.), the route of administration, etc. Those skilled in the art will be able to identify such amounts without undue experimentation.

[0013] Another aspect of the present invention relates to the use of a pharmaceutical composition comprising an antibody or its binding fragment that specifically binds to human CSF-1R, the pharmaceutical composition being for treating and / or preventing a disease mediated by CSF-1R, CSF-1, and / or IL-34.

[0014] In some embodiments, the disease mediated by CSF-1R, CSF-1, and / or IL-34 is cancer.

[0015] In some embodiments, the cancers include (but are not limited to) multiple myeloma, leukemia (e.g., acute myeloid leukemia (AML) and chronic myeloid leukemia (CML)), prostate cancer, glioblastoma multiforme, giant cell tumor of bone, pigmented villonodular synovitis, tumor metastasis to other tissues, and gastrointestinal stromal tumor, melanoma, non-small cell lung cancer, renal cancer, breast cancer, leukemia, ovarian cancer, myelofibrosis, gastrointestinal stromal tumor, and other advanced solid tumors.

[0016] In some embodiments, the disease mediated by CSF-1R, CSF-1, and / or IL-34 is an inflammatory or immune disease.

[0017] In some embodiments, the inflammatory or immune disease is pigmented villonodular synovitis (PVNS), osteoporosis, inflammatory arthritis, or other inflammatory bone erosion. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 Shows the binding of mAb AB21 antibody to CSF-1R as determined by ELISA.

[0019] Figure 2 Shows the binding of mAb AB21 to human CSF-1R as determined by Biacore analysis.

[0020] Figure 3 Shows the ability of mAb AB21 to block the binding between CSF-1 and CSF-1R.

[0021] Figure 4 Shows the ability of mAb AB21 to bind to CSF-1R on the cell surface as determined by flow cytometry.

[0022] Figure 5 Shows the ability of mAb AB21 to inhibit CSF-1-dependent cell growth of Ba / F3-CSF-1R cell line.

[0023] Figure 6 Shows the ability of mAb AB21 to block downstream signaling of CSF-1R.

[0024] Figure 7 Shows the competitive ELISA of mAb AB21 with other CSF-1R antibodies.

[0025] Figure 8 Shows the binding epitope of mAb AB21.

[0026] Figure 9A Displays the heavy chain variable region of the anti-CSF-1R antibody variant of the present invention. Shows the positions of CDR1, CDR2, CDR3, FR1, FR2, FR3, and FR4.

[0027] Figure 9B Shows the light chain variable region of the anti-CSF-1R antibody variant of the present invention. The positions of CDR1, CDR2, CDR3, FR1, FR2, FR3, and FR4 are shown.

[0028] Figure 10 Shows the revertant mutant residues of the antibody of the present invention.

[0029] Figure 11 Shows the expression and characterization results of various anti-CSF-1R antibody variants of the present invention.

[0030] Figure 12 Shows the ELISA binding assay of the anti-CSF-1R variant of the present invention.

[0031] Figure 13 Shows the results of the anti-CSF-1R antibody of the present invention and its combination therapy with the anti-PD-1 antibody pembrolizumab in inhibiting human RKO colorectal cancer. The combination therapy produces a synergistic effect. Detailed Description

[0032] Embodiments of the present invention relate to novel antibodies that can specifically bind to human CSF-1R with high affinity and can provide therapeutic benefits to an individual. The antibodies can be humanized antibodies or human antibodies. In some embodiments, the anti-CSF-1R antibody can potently neutralize CSF-1R signaling induced by CSF-1 and / or induced by IL-34. The antibodies of the present invention can be human or humanized antibodies and can be used as therapeutic agents for treating various diseases mediated by CSF-1R as more fully described herein.

[0033] Some embodiments of the present invention relate to the use of an anti-CSF-1R antibody or an antigen-binding fragment thereof for diagnosing, evaluating, and treating diseases or disorders associated with CSF-1R, CSF-1, and / or IL-34 or their abnormal expression. The subject antibodies are for treating or preventing tumors and / or treating or preventing autoimmune and / or inflammatory diseases and other diseases.

[0034] Specifically, the antibody or an antigen-binding fragment thereof according to an embodiment of the present invention can specifically bind to an epitope in the extracellular domain (ECD) of human CSF-1R or a fragment thereof, wherein the extracellular domain (ECD) of human CSF-1R has the amino acid sequence of SEQ ID NO: 1, and the epitope is located in the region spanning residues 228-233: serine-228, valine-229, aspartic acid-230, valine-231, asparagine-232, and phenylalanine-233. That is, the epitope is located in 228Ser-Val-Asp-Val-Asn-Phe 233 in (SEQ ID NO:17).

[0035] Antibodies according to embodiments of the invention can be full-length (e.g., IgG1 or IgG4 antibodies), or may only comprise their antigen-binding fragment / portion (e.g., Fab, F(ab')2 or scFv fragments), and may be modified as desired to improve function.

[0036] An antibody or its antigen-binding fragment according to embodiments of the invention specifically binds to human CSF-1R. The human CSF-1 receptor (CSF-1R; colony stimulating factor 1 receptor; synonyms: M-CSF receptor; macrophage colony stimulating factor 1 receptor, Fms proto-oncogene, c-fms, SEQ ID NO:1), also known as CD115, is a single-pass type I membrane protein encoded by the proto-oncogene c-fms, having 972 amino acids and a predicted molecular weight of 107 kilo Daltons. It acts as the receptor for colony stimulating factor 1 (CSF-1 or M-CSF), a cytokine that controls the proliferation, differentiation and function of macrophages. Another ligand of CSF-1R, interleukin-34 (IL-34), was identified in 2008.

[0037] The role of CSF-1R may be involved in immune response, bone remodeling and the reproductive system, as shown by gene knockout mice against CSF-1 (Pollard, J.W., Mol. Reprod. Dev. 46 (1997) 54-61) or CSF-1R (Dai, X.M. et al., Blood 99 (2002) 111-120) which can have osteopetrosis, hematopoiesis, tissue macrophage and / or reproductive phenotypes.

[0038] The main biological effects of CSF-1R signaling include the differentiation of hematopoietic progenitor cells into macrophage lineage cells such as macrophages, osteoclasts and microglial cells, as well as their proliferation, migration and survival. Binding of CSF-1 (M-CSF) to CSF-1R will induce the formation of homodimers and activate kinases through tyrosine phosphorylation, thereby further causing downstream PI3K, AKT and MAPK signaling.

[0039] As used herein, the term "antibody" means any antigen-binding molecule or molecular complex that includes at least one complementarity-determining region (CDR) that specifically binds to or interacts with a particular antigen (e.g., CSF-1R). The term "antibody" includes immunoglobulin molecules and their multimers, and the immunoglobulin molecules comprise four polypeptide chains, i.e., two heavy (H) chains and two light (L) chains that are interconnected by disulfide bonds. Each heavy chain comprises a heavy-chain variable region (VH) and a heavy-chain constant region, and the heavy-chain constant region comprises three domains, i.e., CH1, CH2, and CH3. Each light chain comprises a light-chain variable region (VL) and a light-chain constant region (CL1). The VH and VL regions can be further subdivided into multiple complementarity-determining regions (CDRs), interspersed with framework regions (FRs). Each VH and VL is composed of three CDRs and four FRs, which are arranged in the following order from the amino terminus to the carboxyl terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. In different embodiments of the present invention, the FRs may be identical to human germline sequences or may be naturally or artificially modified.

[0040] As used herein, terms such as "antigen-binding portion" or "antigen-binding fragment" of an antibody include any naturally occurring, enzymatically obtainable, synthetic, or genetically engineered polypeptide or glycoprotein that specifically binds an antigen to form a complex. Antigen-binding fragments of an antibody can be obtained from the intact antibody molecule using any suitable standard techniques, such as proteolytic digestion or recombinant genetic engineering techniques.

[0041] Non-limiting examples of antigen-binding fragments include: (i) Fab fragments; (ii) F(ab')2 fragments; (iii) Fd fragments; (iv) Fv fragments; (v) single-chain Fv (scFv) molecules; (vi) dAb fragments; and (vii) minimal recognition units composed of amino acid residues that mimic the hypervariable regions of an antibody (e.g., isolated complementarity-determining regions (CDRs), such as CDR3 peptides), or restricted FR3-CDR3-FR4 peptides. Other engineered molecules, such as domain-specific antibodies, single-domain antibodies, domain-deleted antibodies, chimeric antibodies, CDR-grafted antibodies, bifunctional antibodies, trifunctional antibodies, tetrafunctional antibodies, minibodies, nanobodies (e.g., monovalent nanobodies, bivalent nanobodies, etc.), small modular immunopharmaceuticals (SMIPs), and shark variable IgNAR domains are also encompassed by the expression "antigen-binding fragment" as used herein.

[0042] Antigen-binding fragments of antibodies typically comprise at least one variable domain. The variable domain can have any size or amino acid composition and will generally comprise at least one CDR, which is adjacent to or in-frame with one or more framework sequences. In an antigen-binding fragment having a VH domain associated with a VL domain, the VH and VL domains can be positioned in any suitable arrangement relative to each other. For example, the variable regions can be dimeric and contain VH-VH, VH-VL, or VL-VL dimers. Alternatively, the antigen-binding fragment of an antibody can contain a monomeric VH or VL domain.

[0043] In certain embodiments, the antigen-binding fragment of an antibody can contain at least one variable domain covalently linked to at least one constant domain. Non-limiting exemplary configurations of variable and constant domains that can be found within the antigen-binding fragments of the antibodies of the present invention include: (i) VH-CH1; (ii) VH-CH2; (iii) VH-CH3; (iv) VH-CH1-CH2; (v) VH-CH1-CH2-CH3, (vi) VH-CH2-CH3; (vii) VH-CL; (viii) VL-CH1; (ix) VL-CH2; (x) VL-CH3; (xi) VL-CH1-CH2; (xii) VL-CH1-CH2-CH3; (xiii) VL-CH2-CH3; and (xiv) VL-CL. In any configuration of variable and constant domains including any of the exemplary configurations listed above, the variable and constant domains can be directly linked to each other or can be linked by a full or partial hinge or linker region. The hinge region can be composed of at least 2 (e.g., 5, 10, 15, 20, 40, 60 or more) amino acids that create a flexible or semi-flexible linkage between adjacent variable and / or constant domains in a single polypeptide molecule. In addition, the antigen-binding fragments of the antibodies of the present invention can comprise homodimers or heterodimers (or other multimers) formed by non-covalent association of any of the variable and constant domain configurations listed above with each other and / or with one or more monomeric VH or VL domains (e.g., via disulfide bonds).

[0044] Like the intact antibody molecule, the antigen-binding fragment can be monospecific or multispecific (e.g., bispecific). Multispecific antigen-binding fragments of antibodies will typically comprise at least two different variable domains, where each variable domain is capable of specifically binding to a distinct antigen or to a different epitope on the same antigen. Any form of multispecific antibody, including the exemplary bispecific antibody forms disclosed herein, can be adapted for use in the context of the antigen-binding fragments of the antibodies of the present invention using conventional techniques available in the art.

[0045] The antibodies of the present invention can be used in the form of antibody-drug conjugates (ADCs) that specifically target CSF-1R. The conjugates on the ADC can modulate immune cells expressing CSF-1R or cells that interact with cells expressing CSF-1R (such as CSF-1R-expressing cells). These ADCs can use any antibody or antigen-binding fragment of the present invention. The drug (payload) conjugated to the antibody (or binding fragment) can be any drug commonly used in ADCs. The conjugation method can be a method known in the art.

[0046] Preferably, the antibody or antigen-binding fragment according to an embodiment of the present invention is a mammalian antibody. As used herein, the term "mammalian antibody" is intended to include antibodies having variable and constant regions derived from mammalian germline immunoglobulin sequences. The mammalian antibodies of the present invention can include amino acid residues not encoded by mammalian germline immunoglobulin sequences (such as mutations induced by in vitro random or site-specific mutagenesis or introduced by in vivo somatic mutation) in, for example, the CDRs, particularly in CDR3, or in other regions.

[0047] As used herein, the term "recombinant mammalian antibody" is intended to include all mammalian antibodies prepared, expressed, produced, or isolated by recombinant means, such as antibodies expressed using recombinant expression vectors transfected into host cells (further described below); antibodies isolated from recombinant, combinatorial mammalian antibody libraries (further described below); antibodies isolated from transgenic animals (such as mice) against mammalian immunoglobulin genes; or antibodies prepared, expressed, produced, or isolated by any other means involving splicing mammalian immunoglobulin gene sequences to other DNA sequences. Such recombinant mammalian antibodies have variable and constant regions derived from mammalian germline immunoglobulin sequences. However, in certain embodiments, such recombinant mammalian antibodies undergo in vitro mutagenesis (or in vivo somatic mutagenesis when using transgenic animals against human Ig sequences) and thus, the amino acid sequences of the VH and VL regions of the recombinant antibody are derived from human germline VH and VL sequences and are related to human germline VH and VL sequences, but may not be sequences that naturally occur in the mammalian antibody germline lineage in vivo.

[0048] Mammalian antibodies, such as human antibodies, can exist in two forms associated with hinge heterogeneity. In one form, the immunoglobulin molecule comprises a stable four-chain construct of approximately 150 - 160 kDa, where the dimer is held together by interchain heavy-chain disulfide bonds. In the second form, the dimer is not linked by interchain disulfide bonds and forms a molecule of approximately 75 - 80 kDa (half-antibody) composed of covalently coupled light and heavy chains. These forms are extremely difficult to separate, even after affinity purification.

[0049] Compared to the corresponding germline sequences from which the antibodies are derived, the anti-CSF-1R antibodies or antigen-binding fragments disclosed herein may contain one or more amino acid substitutions, insertions, and / or deletions in the framework regions and / or CDR regions of the heavy and / or light chain variable domains. The invention includes antibodies and antigen-binding fragments derived from any of the amino acid sequences disclosed herein, wherein one or more amino acids in one or more framework regions and / or CDR regions may be mutated to the corresponding residues of the germline sequence from which the antibody is derived, or to the corresponding residues of another mammalian germline sequence, or to conservative amino acid substitutions of the corresponding germline residues (such sequence variations are collectively referred to herein as "germline mutations"). One of ordinary skill in the art can readily generate a variety of antibodies and antigen-binding fragments containing one or more individual germline mutations or combinations thereof starting from the heavy and light chain variable region sequences disclosed herein.

[0050] In certain embodiments, one or more framework and / or CDR residues within the VH and / or VL domains may be reverted to the residues found in the original germline sequence from which the antibody is derived. In other embodiments, only certain residues may be reverted to the original germline sequence, such as only the mutated residues found within 8 amino acids before FR1 or within 8 amino acids after FR4, or only the mutated residues found within CDR1, CDR2, or CDR3. In other embodiments, one or more framework and / or CDR residues may be mutated to the corresponding residues of a different germline sequence (i.e., a germline sequence different from the germline sequence from which the antibody was originally obtained).

[0051] In addition, the antibodies of the invention may contain any combination of two or more germline mutations in the framework regions and / or CDR regions, such as where certain individual residues are mutated to the corresponding residues of a particular germline sequence while other residues different from the original germline sequence remain unchanged or are mutated to the corresponding residues of a different germline sequence. Once antibodies and antigen-binding fragments containing one or more germline mutations are obtained, one or more of their desired properties, such as improved binding specificity, increased binding affinity, improved or enhanced antagonistic or agonistic biological properties (as appropriate), reduced immunogenicity, etc., can be readily tested. Antibodies and antigen-binding fragments obtained in this general manner are encompassed within the scope of the invention.

[0052] When referring to a nucleic acid or a fragment thereof, the terms "substantial identity" or "substantially identical" indicate that, when optimally aligned with another nucleic acid (or its complementary strand) in the presence of appropriate nucleotide insertions or deletions, as measured by any well-known sequence identity algorithm discussed below, such as FASTA, BLAST, or Gap, there is nucleotide sequence identity in at least about 95%, and more preferably at least about 96%, 97%, 98%, or 99% of the nucleotide bases. A nucleic acid molecule having substantial identity to a reference nucleic acid molecule may, in some cases, encode a polypeptide having an amino acid sequence that is the same as or substantially similar to the polypeptide encoded by the reference nucleic acid molecule.

[0053] When applied to polypeptides, the terms "substantial similarity" or "substantially similar" mean that two peptide sequences have at least 95% sequence identity, even more preferably at least 98% or 99% sequence identity, when optimally aligned using the programs GAP or BESTFIT with default gap weights. Preferably, the differences in the non-identical residue positions are due to conservative amino acid substitutions. A "conservative amino acid substitution" is an amino acid substitution in which an amino acid residue is replaced with another amino acid residue having a side chain (R group) with similar chemical / physical properties (e.g., charge or hydrophobicity). In general, conservative amino acid substitutions do not substantially alter the functional properties of the protein. In cases where two or more amino acid sequences differ from each other due to conservative substitutions, the percentage of sequence identity or similarity may be adjusted upward to correct for the nature of the conservative substitutions. The manner in which this adjustment is made is well known to those of skill in the art. Examples of groups of amino acids having side chains with similar chemical properties include (1) aliphatic side chains: glycine, alanine, valine, leucine, and isoleucine; (2) aliphatic hydroxyl side chains: serine and threonine; (3) side chains containing amides: asparagine and glutamine; (4) aromatic side chains: phenylalanine, tyrosine, and tryptophan; (5) basic side chains: lysine, arginine, and histidine; (6) acidic side chains: aspartic acid and glutamic acid; and (7) sulfur-containing side chains: cysteine and methionine. Preferred groups of conservative amino acid substitutions are: valine - leucine - isoleucine, phenylalanine - tyrosine, lysine - arginine, alanine - valine, glutamic acid - aspartic acid, and asparagine - glutamine. Alternatively, a conservative substitution is any change having a positive value in the PAM250 log-likelihood matrix disclosed in Gonnet et al. (1992) Science 256:1443 - 1445, which is incorporated herein by reference. A "moderately conservative" substitution is any change having a non-negative value in the PAM250 log-likelihood matrix.

[0054] Typically, sequence analysis software is used to measure the sequence similarity of polypeptides, also known as sequence identity. Protein analysis software uses similarity measures assigned to various substitutions, deletions, and other modifications, including conservative amino acid substitutions, to match similar sequences. For example, the GCG software contains programs such as Gap and Best fit, which can determine sequence homology or sequence identity between closely related polypeptides, such as homologous polypeptides from different organism species or between a wild-type protein and its mutant, using default parameters. Polypeptide sequences can also be compared using FASTA, a program in GCG version 6.1, using default or recommended parameters. FASTA (e.g., FASTA2 and FASTA3) provides an alignment of the best overlapping region between the query sequence and the search sequence and the percentage of sequence identity (Pearson (2000), supra). When comparing the sequences of the present invention with a database containing a large number of sequences from different organisms, another preferred algorithm is the computer program BLAST, especially BLASTP or TBLASTN, using default parameters. See, e.g., Altschul et al. (1990) J. Mol. Biol. 215:403-410; and Altschul et al. (1997) Nucleic Acids Res. 25:3389-402, each incorporated herein by reference.

[0055] In a preferred embodiment of the invention, the antibody or antigen-binding fragment thereof comprises the complementarity determining regions of the heavy chain variable region and the complementarity determining regions of the light chain variable region, wherein the complementarity determining regions of the heavy chain variable region comprise the CDRH1 (or HCDR1), CDRH2 (or HCDR2), and CDRH3 (or HCDR3) regions, and the complementarity determining regions of the light chain variable region comprise the CDRL1 (or LCDR1), CDRL2 (or LCDR2), and CDRL3 (or LCDR3) regions.

[0056] According to some embodiments of the present invention, the CDRH1 region comprises the amino acid sequence of SEQ ID NO:4 or a substantially similar sequence having at least 90%, at least 95%, at least 98% or at least 99% sequence identity thereto; the CDRH2 region comprises the amino acid sequence of SEQ ID NO:5 or a substantially similar sequence having at least 90%, at least 95%, at least 98% or at least 99% sequence identity thereto; the CDRH3 region comprises the amino acid sequence of SEQ ID NO:6 or a substantially similar sequence having at least 90%, at least 95%, at least 98% or at least 99% sequence identity thereto; the CDRL1 region comprises the amino acid sequence of SEQ ID NO:7 or a substantially similar sequence having at least 90%, at least 95%, at least 98% or at least 99% sequence identity thereto; the CDRL2 region comprises the amino acid sequence of SEQ ID NO:8 or a substantially similar sequence having at least 90%, at least 95%, at least 98% or at least 99% sequence identity thereto; and the CDRL3 region comprises the amino acid sequence of SEQ ID NO:9 or a substantially similar sequence having at least 90%, at least 95%, at least 98% or at least 99% sequence identity thereto.

[0057] According to a preferred embodiment of the present invention, the anti-CSF-1R antibody or antigen-binding fragment thereof comprises a heavy chain variable region which comprises the amino acid sequence of SEQ ID NO:2 or a substantially similar sequence having at least 90%, at least 95%, at least 98% or at least 99% sequence identity thereto. Preferably, the heavy chain variable region is encoded by the nucleic acid sequence of SEQ ID NO:2. The anti-CSF-1R antibody or antigen-binding fragment thereof comprises a light chain variable region which comprises the amino acid sequence of SEQ ID NO:3 or a substantially similar sequence having at least 90%, at least 95%, at least 98% or at least 99% sequence identity thereto or a substantially similar sequence thereof. Preferably, the light chain variable region is encoded by the nucleic acid sequence of SEQ ID NO:3.

[0058] It is determined that the antibody of the present invention specifically binds to CSF-1R via ELISA or BIAcore analysis. Briefly, for ELISA, CSF-1R is coated on a 96-well ELISA plate (1 μg / ml). After the anti-CSF-1R antibody binds, goat anti-mouse IgG conjugated to horseradish peroxidase (HRP) is used as the secondary antibody, and 3,3',5,5'-tetramethylbenzidine (TMB) is used as the substrate to evaluate the antibody-CSF-1R binding. OD450 is read to calculate the activity.

[0059] As Figure 1 (ELISA) and Figure 2As shown in (BIAcore), the murine fusion anti-human CSF-1R antibody (mAb AB21) showed specific binding to CSF-1R. Figure 1 The results obtained by ELISA analysis are shown, where the M-CSF R / CD115Fc chimera (R&D Systems, Inc., Minneapolis, MN) was coated in 96-well plates and various concentrations of mAb AB21 were added. After binding and washing, the bound mAb AB21 was evaluated using a horseradish peroxidase-conjugated secondary antibody. The results showed that the mAb bound to this antigen with high affinity (Kd of approximately 0.745 nM). Figure 2 Similar results obtained by Biacore analysis are shown.

[0060] A useful antibody against CSF-1R should block the binding between CSF-1 and CSF-1R. An ELISA-based assay was used to evaluate whether mAb AB21 could block the binding between CSF-1 and CSF-1R. Briefly, CSF-1RECD at a concentration of 1.2 μg / ml was coated in 96-well plates overnight. Then, the wells were washed and blocked with 1% blocking buffer. After washing, serially diluted antibodies were added, and then the CSF-1 ligand (100 ng / mL) was added to the wells. After antibody blocking, a human M-CSF biotinylated antibody and streptavidin peroxidase (POD) conjugate were used as secondary antibodies and 3,3',5,5'-tetramethylbenzidine (TMB) was used as a substrate to evaluate the blocking activity of the anti-CSF-1R antibody. OD450 was read to calculate the activity.

[0061] As Figure 3 shown, the mAb AB21 of the present invention showed specific and potent activity in blocking the CSF-1 / CSF-1R interaction. These results confirm that the antibody of the present invention will effectively inhibit the proliferation and differentiation of tumor-associated macrophages mediated by CSF-1 and CSF-1R signaling.

[0062] In addition to ELISA analysis, the binding of the anti-CSF-1R antibody to cells expressing CSF-1R can also be analyzed by flow cytometry using the THP-1 cell line (a human monocyte cell line) that endogenously expresses CSF-1R. Briefly, THP-1 cells were incubated with the anti-CSF-1R antibody for 1 hour and then analyzed by flow cytometry. As Figure 4 shown, the mAb AB21 of the present invention could bind to THP-1 cells in a specific manner, indicating that this antibody could recognize CSF-1R on the cell surface.

[0063] The above results clearly indicate that the anti-CSF-1R antibodies of the present invention can bind to CSF-1R in vitro and on the cell surface with high affinity. Therefore, these antibodies should be able to alter cell activities mediated by CSF-1R. The following examples demonstrate that, in fact, these antibodies can interfere with the interaction between CSF-1 and CSF-1R, thereby interrupting CSF-1R-mediated signal transduction and the consequent cell functions / activities.

[0064] Growth inhibition of Ba / F3-CSF-1R cells under treatment with anti-CSF-1R monoclonal antibodies.

[0065] The full-length human CSF-1R gene was stably expressed in the Ba / F3 cell line (Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSMZ, Germany)) and cultured in RPMI 1640 supplemented with 10% fetal bovine serum (Biological Industries, 04-121-1A) and recombinant human M-CSF (Andi Systems). The growth of this cell line depends on recombinant human IL-3, CSF-1, and IL-34 (all from Andi Systems). To evaluate the in vivo activity of the antibodies of the present invention, 8×10 3 Ba / F3-CSF-1R cells were seeded into each well of a 96-well plate and incubated for 3 days in the presence of different concentrations of the antibody to determine the IC50 (the concentration that inhibits 50% of cell viability). The human antibody constant region fragment (hFc) was used as a negative control. The cell viability was detected by measuring the absorbance of the cells using the MTS (Promega CellTiter Aqueous MTS reagent powder) and phenazine methosulfate (PMS) (Sigma Aldrich, P9625) assay system. MTS (3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) produces formazan products in the presence of phenazine methosulfate (PMS), which has a maximum absorbance at 490 nm in phosphate-buffered saline.

[0066] As Figure 5 shown, the anti-CSF-1R antibody mAb AB21 of the present invention can block the interaction between CSF-1 and CSF-1R, thereby inhibiting the growth of CSF-1-dependent Ba / F3-CSF-1R cells. These results indicate that the antibodies of the present invention can be used to treat CSF-1R-mediated diseases in vivo.

[0067] Treatment with anti-CSF-1R monoclonal antibodies downregulates CSF-1R downstream signal transduction.

[0068] The effect of anti-CSF-1R binding to CSF-1R on downstream signaling of CSF-1R was analyzed by western blot. THP-1 or Ba / F3-CSF-1R cells cultured in the presence or absence of recombinant human M-CSF (rhM-CSF) were treated with higher and lower doses of mAb AB21. As Figure 6 shown, mAb AB21 could inhibit phosphorylation of CSF-1R and AKT, a kinase downstream of CSF-1R signaling, in a dose-dependent manner. These results indicate that the antibody of the present invention can actually inhibit CSF-1R-mediated signaling. Therefore, the antibody of the present invention should be useful for treating diseases mediated by CSF-1R.

[0069] The anti-CSF-1R monoclonal antibody AB21 binds to an epitope different from that bound by other anti-CSF-1R monoclonal antibodies in clinical trials.

[0070] There are several anti-CSF-1R antibodies on the market. Competitive analysis can be used to study whether the antibody of the present invention binds to the same epitope. Briefly, mAb AB21 was analyzed by ELISA binding assay in the presence of other anti-CSF-1R monoclonal antibodies in clinical trials, such as RG7155 (Roche), FPA008 (Five Prime), and IMC-CS4 (Eli Lilly). As Figure 7 shown, none of these antibodies could prevent or affect the binding of mAb AB21 to CSF-1R. These results indicate that the binding epitope of mAb AB21 is different from that of RG7155, FPA008, and IMC-CS4.

[0071] Analysis of the binding epitope of the anti-CSF-1R monoclonal antibody AB21.

[0072] To clarify the binding epitope of mAb AB21, ELISA analysis was performed on the binding of mAb AB21 to different CSF-1R ECD mutants generated by single-point mutation or fragment mutation. Ten (10) different extracellular domain (ECD) mutants of CSF-1R were generated: E29A, W50G, W159G, 90-100A, 100-106A, 120-130A, 151-163A, 171-185A, 228-233A, and 281-286A, which carried a single Ala mutation at the designated position or a stretch of Ala mutations in the designated region. As Figure 8As shown, the ECD fragment with only the 228 - 233 mutation loses the binding of mAb AB21, indicating that the residues at 228 - 233 are crucial for mAb 21 to bind to the CSF-1R ECD. All other ECD mutants tested retained mAb 21 binding, indicating that mutations at these residues will not affect the binding of mAb 21 to the CSF-1R ECD. These results indicate that the epitope of the anti-CSF-1R monoclonal antibody mAb AB21 is located in the region spanning residues 228 - 233.

[0073] The above examples clearly show that the anti-CSF-1R antibody AB21 of the present invention can specifically and tightly bind to human CSF-1R. These antibodies can also interfere with the interaction between CSF-1 and CSF-1R and block CSF-1 / CSF-1R binding, thereby inhibiting CSF-1 / CSF-1R-mediated signal transduction. Therefore, the antibodies of the present invention can be used as therapeutic agents for treating diseases mediated by CSF-1 / CSF-1R interaction. Such diseases include, for example, cancer and inflammatory / immune diseases. Examples of cancer include (but are not limited to) lung cancer, breast cancer, prostate cancer, colorectal cancer, etc.

[0074] Some embodiments of the present invention relate to methods for treating diseases mediated by CSF-1R, such diseases may include cancer. To demonstrate the utility of the antibodies of the present invention in treating cancer, a murine model was used. Briefly, RKO cells were subcutaneously injected into IL-6NOG mice (Taconic) that had been transplanted with human PBMC to reconstitute the human immune system. On days 8, 15, and 22, the mice were treated each time with a combination of 30 mpk (mg / Kg), or 10 mpk, or 30 mpk of the antibody of the present invention (such as mAB21) and 5 mpk of pembrolizumab (Keytruda). IgG (non-anti-CSF-1R) was used as a control. Tumor growth in each treatment group was monitored until day 33.

[0075] As Figure 13 shown, the anti-CSF-1R mAb of the present invention effectively treats cancer in this in vivo colorectal cancer model and has the potential to be combined with checkpoint inhibitors. These results clearly show that the antibodies of the present invention will be useful for clinical use in treating cancer.

[0076] Some embodiments of the present invention relate to methods for treating diseases mediated by CSF-1R, such diseases may include cancer. Some embodiments of the present invention relate to methods for treating inflammatory / immune diseases.

[0077] The following examples will further illustrate the embodiments of the present invention. Those skilled in the art should understand that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention, and other modifications and variations are possible without departing from the scope of the present invention.

[0078] Example

[0079] Example 1. CSF-1R Binding ELISA of AB21 Monoclonal Antibody

[0080] To evaluate the binding affinity of the anti-human CSF-1R antibody AB21 mAb, the hybridoma was grown in IMDM containing 15% fetal bovine serum (FCS). After culturing for one week, 1×10 6 cells were collected, washed with PBS, resuspended in 200 μl of RPMI medium, and injected into severe combined immunodeficient (SCID) mice by IP injection. Three weeks later, the ascites of the mice was collected and diluted to 15 ml. The antibody was further purified by 40% ammonium sulfate and a protein A column (Montage Antibody Purification Kit, Millipore). The purified antibody was concentrated using an Amicon Ultra-15 centrifugal filter device following the protocol provided by the manufacturer (Millipore). The purity of the antibody was analyzed by 12% SDS PAGE.

[0081] One hundred (100) nanograms of human CSF-1R-Fc protein was coated on a 96-well ELISA plate, and the plate was washed again with PBS. Serial dilutions of the AB21 mAb antibody from 1×10 -12 M to 1×10 -8 M were added to the plate, and the plate was incubated at 37 °C for 1 hour. A conjugate of goat anti-mouse IgG with horseradish peroxidase (HRP) was added. After 1 hour, 3,3',5,5'-tetramethylbenzidine (TMB) was added and the OD450 was read. Each study was repeated three times. The data was presented as mean ± SD. Using the OD readings and concentrations of the antibody, a multiple scatter plot was made using GraphPad Prism 5. The values were predicted by a four parameter logistic fit.

[0082] The results of this experiment are shown in Figure 1 . The Kd value of the AB21 mAb antibody was 7.45×10 -10 M (N>3). This result indicates that the AB21 mAb antibody can recognize the human CSF-1R protein and has a favorable affinity with a Kd value of approximately 7.45×10 -10 M.

[0083] Example 2. Determination of the affinity of anti-CSF-1R antibodies against CSF-1R using BIAcore Instrument: T200; Chip: 222; Coupling: amine coupling; Buffer: PBS (Biacore BR-1006-72)

[0084] To understand the differences in binding kinetics between individual antibodies, as previously described (Karlsson and Fait, (1997) J. Immunol Methods 200:121-133), surface plasmon resonance (SPR) measurements were performed using a BIAcore T200 (BIAcore, Inc., Piscataway, N.J.). According to the supplier's instructions, a carboxymethylated dextran biosensor chip (CMS, BIAcore) was activated with N-ethyl-N'-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) and N-hydroxysuccinimide (NHS). AB21 mAb was diluted to 5 μg / ml with 10 mM sodium acetate at pH 4.8 and subsequently injected at a flow rate of 20 μL / min to obtain a coupled protein of approximately 100 response units (RU), followed by injection of 1 M ethanolamine to block unreacted groups. For kinetic measurements, two-fold serial dilutions of CSF-1R-ECD (0.3125 nM to 40 nM) were injected at a flow rate of 30 μL / min into the HBS-P BIAcore running buffer (BIAcore, Inc., Piscataway, N.J.) provided by the manufacturer at 25°C, and the binding reaction on AB21 mAb was corrected by subtracting the reaction on the blank flow cell. Using a simple one-to-one Langmuir binding model, the association rate (kon or ka) and dissociation rate (koff or kd) were calculated, and separate fits were used for kon and koff. (BIAcore TM Evaluation Software version 3.2).

[0085] The results are shown in Figure 2 The kon and koff for the binding of AB21 mAb to CSF-1R were 3.99×10 5 and 4.90×10 -5 , and K d was 1.228×10 -10 mol / L.

[0086] Example 3. Inhibition of the binding of CSF-1 to CSF-IR (ELISA)

[0087] Dilute CSF-1R-ECD-human Fc (internal) to 1.2 μg / ml with coating buffer and coat overnight at 4 °C. After the incubation step, wash each plate once with wash buffer and block with 1% casein blocking buffer for 2 hours at room temperature. Incubate different dilutions of purified AB21 antibody with 250 ng / ml M-CSF (R&D Systems, 216-GMP-025) in dilution buffer for 1 hour at 37 °C. After 1 hour of incubation, wash 5 times, and then the ligand bound to the receptor can be detected by 50 ng / ml biotinylated anti-CSF-1 clone BAF216 (R&D Systems, UK) and 1:5000 diluted streptavidin HRP (Roche Diagnostics GmbH, DE, catalog number 11089153001). Use anti-CSF-1R SC 2-4A5 (Santa Cruz Biotechnology, US) that inhibits ligand-receptor interaction as a positive control. Develop each plate with TMB microwell peroxidase substrate (KPL, 95059-154). Measure the absorbance at 450 nm. If the anti-CSF-1R antibody causes the release of CSF-1 from the dimer complex, a decrease in absorbance is found. As Figure 3 shown, the anti-CSF-1R antibody AB21 shows significant inhibition of the interaction between CSF-1 and CSF-1R, indicating that the AB21 mAb can effectively block the binding of CSF-1 ligand to CSF-1R. These results suggest that the antibodies of the present invention can be used to block CSF-1R-mediated biological effects. Therefore, the antibodies of the present invention can be used to prevent or treat diseases mediated by CSF-1R or CSF-1.

[0088] Example 4. Flow cytometry affinity assay

[0089] In addition to binding to CSF-1R ECD in vitro, the antibodies of the present invention can also bind to CSF-1R on cells. In this example, THP-1 cells (human monocyte cell line, TIB-202 TM ) were stained with different concentrations of antibody (AB21) from 6 to 0.625 μg / ml. After washing, the cells were stained with secondary antibody FITC anti-mouse (1:500 dilution). The cells were fixed with fixation buffer (FluroFix TM buffer, Biolegend) and analyzed using an LSRFortessa FACS analyzer (Becton Dickson, US). The FACS analysis results are shown in Figure 4In it, the figure shows the dose-dependent binding of AB 21mAb. The dose-dependent binding fits an S-shaped curve in a semi-logarithmic plot, indicating binding to a specific site (i.e., the antibody specifically binds to the target on THP-1 cells). The binding curve also shows a binding constant of 3.738×10 -10 M.

[0090] Example 5. Growth inhibition of Ba / F3-hCSF-1R recombinant cells under treatment with anti-CSF-lR monoclonal antibody

[0091] To evaluate the ability of AB21 mAb to inhibit the CSF-1R activity of CSF-1 growth-dependent cells, the murine pro-B cell line Ba / F3 (German Collection of Microorganisms and Cell Cultures catalogue number ACC 300) was stably transfected with human CSF-1R to achieve human CSF-1-dependent growth of Ba / F3-hCSF-1R. Ba / F3-hCSF-1R cells were maintained in RPMI containing 10% FCS and 30 ng / ml recombinant human M-CSF (rhM-CSF, R&D Systems, 216-MC). 8×10 3 Ba / F3-hCSF-1R cells were seeded in 96-well plates overnight. In the presence of test antibodies at different concentrations, the cells were incubated for 3 days to determine the IC50 (the concentration that inhibits 50% of cell viability). The human antibody Fc fragment was used as a negative control. 2 mL of MTS solution (CellTiter Promega) was mixed with 100 μL of PMS solution (Sigma-Aldrich, P9625), and 20 μL of the mixed solution was added to each well. The plates were incubated at 37 °C for 3 hours, and the absorbance at 690 nm and 490 nm was measured using a plate reader (Thermo Fisher, MultiscanGo). The inhibition rate of the anti-CSF-1R antibody was calculated as follows: Inhibition rate (%) = [1 - (Ab 490 - 690 nm in the experimental group) / (average Ab 490 - 690 nm in the control group)] × 100. The IC50 was determined by non-linear regression analysis using GraphPad Prism 5. The results of this experiment are shown in Figure 5 In. The results showed that AB21 mAb could inhibit the growth of Ba / F3-hCSF-1R in a specific and dose-dependent manner, as confirmed by the S-shaped curve of the inhibition % versus the semi-logarithmic plot of concentration.

[0092] Example 6. Inhibition of CSF-1-induced CSF-1R phosphorylation by anti-CSF-1R antibody

[0093] Maintain THP-1 cells in RPMI 1640 (Gibco, 11875-093) containing 10% FCS. Culture the cells in medium without rhM-CSF-1 for one day, and then conduct signal transduction studies. Resuspend 3×10 6 cells in 1 ml of medium without rhM-CSF-1 and containing different concentrations (0.5 μg / ml and 5 μg / ml) of AB21 antibody, culture at 37 °C for 2 hours, and then stimulate the cells with 20 ng / mL rhM-CSF-1 at 37 °C for 5 minutes. rhM-CSF-1 alone (without AB21) is used as a positive control. After incubation, wash the cells with PBS and treat with 200 μL of 2× sample buffer at 95 °C for 10 minutes. Analyze the presence of phosphorylated and total CSF-1 receptor and other CSF-1R downstream signaling proteins in cell lysates by Western blotting. Use the following detection antibodies: rabbit anti-CSF1R (Santa Cruz Biotechnology, sc-692) (1:500), rabbit anti-phospho-AKT (Ser473) (Cell Signaling, 4060) (1:1000), mouse anti-β-tubulin (1:5000) (Abcam, ab6049). Figure 6 The results shown in

[0094] clearly demonstrate that AB21 can inhibit downstream signaling of the CSF-1R pathway, as evidenced by the dose-dependent reduction of pAKT473 phosphorylation by the AB21 mAb. These results indicate that the antibodies of the present invention can be used to block CSF-1R-mediated biological effects. Therefore, the antibodies of the present invention can be used to prevent or treat diseases mediated by CSF-1R or CSF-1.

[0095] There are several anti-CSF-1R antibodies in the market and in clinical trials. To test whether AB21 mAb can compete with these known antibodies, 1 μg / ml CSF-1R-ECD-hFc was coated onto a 96-well plate overnight at 4°C. The contents of the plate were tapped into the wells and 100 μl of blocking buffer was added per well to block non-specific binding. Incubate at room temperature for at least 1 hour. The contents of the plate were tapped into the wells and the wells were washed three times with 300 μl of wash buffer. 100 μl of blocking buffer containing primary antibodies (1 μg / mL RG7155, 0.25 μg / mL IMC-CS4) was added per well and incubated at 37°C for 1 hour. 2A6 was used as a negative control antibody which does not recognize human CSF-1R. The contents of the plate were tapped into the wells and the wells were washed three times with 300 μl of wash buffer. 100 μl of blocking buffer containing 4-fold serial dilutions of the competing antibody (highest concentration is 2 μg / ml) was added per well and incubated at 37°C for 1 hour. The wells were washed three times with 300 μl of wash buffer. 100 μl of substrate solution (TMB) was added per well and reacted at room temperature for 20 minutes, and the reaction was stopped with 100 μl of 1N HCl. The absorbance of the plate at 450 nm was measured and the EC 50 value was calculated via GraphPad Prism 5.

[0096] Figure 7 The results in -

[0097] show that the binding of AB21 mAb is not interfered by the anti-CSF-1R antibodies (RG7155, FPA008, IMC-CS4) being used in clinical trials. These results indicate that the epitope of the CSF-1R ECD bound by AB21 mAb is different from the epitopes bound by these other antibodies. Thus, the antibody of the present invention can be used as an alternative therapeutic agent when other antibodies become ineffective due to elimination of the CSF-1R mutations they bind.

[0097] Example 8. Epitope mapping of anti-CSF-1R antibody AB21 versus clinical trial antibodies

[0098] To determine the binding epitope of anti-CSF-1R antibody AB21, different CSF-1R extracellular domain variants with certain residues substituted by alanine were constructed. The CSF-1R ECD variants include E29A, W50G, W159G, 90 - 100A, 100 - 106A, 120 - 130A, 151 - 163A, 171 - 185A, 228 - 233A and 281 - 286A. After purification of the variant proteins, the binding affinity of AB21 mAb to these CSF-1R-ECD variants was analyzed by ELISA using the method described in Example 1. Figure 8The results shown in [Figure 0] demonstrate that the binding epitope of the AB21 mAb is located at residues 228 - 233 in human CSF-1R, as only the 228 - 233A variant of the CSF-1R ECD fails to bind to the AB21 mAb.

[0099] Example 9. Cloning of the gene encoding the antibody AB21 mAb was performed according to the method described below

[0100] (1) cDNA cloning and preparation of the antibody gene

[0101] The hybridoma was cultured in IMDM medium (manufactured by Gibco) containing 15% FCS. After the cell number reached approximately 10×10 6 cells / mL, the cells were collected by centrifugation and then, according to the instruction manual, (manufactured by Invitrogen) was added to extract total RNA. According to the attached instruction manual, the variable region of the antibody cDNA was cloned using a mouse Ig-primerset (manufactured by Novagen).

[0102] (a) According to the instruction manual of the SuperScript III First-Strand Synthesis System (manufactured by Invitrogen), the first-strand cDNA was synthesized. Using 5 μg of total RNA as a template, the first-strand cDNA was prepared. In a 200 μL PCR tube, 5 μg of total hybridoma RNA, 1 μL of 50 ng / μL oligo dT primer, and 1 μL of 10 mM dNTP were mixed, and DEPC-treated water was added to make it up to 10 μL. The reaction mixture was incubated at 65 °C for 5 minutes and then placed on ice for at least 1 minute. Ten microliters of the cDNA synthesis mixture containing 2 μL of 10×RT buffer, 4 μL of 25 mM MgCl 2 , 2 μL of DTT, 1 μL of 4 units of RNaseOUT TM and 1 μL of 200 units of SuperScript III RT was added, gently mixed, and collected by brief centrifugation. The reaction tube was incubated at 25 °C for 10 minutes, then at 50 °C for 50 minutes. The reaction was terminated by holding at 85 °C for 5 minutes and cooled on ice. The tube was briefly centrifuged to collect the reaction product, 1 μl of RNase H was added, and it was incubated at 37 °C for 20 minutes.

[0103] (b) Amplification of the heavy-chain gene and light-chain gene by PCR

[0104] Addition of poly G reactant (TdT reaction): cDNA and 10×TdT buffer, TdT enzyme (terminal deoxynucleotidyl transferase; NEB M0315L), CoCl 2and dGTP (Life; R0161), and incubated at 37 °C for 30 minutes.

[0105] RACE PCR: The heavy and light chains were amplified by poly C and 3' reverse primers (AS1 and AS2) (shown in Table 1).

[0106] Table I - List of 3' reverse primers

[0107] Mouse heavy chain AS1 GCAGCAGATCCAGGGGCCAG SEQ ID NO:18 Mouse heavy chain AS2 GTGGATAGACAGATGGGG SEQ ID NO:19 Mouse and rat light chain λ AS1 GAAATCAGACACACCAGTG SEQ ID NO:20 Mouse and rat t light chain λ AS2 GTGGGAGTGGACTTGGGCTG SEQ ID NO:21 Mouse and hamster IgKV AS1 GATGTCTTTGGGGTAGAAGTTGTTC SEQ ID NO:22 Mouse and hamster IgKV AS2 CTGCTCACTGGATGGTGGGAAGATGG SEQ ID NO:23

[0108] Mouse AS primers were designed according to the published Kurosawa et al., BMC Biology 2012, 10:80. A PCR reaction solution was prepared with a composition of 5 μL of cDNA, 5 μL of 10× reaction buffer, 1 μL of 10 mM dNTP mixture, 1 μL of 2.5 units of Taq polymerase, 1 μL of forward primer 1 and 1 μL of reverse primer 2 provided by the primer set, brought to a final volume of 50 μL with double-distilled water, and PCR was performed. For amplification of the light and heavy chains of the antibody, a cycle of holding at 94 °C for 10 minutes was used, followed by repeating the cycle of holding at 94 °C for one minute, at 52 °C for 1 minute, and at 72 °C for 1 minute 35 times, and the reaction product was further incubated at 72 °C for 10 minutes. The reaction solution was subjected to 2% agarose gel electrophoresis to analyze the reaction products. Products with the correct molecular weights, i.e., approximately 600 bp (including the untranslated region) for the heavy chain and approximately 500 bp (including the untranslated region) for the light chain, were ligated to a TA cloning vector (pJET), and then sequenced using T7P primers to determine the nucleotide sequence. Based on the sequence information, the antibody sequence was translated into a protein sequence using the ExPASY translation tool. The resulting AB21 mAb sequence contains a heavy chain amino acid sequence and a light chain sequence with complementarity-determining regions (CDRs), which were determined by the method disclosed by Kabat et al., Sequences of Proteins of Immunological Interest, 5th Edition, NIH Publication 91 - 3242, Bethesda, Md. (1991), Volumes 1 - 3.

[0109] Figure 9A Depict the variable heavy chain region / domain amino acid sequence of AB21 mAb (SEQ ID NO:2). Indicate the framework regions (FR1, FR2, FR3, and FR4) and CDRs (HCDR1 (SEQ ID NO:4), HCDR2 (SEQ ID NO:5), and HCDR3 (SEQ ID NO:6)). Figure 9BDepict the amino acid sequence (SEQ ID NO:3) of the variable light chain region / domain of AB21 mAb. Indicate the framework regions (FR1, FR2, FR3 and FR4) and CDRs (LCDR1 (SEQ ID NO:7), LCDR2 (SEQ ID NO:8) and LCDR3 (SEQ ID NO:9)).

[0110] Example 10. Humanization of AB21 mAb

[0111] Selection of human V region framework sequences

[0112] Using the murine monoclonal antibody AB21 mAb as the parental antibody, the CDR sequences of AB21 mAb defined according to Kabat are described in Figure 9A and 9B (SEQ ID NO:2 and SEQ ID NO:3).

[0113] For the humanized AB21 mAb IMGT, human germline VL and VH sequences with the highest degree of homology to the framework regions of AB21 mAb were identified from the IMGT database (International immunogenetics Information ). Homology searches can be performed using BLAST or similar methods.

[0114] As Figure 9A shown, the framework sequence (SEQ ID NO:10) of Hu AB21 VH, adapted from the IMGT species IGHV1-69-2*01 human heavy chain framework region, has 25 amino acid differences (underlined residues) from the sequence in AB21 mAb, corresponding to 30.48% (25 out of 82 total residues in the framework region) variation. A human light chain framework (κI subtype: IGKV1-NL1*01) sequence was identified from IMGT. As Figure 9B shown, the sequence (SEQ ID NO:14) of Hu AB21 VL has 17 amino acid differences (underlined residues) from the sequence in AB21 mAb, corresponding to 22.36% (17 out of 76 total residues in the framework region) variation.

[0115] Back mutations

[0116] Transplanting the CDRs onto the framework such that the variable domains (VH and VL) from the IMGT source may not have the optimal sequence. Thus, the affinity of the antibody may not be optimal. In fact, the K Figure 11 of the initial humanized antibody ( d Hu-Hu in -8M, while the K Figure 11 of M-M in the original murine antibody( d is 9.36×10 -11 M. This represents a decrease in affinity by approximately 1000-fold. To improve the binding affinity, some amino acids can be back-mutated to the original species to enhance the stability of the CDR structure. Some important amino acid residues that may affect antibody binding can be the upper core region and the interface region. (E. Stefan, H. Annemarie, and P. Andreas, Methods 34 (2004) 184-199). The following are additional considerations: (i) the most structurally conserved strand in the Fv β-barrel should be avoided; (ii) surface remodeling sites (murine amino acids) are rated by relatively high surface accessibility (e.g., greater than 30%); and (iii) the commonly reported risk sites in the framework are classified.

[0117] Humanized AB21 VHB1 (SEQ ID NO:11) and AB21 VLB1 (SEQ ID NO:15) contain 7 and 2 back-mutated amino acids, respectively. (See Figure 10 and Figure 9A and 9B ).

[0118] Humanized heavy chains Hu AB21 VHB2 (SEQ ID NO:12) and Hu AB21 VHB3 (SEQ ID NO:13), and light chain Hu AB21 VLB2 (SEQ ID NO:16)) contain more back-mutated sites. These variants have fewer human framework residues. (See Figure 10 ).

[0119] Example 11. Binding Affinity Analysis of Humanized Antibodies

[0120] To determine the affinity change after humanization of the murine antibody, the variable regions of humanized light chain and humanized heavy chain were directly generated by nucleotide synthesis method. The murine variable region, humanized region, and human Fc chimeric antibody expression vector pTCAE8-AB21 were introduced into host cells to prepare cells expressing recombinant antibodies. Free Style TM 293 cells (Invitrogen) were used as host cells for expression. The vector was introduced into host cells by polyethylenimine (PEI) according to the attached user manual (manufactured by Invitrogen). Approximately 37 μg of antibody expression vector was linearized by restriction enzyme, and the gene was introduced into 3×10 7 cells.

[0121] A culture supernatant containing human IgG antibodies was prepared by the method described below. Antibody-producing cells were adapted to Free Style TM 293 expression medium (Gibco). The cells were cultured in a tissue culture flask, and when the viable cell ratio reached 90%, the culture supernatant was collected. The collected supernatant was filtered through 10 μm and 0.2 μm filters (manufactured by Millipore) to remove contaminants. Affinity purification of the culture supernatant containing the antibody was performed using Protein A (manufactured by Millipore), with PBS as the absorption buffer and 20 mM sodium citrate buffer (pH 3.0) as the elution buffer. The eluted fraction was adjusted to approximately pH 6.0 by adding 50 mM sodium phosphate buffer (pH 7.0). Using a dialysis membrane (10,000 MW cut-off, manufactured by Spectrum Laboratories), the prepared antibody solution was replaced with PBS and filtered and sterilized through a membrane filter with a pore size of 0.22 μm (manufactured by Millipore) to obtain a purified antibody. The concentration of the purified antibody was determined by measuring the absorbance at 280 nm and converting the measured value based on 1.45 optical density being equal to 1 mg / ml.

[0122] To understand the binding affinity differences between individual antibodies, the ELISA method was used. ELISA plates were coated with 1 μg / ml CSF1R-ECD-hFc, and then diluted (5- to 10-fold dilution) assay antibodies from 50 nM to 1 × 10 -5 nM were added. Analysis was performed by adding an anti-κ HRP secondary antibody (1:5000 dilution). For the non-linear fitting method, with GraphPad Prism software, the binding curve and KD were determined using a one-site specific binding assay. The binding affinity of the humanized antibody with the combination of heavy chain B1 and light chain Hu (B1-Hu) was 9.58 × 10 -11 M, and the combination of heavy chain B1 and light chain B1 (B1-B1) was 5.58 × 10 -11 M, while the combination of heavy chain Hu and light chain Hu (Hu-Hu, i.e., the original humanized antibody) was 8.3 × 10 -8 M, and this affinity was approximately 1000-fold lower than that of the original mouse antibody (M-M). As confirmed by the humanized antibody B1-Hu, B2-Hu, B1-B1, and B2-B1 clone lines, this loss of affinity was restored by back mutation. (See Figure 11 and Figure 12 ). These results also showed that any one of the heavy chain variants (M, Hu, B1, B2, or B3) could be paired with any one of the light chain variants (M, Hu, B1, or B2) to produce the desired antibody.

[0123] Example 12. Inhibitory effect of AB21 mAb on tumor growth

[0124] In vivo efficacy analysis: The tumor growth inhibitory effect of anti-CSF-lR antibody was studied in a colorectal cancer RKO xenograft model in IL-6NOG mice (Taconic Biosciences, Albany, New York). Since the anti-human CSF-1R antibody AB21 cannot recognize mouse CSF-1R, immunodeficient mice IL-6NOG mice transplanted with human PBMC were used for efficacy studies.

[0125] Seven days before subcutaneous implantation of l×10 6 cells of RKO cells ( CRL-2577 TM ) and 100 μl of Matrigel, human PBMC (Lonza, Basel, Switzerland) were transplanted into IL-6NOG mice (Taconic Biosciences, Albany, New York). Animal treatment started on the day of randomization, with an average tumor volume of 200 mm 3 . Mice were treated intraperitoneally once a week with anti-CSF-1R antibody AB21 mAb (10 mpk or 30 mpk), or with a combination of AB21 mAb and the anti-PD-1 antibody pembrolizumab ( Merck, 5 mpk) injected once every two weeks. During the entire treatment period, tumor dimensions were measured twice a week with calipers starting from the staging day. Tumor volume was calculated according to the NCI protocol (tumor volume = l / 2ab 2 , where "a" and "b" are the major and minor diameters of the tumor, respectively).

[0126] Tumor growth analysis is shown in Figure 13In it, the inhibitory effect of anti-CSF-lR AB21 mAb (30 mpk, once a week) on RKO tumor growth was similar to that of pembrolizumab (5 mpk, once every two weeks). The inhibitory effect of the combination of anti-CSF-lR AB21 mAb and anti-PD-1 antibody (pembrolizumab) on RKO tumor growth was statistically more effective, indicating a synergistic effect. These results clearly show that the anti-CSF-1R antibody of the present invention will be effective in treating CSF-1R-mediated diseases, such as cancer, or inflammatory or immune diseases. CSF-1R-mediated cancers include multiple myeloma, acute myeloid leukemia (AML), chronic myeloid leukemia (CML), prostate cancer, breast cancer, ovarian cancer, melanoma, glioblastoma multiforme, giant cell tumor of bone, non-small cell lung cancer, giant cell tumor of tendon sheath, kidney cancer, tumor metastasis to other tissues, myelofibrosis, and gastrointestinal stromal tumor. CSF-1R-mediated inflammatory or immune diseases are pigmented villonodular synovitis (PVNS), osteoporosis, inflammatory arthritis, or other inflammatory bone erosions.

[0127] The embodiments of the present invention have been described with reference to limited examples. Those skilled in the art should understand that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention, and other modifications and variations are possible without departing from the scope of the present invention. Therefore, the scope of the present invention should be limited only by the appended claims.

[0128] References

[0129] 1. Arango Duque G, Descoteaux A. Macrophage cytokines: involvement in immunity and infectious diseases. Front Immunol. 2014;5:491.

[0130] 2. Mantovani A, Sozzani S, Locati M, Allavena P, Sica A. Macrophage polarization: tumor-associated macrophages as a paradigm for polarized M2 mononuclear phagocytes. Trends Immunol. 2002;23(11):549-55.

[0131] 3. Pollard JW, Role of colony-stimulating factor-1 in reproduction and development. Mol Reprod Dev. 1997;46:54-61

[0132] 4. Dai XM, Ryan GR, Hapel AJ, Dominguez MG, Russell RG, Kapp S, Sylvestre V, Stanley ER. Blood. 2002;99:111-120

[0133] 5. Arango-Duque G, Descoteaux A. Macrophage cytokines: involvement in immunity and infectious diseases. Front Immunol. 2014;5:491.

[0134] 6. Allavena P, Sica A, Solinas G., Porta C., Mantovani A. The inflammatory micro-environment in tumor progression: the role of tumor-associated macrophages. Crit Rev Oncol Hematol. 2008;66:1.

[0135] 7. Mantovani A, Bottazzi B., Colotta F., Sozzani S, Ruco L. The origin and function of tumor-associated macrophages. Immunol Today. 1992;13:265.

[0136] 8. Stanley ER, Chitu V: CSF-1 receptor signaling in myeloid cells. Cold Spring Harb Perspect Biol. 2014;6.

[0137] 9. Pedersen MB, Danielsen AV, Hamilton-Dutoit SJ, Bendix K, Norgaard P, Moller MB, Steiniche T, d'Amore F. High intratumoral macrophage content is an adverse prognostic feature in anaplastic large cell lymphoma. Histopathology. 2014;65:490.

[0138] 10. Zhang QW, Liu L, Gong CY, Shi HS, Zeng YH, Wang XZ, Zhao YW, Wei YQ. Prognostic significance of tumor-associated macrophages in solid tumor: a Meta-analysis of the literature. PLoS One. 2012;7:e50946. Wan, P.T.C. et al., Mechanism of Activation of the RAF-ERK Signaling Pathway by Oncogenic Mutations of B-RAF. Cell, 2004. 116(6):855.

[0139] 11. Chockalingam S, Ghosh SS. Macrophage colony-stimulating factor and cancer: a review. Tumour Biol, 2014, 35:10635-10644

[0140] 12. Stanley ER. The macrophage colony-stimulating factor, CSF-1. Methods Enzymol, 1985, 116: 564-587

[0141] 13. Laoui D, Van Overmeire E, DeBaetselier P, Van Ginderachter JA, Raes G. Functional relationship between tumor-associated macrophages and macrophage colony-stimulating factor as contributors to cancer progression. Front Immunol, 2014, 5: 489

[0142] 14. Joyce JA, Pollard JW. Microenvironmental regulation of metastasis. Nat Rev Cancer, 2009, 9: 239-252

[0143] 15. Qian BZ, Pollard JW. Macrophage diversity enhances tumor progression and metastasis. Cell, 2010, 141: 39-51

[0144] 16. Strachan DC, Ruffell B, Oei Y, Bissell MJ, Coussens LM, Pryer N, Daniel D. CSF1R inhibition delays cervical and mammary tumor growth in murine models by attenuating the turnover of tumor-associated macrophages and enhancing infiltration by CD8 T cells. Oncoimmunology, 2013, 2: e26968

[0145] 17. Noy R, Pollard JW. Tumor-associated macrophages: from mechanisms to therapy. Immunity, 2014, 41: 49-61

[0146] 18. Zhu Y, Knolhoff BL, Meyer MA, Nywening TM, West BL, Luo J, Wang-Gillam A, Goedegebuure SP, Linehan DC, DeNardo DG. CSF1 / CSF1R blockade reprograms tumor-infiltrating macrophages and improves response to T-cell checkpoint immunotherapy in pancreatic cancer models. Cancer Res, 2014, 74: 5057-5069

[0147] 19. Pyonteck SM, Akkari L, Schuhmacher AJ, Bowman RL, Sevenich L, Quail DF, Olson OC, Quick ML, Huse JT, Teijeiro V, Setty M, Leslie CS, Ooi Y, Pedraza A, Zhang J, Brennan CW, Sutton JC, Holland EC, Daniel D, Joyce JA. CSF-1R inhibition alters macrophage polarization and blocks glioma progression. Nat Med, 2013, 19: 1264-1272

[0148] 20. Mitchem JB, Brennan DJ, Knolhoff BL, Belt BA, Zhu Y, Sanford DE, Belaygorod L, Carpenter D, Collins L, Piwnica-Worms D, Hewitt S, Udupi GM, Gallagher WM, Wegner C, West BL, Wang-Gillam A, Godegbuhr P, Linehan DC, DeNardo DG. Targeting tumor-infiltrating macrophages decreases tumor-initiating cells, relieves immunosuppression, and improves chemotherapeutic responses. Cancer Res, 2013, 73: 1128-1141. Sequence Listing <110> Development Center for Biotechnology DCB-USA LLC <120> Anti-human CSF-1R antibody and its uses <130> DCB028-821PCT <150> US 62 / 779,455 <151> December 13, 2018 <160> 23 <170> PatentIn version 3.5 <210> 1 <211> 512 <212> PRT <213> Homo sapiens <400> 1 Met Gly Pro Gly Val Leu Leu Leu Leu Leu Val Ala Thr Ala Trp His 1 5 10 15 Gly Gln Gly Ile Pro Val Ile Glu Pro Ser Val Pro Glu Leu Val Val 20 25 30 Lys Pro Gly Ala Thr Val Thr Leu Arg Cys Val Gly Asn Gly Ser Val 35 40 45 Glu Trp Asp Gly Pro Pro Ser Pro His Trp Thr Leu Tyr Ser Asp Gly 50 55 60 Ser Ser Ser Ile Leu Ser Thr Asn Asn Ala Thr Phe Gln Asn Thr Gly 65 70 75 80 Thr Tyr Arg Cys Thr Glu Pro Gly Asp Pro Leu Gly Gly Ser Ala Ala 85 90 95 Ile His Leu Tyr Val Lys Asp Pro Ala Arg Pro Trp Asn Val Leu Ala 100 105 110 Gln Glu Val Val Val Phe Glu Asp Gln Asp Ala Leu Leu Pro Cys Leu 115 120 125 Leu Thr Asp Pro Val Leu Glu Ala Gly Val Ser Leu Val Arg Val Arg 130 135 140 Gly Arg Pro Leu Met Arg His Thr Asn Tyr Ser Phe Ser Pro Trp His 145 150 155 160 Gly Phe Thr Ile His Arg Ala Lys Phe Ile Gln Ser Gln Asp Tyr Gln 165 170 175 Cys Ser Ala Leu Met Gly Gly Arg Lys Val Met Ser Ile Ser Ile Arg 180 185 190 Leu Lys Val Gln Lys Val Ile Pro Gly Pro Pro Ala Leu Thr Leu Val 195 200 205 Pro Ala Glu Leu Val Arg Ile Arg Gly Glu Ala Ala Gln Ile Val Cys 210 215 220 Ser Ala Ser Ser Val Asp Val Asn Phe Asp Val Phe Leu Gln His Asn 225 230 235 240 Asn Thr Lys Leu Ala Ile Pro Gln Gln Ser Asp Phe His Asn Asn Arg 245 250 255 Tyr Gln Lys Val Leu Thr Leu Asn Leu Asp Gln Val Asp Phe Gln His 260 265 270 Ala Gly Asn Tyr Ser Cys Val Ala Ser Asn Val Gln Gly Lys His Ser 275 280 285 Thr Ser Met Phe Phe Arg Val Val Glu Ser Ala Tyr Leu Asn Leu Ser 290 295 300 Ser Glu Gln Asn Leu Ile Gln Glu Val Thr Val Gly Glu Gly Leu Asn 305 310 315 320 Leu Lys Val Met Val Glu Ala Tyr Pro Gly Leu Gln Gly Phe Asn Trp 325 330 335 Thr Tyr Leu Gly Pro Phe Ser Asp His Gln Pro Glu Pro Lys Leu Ala 340 345 350 Asn Ala Thr Thr Lys Asp Thr Tyr Arg His Thr Phe Thr Leu Ser Leu 355 360 365 Pro Arg Leu Lys Pro Ser Glu Ala Gly Arg Tyr Ser Phe Leu Ala Arg 370 375 380 Asn Pro Gly Gly Trp Arg Ala Leu Thr Phe Glu Leu Thr Leu Arg Tyr 385 390 395 400 Pro Pro Glu Val Ser Val Ile Trp Thr Phe Ile Asn Gly Ser Gly Thr 405 410 415 Leu Leu Cys Ala Ala Ser Gly Tyr Pro Gln Pro Asn Val Thr Trp Leu 420 425 430 Gln Cys Ser Gly His Thr Asp Arg Cys Asp Glu Ala Gln Val Leu Gln 435 440 445 Val Trp Asp Asp Pro Tyr Pro Glu Val Leu Ser Gln Glu Pro Phe His 450 455 460 Lys Val Thr Val Gln Ser Leu Leu Thr Val Glu Thr Leu Glu His Asn 465 470 475 480 Gln Thr Tyr Glu Cys Arg Ala His Asn Ser Val Gly Ser Gly Ser Trp 485 490 495 Ala Phe Ile Pro Ile Ser Ala Gly Ala His Thr His Pro Pro Asp Glu 500 505 510 <210> 2 <211> 123 <212> PRT <213> Mus musculus <400> 2 Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Glu Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Ser Phe Thr Gly Tyr 20 25 30 Asn Met Asn Trp Val Lys Gln Ser Asn Gly Lys Ser Leu Glu Trp Ile 35 40 45 Gly Asn Ile Asp Pro Tyr Tyr Gly Gly Thr Thr Tyr Asn Gln Lys Phe 50 55 60 Lys Gly Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr 65 70 75 80 Met Gln Leu Lys Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Arg Gly Asp Tyr Ser Gly Ser Ser Tyr Trp Tyr Phe Asp Val 100 105 110 Trp Gly Ala Gly Thr Thr Val Thr Val Ser Ser 115 120 <210> 3 <211> 107 <212> PRT <213> Mus musculus <400> 3 Asp Ile Gln Met Thr Gln Ser Ser Ser Tyr Leu Ser Val Ser Leu Gly 1 5 10 15 Gly Arg Val Thr Ile Thr Cys Lys Ala Ser Asp His Ile Asn Asn Trp 20 25 30 Leu Ala Trp Tyr Gln Gln Lys Pro Gly Asn Ala Pro Arg Leu Leu Ile 35 40 45 Ser Gly Ala Thr Ser Leu Glu Thr Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Lys Asp Tyr Thr Leu Ser Ile Thr Ser Leu Gln Thr 65 70 75 80 Glu Asp Val Val Thr Tyr Tyr Cys Gln Gln Tyr Trp Ser Thr Pro Phe 85 90 95 Thr Phe Gly Ser Gly Thr Lys Leu Glu Ile Lys 100 105 <210> 4 <211> 10 <212> PRT <213> Mus musculus <400> 4 Gly Tyr Ser Phe Thr Gly Tyr Asn Met Asn 1 5 10 <210> 5 <211> 17 <212> PRT <213> Mus musculus <400> 5 Asn Ile Asp Pro Tyr Tyr Gly Gly Thr Thr Tyr Asn Gln Lys Phe Lys 1 5 10 15 Gly <210> 6 <211> 13 <212> PRT <213> Mus musculus <400> 6 Gly Asp Tyr Ser Gly Ser Ser Tyr Trp Tyr Phe Asp Val 1 5 10 <210> 7 <211> 11 <212> PRT <213> Mus musculus <400> 7 Lys Ala Ser Asp His Ile Asn Asn Trp Leu Ala 1 5 10 <210> 8 <211> 7 <212> PRT <213> Mus musculus <400> 8 Gly Ala Thr Ser Leu Glu Thr 1 5 <210> 9 <211> 9 <212> PRT <213> Mus musculus <400> 9 Gln Gln Tyr Trp Ser Thr Pro Phe Thr 1 5 <210> 10 <211> 123 <212> PRT <213> Artificial Sequence <220> <223> Synthetic <400> 10 Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala 1 5 10 15 Thr Val Lys Ile Ser Cys Lys Val Ser Gly Tyr Ser Phe Thr Gly Tyr 20 25 30 Asn Met Asn Trp Val Gln Gln Ala Pro Gly Lys Gly Leu Glu Trp Met 35 40 45 Gly Asn Ile Asp Pro Tyr Tyr Gly Gly Thr Thr Tyr Asn Gln Lys Phe 50 55 60 Lys Gly Arg Val Thr Ile Thr Ala Asp Thr Ser Thr Asp Thr Ala Tyr 65 70 75 80 Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Thr Arg Gly Asp Tyr Ser Gly Ser Ser Tyr Trp Tyr Phe Asp Val 100 105 110 Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 11 <211> 123 <212> PRT <213> Artificial Sequence <220> <223> Synthetic <400> 11 Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala 1 5 10 15 Thr Val Lys Ile Ser Cys Lys Val Ser Gly Tyr Ser Phe Thr Gly Tyr 20 25 30 Asn Met Asn Trp Val Gln Gln Ala Pro Gly Lys Gly Leu Glu Trp Met 35 40 45 Gly Asn Ile Asp Pro Tyr Tyr Gly Gly Thr Thr Tyr Asn Gln Lys Phe 50 55 60 Lys Gly Lys Ala Thr Leu Thr Val Asp Lys Ser Thr Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Arg Gly Asp Tyr Ser Gly Ser Ser Tyr Trp Tyr Phe Asp Val 100 105 110 Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 12 <211> 123 <212> PRT <213> Artificial Sequence <220> <223> Synthetic <400> 12 Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Ile Ser Cys Lys Val Ser Gly Tyr Ser Phe Thr Gly Tyr 20 25 30 Asn Met Asn Trp Val Lys Gln Ala Pro Gly Lys Gly Leu Glu Trp Ile 35 40 45 Gly Asn Ile Asp Pro Tyr Tyr Gly Gly Thr Thr Tyr Asn Gln Lys Phe 50 55 60 Lys Gly Lys Ala Thr Leu Thr Val Asp Lys Ser Thr Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Arg Gly Asp Tyr Ser Gly Ser Ser Tyr Trp Tyr Phe Asp Val 100 105 110 Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 13 <211> 123 <212> PRT <213> Artificial Sequence <220> <223> Synthetic <400> 13 Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Ser Phe Thr Gly Tyr 20 25 30 Asn Met Asn Trp Val Lys Gln Ala Pro Gly Lys Gly Leu Glu Trp Ile 35 40 45 Gly Asn Ile Asp Pro Tyr Tyr Gly Gly Thr Thr Tyr Asn Gln Lys Phe 50 55 60 Lys Gly Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr 65 70 75 80 Met Gln Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Arg Gly Asp Tyr Ser Gly Ser Ser Tyr Trp Tyr Phe Asp Val 100 105 110 Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 14 <211> 107 <212> PRT <213> Artificial Sequence <220> <223> Synthetic <400> 14 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Lys Ala Ser Asp His Ile Asn Asn Trp 20 25 30 Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Leu 35 40 45 Tyr Gly Ala Thr Ser Leu Glu Thr Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Tyr Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Tyr Trp Ser Thr Pro Phe 85 90 95 Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys 100 105 <210> 15 <211> 107 <212> PRT <213> Artificial Sequence <220> <223> Synthesis <400> 15 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Leu Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Lys Ala Ser Asp His Ile Asn Asn Trp 20 25 30 Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Leu 35 40 45 Ser Gly Ala Thr Ser Leu Glu Thr Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Tyr Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Tyr Trp Ser Thr Pro Phe 85 90 95 Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys 100 105 <210> 16 <211> 107 <212> PRT <213> Artificial Sequence <220> <223> Synthesis <400> 16 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Leu Gly 1 5 10 15 Gly Arg Val Thr Ile Thr Cys Lys Ala Ser Asp His Ile Asn Asn Trp 20 25 30 Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Leu 35 40 45 Tyr Gly Ala Thr Ser Leu Glu Thr Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Tyr Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Val Ala Thr Tyr Tyr Cys Gln Gln Tyr Trp Ser Thr Pro Phe 85 90 95 Thr Phe Gly Ser Gly Thr Lys Leu Glu Ile Lys 100 105 <210> 17 <211> 6 <212> PRT <213> Homo sapiens <400> 17 Ser Val Asp Val Asn Phe 1 5 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 18 gcagcagatc caggggccag 20 <210> 19 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Synthesis <400> 19 gtggatagac agatgggg 18 <210> 20 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Synthesis <400> 20 gaaatcagac acaccagtg 19 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthesis <400> 21 gtgggagtgg acttgggctg 20 <210> 22 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Synthesis <400> 22 gatgtctttg gggtagaagt tgttc 25 <210> 23 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Synthesis <400> 23 ctgctcactg gatggtggga agatgg 26

Claims

1. An antibody or antigen-binding fragment thereof that specifically binds to human CSF-1R, comprising: A heavy chain variable domain comprising an HCDR1 region as shown in SEQ ID NO: 4, an HCDR2 region as shown in SEQ ID NO: 5, and an HCDR3 region as shown in SEQ ID NO: 6; and A light chain variable domain comprising an LCDR1 region as shown in SEQ ID NO: 7, an LCDR2 region as shown in SEQ ID NO: 8, and an LCDR3 region as shown in SEQ ID NO:

9.

2. The antibody or antigen-binding fragment thereof according to claim 1, wherein the heavy chain variable domain comprises the sequence of SEQ ID NO: 2, 10, 11, 12 or 13, and wherein the light chain variable domain comprises the sequence of SEQ ID NO: 3, 14, 15 or 16.

3. The antibody or antigen-binding fragment thereof according to claim 1, wherein the antibody or antigen-binding fragment specifically binds to an epitope in the extracellular domain of human CSF-1R, wherein the extracellular domain of human CSF-1R has the amino acid sequence of SEQ ID NO: 1, and the epitope has the following sequence: Ser-Val-Asp-Val-Asn-Phe (SEQ ID NO: 17).

4. The antibody or antigen-binding fragment thereof according to claim 1, wherein the antibody or antigen-binding fragment inhibits CSF-1-induced signal transduction and / or IL-34-induced signal transduction.

5. The antibody or antigen-binding fragment thereof according to claim 1, wherein the antibody or antigen-binding fragment inhibits CSF-1R signal transduction.

6. The antibody or antigen-binding fragment thereof according to claim 1, which further comprises a drug conjugate covalently linked to the antibody or antigen-binding fragment to form an antibody-drug conjugate (ADC).

7. The antibody or antigen-binding fragment thereof according to claim 1, wherein the antibody or antigen-binding fragment is linked to a second antibody-binding fragment to form a bispecific antibody.

8. The antibody or antigen-binding fragment thereof according to claim 1, wherein the antigen-binding fragment is a Fab, F(ab')2 or scFv fragment.

9. A pharmaceutical composition for treating a disease mediated by CSF-1R, CSF-1 and / or IL-34, wherein the pharmaceutical composition comprises the antibody or antigen-binding fragment thereof according to any one of claims 1 to 8, and a pharmaceutically acceptable carrier.

10. The pharmaceutical composition according to claim 9, wherein the disease is cancer.

11. The pharmaceutical composition according to claim 10, wherein the cancer is selected from the group consisting of: multiple myeloma, acute myeloid leukemia (AML), chronic myeloid leukemia (CML), prostate cancer, breast cancer, ovarian cancer, melanoma, glioblastoma multiforme, giant cell tumor of bone, non-small cell lung cancer, giant cell tumor of tendon sheath, renal cancer, myelofibrosis, and gastrointestinal stromal tumor.

12. The pharmaceutical composition according to claim 9, wherein the disease is an inflammatory or immune disease.

13. The pharmaceutical composition according to claim 12, wherein the inflammatory or immune disease is pigmented villonodular synovitis (PVNS), osteoporosis, or inflammatory arthritis.

14. Use of a pharmaceutical composition according to claim 9 in the preparation of a medicament for treating a disease mediated by CSF-1R, CSF-1, and / or IL-34, wherein the disease is colorectal cancer.

Images