Delivery and use of CRISPR-Cas systems, vectors and compositions for liver targeting and treatment

Abstract

The present invention provides delivery, engineering and optimization of systems, methods and compositions for manipulating the activity of sequences and / or target sequences. A delivery system and a tissue or organ targeted as a site for delivery are provided. Also provided are vectors and vector systems and methods for designing and using such vectors, wherein some of these vectors and vector systems encode one or more components of CRISPR complexes. Also provided are methods for guiding the formation of CRISPR complexes in eukaryotic cells to ensure enhanced specificity for target identification and avoid toxicity, and to edit or modify the target site in the genomic locus of interest in order to change or improve the state of a disease or condition.

Description

[0001] Related applications and references

[0002] Claiming priority for U.S. purposes from U.S. Provisional Patent Applications 61 / 836,123 filed June 17, 2013, 61 / 847,537 filed July 17, 2013, 61 / 862,355 filed August 5, 2013, 61 / 871,301 filed August 28, 2013, 61 / 915,325 filed December 12, 2013, 61 / 979,733 filed April 15, 2014, and PCT / US2013 / 074667 filed December 12, 2013, which is also a continuation-in-part application; and as may be allowed under U.S. law, U.S. equivalents or national phase applications hereto may further claim and claim priority to PCT / US2013 / 074667 and PCT / US The priority of the application from which priority is claimed in 2013 / 074667.

[0003] The foregoing applications, and all documents cited therein or during their prosecution ("application cited documents"), and all documents cited or referenced in these application cited documents, and all documents cited or referenced herein ("herein cited documents"), and all documents cited or referenced in the herein cited documents, together with any manufacturer's instructions, descriptions, product specifications, and product sheets for any products mentioned herein or incorporated by reference in any document herein, are hereby incorporated by reference and may be employed in the practice of the present invention. More specifically, all referenced documents are incorporated by reference to the same extent as if each individual document was specifically and individually indicated to be incorporated by reference. Field of the Invention

[0004] The present invention generally relates to the delivery, engineering, optimization and therapeutic applications of systems, methods and compositions for controlling gene expression involving sequence targeting, such as genomic interference or gene editing involving clustered regularly interspaced short palindromic repeats (CRISPR) and its components. Specifically, the present invention relates to aspects related to the following items: delivery to the liver for gene therapy for liver disorders, understanding liver or liver tissue gene function and creating liver models. The liver or liver tissue includes parenchymal cells commonly referred to as hepatocytes. The liver or liver tissue can also be liver cells that are non-parenchymal cells, especially when such cells constitute 40% of the total number of liver cells, even if only 6.5% of its volume; and examples of such non-parenchymal liver cells or tissues include sinusoidal endothelial cells, Kupffer cells and hepatic stellate cells. The cells of the liver express one or more liver gene products. Advantageously, the present invention is practiced relative to hepatocytes or liver or liver tissue comprising hepatocytes.

[0005] Statement Regarding Federally Funded Research

[0006] This invention was made with government support under an NIH Pioneer Award (1DP1MH100706) awarded by the National Institutes of Health. The U.S. Government has certain rights in this invention. Background of the Invention

[0007] The latest progress in genome sequencing technology and analytical methods has significantly accelerated the ability to catalog and map the genetic factors associated with a wide range of biological functions and diseases. Accurate genome targeting technology is needed for making the systematic reverse engineering of causal genetic variations possible and promoting synthetic biology, biotechnology applications and medical applications by allowing the selective interference of individual genetic elements. Although genome editing technologies such as designer zinc fingers, transcription activator-like effectors (TALEs), or homing meganucleases are available for generating targeted genome interference, there is still a need for new genome engineering technologies that are affordable, easy to establish, scalable and convenient for targeting multiple positions in the eukaryotic genome. SUMMARY OF THE INVENTION

[0008] The CRISPR-Cas system does not require the production of custom proteins for target-specific sequences, but rather a single Cas enzyme can be programmed by short RNA molecules that recognize specific DNA targets. Adding the CRISPR-Cas system to the repertoire of genome sequencing technologies and analytical methods can significantly simplify this methodology and improve the ability to catalog and map genetic factors associated with a wide range of biological functions and diseases. In order to utilize the CRISPR-Cas system for genome editing effectively and without deleterious effects, it is crucial to understand aspects such as the engineering, optimization, and cell type / tissue / organ specific delivery of these genome engineering tools, which are aspects of the claimed invention.

[0009] There is an urgent need for alternative and robust systems and techniques for targeting nucleic acid sequences with a wide range of applications. Various aspects of the present invention address this need and provide related advantages. An exemplary CRISPR complex includes a CRISPR enzyme complexed with a guide sequence that hybridizes or is hybridizable to a target sequence within a target polynucleotide. The guide sequence is linked to a tracr mate sequence that, in turn, hybridizes to a tracr sequence.

[0010] In one aspect, the present invention provides methods using one or more elements of the CRISPR-Cas system. The CRISPR complex of the present invention provides an effective means for modifying target polynucleotides. The CRISPR complex of the present invention has a variety of practical applications, including modification (e.g., deletion, insertion, translocation, inactivation, activation) of target polynucleotides in various cell types in various tissues and organs. Because of this, the CRISPR complex of the present invention has a broad spectrum of applications in, for example, gene or genome editing, gene therapy, drug discovery, drug screening, disease diagnosis, and prognosis. In vivo, in vitro, and ex vivo uses are envisioned.

[0011] Aspects of the invention relate to Cas9 enzymes with improved liver targeting specificity that are smaller in length than a wild-type Cas9 enzyme and nucleic acid molecules encoding the same, and chimeric Cas9 enzymes in a CRISPR-Cas9 system with a guide RNA having optimized activity, as well as methods for improving the targeting specificity of a Cas9 enzyme or designing a CRISPR-Cas9 system, the methods comprising designing or preparing a guide RNA with optimized activity and / or selecting or preparing a Cas9 enzyme that is smaller in size or length than wild-type Cas9, thereby making packaging of the nucleic acid encoding it into a delivery vector more advanced (because less of it is encoded in the delivery vector than wild-type Cas9), and / or generating a chimeric Cas9 enzyme.

[0012] Also provided are uses of the sequences, vectors, enzymes or systems of the invention in medicine. Also provided are uses of the sequences, vectors, enzymes or systems of the invention in gene or genome editing. This relates to liver tissue or cells, whether in vivo or in vitro,

[0013] In other aspects of the present invention, the Cas9 enzyme may include one or more mutations and may be used as a universal DNA binding protein with or without fusion to a functional domain. These mutations may be artificially introduced mutations or acquired and lost function mutations. These mutations may include, but are not limited to, mutations in one of the catalytic domains (D10 and H840) in RuvC and HNH catalytic domains, respectively. Other mutations have been characterized and may be used in one or more compositions of the present invention. In one aspect of the present invention, the mutated Cas9 enzyme may be fused to a protein domain, such as a transcriptional activation domain. In one aspect of the present invention, the transcriptional activation domain may be VP64. In other aspects of the present invention, the transcriptional repressor domain may be KRAB or SID4X. Other aspects of the present invention relate to fused to the Cas9 enzyme of the mutation on the domain, including, but not limited to, transcriptional activators, repressors, recombinases, transposases, histone remodelers, demethylases, DNA methyltransferases, cryptochromes, light-inducible / controllable domains, or chemically inducible / controllable domains.

[0014] In a further embodiment, the invention provides methods for generating mutant tracrRNA and direct repeat sequences or mutant chimeric guide sequences that allow for enhanced performance of these RNAs in cells. Aspects of the invention also provide for the selection of such sequences.

[0015] Aspects of the present invention also provide methods for simplifying the cloning and delivery of components of the CRISPR complex. In a preferred embodiment of the present invention, a suitable promoter, such as the U6 promoter, is amplified together with a DNA oligonucleotide and added to the guide RNA. The resulting PCR product is then transfected into cells to drive the expression of the guide RNA. Aspects of the present invention also relate to guide RNAs that are transcribed in vitro or ordered from a synthesis company and directly transfected.

[0016] In one aspect, the present invention provides methods for increasing activity by using a more active polymerase. In a preferred embodiment, expression of these guide RNAs under the control of a T7 promoter is driven by expression of the T7 polymerase in the cell. In an advantageous embodiment, the cell is a eukaryotic cell. In a preferred embodiment, the eukaryotic cell is a human cell. In a more preferred embodiment, the human cell is a patient-specific cell.

[0017] In one aspect, the present invention provides a method for reducing the toxicity of a Cas enzyme. In certain aspects, the Cas enzyme is any Cas9 as described herein, such as any naturally occurring bacterial Cas9 and any chimera, mutant, homolog or ortholog. In a preferred embodiment, the Cas9 is delivered to the cell in the form of mRNA. This allows transient expression of the enzyme, thereby reducing toxicity. In another preferred embodiment, the present invention also provides a method for expressing Cas9 under the control of an inducible promoter and a construct used therein.

[0018] On the other hand, the present invention provides a method for improving the in vivo application of the CRISPR-Cas system. In the preferred embodiment, the Cas enzyme is the wild-type Cas9 described herein or any modified version, including any naturally occurring bacterial Cas9 and any chimera, mutant, homolog or ortholog. An advantageous aspect of the present invention provides a selection of Cas9 homologs that are easily packaged into viral vectors for delivery. Cas9 orthologs typically share a common structure of 3-4 RuvC domains and one HNH domain. The 5'most RuvC domain cuts the non-complementary chain, while the HNH domain cuts the complementary chain. All symbols are with respect to the guide sequence.

[0019] The catalytic residues in the 5' RuvC domain are identified by comparison of the homology of the Cas9 of interest with other Cas9 orthologs (from Streptococcus pyogenes type II CRISPR site, Streptococcus thermophilus CRISPR Site 1, Streptococcus thermophilus CRISPR site 3, and Franciscilla novicida type II CRISPR site), and the conserved Asp residue (D10) is mutated to alanine to convert Cas9 into a complementary chain nicking enzyme. Similarly, the conserved His and Asn residues in the HNH domain are mutated to alanine to convert Cas9 into a non-complementary chain nicking enzyme. In certain embodiments, both sets of mutations can be performed to convert Cas9 into a non-cutting enzyme.

[0020] In some embodiments, the CRISPR enzyme is a type I or type III CRISPR enzyme, preferably a type II CRISPR enzyme. This type II CRISPR enzyme can be any Cas enzyme. The preferred Cas enzyme can be identified as Cas9, as this can refer to the general class of enzymes that share homology with the largest nuclease with multiple nuclease domains from the type II CRISPR system. Most preferably, the Cas9 enzyme is from or derived from spCas9 or saCas9. By derived, applicants mean that the derived enzyme is largely based on the meaning of having a high sequence homology to the wild-type enzyme, but it has been mutated (modified) in some aspects as described herein.

[0021] It should be understood that the terms Cas and CRISPR enzyme are generally used interchangeably herein unless otherwise indicated. As mentioned above, many of the residue numbers used herein refer to the Cas9 enzyme from the type II CRISPR locus in Streptococcus pyogenes. However, it should be understood that the present invention includes more Cas9s from other microbial species, such as SpCas9, SaCas9, St1Cas9, etc. Additional examples are provided herein. A skilled person will be able to determine the appropriate corresponding residues in Cas9 enzymes other than SpCas9 by comparing relevant amino acid sequences. Therefore, where a specific amino acid replacement refers to the use of SpCas9 numbering, then, unless the context clearly indicates, this is not intended to refer to other Cas9 enzymes, and the present disclosure is intended to cover corresponding modifications in other Cas9 enzymes. SaCas9 is particularly preferred.

[0022] Examples of codon-optimized sequences that are, in this context, optimized for humans (i.e., optimized for expression in humans) are provided herein, for example, see the SaCas9 human codon-optimized sequence. While this is preferred, it will be appreciated that other examples are possible, and codon optimization for host species other than humans or for specific organs (such as the brain) is known.

[0023] In another embodiment, the present invention provides methods for enhancing the function of Cas9 by generating chimeric Cas9 proteins. Chimeric Cas9 proteins Chimeric Cas9 can be new Cas9s containing fragments from more than one naturally occurring Cas9. These methods can include fusing the N-terminal fragment of one Cas9 homolog to the C-terminal fragment of another Cas9 homolog. These methods also allow for the selection of new properties exhibited by these chimeric Cas9 proteins.

[0024] It should be understood that in the methods of the present invention, where the organism is an animal or plant, the modification can be performed ex vivo or in vitro, such as in cell culture, and in some cases not in vivo. In other embodiments, it can be performed in vivo.

[0025] In one aspect, the present invention provides a method for modifying an organism or non-human organism by manipulating a target sequence in a genomic locus of interest, the method comprising:

[0026] Delivery of a non-naturally occurring or engineered composition comprising:

[0027] A)-I. CRISPR-Cas system chimeric RNA (chiRNA) polynucleotide sequence, wherein the polynucleotide sequence comprises:

[0028] (a) a guide sequence capable of hybridizing to a target sequence in a eukaryotic cell,

[0029] (b) tracr mate sequence, and

[0030] (c) tracr sequence, and

[0031] II. a polynucleotide sequence encoding a CRISPR enzyme comprising at least one or more nuclear localization sequences,

[0032] Among them, (a), (b) and (c) are arranged in a 5' to 3' direction,

[0033] wherein upon transcription, the tracr mate sequence hybridizes to the tracr sequence and the guide sequence directs sequence-specific binding of the CRISPR complex to the target sequence, and

[0034] wherein the CRISPR complex comprises a CRISPR enzyme complexed with (1) the guide sequence that is hybridized or hybridizable to the target sequence, and (2) the tracr mate sequence that is hybridized or hybridizable to the tracr sequence, and the polynucleotide sequence encoding the CRISPR enzyme is DNA or RNA,

[0035] or

[0036] (B)I. A polynucleotide comprising:

[0037] (a) a guide sequence capable of hybridizing to a target sequence in a eukaryotic cell, and

[0038] (b) at least one or more tracr mate sequences,

[0039] II. a polynucleotide sequence encoding a CRISPR enzyme, and

[0040] III. a polynucleotide sequence comprising a tracr sequence,

[0041] wherein upon transcription, the tracr mate sequence hybridizes to the tracr sequence and the guide sequence directs sequence-specific binding of the CRISPR complex to the target sequence, and

[0042] wherein the CRISPR complex comprises a CRISPR enzyme complexed with (1) the guide sequence that is hybridized or hybridizable to the target sequence, and (2) the tracr mate sequence that is hybridized or hybridizable to the tracr sequence, and the polynucleotide sequence encoding the CRISPR enzyme is DNA or RNA.

[0043] In some embodiments, the second alternative above is preferred. However, in most, but not all, aspects of the present disclosure, the first alternative is particularly preferred.

[0044] It should be understood that the present application is directed to the liver, whether the organ itself or the tissue therein, or just one or more liver cells, such as hepatocytes. Primary hepatocytes are preferred. The liver cells can be contained in vertebrates (patients (in the sense of animals in need of CRISPR-directed gene therapy) or model organisms), or can be in cell culture, organoids or other ex vivo tissues (e.g., as "liver on a chip" in which hepatocytes are seeded and grown on a scaffold). Harvested hepatocytes from non-transplanted organs are also useful targets. With the development of 3-D printing technology applied to biology, printed tissues are within grasp, and it is entirely feasible that liver cells or tissues printed in a manner to establish organoids or printed on a chip can also be targeted.

[0045] Therefore, a model organism comprising liver cells such as hepatocytes is provided, to which the CRISPR-Cas system of the present invention has been delivered. Similarly, an in vitro collection of two or more liver cells such as hepatocytes is also provided, to which the CRISPR-Cas system of the present invention has been delivered. Such collections can include liver organs, liver organoids, liver cells (e.g., like 'liver on a chip') occupying a support. A method for creating such a model or collection is also provided.

[0046] Specifically, such liver cells may express or may include polynucleotides capable of expressing Cas enzymes. As discussed herein, this has the following advantages: a ready-to-use model for interrogating gene function by gene interference (including knockdown) is provided. This is particularly useful in studying liver disorders (such as amyloidosis and others listed herein) and broader disorders (such as obesity) in which the liver is the only influencing element in the body.

[0047] Also provided herein are methods for interrogating liver gene function. These typically involve delivering the CRISPR-Cas system to liver cells in vivo or ex vivo. However, if the cells already contain Cas, whether expressed as a protein or encoded by a polynucleotide already contained within the cell, only the CRISPR polynucleotide needs to be delivered. The method can include extraction from the liver and, optionally, reinsertion back into the liver. By delivery, it is meant that the polynucleotide is actually physically delivered to the cell nucleus and transfected. Therefore, delivery should also be interpreted as including transfection, unless otherwise clearly indicated.

[0048] Also provided is a method for inducing gene interference in one or more liver cells, the method comprising transducing a first cell population with a CRISPR-Cas system according to the present invention, thereby changing the genome of the first cell population to obtain a second cell population. The method can be performed in vitro or in vitro, for example, in cell culture or in an in vitro or in vitro model (such as an organoid or 'liver on a chip'). Alternatively, the method can be in vivo, in which case it can also include isolating the first cell population from the subject and transplanting (back) the second cell population into the subject. Gene interference can be for one or more, or two or more, or three or more, or four or more genes. The gene interference can be a reduction in gene function (i.e., the activity of the encoded gene product). This can be, for example, induced by changing the genome of the first cell population to obtain a second cell population, wherein the second cell population has a defective genotype, such as a monogenic disorder not present in the first cell population. This may require a corresponding repair template, as discussed herein, to provide a defective sequence, or it can be by the induction of DSB. Specifically, the gene interference is gene knockdown.

[0049] Alternatively, the gene disruption can be an increase in gene function (i.e., the activity of the encoded gene product). This can be induced, for example, by altering the genome of a first cell population to obtain a second cell population, wherein the first cell population has a defective genotype, such as a monogenic disorder that is not present in (i.e., corrected in) the second cell population. This may require a corresponding repair template, as discussed herein, to provide the corrected sequence.

[0050] If a multiplex is used, then reduction of one or more genes and increase of one or more genes is contemplated. This can be achieved by providing one or more guides (in a multiplex) and corresponding repair templates for reduction of function, while one or more guides and their corresponding templates for increase of function.

[0051] Also provided is a method for interrogating the function of one or more genes in one or more liver cells, the method comprising determining a change in expression of one or more genes in a first liver cell population, inducing gene perturbation in the first population to provide a second population having an altered genome (or genotype), and determining a change in expression of one or more genes in the second liver cell population, thereby interrogating the function of the one or more genes.

[0052] A model and a method for creating the model are also provided. The model can be an animal comprising a liver (in vivo model), or it can be an in vitro or in vitro model, such as a liver organoid or 'liver on a chip' or a collection of liver cells (such as on a scaffold), as described herein. These liver cells of any model will preferably be transfected with Cas9. Therefore, a model comprising one or more liver cells containing CRISPR enzymes (preferably Cas9, such as Sa or SpCas9) is specifically provided. The model cells may have been transfected or transduced with a second regulatory element provided herein, which is a second regulatory element operably linked to an enzyme coding sequence encoding a CRISPR enzyme, and the CRISPR enzyme includes at least one or more nuclear localization sequences (NLS). The model can be an in vivo model as described above, or it can be an in vitro or in vitro model. Such a model allows for rapid interrogation of the function of one or more genes, because only the CRISPR-Cas system polynucleotide sequence (including one or more guide sequences targeting the one or more genes) needs to be delivered to disrupt the function of the gene. In other words, methods for interrogating gene function in the model can comprise delivering only the CRISPR-Cas system polynucleotide sequence (including the one or more guide sequences), Cas (CRISPR enzyme) already being provided in one or more cells of the model. Also provided are methods for creating such models, comprising transducing or transfecting one or more liver cells in a first liver cell population with a second regulatory element operably linked to an enzyme-coding sequence encoding a CRISPR enzyme comprising at least one or more nuclear localization sequences (NLS) as described herein, thereby providing one or more second liver cell populations comprising or expressing the CRISPR enzyme.

[0053] Also provided is a method for creating a gene perturbation model, particularly a gene knockdown model. These methods can typically include inducing the gene perturbation of one or more genes in a first cell population, as described herein, thereby providing a second cell population with a genome (or genotype) of change. The second cell population can then be seeded in, for example, a scaffold or on a chip, thereby providing an in vitro or in vitro model. Alternatively, the second population can be contained in an animal in vivo.

[0054] Methods of gene therapy are also envisioned. For example, correction of one or more defective genotypes (e.g., single point mutations) can be achieved by using the CRISPR-Cas system (including models) of the present invention discussed herein in liver cells. Monogenic disorders associated with the liver are particularly preferred and are exemplified herein, see Example 38, in which the CRISPR-Cas9 system target is ApoB (a lipid metabolism gene), which is effective in inducing phenotypic changes in vivo. Compositions for use in gene therapy are also provided.

[0055] Although various Cas enzymes are contemplated, Cas9 is particularly preferred, and we have shown particular efficacy for SaCas9 in the liver. If the Cas enzyme is a SaCas enzyme, the Tracr sequence from Sa is also preferred. In this case, a suitable PAM is NNGRR. For Streptococcus pyogenes Cas9 or derivative enzymes, a suitable PAM is 5'-NRG.

[0056] Although one guide can be used, so-called multiplexing with two, three, four or more guides is particularly useful in interrogating gene function and model creation (to provide multiple gene knockdowns), but also in gene therapy where multiple defective genotypes are to be corrected (multiple errors in a single gene, or more likely multiple errors distributed across several genes). Alternatively, multiplexing with two guides can be used for dual nickase approaches to reduce off-target effects or can be used to simply select multiple targets within a gene to ensure Cas recruitment. Triple and quadruple guides are preferred. References to genes herein can be interchangeable with genomic loci.

[0057] The intronic approach described here is also useful in this regard, where the guide is positioned within the Cas intron.

[0058] Preferred means of delivery include those described by Kanasty below, such as LNPs, especially where only the guide is to be delivered or it is to be delivered alone. However, viral vectors, including lentivirus and AAV, are generally preferred for the liver as they have been successful to date. Of these, AAV is preferred, and especially serotype 8, with AAV2 / 8 shown to be effective.

[0059] Some preferred targets, to the extent they are present in the liver or they are disorders of the liver, are metabolic disorders, such as any of the following: amyloid neuropathy (TTR, PALB); amyloidosis (APOA1, APP, AAA, CVAP, AD1, GSN, FGA, LYZ, TTR, PALB); cirrhosis (KRT18, KRT8, CIRH1A, NAIC, TEX292, KIAA1988); cystic fibrosis (CFTR, ABCC7, CF, MRP7); glycogen storage diseases (SLC2A2, GLUT2, G6PC, G6PT, G6PT1, GAA, LAMP2, LAMPB, AGL, GDE, GBE1, GYS2, PYGL, PFKM); hepatic adenoma, 142330 (TCF1, HNF1A, MODY3), liver failure, early onset and neurological disorders (SCOD1, SCO1), hepatic lipase deficiency (LIPC), hepatoblastoma, cancer and carcinomas (CTNNB1, PDGFRL, PDGRL, PRLTS, AXIN1, AXIN, CTNNB1, TP53, P53, LFS1, IGF2R, MPRI, MET, CASP8, MCH5); medullary cystic kidney disease (UMOD, HNFJ, FJHN, MCKD2, ADMCKD2); phenylketonuria (PAH, PKU1, QDPR, DHPR, PTS); polycystic kidney and liver disease (FCYT, PKHD1, ARPKD, PKD1, PKD2, PKD4, PKDTS, PRKCSH, G19P1, PCLD, SEC63). Other preferred targets include any one or more of the following, including one or more of the following: PCSK9; Hmgcr; SERPINA1; ApoB; and / or LDL.

[0060] It should be understood that methods for altering expression in the liver do not involve germline alteration, which may be excluded on ethical grounds. Indeed, while transfection of stem cells is contemplated and certainly preferred in some embodiments, primary hepatocytes are particularly preferred, particularly when they can show or be stimulated to show some regeneration.

[0061] Type II CRISPRS are particularly preferred, especially for use in eukaryotes, as in the case of the present invention, where the liver is only found in eukaryotes, particularly vertebrates (in any case).

[0062] The use of CRISPR-Cas systems to induce phenotypic changes is particularly advantageous, especially in vivo. We have shown this in this application.

[0063] When therapeutic applications are envisioned, or for other genome engineering in the liver, it will be understood that correction is required after the incision or cutting of the genomic DNA target, and then correction via the HDR approach is preferred. For gene knockdown, NHEJ is advantageous, however, correction via the HDR approach is preferred for therapy. In such cases, it is preferred to deliver a repair template. This is most preferably ssDNA, although it is also possible for RNA to provide the corresponding DNA template via a retroviral vector. The skilled person can easily put the present invention into practice based on the teachings of the knowledge contributed to this art; and it should be mentioned in this regard that the skilled person can easily understand and implement considerations about the length of the homology arms based on the teachings of the knowledge contributed to this art. The patent applications and publications mentioned include those of Zhang, the inventor of this article, including those cited herein. The repair template is preferably co-delivered with one or more elements of the CRISPR-Cas system.

[0064] Also provided is a method of altering the expression of at least one liver gene product, the method comprising introducing into a eukaryotic liver cell, such as a hepatocyte, (which cell contains and expresses a DNA molecule having a target sequence and encoding the gene product), an engineered, non-naturally occurring Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-CRISPR associated (Cas) (CRISPR-Cas) system comprising one or more vectors comprising:

[0065] a) a first regulatory element operable in a eukaryotic cell, operably linked to at least one nucleotide sequence encoding a CRISPR-Cas system guide RNA that hybridizes to a target sequence, and

[0066] b) a second regulatory element operable in a eukaryotic cell, operably linked to a nucleotide sequence encoding a Type-II Cas9 protein,

[0067] wherein components (a) and (b) are located on the same or different vectors of the system, whereby the guide RNA targets the target sequence and the Cas9 protein cleaves the DNA molecule, whereby the expression of at least one liver gene product is altered; and wherein the Cas9 protein and the guide RNA do not naturally occur together.

[0068] References hereinafter to targets are to be understood as referring to hepatic targets or genes that are otherwise expressed in the liver, unless clearly indicated otherwise.

[0069] Any or all of the polynucleotide sequence encoding the CRISPR enzyme, the guide sequence, the tracr mate sequence, or the tracr sequence may be RNA. The polynucleotide comprising the sequence encoding the CRISPR enzyme, the guide sequence, the tracr mate sequence, or the tracr sequence may be RNA and may be delivered via liposomes, nanoparticles, exosomes, microvesicles, or a gene gun.

[0070] It will be understood that where a polynucleotide is referred to as RNA and is considered to 'comprise' a feature of such a tracr mate sequence, the RNA sequence includes the feature. Where the polynucleotide is DNA and is considered to comprise a feature of such a tracr mate sequence, the DNA sequence is or can be transcribed into RNA that includes the feature in question. Where the feature is a protein, such as a CRISPR enzyme, reference to the DNA or RNA sequence is or can be translated (and where the DNA is first transcribed).

[0071] Thus, in certain embodiments, the present invention provides a method for modifying the liver of an organism (e.g., a mammal including a human or a non-human mammal or organism) by manipulating a target sequence in a genomic locus of interest, the method comprising delivering a non-naturally occurring or engineered composition comprising a viral or plasmid vector system comprising one or more viral or plasmid vectors operably encoding a composition for expression thereof, wherein the composition comprises: (A) a non-naturally occurring or engineered composition comprising a vector system comprising one or more vectors comprising: I. a first regulatory element operably linked to a CRISPR-Cas system chimeric RNA (chiRNA) polynucleotide sequence, wherein the polynucleotide sequence comprises (a) a guide sequence capable of hybridizing to a target sequence in a eukaryotic cell, (b) a tracr mate sequence, and (c) a tracr sequence, and II. a second regulatory element operably linked to an enzyme-coding sequence encoding a CRISPR enzyme comprising at least one or more nuclear localization sequences (or optionally at least one or more nuclear localization sequences, as in some embodiments no NLS may be involved), wherein (a), (b) and (c) are arranged in a 5' to 3' orientation, wherein components I and II are located on the same or different vectors of the system, wherein when transcribed, the tracr mate sequence hybridizes to the tracr sequence and the guide sequence directs sequence-specific binding of a CRISPR complex to the target sequence, and wherein the CRISPR complex comprises a CRISPR enzyme complexed with (1) the guide sequence that is hybridized or hybridizable to the target sequence, and (2) the tracr mate sequence that is hybridized or hybridizable to the tracr sequence, or (B) a non-naturally occurring or engineered composition comprising a vector system comprising one or more vectors comprising I. a first regulatory element operably linked to (a) a guide sequence capable of hybridizing to a target sequence in a eukaryotic cell, and (b) at least one or more tracr mate sequences, II. a second regulatory element operably linked to an enzyme-coding sequence encoding a CRISPR enzyme, and III.a third regulatory element operably linked to the tracr sequence, wherein components I, II, and III are located on the same or different vectors of the system, wherein when transcribed, the tracr mate sequence hybridizes to the tracr sequence and the guide sequence directs sequence-specific binding of the CRISPR complex to the target sequence, and wherein the CRISPR complex comprises a CRISPR enzyme complexed with (1) the guide sequence that is hybridized or hybridizable to the target sequence, and (2) the tracr mate sequence that is hybridized or hybridizable to the tracr sequence. In some embodiments, components I, II, and III are located on the same vector. In other embodiments, components I and II are located on the same vector, and component III is located on another vector. In other embodiments, components I and III are located on the same vector, and component II is located on another vector. In other embodiments, components II and III are located on the same vector, and component I is located on another vector. In other embodiments, components I, II, and III are each located on a different vector. The present invention also provides a viral or plasmid vector system as described herein.

[0072] Preferably, the vector can be a viral vector, such as a lentiviral or baculoviral or preferably an adenoviral / adeno-associated viral vector, but other delivery methods are also known (such as yeast systems, microvesicles, gene guns / means of attaching vectors to gold nanoparticles) and are provided. In some embodiments, one or more viral vectors or plasmid vectors can be delivered via liposomes, nanoparticles, exosomes, microvesicles, or a gene gun.

[0073] By manipulating the target sequence, the applicant also intends epigenetic manipulation of the target sequence. This can be manipulation of the chromatin state of the target sequence, such as by modifying the methylation state of the target sequence (i.e., methylation or methylation pattern or addition or removal of CpG islands), histone modification, thereby increasing or decreasing the accessibility of the target sequence, or by 3D folding.

[0074] It should be understood that, in the case of a method of modifying an organism or mammal (including humans or non-human mammals or organisms) by manipulating a target sequence in a genomic locus of interest, this is applicable to the organism (or mammal) as a whole or simply a single cell or cell population from such an organism (if the organism is multicellular). In the case of humans, for example, applicants particularly contemplate single cells or cell populations, and these cells may preferably be modified ex vivo and then reintroduced. In this case, a biopsy or other tissue or biological fluid sample may be necessary. In this regard, stem cells are also particularly preferred. However, in vivo embodiments are of course also contemplated.

[0075] In certain embodiments, the present invention provides a method of treating or inhibiting a condition caused by a defect in a target sequence at a genomic locus of interest in a subject (e.g., a mammal or human) or a non-human subject (e.g., a mammal) in need thereof, the method comprising modifying the subject or non-human subject by manipulating the target sequence, and wherein the condition is susceptible to treatment or inhibition by manipulation of the target sequence comprising providing a treatment comprising: delivering a non-naturally occurring or engineered composition comprising an AAV or lentiviral vector system, the vector system comprising one or more AAV or lentiviral vectors operably encoding a composition for expression thereof, wherein upon expression the target sequence is manipulated by the non-naturally occurring or engineered composition, wherein the non-naturally occurring or engineered composition comprises: (A) a non-naturally occurring or engineered composition comprising a vector system comprising one or more vectors comprising: I. a first regulatory element operably linked to a CRISPR-Cas system chimeric RNA (chiRNA) polynucleotide sequence, wherein the polynucleotide sequence comprises (a) a guide sequence capable of hybridizing to a target sequence in a eukaryotic cell, (b) a tracr mate sequence, and (c) a tracr sequence, and II. a second regulatory element operably linked to an enzyme-coding sequence encoding a CRISPR enzyme comprising at least one or more nuclear localization sequences (or optionally at least one or more nuclear localization sequences, as in some embodiments no NLS may be involved), wherein (a), (b) and (c) are arranged in a 5' to 3' orientation, wherein components I and II are located on the same or different vectors of the system, wherein when transcribed, the tracr mate sequence hybridizes to the tracr sequence and the guide sequence directs sequence-specific binding of a CRISPR complex to the target sequence, and wherein the CRISPR complex comprises the CRISPR complexed with (1) the guide sequence that is hybridized or hybridizable to the target sequence, and (2) the tracr mate sequence that is hybridized or hybridizable to the tracr sequence. enzyme, or (B) a non-naturally occurring or engineered composition comprising a vector system comprising one or more vectors comprising I. a first regulatory element operably linked to (a) a guide sequence capable of hybridizing to a target sequence in a eukaryotic cell, and (b) at least one or more tracr mate sequences, II. a second regulatory element operably linked to an enzyme-coding sequence encoding a CRISPR enzyme, and III.a third regulatory element operably linked to the tracr sequence, wherein components I, II, and III are located on the same or different vectors of the system, wherein when transcribed, the tracr mate sequence hybridizes to the tracr sequence and the guide sequence directs sequence-specific binding of the CRISPR complex to the target sequence, and wherein the CRISPR complex comprises a CRISPR enzyme complexed with (1) the guide sequence that is hybridized or hybridizable to the target sequence, and (2) the tracr mate sequence that is hybridized or hybridizable to the tracr sequence. In some embodiments, components I, II, and III are located on the same vector. In other embodiments, components I and II are located on the same vector, and component III is located on another vector. In other embodiments, components I and III are located on the same vector, and component II is located on another vector. In other embodiments, components II and III are located on the same vector, and component I is located on another vector. In other embodiments, components I, II, and III are each located on a different vector. The present invention also provides a viral (e.g., AAV or lentiviral) vector system as described herein and can be part of a vector system as described herein.

[0076] Some methods of the present invention may include induced expression. The organism or subject is a eukaryotic cell (including mammals, including humans) or a non-human eukaryotic organism or a non-human animal or a non-human mammal, provided that it has a liver or liver function. In some embodiments, the organism or subject is a non-human animal, and may be an arthropod such as an insect, or may be a nematode. In some methods of the present invention, the organism or subject is a mammal or a non-human mammal. Non-human mammals may be, for example, rodents (preferably mice or rats), ungulates, or primates. In some methods of the present invention, the viral vector is an AAV or a lentivirus, and may be a part of a vector system as described herein. In some methods of the present invention, the CRISPR enzyme is Cas9. In some methods of the present invention, the expression of the guide sequence is under the control of a T7 promoter and is driven by the expression of a T7 polymerase.

[0077] The invention in some embodiments comprises a method of delivering a CRISPR enzyme, the method comprising delivering to a cell an mRNA encoding the CRISPR enzyme. In some of these methods of the invention, the CRISPR enzyme is Cas9.

[0078] The present invention also provides methods for preparing the vector systems of the present invention, in particular the viral vector systems as described herein. In some embodiments, the present invention includes a method for preparing the AAV of the present invention, comprising transfecting one or more plasmids containing or consisting essentially of one or more nucleic acid molecules encoding AAV into cells infected with AAV, and providing the AAV rep and / or cap necessary for the replication and packaging of AAV. In some embodiments, the AAV rep and / or cap necessary for the replication and packaging of AAV are provided by transfecting the cells with one or more helper plasmids or one or more helper viruses. In some embodiments, the helper virus is a poxvirus, an adenovirus, a herpes virus, or a baculovirus. In some embodiments, the poxvirus is a vaccinia virus. In some embodiments, the cells are mammalian cells. And in some embodiments, the cells are insect cells and the helper virus is a baculovirus. In other embodiments, the virus is a lentivirus.

[0079] The present invention further includes a composition of the present invention or a CRISPR enzyme thereof (including or alternatively an mRNA encoding a CRISPR enzyme) for use in medicine or therapy. In some embodiments, the present invention includes a composition of the present invention or a CRISPR enzyme thereof (including or alternatively an mRNA encoding a CRISPR enzyme) for use in a method according to the present invention. In some embodiments, the present invention provides the use of a composition of the present invention or a CRISPR enzyme thereof (including or alternatively an mRNA encoding a CRISPR enzyme) in ex vivo gene or genome editing. In certain embodiments, the present invention includes the use of a composition of the present invention or a CRISPR enzyme thereof (including or alternatively an mRNA encoding a CRISPR enzyme) in the manufacture of a medicament for ex vivo gene or genome editing or for use in a method according to the present invention. In some embodiments, the present invention includes a composition of the present invention or a CRISPR enzyme thereof (including or alternatively an mRNA encoding a CRISPR enzyme) wherein the target sequence is flanked at its 3' end by a PAM (protospacer adjacent motif) sequence comprising a 5'-motif, particularly when the Cas9 is (or is derived from) Streptococcus pyogenes or Staphylococcus aureus Cas9. For example, a suitable PAM is 5'-NRG or 5'-NNGRR (wherein N is any nucleotide) for SpCas9 or SaCas9 enzymes (or derived enzymes), respectively, as mentioned below.

[0080] It will be understood that SpCas9 or SaCas9 are those from or derived from Streptococcus pyogenes or Staphylococcus aureus Cas9. It can of course be mutated or otherwise altered from the wild type to suit the intended use, as described herein. The double nickase D10A mutant or variant is preferred, especially in combination with two overlapping guides directed to opposite sites on different strands of the same chromosome.

[0081] Aspects of the invention include increasing the specificity of gene targeting mediated by CRISPR enzymes, such as Cas9, and reducing the likelihood of off-target modifications by CRISPR enzymes, such as Cas9. In some embodiments, the invention includes methods of modifying an organism or non-human organism by minimizing off-target modifications by manipulating first and second target sequences on opposite strands of a DNA duplex in a genomic locus of interest in a cell, the methods comprising delivering a non-naturally occurring or engineered composition comprising:

[0082] I. A first CRISPR-Cas system chimeric RNA (chiRNA) polynucleotide sequence, wherein the first polynucleotide sequence comprises:

[0083] (a) a first guide sequence capable of hybridizing to the first target sequence,

[0084] (b) a first tracr mate sequence, and

[0085] (c) a first tracr sequence,

[0086] II. A second CRISPR-Cas system chiRNA polynucleotide sequence, wherein the second polynucleotide sequence comprises:

[0087] (a) a second guide sequence capable of hybridizing to the second target sequence,

[0088] (b) a second tracr mate sequence, and

[0089] (c) a second tracr sequence, and

[0090] III. A polynucleotide sequence encoding a CRISPR enzyme comprising at least one or more nuclear localization sequences and comprising one or more mutations, wherein (a), (b) and (c) are arranged in a 5' to 3' orientation, wherein when transcribed, the first and second tracr mate sequences hybridize to the first and second tracr sequences, respectively, and the first and second guide sequences direct sequence-specific binding of a first and second CRISPR complex to the first and second target sequences, respectively, wherein the first CRISPR complex comprises a first guide sequence that is hybridized or hybridizable to the first target sequence, and (2) a first tracr sequence that is hybridized or hybridizable to the first tracr sequence. The invention provides a CRISPR enzyme complexed with a first tracr mate sequence, wherein the second CRISPR complex comprises the CRISPR enzyme complexed with (1) a second guide sequence that is hybridized or hybridizable to the second target sequence, and (2) a second tracr mate sequence that is hybridized or hybridizable to the second tracr sequence, wherein the polynucleotide sequence encoding the CRISPR enzyme is DNA or RNA, and wherein the first guide sequence directs cleavage of one strand of the DNA duplex proximal to the first target sequence and the second guide sequence directs cleavage of the other strand proximal to the second target sequence thereby inducing a double strand break, thereby modifying the organism or non-human organism by minimizing off-target modifications.

[0091] In some methods of the invention, any or all of the polynucleotide sequence encoding the CRISPR enzyme, the first and second guide sequences, the first and second tracr mate sequences, or the first and second tracr sequences are RNA. In further embodiments of the invention, the polynucleotide comprising the sequence encoding the CRISPR enzyme, the first and second guide sequences, the first and second tracr mate sequences, or the first and second tracr sequences is RNA and is delivered via liposomes, nanoparticles, exosomes, microvesicles, or a gene gun. In certain embodiments of the invention, the first and second tracr mate sequences share 100% identity and / or the first and second tracr sequences share 100% identity. In some embodiments, these polynucleotides can be contained in a vector system comprising one or more vectors. In a preferred embodiment of the invention, the CRISPR enzyme is a Cas9 enzyme, such as SpCas9. In one aspect of the invention, the CRISPR enzyme comprises one or more mutations in the catalytic domain, wherein the one or more mutations are selected from the group consisting of: D10A, E762A, H840A, N854A, N863A, and D986A. In a highly preferred embodiment, the CRISPR enzyme has a D10A mutation. In preferred embodiments, the first CRISPR enzyme has one or more mutations such that the enzyme is a complementary strand nicking enzyme, and the second CRISPR enzyme has one or more mutations such that the enzyme is a non-complementary strand nicking enzyme. Alternatively, the first enzyme may be a non-complementary strand nicking enzyme, and the second enzyme may be a complementary strand nicking enzyme.

[0092] In preferred methods of the invention, the first guide sequence directs cleavage of one strand of the DNA duplex adjacent to the first target sequence and the second guide sequence directs cleavage of the other strand adjacent to the second target sequence thereby generating a 5' overhang. In embodiments of the invention, the 5' overhang is at most 200 base pairs, preferably at most 100 base pairs, or more preferably at most 50 base pairs. In embodiments of the invention, the 5' overhang is at least 26 base pairs, preferably at least 30 base pairs, or more preferably 34-50 base pairs. Most preferably, the overlap is between 5 and -1 base pairs.

[0093] In some embodiments, the present invention comprises a method of modifying an organism or non-human organism by minimizing off-target modifications by manipulating first and second target sequences on opposite strands of a DNA duplex in a genomic locus of interest in a cell, the method comprising delivering a non-naturally occurring or engineered composition comprising a vector system comprising one or more vectors comprising

[0094] I. A first regulating element operatively connected to

[0095] (a) a first guide sequence capable of hybridizing to the first target sequence, and

[0096] (b) at least one or more tracr mate sequences,

[0097] II. A second regulatory element operably linked to

[0098] (a) a second guide sequence capable of hybridizing to the second target sequence, and

[0099] (b) at least one or more tracr mate sequences,

[0100] III. a third regulatory element operably linked to an enzyme-coding sequence encoding a CRISPR enzyme, and

[0101] IV. a fourth regulatory element operably linked to the tracr sequence,

[0102] wherein components I, II, III and IV are located on the same or different vectors of the system, when transcribed, the tracr mate sequence hybridizes to the tracr sequence, and the first and second guide sequences direct sequence-specific binding of a first and a second CRISPR complex to the first and second target sequences, respectively, wherein the first CRISPR complex comprises a CRISPR enzyme complexed with (1) a first guide sequence that is hybridized or hybridizable to the first target sequence, and (2) a tracr mate sequence that is hybridized or hybridizable to the tracr sequence, wherein the second CRISPR complex comprises a CRISPR enzyme complexed with (1) a second guide sequence that is hybridized or hybridizable to the second target sequence, and (2) a tracr mate sequence that is hybridized or hybridizable to the tracr sequence, wherein the polynucleotide sequence encoding the CRISPR enzyme is DNA or RNA, and wherein the first guide sequence directs cleavage of one strand of the DNA duplex adjacent to the first target sequence and the second guide sequence directs cleavage of the other strand adjacent to the second target sequence, thereby inducing a double strand break, thereby modifying the organism or non-human organism by minimizing off-target modifications.

[0103] The present invention also provides a vector system as described herein. The system can comprise one, two, three, or four different vectors. Components I, II, III, and IV can thus be located on one, two, three, or four different vectors, and all possible combinations of locations for these components are contemplated, for example: components I, II, III, and IV can be located on the same vector; components I, II, III, and IV can each be located on a different vector; components I, II, III, and IV can be located on a total of two or three different vectors, wherein all combinations of locations are contemplated, etc.

[0104] In some methods of the invention, any or all of the polynucleotide sequence encoding the CRISPR enzyme, the first and second guide sequences, the first and second tracr mate sequences, or the first and second tracr sequences is RNA. In further embodiments of the invention, the first and second tracr mate sequences share 100% identity and / or the first and second tracr sequences share 100% identity. In preferred embodiments of the invention, the CRISPR enzyme is a Cas9 enzyme, such as SpCas9. In one aspect of the invention, the CRISPR enzyme comprises one or more mutations in the catalytic domain, wherein the one or more mutations are selected from the group consisting of D10A, E762A, H840A, N854A, N863A, and D986A. In a highly preferred embodiment, the CRISPR enzyme has a D10A mutation. In preferred embodiments, the first CRISPR enzyme has one or more mutations such that the enzyme is a complementary strand nicking enzyme, and the second CRISPR enzyme has one or more mutations such that the enzyme is a non-complementary strand nicking enzyme. Alternatively, the first enzyme may be a non-complementary strand nicking enzyme, and the second enzyme may be a complementary strand nicking enzyme.In a further embodiment of the invention, one or more of the viral vectors may be delivered via liposomes, nanoparticles, exosomes, microvesicles, or a gene gun.

[0105] In preferred methods of the invention, the first guide sequence directs cleavage of one strand of the DNA duplex adjacent to the first target sequence and the second guide sequence directs cleavage of the other strand adjacent to the second target sequence thereby generating a 5' overhang. In embodiments of the invention, the 5' overhang has at most 200 base pairs, preferably at most 100 base pairs, or more preferably at most 50 base pairs. In embodiments of the invention, the 5' overhang has at least 26 base pairs, preferably at least 30 base pairs, or more preferably 34-50 base pairs.

[0106] In some embodiments, the invention includes a method of modifying a genomic locus of interest by minimizing off-target modifications by introducing into a cell containing and expressing a double-stranded DNA molecule encoding a gene product of interest an engineered, non-naturally occurring CRISPR-Cas system comprising a Cas protein having one or more mutations and two guide RNAs that target the first and second strands of the DNA molecule, respectively, whereby the guide RNAs target the DNA molecule encoding the gene product and the Cas protein nicks each of the first and second strands of the DNA molecule encoding the gene product, thereby altering expression of the gene product; and wherein the Cas protein and the two guide RNAs do not naturally occur together.

[0107] In a preferred method of the invention, the Cas protein nicks each of the first and second strands of the DNA molecule encoding the gene product to result in a 5' overhang. In an embodiment of the invention, the 5' overhang has at most 200 base pairs, preferably at most 100 base pairs, or more preferably at most 50 base pairs. In an embodiment of the invention, the 5' overhang has at least 26 base pairs, preferably at least 30 base pairs, or more preferably 34-50 base pairs.

[0108] Embodiments of the present invention also include guide RNAs comprising guide sequences fused to a tracr pairing sequence and a tracr sequence. In one aspect of the invention, the Cas protein is codon-optimized for expression in eukaryotic cells, preferably mammalian cells or human cells. In another embodiment of the present invention, the Cas protein is a type II CRISPR-Cas protein, such as a Cas9 protein. In a highly preferred embodiment, the Cas protein is a Cas9 protein, such as SpCas9. In aspects of the present invention, the Cas protein has one or more mutations selected from the group consisting of D10A, E762A, H840A, N854A, N863A, and D986A. In a highly preferred embodiment, the Cas protein has a D10A mutation.

[0109] Aspects of the invention relate to expression of a gene product that is reduced, or a template polynucleotide that is further introduced into a DNA molecule encoding a gene product, or an intervening sequence that is precisely severed by allowing the two 5' overhangs to reanneal and ligate, or the activity or function of a gene product that is altered, or expression of a gene product that is increased. In one embodiment of the invention, the gene product is a protein.

[0110] The present invention also includes an engineered, non-naturally occurring CRISPR-Cas system, comprising a Cas protein having one or more mutations and two guide RNAs that target a first strand and a second strand, respectively, of a double-stranded DNA molecule encoding a gene product in a cell, whereby the guide RNAs target the DNA molecule encoding the gene product and the Cas protein nicks each of the first strand and the second strand of the DNA molecule encoding the gene product, thereby altering expression of the gene product; and wherein the Cas protein and the two guide RNAs do not naturally occur together.

[0111] In aspects of the invention, the guide RNAs may comprise a guide sequence fused to a tracr pairing sequence and a tracr sequence. In one embodiment of the invention, the Cas protein is a type II CRISPR-Cas protein. In one aspect of the invention, the Cas protein is codon-optimized for expression in eukaryotic cells, preferably mammalian cells or human cells. In another embodiment of the invention, the Cas protein is a type II CRISPR-Cas protein, such as a Cas 9 protein. In a highly preferred embodiment, the Cas protein is a Cas9 protein, such as SpCas9. In aspects of the invention, the Cas protein has one or more mutations selected from the group consisting of D10A, E762A, H840A, N854A, N863A and D986A. In a highly preferred embodiment, the Cas protein has a D10A mutation.

[0112] Aspects of the invention relate to expression of a gene product that is reduced, or a template polynucleotide that is further introduced into a DNA molecule encoding a gene product, or an intervening sequence that is precisely severed by allowing the two 5' overhangs to reanneal and ligate, or the activity or function of a gene product that is altered, or expression of a gene product that is increased. In one embodiment of the invention, the gene product is a protein.

[0113] The present invention also includes engineered, non-naturally occurring vector systems comprising one or more vectors comprising:

[0114] a) a first regulatory element operably linked to each of two CRISPR-Cas system guide RNAs that target the first and second strands, respectively, of a double-stranded DNA molecule encoding a gene product,

[0115] b) a second regulatory element operably linked to the Cas protein,

[0116] Wherein components (a) and (b) are located on the same or different vectors of the system, whereby the guide RNAs target the DNA molecule encoding the gene product, and the Cas protein nicks each of the first and second strands of the DNA molecule encoding the gene product, thereby altering expression of the gene product; and wherein the Cas protein and the two guide RNAs do not naturally exist together.

[0117] In aspects of the invention, the guide RNAs may comprise a guide sequence fused to a tracr pairing sequence and a tracr sequence. In one embodiment of the invention, the Cas protein is a type II CRISPR-Cas protein. In one aspect of the invention, the Cas protein is codon optimized for expression in eukaryotic cells, preferably mammalian cells or human cells. In another embodiment of the invention, the Cas protein is a type II CRISPR-Cas protein, such as a Cas9 protein. In a highly preferred embodiment, the Cas protein is a Cas9 protein, such as SpCas9. In aspects of the invention, the Cas protein has one or more mutations selected from the group consisting of: D10A, E762A, H840A, N854A, N863A and D986A. In a highly preferred embodiment, the Cas protein has a D10A mutation.

[0118] Aspects of the present invention relate to expression of a reduced gene product, or a template polynucleotide further introduced into a DNA molecule encoding a gene product, or an intervening sequence precisely severed by allowing two 5' overhangs to reanneal and ligate, or altered gene product activity or function, or increased gene product expression. In one embodiment of the present invention, the gene product is a protein. In a preferred embodiment of the present invention, the vectors of the system are viral vectors. In another embodiment, the vectors of the system are delivered via liposomes, nanoparticles, exosomes, microvesicles, or a gene gun.

[0119] In one aspect, the present invention provides a method for modifying a target polynucleotide in a liver cell. In some embodiments, the method comprises allowing a CRISPR complex to bind to the target polynucleotide to effect cleavage of the target polynucleotide, thereby modifying the target polynucleotide, wherein the CRISPR complex comprises a CRISPR enzyme complexed with a guide sequence that is hybridized or hybridizable to a target sequence within the target polynucleotide, wherein the guide sequence is linked to a tracr mate sequence that in turn hybridizes to a tracr sequence. In some embodiments, the cleavage comprises cleaving one or both strands at the target sequence position by the CRISPR enzyme. In some embodiments, the cleavage results in reduced transcription of the target gene. In some embodiments, the method further comprises repairing the cleaved target polynucleotide by homologous recombination with an exogenous template polynucleotide, wherein the repair results in a mutation comprising an insertion, deletion, or substitution of one or more nucleotides of the target polynucleotide. In some embodiments, the mutation results in one or more amino acid changes in a protein expressed from a gene comprising the target sequence. In some embodiments, the method further comprises delivering one or more vectors to the eukaryotic cell, wherein the one or more vectors drive expression of one or more of: the CRISPR enzyme, the guide sequence linked to the tracr mate sequence, and the tracr sequence. In some embodiments, the vector is delivered to a eukaryotic cell in a subject. In some embodiments, the modification occurs in the eukaryotic cell in cell culture. In some embodiments, the method further comprises isolating the eukaryotic cell from the subject prior to the modification. In some embodiments, the method further comprises returning the eukaryotic cell and / or cells derived therefrom to the subject.

[0120] In one aspect, the present invention provides a method for modifying expression of a polynucleotide in a liver cell. In some embodiments, the method comprises allowing a CRISPR complex to bind to the polynucleotide such that said binding results in increased or decreased expression of said polynucleotide; wherein the CRISPR complex comprises a CRISPR enzyme complexed with a guide sequence hybridized or hybridizable to a target sequence within said polynucleotide, wherein said guide sequence is linked to a tracr mate sequence, which in turn hybridizes to a tracr sequence. In some embodiments, the method further comprises delivering one or more vectors to said eukaryotic cells, wherein said one or more vectors drive expression of one or more of: the CRISPR enzyme, the guide sequence linked to the tracr mate sequence, and the tracr sequence.

[0121] In one aspect, the present invention provides a method for producing a model liver cell comprising a mutated disease gene. In some embodiments, the disease gene is any gene associated with an increased risk of having or developing a disease. In some embodiments, the method comprises (a) introducing one or more vectors into a eukaryotic cell, wherein the one or more vectors drive the expression of one or more of the following: a CRISPR enzyme, a guide sequence connected to a tracr pairing sequence, and a tracr sequence; and (b) allowing a CRISPR complex to bind to a target polynucleotide to implement cleavage of the target polynucleotide within the disease gene, wherein the CRISPR complex comprises a CRISPR enzyme that is complexed with (1) a guide sequence that is hybridized or hybridizable to a target sequence within the target polynucleotide, and (2) a tracr pairing sequence that is hybridized or hybridizable to the tracr, thereby producing a model eukaryotic cell comprising a mutated disease gene. In some embodiments, the cleavage comprises cleaving one or both chains at the target sequence position by the CRISPR enzyme. In some embodiments, the cleavage results in reduced transcription of the target gene. In some embodiments, the method further comprises repairing the cleaved target polynucleotide by homologous recombination with an exogenous template polynucleotide, wherein the repair results in a mutation comprising an insertion, deletion, or substitution of one or more nucleotides of the target polynucleotide. In some embodiments, the mutation results in one or more amino acid changes in a protein expressed from a gene comprising the target sequence.

[0122] In one aspect, the present invention provides a method for selecting one or more liver cells by introducing one or more mutations into one or more cells, the method comprising: introducing one or more vectors into the one or more cells, wherein the one or more vectors drive expression of one or more of: a CRISPR enzyme, a guide sequence linked to a tracr mate sequence, a tracr sequence, and an editing template; wherein the editing template comprises one or more mutations that eliminate CRISPR enzyme cleavage; allowing the editing template to undergo homologous recombination with a target polynucleotide in the one or more cells to be screened; allowing a CRISPR complex to bind to the target polynucleotide to effect cleavage of the target polynucleotide within the gene, wherein the CRISPR complex comprises a CRISPR enzyme complexed with (1) a guide sequence on a target sequence that is hybridized or hybridizable to the target polynucleotide, and (2) the tracr mate sequence that is hybridized or hybridizable to the tracr, wherein binding of the CRISPR complex to the target polynucleotide induces cell death, thereby allowing selection of one or more prokaryotic cells into which one or more mutations have been introduced. In a preferred embodiment, the CRISPR enzyme is Cas9. Aspects of the present invention allow selection of specific cells without the need for a selectable marker or a two-step approach that may include a counter-selection system.

[0123] In one aspect, the invention provides methods of modifying a target polynucleotide in a liver cell. In some embodiments, the method comprises allowing a CRISPR complex to bind to the target polynucleotide to effect cleavage of said target polynucleotide, thereby modifying the target polynucleotide, wherein the CRISPR complex comprises a CRISPR enzyme complexed with a guide sequence hybridized or hybridizable to a target sequence within said target polynucleotide, wherein said guide sequence is linked to a tracr mate sequence that in turn hybridizes to a tracr sequence.

[0124] In other embodiments, the present invention provides a method for modifying expression of a polynucleotide in liver cells, the method comprising increasing or decreasing expression of a target polynucleotide by using a CRISPR complex that binds to the polynucleotide.

[0125] Where desired, to effect modification of expression in a cell, one or more vectors comprising a tracr sequence, a guide sequence linked to the tracr mate sequence, and a sequence encoding a CRISPR enzyme are delivered to the cell. In some methods, the one or more vectors comprise: a regulatory element operably linked to an enzyme-coding sequence encoding the CRISPR enzyme, the CRISPR enzyme comprising a nuclear localization sequence; and a regulatory element operably linked to a tracr mate sequence and one or more insertion sites for inserting a guide sequence upstream of the tracr mate sequence. When expressed, the guide sequence directs sequence-specific binding of the CRISPR complex to a target sequence in the cell. Typically, the CRISPR complex comprises a CRISPR enzyme complexed with (1) the guide sequence that is hybridized or hybridizable to the target sequence, and (2) the tracr mate sequence that is hybridized or hybridizable to the tracr sequence.

[0126] In some methods, a target polynucleotide can be inactivated to modify expression in a cell. For example, when a CRISPR complex binds to a target sequence in a cell, the target polynucleotide is inactivated so that the sequence is not transcribed, the encoded protein is not produced, or the sequence does not function as a wild-type sequence. For example, a protein or microRNA encoding sequence can be inactivated so that the protein is not produced.

[0127] In certain embodiments, the CRISPR enzyme comprises one or more mutations selected from the group consisting of D10A, E762A, H840A, N854A, N863A or D986A and / or the one or more mutations are in the RuvC1 or HNH domain of the CRISPR enzyme or are mutations as otherwise discussed herein. In some embodiments, the CRISPR enzyme has one or more mutations in the catalytic domain, wherein upon transcription, the tracr pairing sequence hybridizes to the tracr sequence, and the guide sequence directs sequence-specific binding of the CRISPR complex to the target sequence, and wherein the enzyme further comprises a functional domain. In some embodiments, the functional domain is a transcriptional activation domain, preferably VP64. In some embodiments, the functional domain is a transcriptional repression domain, preferably KRAB. In some embodiments, the transcriptional repression domain is SID or a concatemer of SIDs (e.g., SID4X). In some embodiments, the functional domain is an epigenetic modification domain, thereby providing an epigenetic modification enzyme. In some embodiments, the functional domain is an activation domain, which can be a P65 activation domain.

[0128] In some embodiments, the CRISPR enzyme is a type I or type III CRISPR enzyme, but preferably a type II CRISPR enzyme. This type II CRISPR enzyme can be any Cas enzyme. A Cas enzyme can be identified as Cas9, as this can refer to the general class of enzymes that share homology with the largest nuclease with multiple nuclease domains from a type II CRISPR system. Most preferably, the Cas9 enzyme is from or derived from spCas9 or saCas9. By derived, applicants mean that the derived enzyme is largely based on the meaning of having a high sequence homology to the wild-type enzyme, but it has been mutated (modified) in some aspects as described herein.

[0129] It should be understood that the terms Cas and CRISPR enzyme are generally used interchangeably herein unless otherwise indicated. As mentioned above, many of the residue numbers used herein refer to the Cas9 enzyme from the type II CRISPR locus in Streptococcus pyogenes. However, it should be understood that the present invention includes more Cas9s from other microbial species, such as SpCas9, SaCa9, St1Cas9, etc.

[0130] An example of a codon optimized sequence that is optimized for humans (i.e., optimized for expression in humans) is provided herein, see SaCas9 human codon optimized sequence. While this is optimized, it will be appreciated that other examples are possible and codon optimization for host species is known.

[0131] Preferably, delivery is in the form of a vector, which can be a viral vector, such as a lentivirus or baculovirus or preferably an adenovirus / adeno-associated virus vector, but other means of delivery are also known (such as yeast systems, microvesicles, gene guns / means of attaching vectors to gold nanoparticles) and are provided. A vector may not only refer to a viral or yeast system (for example, where the nucleic acid of interest can be operably linked to a promoter and under its control (in terms of expression, thereby ultimately providing processed RNA)), but also directs the delivery of nucleic acids into host cells. Although in the methods herein the vector can be a viral vector and AAV is advantageous here, other viral vectors as discussed herein can be used, such as lentivirus. For example, baculovirus can be used for expression in insect cells. These insect cells can in turn be used to produce a large number of other vectors, such as AAV or lentiviral vectors suitable for delivery of the present invention. A method of delivering a CRISPR enzyme of the present invention is also contemplated, the method comprising delivering mRNA encoding the CRISPR enzyme to a cell. It will be appreciated that in certain embodiments, the CRISPR enzyme is truncated, and / or consists of less than one thousand amino acids or less than four thousand amino acids, and / or is a nuclease or nickase, and / or is codon-optimized, and / or comprises one or more mutations, and / or comprises a chimeric CRISPR enzyme, and / or other options as discussed herein. AAV and lentiviral vectors are preferred.

[0132] In certain embodiments, the target sequence is flanked or downstream at its 3' end by a PAM suitable for a CRISPR enzyme (typically Cas, and particularly Cas9).

[0133] For example, a suitable PAM is 5'-NRG or 5'-NNGRR for SpCas9 or SaCas9 enzymes (or derived enzymes), respectively.

[0134] It will be understood that SpCas9 or SaCas9 are those from or derived from Streptococcus pyogenes or Staphylococcus aureus Cas9.

[0135] Some points in this application are summarized below:

[0136] AAV2 / 8

[0137] The preferred delivery for the CRISPR-Cas system is via a viral vector. The vector can be a lentiviral vector or an AAV vector, as discussed at some length herein. We have shown in particular that AAV is a preferred example of a viral vector. Therein, we continue to show that AAV8, and in particular AAV2 / 8 (AAV8 packaged with the AAV2 packaging signal ITR), can be used for delivery to the liver, particularly in vivo.

[0138] Phenotypic changes seen in vivo

[0139] As discussed elsewhere, we have been able to show that phenotypic changes can be detected in vivo. This is a significant advance, as often defects at the RNAi level do not see any sustained effects. With the present invention, phenotypic changes can be seen in the liver for the first time. A preferred arrangement for achieving this is the one used in Example 36. Its key elements are preferably, alone or in combination, namely:

[0140] SaCas9;

[0141] Use of chimeric guide RNAs, including guide, tracr sequence, and tracr partner;

[0142] For the tracr sequence, Sa tracr is preferred to recruit SaCas9;

[0143] AAV8 or more preferably AAV2 / 8;

[0144] For experimental purposes, Rosa26 is a useful negative control.

[0145] Although the use of the CMV promoter in AAV vectors is helpful, the use of liver-specific promoters such as TBG is particularly effective;

[0146] The one or more targets can be broad, as CRISPR has been shown to have broad applicability across targets once the guide is successfully delivered and the Css9 enzyme is appropriately expressed. However, preferred targets in the liver (for which guides can be designed) still include one or more of the following: PCSK9; Hmgcr; SERPINA1; ApoB; and / or LDL.

[0147] Therefore, in some embodiments, it is particularly preferred that the Cas enzyme is SaCas9. Preferably, the CRISPRS-Cas polynucleotide sequence is chimeric and preferably includes Sa tracr, wherein Cas9 is SaCas9. A viral vector can be used, which is preferably AAV2 / 8. In addition, a liver-specific promoter is ideal, and a preferred example is TBG. All of these can be used in combination to provide a chimeric CRISPRS-Cas polynucleotide sequence including Sa tracr, wherein Cas9 is SaCas9, and the vector is AAV2 / 8, wherein at least Cas9 is under the control of a liver-specific promoter such as TBG. Any of the above targets can be used in this system, particularly ApoB, due to its importance in obesity.

[0148] A subsequent Nature Biotech Paper by Yin and Anderson (NBT 2884, cited herein) provides further support for the phenotypic changes in vivo that we have shown.

[0149] We then provide additional data in Example 37 that add further support by demonstrating efficient in vivo editing of somatic liver tissue via Cas9. Furthermore, delivery via AAV2 / 8 and the use of SaCas9 again demonstrate the usefulness of this particular approach in vivo. ApoB was again preferentially targeted.

[0150] Later, Examples 38 and 39 showed excellent in vivo data on efficacy, including in vivo phenotypic changes: particularly ApoB (a lipid metabolism gene), while Example 40 showed the applicability of the technology on post-mitotic cells, with the liver being an important example. Example 41 showed that multiple epitope tags are preferred for detection purposes.

[0151] Although viral vectors are preferred, in some embodiments, the use of cell penetrating peptides is a viable alternative and as such is preferred.

[0152] It is therefore an object of the present invention not to encompass within the present invention any previously known product, process for making the same, or method of using the same, such that applicants reserve the right and hereby publicly disclaim any previously known product, process, or method. It is further noted that the present invention is not intended to encompass within the scope of the present invention any product, process, or method of making the same that does not meet the written description and enablement requirements of the USPTO (35 U.S.C. §112, first paragraph) or the EPO (Article 83 of the EPC), such that applicants reserve the right and hereby publicly disclaim any previously described product, process for making the same, or method of using the same.

[0153] It should be noted that in this disclosure and particularly in the claims and / or paragraphs, terms such as “comprise,” “comprised,” “comprising,” and the like may have the meanings ascribed to them in U.S. patent law; for example, they may mean “includes,” “included,” “including,” and the like; and that terms such as “consisting essentially of” and “consists essentially of” have the meanings ascribed to them in U.S. patent law, for example, they allow for elements not expressly recited, but exclude elements that are found in the prior art or that affect the basic or novel characteristics of the invention.

[0154] These and other embodiments are disclosed in, or are obvious from, and encompassed by, the following detailed description. BRIEF DESCRIPTION OF THE DRAWINGS

[0155] The novel features of the invention are set forth with particularity in the appended claims. A better understanding of the features and advantages of the invention will be obtained by reference to the following detailed description which describes illustrative embodiments in which the principles of the invention are utilized, and in the accompanying drawings:

[0156] Figure 1 Figure 2 shows a schematic model of the CRISPR system. The Cas9 nuclease from Streptococcus pyogenes (yellow) targets genomic DNA via a synthetic guide RNA (sgRNA) consisting of a 20-nt guide sequence (blue) and a scaffold (red). The guide sequence base pairs with the DNA target (blue), directly upstream of the necessary 5'-NGG protospacer adjacent motif (PAM; magenta), and Cas9 mediates a double-strand break (DSB) approximately 3 bp upstream of the PAM (red triangle).

[0157] Figure 2A -F shows an exemplary CRISPR system, possible mechanisms of action, exemplary adaptations of expression in eukaryotic cells, and results of experiments assessing nuclear localization and CRISPR activity.

[0158] Figure 3A-D shows the results of the evaluation of SpCas9 specificity against exemplary targets.

[0159] Figures 4A-G show an exemplary vector system and the results of its use in directing homologous recombination in eukaryotic cells.

[0160] Figure 5The table of protospacer sequences is provided, and the modification efficiency results of the protospacer targets designed based on exemplary Streptococcus pyogenes and Streptococcus thermophilus CRISPR systems are summarized, and these CRISPR systems have the corresponding PAM for the seat in the human and mouse genomes. Cells were transfected with Cas9 and pre-crRNA / tracrRNA or chimeric RNA and analyzed after transfection for 72 hours. Based on the inspector (Surveyor) analysis results from the indicator cell line, insertion and deletion (indel) were calculated Percentage (N=3 for all protospacer targets, error is SEM, ND represents not detected using Surveyor determination, and NT represents not detected in this study).

[0161] Figure 6A-C shows a comparison of different tracrRNA transcripts for Cas9-mediated gene targeting.

[0162] Figure 7 Schematic diagram of the surveyor nuclease assay for detection of double-strand break-induced microindels and microdeletions is shown.

[0163] Figure 8A-B Exemplary bicistronic expression vectors for expression of CRISPR system elements in eukaryotic cells are shown.

[0164] Figure 9A-C Shown are histograms of the distances between the adjacent S. pyogenes SF370 locus 1 PAM (NGG) ( FIG. 9A ) and S. thermophilus LMD9 locus 2 PAM (NNAGAAW) ( FIG. 9B ) in the human genome, as well as the distance for each PAM in terms of chromosome (Chr) ( FIG. 9C ).

[0165] 10A-D show exemplary CRISPR systems, exemplary adaptations for expression in eukaryotic cells, and results of assays assessing CRISPR activity.

[0166] Figure 11A-C Shown are exemplary manipulations of the CRISPR system for targeting genomic loci in mammalian cells.

[0167] Figure 12A-B Shown are the results of Northern blot analysis of crRNA processing in mammals.

[0168] Figure 13A-B An exemplary selection of protospacers in the human PVALB and mouse Th loci is shown.

[0169] Figure 14Exemplary protospacers and corresponding PAM sequence targets of the S. thermophilus CRISPR system in the human EMX1 locus are shown.

[0170] Figure 15 Tables of primer and probe sequences for Surveyor, RFLP, genomic sequencing, and Northern blot analysis are provided.

[0171] Figure 16A -C shows an exemplary manipulation of the CRISPR system with chimeric RNA and the results of SURVEYOR analysis of the system's activity in eukaryotic cells.

[0172] Figure 17A-B A graphical representation showing the results of SURVEYOR analysis of CRISPR system activity in eukaryotic cells.

[0173] Figure 18 Shown is an exemplary visualization of some S. pyogenes Cas9 target sites in the human genome using the UCSC genome browser.

[0174] Figure 19A -D shows a circular depiction of phylogenetic analysis revealing five Cas9 families, including three groups of large Cas9s (approximately 1400 amino acids) and two groups of small Cas9s (approximately 1100 amino acids).

[0175] Figure 20A -F shows a linear depiction of phylogenetic analysis revealing five Cas9 families, including three groups of large Cas9s (about 1400 amino acids) and two groups of small Cas9s (about 1100 amino acids).

[0176] Figure 21A -D shows genome editing via homologous recombination. (a) Schematic diagram of SpCas9 nickase with a D10A mutation in the RuvC I catalytic domain. (b) Schematic diagram showing homologous recombination (HR) at the human EMX1 seat using sense or antisense single-stranded oligonucleotides as repair templates. The above red arrows indicate sgRNA cleavage sites; PCR primers for genotyping (Tables J and K) are represented as arrows in the right figure. (c) Sequences of regions modified by HR. d, SURVEYOR analysis (n=3) for indels at the EMX1 target 1 seat mediated by wild-type (wt) and nickase (D10A) SpCas9. Arrows indicate the position of the expected fragment size.

[0177] Figure 22A -B shows a single vector design for SpCas9.

[0178] Figure 23 Shown is a graph representing the length distribution of Cas9 orthologs.

[0179] Figure 24A -M shows the sequence in the case where the mutation point is located within the SpCas9 gene.

[0180] Figure 25A A map of the conditional Cas9 and Rosa26 targeting vectors is shown.

[0181] Figure 25B Maps of constitutive Cas9 and Rosa26 targeting vectors are shown.

[0182] Figure 26 Schematic diagrams showing important elements in constitutive and conditional Cas9 constructs.

[0183] Figure 27 Delivery and in vivo mouse brain Cas9 expression data are shown.

[0184] Figure 28 RNA delivery of Cas9 and chimeric RNA into cells is shown. (A) Delivery of a GFP reporter gene as DNA or mRNA into Neuro-2A cells. (B) Delivery of Cas9 and chimeric RNA directed against the Icam2 gene as RNA resulted in cleavage of one of the two spacers tested. (C) Delivery of Cas9 and chimeric RNA directed against the F7 gene as RNA resulted in cleavage of one of the two spacers tested.

[0185] Figure 29 Shown how DNA double-strand break (DSB) repair facilitates gene editing. In the error-prone non-homologous end joining (NHEJ) pathway, the ends of the DSB are processed and rejoined by endogenous DNA repair machinery, which can lead to random insertion / deletion (indel) mutations at the junction site. Indel mutations occurring in gene coding regions can produce frameshifts and premature stop codons, leading to gene knockout. Alternatively, a repair template in the form of a plasmid or single-stranded oligodeoxynucleotide (ssODN) can be provided to utilize the homology-directed repair (HDR) pathway, which allows high-fidelity and precise editing.

[0186] Figure 30A-CFigure 3 shows the expected results of HDR in HEK and HUES9 cells. (a) Targeting plasmids or ssODN (sense or antisense) with homology arms can be used to edit sequences cut by Cas9 (red triangle) at the target genomic seat. In order to analyze the efficiency of HDR, we introduced HindIII sites (red bars) in the target seat and performed PCR amplification with primers annealed outside the homology region. Digestion of the PCR product with HindIII revealed the presence of HDR events. (b) ssODN directed in the sense or antisense direction (s or a) relative to the genome of interest can be used in combination with Cas9 to achieve effective HDR-mediated editing at the target seat. On either side of the modification (red bar), a minimum homology region of 40bp and preferably 90bp is recommended. (c) Using both wild-type Cas9 and Cas9 nickase (D10A), examples of the effects of ssODN on HDR in the EMX1 seat were shown. Each ssODN contains 90 bp homology arms flanked by a 12-bp insert of two restriction sites.

[0187] Figure 31 AC shows the repair strategy of the cystic fibrosis δF508 mutation.

[0188] Figure 32 AB (a) shows a schematic diagram of the GAA repeat expansion in FXN intron 1 and (b) shows a schematic diagram of the strategy adopted to excise the GAA expansion region using the CRISPR / Cas system.

[0189] Figure 33 Screening for efficient SpCas9-mediated targeting of Tet1-3 and Dnmt1, 3a, and 3b loci was shown. Surveyor assays on DNA from transfected N2A cells demonstrated efficient DNA cleavage using different gRNAs.

[0190] Figure 34 A multiplex genome targeting strategy using a 2-vector system in an AAV1 / 2 delivery system is shown. Tet1-3 and Dnmt1, 3a, and 3b gRNAs are under the control of the U6 promoter. GFP-KASH is under the control of the human synapsin promoter. The restriction side shows a simple gRNA replacement strategy via subcloning. HA-tagged SpCas9 is shown, flanked by two nuclear localization signals (NLS). Both vectors are delivered to the brain via AAV1 / 2 viruses at a 1:1 ratio.

[0191] Figure 35Validation of the functionality of the multiplex DNMT targeting vector #1 using the Surveyor assay is shown. N2A cells were co-transfected with the DNMT targeting vector #1 (+) and the SpCas9 encoding vector to detect SpCas9-mediated cleavage of DNMT gene family loci. The negative control was gRNA only (-). Cells were harvested for DNA purification and downstream processing was performed 48 hours after transfection.

[0192] Figure 36 Validation of the functionality of the multiplex DNMT targeting vector #2 using the Surveyor assay is shown. N2A cells were co-transfected with the DNMT targeting vector #1 (+) and the SpCas9 encoding vector to detect SpCas9-mediated cleavage of the DNMT gene family loci. The negative control was gRNA only (-). Cells were harvested for DNA purification and downstream processing was performed 48 hours after transfection.

[0193] Figure 37 A schematic overview of the short promoter and short polyA versions used for in vivo HA-SpCas9 expression is shown. The size of the coding region from L-ITR to R-ITR is shown on the right.

[0194] Figure 38 A schematic overview of the short promoter and short polyA versions used for in vivo HA-SaCas9 expression is shown. The size of the coding region from L-ITR to R-ITR is shown on the right.

[0195] Figure 39 Shown are SpCas9 and SaCas9 expression in N2A cells. Representative Western blots of HA-tagged versions of SpCas9 and SaCas9 under the control of different short promoters and with short polyA (spA) sequences. Tubulin serves as a loading control. mCherry (mCh) serves as a transfection control. Cells were harvested and further processed for Western blotting 48 hours after transfection.

[0196] Figure 40 Screening for efficient SaCas9-mediated targeting of the Tet3 locus is shown. Using different gRNAs with the NNGGGT PUM sequence, a Surveyor assay on DNA from transfected N2A cells demonstrated efficient DNA cleavage. GFP-transfected cells and cells expressing SaCas9 alone served as controls.

[0197] Figure 41Figure 3 shows the expression of HA-SaCas9 in the mouse brain. The animals were injected into the dentate gyrus with a virus driving HA-SaCas9 expression under the control of the human synapsin promoter. The animals were sacrificed 2 weeks after surgery. The HA tag was detected using the rabbit monoclonal antibody C29F4 (Cell Signaling). The cell nuclei were stained blue with DAPI dye.

[0198] Figure 42 Shown is the expression of SpCas9 and SaCas9 in cortical primary neurons in culture 7 days after transduction. Representative Western blots of HA-tagged SpCas9 and SaCas9 versions under the control of different promoters and with bgh or short polyA (spA) sequences. Tubulin is a loading control.

[0199] Figure 43 Shown are LIVE / DEAD staining of primary cortical neurons 7 days after transduction with AAV1 particles carrying SpCas9 and multiple gRNA constructs with different promoters (examples shown on the last panel of DNMTs). Neurons after AAV transduction were compared to untransduced control neurons. Red nuclei indicate permeabilized dead cells (second line of panels). Live cells are labeled green (third line of panels).

[0200] Figure 44 Shown are LIVE / DEAD staining of primary cortical neurons 7 days after transduction with AAV1 particles carrying SaCas9 with different promoters. Red nuclei indicate permeabilized dead cells (second line of panels). Live cells are labeled green (third line of panels).

[0201] Figure 45 Shown is a morphological comparison of neurons after transduction with AAV1 viruses carrying SpCas9 and gRNA multiplexes for TET and DNMT gene loci. Untransduced neurons are shown as a control.

[0202] Figure 46 Figure 4: Validation of the functionality of multiplexed DNMT targeting vector #1 using the Surveyor assay in primary cortical neurons. Cells were co-transduced with DNMT targeting vector #1 and SpCas9 viruses with different promoters to detect SpCas9-mediated cleavage of DNMT gene family loci.

[0203] Figure 47The in vivo efficiency of SpCas9 cutting in the brain is shown. Mice were injected with AAV1 / 2 viruses carrying gRNAs targeting multiple DNMT family gene loci together with SpCas9 viruses under the control of 2 different promoters (mouse Mecp2 and rat Map1b). Brain tissue was extracted two weeks after injection, and cell nuclei were prepared and sorted using FACS based on GFP expression driven by the synapsin promoter from the gRNA multiple construct. After gDNA extraction, Surveyor assay was performed. + indicates GFP-positive nuclei, - is a control, GFP-negative nuclei from the same animal. The numbers on the gel indicate the evaluated SpCas9 efficiency.

[0204] Figure 48 The purification of GFP-KASH labeled nuclei from hippocampal neurons is shown. The outer nuclear membrane (ONM) of the nuclear membrane was labeled with a fusion of GFP and the transmembrane domain of the KASH protein. GFP was strongly expressed in the brain one week after stereotactic surgery and AAV1 / 2 injection. A density gradient centrifugation step was performed to purify nuclei from intact brain. The purified nuclei are shown. DyeCycle TM Ruby-stained chromatin staining is shown in red, and GFP-labeled nuclei are shown in green. Representative FACS distribution of GFP+ and GFP- nuclei (red-purple: DyeCycle TM Ruby staining, green: GFP).

[0205] Figure 49 The efficiency of SpCas9 cutting in the mouse brain is shown. Mice were injected with AAV1 / 2 viruses carrying gRNAs targeting multiplexed TET family gene loci together with SpCas9 viruses under the control of two different promoters (mouse Mecp2 and rat Map1b). Three weeks after the injection, brain tissue was extracted and cell nuclei were prepared and sorted using FACS based on GFP expression driven by the synapsin promoter from the gRNA multiplex construct. After gDNA extraction, Surveyor assay was performed. + indicates GFP-positive nuclei, - is the control, GFP-negative nuclei from the same animal. The numbers on the gel indicate the evaluated SpCas9 efficiency.

[0206] Figure 50 Figure 3 shows GFP-KASH expression in cortical neurons in culture. Neurons were transduced with AAV1 virus carrying a gRNA multiplex construct targeting the TET locus. The strongest signal is located around the nucleus due to the localization of the KASH domain.

[0207] Figure 51Shown (top) is a list of the spacing between guide RNA pairs (as indicated by the arrangement pattern of the two PAM sequences). When used with the SpCas9(D10A) nickase, only guide RNA pairs that satisfy patterns 1, 2, 3, and 4 exhibit indels. (bottom) Gel images show that the combination of SpCas9(D10A) and guide RNA pairs that satisfy patterns 1, 2, 3, and 4 leads to the formation of indels in the target site.

[0208] Figure 52 A list of U6 reverse primer sequences used to generate the U6-guide RNA expression cassette is shown. Each primer needs to be paired with the U6 forward primer "gcactgagggcctatttcccatgattc" to generate an amplicon containing U6 and the desired guide RNA.

[0209] Figure 53 The genomic sequence map from the human Emx1 locus is shown, showing the Figure 33 The positions of the 24 patterns are listed in .

[0210] Figure 54 Shown (right) is a gel image indicating the formation of indels at the target site when variable 5' overhangs are present after cleavage by the Cas9 nickase targeted by different guide RNA pairs. (Left) is a table indicating the lane number on the right gel and different parameters, including the guide RNA pairs used for identification and the length of the 5' overhang present after cleavage by the Cas9 nickase.

[0211] Figure 55 A genomic sequence map from the human Emx1 locus is shown, which shows the Figure 54 (Right) Gel pattern and the positions of different guide RNA pairs further described in Example 35.

[0212] Figure 56 Shown are representative Surveyor gels demonstrating genomic cleavage by SaCas9.

[0213] Figure 57 Genomic cleavage efficiency of the PAM sequences (all targets) is shown.

[0214] Figure 58 Genomic cleavage efficiency of the PAM sequence (target of cleavage) is shown.

[0215] Figure 59 Genomic cleavage efficiency by PAM sequence (all targets, discarding low efficiency and orphan targets) is shown.

[0216] Figure 60Genomic cleavage efficiency by PAM sequence (targets cleaved, low efficiency and orphan targets discarded) is shown.

[0217] Figure 61 Sequence diagram showing the spacer & PAM for operational cleavage (new endogenous genome testing shows T is not required).

[0218] Figure 62 Shown are images of immunohistochemical staining of liver tissue sections from animals injected with AAV-CMV-EGFP and AAV-CMV-SaCas9-U6-sgRNA (Pcsk9) (2 weeks after injection, to verify SaCas9 protein expression).

[0219] Figure 63 Shown is cleavage of liver tissue by SaCas9 delivered via tail vein injection of AAV2 / 8 virus (1 week time point).

[0220] Figure 64 Shown is a time course assay of liver tissue cleavage by SaCas9 delivered via tail vein injection of AAV2 / 8 (AAV2 / 8-SaCas9-U6-sgRNA (Pcsk9)).

[0221] Figure 65 Shown is the screening of functional CRISPR / Cas targets in human 293FT cells after delivery of a SaCas9 and U6-sgRNA cassette targeting the human SERPINA1 gene locus, followed by surveyor assay and gel analysis of 12 of a total of 24 different spacer designs of sgRNA-expressing dsDNA targeting the human SERPINA1 gene, with a DNA ladder on the left.

[0222] Figure 66 Shown is a gel analysis of 12 samples, each of the 6 spacer designs of dsDNA expressing sgRNA was co-transfected with the SaCas9 plasmid into a mouse hepatocyte cell line, with two replicates placed next to each other. The DNA ladder is on the left.

[0223] Figure 67 Shown are acutely dissected liver tissues from mice injected with TBG and CMV versions of EGFP (6 days post-injection, GFP channel images, 10X).

[0224] Figure 68Figures AB show (A) Design of an AAV vector for packaging SaCas9 and a guide RNA expression system with the ubiquitous mammalian CMV promoter for delivery into a wide range of tissues. (B) Design of an AAV vector for packaging SaCas9 and a guide RNA expression system with the liver-specific TBG promoter for in vivo targeting of hepatocytes. ITR, AAV inverted terminal repeat. hSaCas9, human codon-optimized SaCas9. NLS, nuclear localization signal. HA, human influenza hemagglutinin-derived tag. bGHpA, bovine growth hormone polyadenylation signal. U6, human U6 promoter. sgRNA, single guide RNA.

[0225] Figure 69 AB shows (A) Surveyor assay results showing genome modification rates in liver tissue from mice injected with AAV2 / 8 expressing SaCas9 targeting the mouse Pcsk9 gene or a control AAV2 / 8 virus expressing an EGFP reporter gene. All samples were obtained 1 week after tail vein injection. (B) Statistics summarizing the cleavage efficiency of all three time points collected from mice injected with AAV2 / 8 expressing SaCas9 targeting the mouse Pcsk9 gene.

[0226] Figure 70A-D Figure 2 shows a biochemical screen of small Cas9 orthologs. (a) Phylogenetic tree of Cas9 orthologs with subfamilies and sizes (amino acids) indicated. Conserved nuclease domains are highlighted in colored boxes, with black residues representing conserved sequences. (b) Schematic diagram of an in vitro cleavage-based method for identifying protospacer adjacent motifs (PAMs). (c) Common PAMs for eight Cas9 orthologs based on sequencing of cleaved fragments. (d) Biochemical cleavage reactions using orthologs and sgRNAs targeting different loci with putative PAMs (shown in red). Red triangles indicate cleaved fragments.

[0227] Figure 71A-F shows the in vitro characterization of Staphylococcus aureus Cas9. (a) Schematic diagram showing the structure of Staphylococcus aureus sgRNA. Indels vary depending on (b) the length of the guide sequence or (c) the repeat: anti-repeat duplex. (d) The common PAM of SaCas9 in HEK 293FT cells. The pooled indel values ​​of all hypothetical PAM 4-base combinations (top, n≥3) and the overall sequence identity (n=116, bottom) are shown. e is a comparison of SpCas9 and SaCas9 cutting efficiencies for genomic target sites, and f is a comparison of SpCas9 and SaCas9 cutting efficiencies for genome-wide off-target sites (error bars indicate Wilson intervals). Off-target (OT) sequences with significant indels are highlighted above the chart. Unless otherwise noted, n=3, error bars SEM; ND not detected.

[0228] Figure 72A-E shows the delivery of Staphylococcus aureus Cas AAV into live animals. (a) Schematic diagram showing the AAV single vector system (top) and experimental timeline (bottom). (b) Mouse Pcsk9 locus showing SaCas9 target locations. The guide sequence is highlighted in blue, with the PAM highlighted in magenta. (c) Time course of indel formation in liver tissue at targets 1 and 6 after injection of AAV2 / 8 particles (up to 2 animals per injection; error bars represent liver tissue pieces). (d) Indel formation at target 6 1 and 3 weeks after injection. Each lane represents a piece of liver tissue. Red triangles indicate cleaved fragments. (e) Representative chromatograms and indels generated in vivo by SaCas9.

[0229] Figure 73 shows a schematic diagram of the CRISPR-Cas seat of six orthologs from two subfamilies of type II CRISPR-Cas systems. The spacer or "guide" sequence is shown in blue, followed by direct repeats (gray). The predicted tracrRNA is shown in red and folded based on the constraint generation (Constraint Generation) RNA folding model.

[0230] Figure 74 Stacked bar graphs are shown, indicating the fraction of targets cleaved 2, 3, 4, or 5-bp upstream of the PAM for each Cas9 ortholog; all Cas9s cleaved most commonly 3-bp upstream of the PAM (red triangles).

[0231] Figure 75A-BShown are: (a) SURVEYOR assay showing indel formation at human endogenous loci from co-transfection of Cas9 orthologs and sgRNA in HEK 293FT cells. (b) SaCas9 cleaves multiple targets with high efficiency. The PAM sequence of each target is shown above each lane, with the consensus sequence for each Cas9 highlighted in red. Red triangles indicate cleaved fragments.

[0232] Figure 76A-B Shown are: (a) Histogram of distances between neighboring S. aureus subsp. aureus type II CRISPR PAMs (NNGRRs) in the human genome (GRCh38), and (b) the distance with respect to the chromosome for each PAM.

[0233] Figure 77A-B The location of the SaCas9 target and PAM within the mouse Pcsk9 gene locus is shown. b, Indels generated by transfection of a mouse liver hepatocellular carcinoma (Hepa1-6) cell line at the target site. Red arrows indicate the cleavage site.

[0234] Figure 78 A shows that guide (target) 1 induces the highest percentage of indels in ApoB.

[0235] Figure 78 B shows the results of a Surveyor nuclease gel assay for indel formation efficiency 4 weeks after injection.

[0236] Figure 79 Shown is Oil Red staining to detect hepatic lipid accumulation phenotype in vivo after AAV-Cas9-sgRNA delivery. The scale bar in each square represents 20 μm.

[0237] Figure 80 It is shown that across a range of targets and within two different genes (AAVS1 and EMX1), 21 nucleotides nt / base pairs (bp), represented by grey bars, is the optimal spacer length at least compared to 20 or 22 base pairs (represented by black and white bars, respectively).

[0238] Figure 81 Show whether the guide sequence can be inserted into the Cas9 intron sequence

[0239] Figure 82 It is shown that the full-length H1 promoter (grey bars) is still weaker than the U6 promoter (black bars), as U6 showed an increased percentage of indel formation for each target tested.

[0240] Figure 83 It was shown that the short H1 promoter is weaker than the full-length H1

[0241] Figure 84 Shown is the distance between the 5' ends of the two guide sequences in the construct, as measured relative to the cleavage efficiency of the D10A SaCAs9 double nickase.

[0242] Figure 85 (Example 40) shows the delivery of the CRISPR-Cas9 system and targeting of the Mecp2 locus in the mouse brain. (a) AAV-SpCas9 and AAV-SpGuide (Mecp2) expression vectors. The sgRNA vector contains the coding sequence of the GFP-KASH fusion protein for identification of transduced neurons. (b) Expression of HA-Cas9 and GFP-KASH in the dorsal dentate gyrus (DG) of the mouse hippocampus. Scale bar, 100 μm. (c) Quantification of cells efficiently targeted by the dual-vector Cas9-CRISPR system. (d) Graphical representation of the mouse Mecp2 locus showing the Cas9 target position; sgRNA is indicated in blue. The PAM sequence is marked in purple. Representative mutation patterns detected by sequencing the Mecp2 locus are shown as follows: green - wild-type sequence; red dashed line - deleted bases; red bases: insertion or mutation; red arrows indicate CRISPR-Cas9 cutting sites. (e) SURVEYOR TM Assay gel shows modification of the Mecp2 locus in the DG region 2 weeks after AAV delivery. (f) Western blot analysis of MeCP2 protein expression in targeted brain regions and quantification of MeCP2 protein levels in the dorsal DG (t-test, **p<0.001, n=4, from 3 animals, error bars: SEM). (g) Image of the dorsal DG region 2 weeks after CRISPR-Cas9 targeting of the Mecp2 locus. Scale bar, 150 μm. (h) Quantification of the MeCP2-positive cell population in all examined cells (DAPI staining) in the targeted brain region compared to control parallel sites (t-test, ****p<0.0001, n=290 and 249 cells, from 2 animals, respectively; error bars: SEM). (ITR-inverted terminal repeat; HA-hemagglutinin tag; NLS-nuclear localization signal; spA-synthetic polyadenylation signal; U6-PolIII promoter; sgRNA-single guide RNA; hSyn-human synapsin 1 promoter; GFP-green fluorescent protein; KASH-Klarsicht, ANC1, Syne homology nuclear transmembrane domain; bGH pA-bovine growth hormone polyadenylation signal; WPRE-woodchuck hepatitis virus posttranscriptional regulatory element).

[0243] Figure 86(Example 40) Analysis of gene expression in Cas9-mediated MeCP2 knockdown neurons is shown. (a) Strategy for purification of nuclei from CRISPR-Cas9-targeted cells from mouse brain. (b) Hierarchical clustering of differentially expressed genes (t-test, p < 0.01, n = 19 populations of classified nuclei from 8 animals) detected by RNAseq. The relative log2 (TPM+1) expression level of the gene was normalized for each row and displayed on a red-blue scale. Each column represents a population of 100 targeted neuronal nuclei sorted by FACS from an isolated dentate gyrus cell population, from controls or from animals transduced with Mecp2 sgRNA, as indicated.

[0244] Figure 87 (Example 40) Cell-autonomous defects in the cellular response properties of neurons following CRISPR-mediated knockdown of MeCP2 were demonstrated. (a) Cartoon showing the in vivo experimental setup and visual stimulation parameters from the mouse visual cortex. GFP is shown. + Neurons. Scale bar, 20 μm. (b) Cartoon showing the configuration for recording from layer 2 / 3 excitatory neurons that receive both contralateral and ipsilateral eye-specific inputs. Genome-modified GFP + Cells are green and unmodified cells are gray. Normalized spike shapes show regular spiking of excitatory neurons. (c, d) Average OSI (c) and evoked FR (d) were obtained from GFP expressing Mecp2 and control sgRNA, respectively. + Cell measurements (t-test, *p<0.05; numbers in the graph indicate the number of recorded cells; n=2-3 animals; error bars: sem).

[0245] Figure 88 (Example 40) shows simultaneous multiplexed gene editing in the mouse brain. (a) Schematic diagram of the CRISPR-Cas9 system designed for multiplexed genome targeting. (b) Graphical representation of the targeted DNMT mouse loci. Guide RNAs are indicated in blue. PAM sequences are marked in purple. (c) SURVEYOR TMAssay gel showing modification of DNMT loci in FACS-sorted GFP-KASH-positive cells 4 weeks after AAV delivery in the DG region. (d) Deep sequencing-based analysis of DNMT locus modification in single cells, showing the co-occurrence of modification in multiple loci. (e) Western blot analysis of Dnmt3a and Dnmt1 proteins after in vivo delivery of a CRISPR-Cas9 system targeting DNMT family genes (top). Western blot quantification of Dnmt3a and Dnmt1 protein levels in the DG after in vivo CRISPR-Cas9 targeting (bottom; t-test, **p<0.001, *p<0.05, Dnmt3a: n=7; Dnmt1: n=5, from 5 animals; error bars: sem). (f) Contextual learning deficits 8 weeks after targeting DNMT genes in the DG region of the hippocampus using SpCas9, tested in the training and altered contexts (t-test, ***p<0.0001, n=18 animals, 2 independent experiments; error bars: sem).

[0246] Figure 89 (Example 40) Cloning and expression of HA-tagged SpCas9 for AAV packaging (HA-SpCas9) are shown. (a) Schematic overview of different cloning strategies to minimize the size of the SpCas9 expression cassette, using a short rat Map1b promoter (pMap1b), a truncated form of the mouse Mecp2 promoter (pMecp2), and a short polyA motif (spA). (b) Western blot analysis of primary cortical neuron cultures expressing HA-SpCas9 using different SpCas9 expression cassettes. (c) The Mecp2 promoter drives expression of HA-SpCas9 (red) in neurons (Map1b, NeuN; arrows) but not in astrocytes (GFAP, arrows). Co-expression of HA-SpCas9 and GFP-KASH is shown (bottom). Cell nuclei are labeled with DAPI (blue). Scale bar, 20 μm. (d) Schematic overview of GFP-labeling. Enhanced green fluorescent protein (GFP) fused to the nuclear transmembrane KASH domain and GFP-KASH integrated into the outer nuclear membrane are shown. (e) Calculation of co-infection efficiency showing a population of cells expressing both HA-SpCas9 and GFP-KASH (n = 973 neurons from 3 cultures; error bars: sem). (f) Seven days after viral delivery, cells were treated with Kit staining. DAPI + and DEAD + ) cells (n=518 DAPI cells in control group) +Nucleus; SpCas9 / GFP-KASH n=1003 DAPI + Nuclei, from two cultures; error bars: sem). (ITR - inverted terminal repeat; HA - hemagglutinin tag; NLS - nuclear localization signal; spA - synthetic polyadenylation signal; U6 - PolIII promoter; sgRNA - single guide RNA; hSyn - human synapsin 1 promoter; GFP - green fluorescent protein; KASH - Klarsicht, ANC1, Syne homology nuclear transmembrane domain; bGH pA - bovine growth hormone polyadenylation signal; WPRE - woodchuck hepatitis virus posttranscriptional regulatory element).

[0247] Figure 90 (Example 40) shows the targeting of Mecp2 in Neuro-2a cells. (a) Mecp2 targeting sequence and corresponding protospacer adjacent motif (PAM). (b) Evaluation of 6 Mecp2 sgRNAs co-transfected with SpCas9 into Neuro-2a cells. TM The locus modification efficiency was analyzed 48 h after transfection.

[0248] Figure 91 (Example 40) shows CRISPR-SpCas9 targeting Mecp2 in primary cortical neurons. (a) Immunofluorescence staining of MeCP2 (red) in cultured neurons 7 days after AAV-CRISPR transduction (green, GFP-KASH). Cell nuclei were labeled with DAPI (blue). Scale bar, 20 μm. (b) Using SURVEYOR TM Assay gels evaluating Mecp2 locus targeting using SpCas9 or dSpCas9 together with Mecp2 sgRNA or control (targeting the bacterial lacZ gene) sgRNA. (c) Quantification of MeCP2-positive nuclei (GFP) in the targeted population of neurons. + (d) Western blot of MeCP2 protein levels after CRISPR-SpCas9 targeting the Mecp2 locus and quantification of MeCP2 protein levels (t-test, **p<0.001, n=5, from 3 cultures, error bars: sem).

[0249] Figure 92(Example 40) shows morphological changes in neuronal dendritic trees after SpCas9-mediated knockdown of MeCP2 in vitro. (a) Reduced complexity of dendritic trees in neurons after CRISPR-SpCas9 targeting the Mecp2 locus. Scale bar, 20 μm. (b) Changes in dendritic spine morphology in neurons targeted by SpCas9 and Mecp2 sgRNA. Scale bar, 10 μm. The morphology of the cells was visualized using co-transfection of mCherry constructs. Cells were selected for morphological analysis based on the results of Mecp2 staining. (c) Dendritic tree morphology assessed by the number of dendritic terminals, and (d) Sholl analysis (t-test, ***p<0.0001, n=40, from 2 cultures). (e) Quantification of dendritic spine density (t-test, ***p<0.0001, n=40, from 2 cultures, error bars: sem).

[0250] Figure 93 (Example 40) shows RNAseq of neuronal nuclei from control animals and SpCas9-mediated Mecp2 knockdown. Box plot, presenting the number of detected genes across RNA-seq libraries (19 libraries, each 100 nuclei were taken from nuclei transduced with control sgRNA or Mecp2 sgRNA; n = 4 animals / group) / expression level quantile. All genes were divided into 10 quantiles by their average log2 (TPM+1) expression levels, and then the number of genes detected for each quantile in each sample (log2 (TPM+1)>2) was counted. The three target sequences shown are SEQ ID NO:___, SEQ ID NO:___, and SEQ ID NO:___ for Dnmt3a, Dnmt1, and Dnmt3b, respectively.

[0251] Figure 94 (Example 40) Multiplexed genomic targeting of DNMT family members in vitro is demonstrated. (a) Dnmt3a, Dnmt1, and Dnmt3b targeting sequences and corresponding protospacer adjacent motifs (PAMs). (b) SURVEYOR™ nuclease assay analysis of Neuro-2a cells 48 hours after transfection with SpCas9 and DNMT 3xsgRNA vectors targeting the Dnmt3a, Dnmt1, and Dnmt3b loci. Efficient genome editing of all three target genes is shown.

[0252] Figure 95(Example 40) shows the next generation sequencing of the targeted Dnmt3a, Dnmt1 and Dnmt3b loci. Examples of sequencing results of mutated Dnmt3a (a), Dnmt1 (b) and Dnmt3b (c) loci after in vivo delivery of SpCas9 and DNMT 3xsgRNA into the dentate gyrus of mice. Green: wild-type sequence, red dashed line: deleted base, red base: insertion or mutation. The red arrow indicates the CRISPR-SpCas9 cutting site. The complete sequences used in this figure are provided as SEQ ID NO:, SEQ ID NO:, and SEQ ID NO: for the Dnmt3a, Dnmt1 and Dnmt3b loci, respectively. They are:

[0253] SEQ ID NO: (Dnmt3a):

[0254] CCT CCG TGT CAG CGA CCC ATG CCA A

[0255] SEQ ID NO: (Dnmt1):

[0256] CCA GCG TCG AAC AGC TCC AGC CCG

[0257] SEQ ID NO: (Dnmt3b)

[0258] AGA GGG TGC CAG CGG GTA TAT GAG G

[0259] Figure 96 SaCas9 protein sequences were codon-optimized ("reopt") and their ubiquitination signals were removed ("reopt(Ub)") for enhanced expression. Western blots for FLAG- and HA-tagged SaCas9 showed approximately 2-fold increased expression of the optimized SaCas9 (reopt, #2-4) relative to the original constructs (#0, 5, and 6), and similar levels to SpCas9 (SpCas9330, top bar left; SpCas9414, top bar right). Adding a 3xHA tag (right panel #6) improved the detection signal by approximately 2-fold over the 1xHA tag (right panel #5).

[0260] Figure 97Shown are the indel efficiencies using sgRNAs transcribed as is via the U6 promoter (grey, left bar, for each number of nt), or appending a "G" (blue, right bar, for each number of nt, with a thicker border) to the 5'-most position of the sgRNA for SaCas9. The total sgRNA spacer length (including G) is indicated on the x-axis. The graph represents aggregated data from five sgRNAs.

[0261] Figure 98 Optimization of sgRNA spacer length is shown (x-axis). Graphs illustrate indel formation with sgRNA spacers of varying lengths in HEK (left) and Hepa (right).

[0262] The figures herein are for illustration purposes only and are not necessarily drawn to scale.

[0263] Detailed description of the invention

[0264] For general information on CRISPR-Cas systems: Reference is made to U.S. Provisional Patent Applications Nos. 61 / 758,468, 61 / 802,174, 61 / 806,375, 61 / 814,263, 61 / 819,803, and 61 / 828,130, filed January 30, 2013; March 15, 2013; March 28, 2013; April 20, 2013; May 6, 2013, and May 28, 2013, respectively. Reference is also made to U.S. Provisional Patent Application No. 61 / 836,123, filed June 17, 2013. Reference is also made to U.S. Provisional Patent Application Nos. 61 / 736,527 and 61 / 748,427, filed December 12, 2012, and January 2, 2013, respectively. Reference is also made to U.S. Provisional Patent Application No. 61 / 791,409, filed March 15, 2013. Reference is also made to U.S. Provisional Patent Application No. 61 / 799,800, filed March 15, 2013. Reference is also made to U.S. Provisional Patent Application Nos. 61 / 835,931, 61 / 835,936, 61 / 836,127, 61 / 836,101, 61 / 836,080, and 61 / 835,973, each filed June 17, 2013. Reference is further made to U.S. Provisional Patent Applications 61 / 862,468 and 61 / 862,355, filed August 5, 2013; 61 / 871,301, filed August 28, 2013; 61 / 960,777, filed September 25, 2013; and 61 / 961,980, filed October 28, 2013. Reference is further made to U.S. Provisional Patent Application 61 / 915,325, filed December 12, 2013. Each of these applications, and all documents cited therein or during their prosecution ("application references"), and all documents cited or referenced in these application references, together with any instructions, descriptions, product specifications, and product sheets for any product mentioned therein or in any of the documents and incorporated herein by reference, are hereby incorporated by reference and may be employed in the practice of the present invention. All documents (eg, these applications and documents cited in the applications) are herein incorporated by reference to the same extent as if each individual document was specifically and individually indicated to be incorporated by reference.

[0265] In addition, general information about the CRISPR-Cas system is mentioned:

[0266] Multiplex genome engineering using CRISPR / Cas systems. Cong, L., Ran, FA, Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, PD, Wu, X., Jiang, W., Marraffini, LA, & Zhang, F. Science. February 15;339(6121):819-23 (2013);

[0267] RNA-guided editing of bacterial genomes using CRISPR-Cas systems. Jiang W., Bikard D., Cox D., Zhang F, Marraffini LA. Nat Biotechnol Mar; 31(3):233-9 (2013);

[0268] One-Step Generation of Mice Carrying Mutations in Multiple Genes by CRISPR / Cas-Mediated Genome Engineering. Wang H., Yang H., Shivalila CS., Dawlaty MM., Cheng AW., Zhang F., Jaenisch R. Cell May 9;153(4):910-8 (2013);

[0269] Optical control of mammalian endogenous transcription and epigenetic states. Konermann S, Brigham MD, Trevino AE, Hsu PD, Heidenreich M, Cong L, Platt RJ, Scott DA, Church GM, Zhang F. Nature. 2013 Aug 22;500(7463):472-6. doi:10.1038 / nature12466. Epub 2013 Aug 23.

[0270] Double Nicking by RNA-Guided CRISPR Cas9 for Enhanced Genome Editing Specificity. Ran, FA., Hsu, PD., Lin, CY., Gootenberg, JS., Konermann, S., Trevino, AE., Scott, DA., Inoue, A., Matoba, S., Zhang, Y., & Zhang, F. Cell. Aug 28. pii:S0092-8674(13)01015-5. (2013);

[0271] DNA targeting specificity of RNA-guided Cas9 nucleases. Hsu, P., Scott, D., Weinstein, J., Ran, F. A., Konermann, S., Agarwala, V., Li, Y., Fine, E., Wu, X., Shalem, O., Cradick, T. J., Marraffini, L. A., Bao, G., & Zhang, F. Nat Biotechnol. doi:10.1038 / nbt.2647 (2013);

[0272] Genome engineering using the CRISPR-Cas9 system. Ran, FA., Hsu, PD., Wright, J., Agarwala, V., Scott, DA., Zhang, F. Nature Protocols. Nov;8(11):2281-308. (2013);

[0273] Genome-Scale CRISPR-Cas9 Knockout Screening in Human Cells. Shalem, O., Sanjana, N.E., Hartenian, E., Shi, X., Scott, D.A., Mikkelson, T., Heckl, D., Ebert, B.L., Root, D.E., Doench, J.G., Zhang, F. Science, December 12 (2013). [Epub ahead of print]

[0274] Crystal structure of cas9 in complex with guide RNA and target DNA. Nishimasu, H., Ran, FA., Hsu, PD., Konermann, S., Shehata, SI., Dohmae, N., Ishitani, R., Zhang, F., Nureki, O. Cell, February 27 (2014). 156(5):935-49.

[0275] Genome-wide binding of the CRISPR endonuclease Cas9 in mammalian cells. Wu X., Scott DA., Kriz AJ., Chiu AC., Hsu PD., Dadon DB., Cheng AW., Trevino AE., Konermann S., Chen S., Jaenisch R., Zhang F., Sharp PA. Nat Biotechnol. (2014) April 20. doi:10.1038 / nbt.2889, and

[0276] Development and Applications of CRISPR-Cas9 for Genome Engineering, Hsu et al., Cell 157, 1262-1278 (June 5, 2014) (Hsu 2014), each of which is incorporated herein by reference and briefly discussed below:

[0277] ■ Cong et al. transformed the type II CRISPR / Cas system based on both Streptococcus thermophilus Cas9 and Streptococcus pyogenes Cas9 for use in eukaryotic cells, and confirmed that the Cas9 molecule can be guided by short RNA to induce precise cutting of DNA in human and mouse cells. Their research further shows that Cas9 can be used to promote homology-directed repair in eukaryotic cells with minimal mutagenic activity when converted into a nickase. In addition, their research confirmed that multiple guide sequences can be encoded into a single CRISPR array to enable simultaneous editing of several endogenous genomic loci within the mammalian genome, confirming the easy programmability and wide applicability of RNA-guided nuclease technology. This ability to use RNA to program sequence-specific DNA cutting within cells defines a new class of genome editing tools. These studies further show that other CRISPR loci may be transplantable into mammalian cells and can also mediate mammalian genome cutting. Importantly, it is conceivable that several aspects of the CRISPR / Cas system can be further improved to increase its efficiency and versatility.

[0278] ■ Jiang et al. used clustered regularly interspaced short palindromic repeats (CRISPR)-associated Cas9 endonuclease, complexed with dual-RNA, to introduce precise mutations in the genomes of Streptococcus pneumoniae and Escherichia coli. The approach relies on dual-RNA:Cas9-guided cleavage at the target genomic site to kill non-mutated cells and circumvents the need for selective markers or counter-selection systems. The study reports reprogramming dual-RNA:Cas9 specificity by changing the sequence of short CRISPR RNA (crRNA) so that single- and multiple polynucleotide changes are carried on the editing template. The study showed that the simultaneous use of two crRNAs enables multiplex mutagenesis. In addition, when the approach was used in combination with recombineering, nearly 100% of cells recovered using the described approach in Streptococcus pneumoniae contained the desired mutation, and 65% of those recovered in Escherichia coli contained mutations.

[0279] ■ Konermann et al. address the need in the art for a versatile and robust technology that enables photo- and chemical regulation of DNA-binding domains based on the CRISPR Cas9 enzyme and also transcription activator-like effectors.

[0280] ■As discussed in this specification, the Cas9 nuclease from the microbial CRISPR-Cas system targets a specific genomic locus through a 20nt guide sequence, which can tolerate certain mismatches with the DNA target and thereby promote undesirable off-target mutagenesis. To address this problem, Ran et al. described an approach to combining Cas9 nickase mutants with paired guide RNAs to introduce targeted double-strand breaks. Because individual cuts in the genome are repaired with high fidelity, simultaneous cuts via appropriate compensating guide RNAs are necessary for double-strand breaks, and the cut formation extends the number of specifically recognized bases for target cutting. The authors demonstrated that the use of paired cut formation can reduce off-target activity in cell lines by 50 to 1,500 times, and thereby promote gene knockout in mouse zygotes without sacrificing on-target cutting efficiency. This general strategy makes a wide variety of genome editing applications requiring high specificity possible.

[0281] ■Hsu et al. characterized the targeting specificity of SpCas9 in human cells to inform the selection of target sites and avoid off-target effects. The study evaluated >700 guide RNA variants and SpCas9-induced indel mutation levels at >100 predicted genomic off-target sites in 293T and 293FT cells. The authors showed that SpCas9 tolerates mismatches between guide RNA and target DNA at different positions in a sequence-dependent manner, sensitive to the number, position and distribution of mismatches. The authors further showed that SpCas9-mediated cleavage is not affected by DNA methylation, and the dose of SpCas9 and sgRNA can be titrated to minimize off-target modifications. In addition, to facilitate mammalian genome engineering applications, the authors report providing a web-based software tool to guide the selection and verification of target sequences together with off-target analysis.

[0282] ■ Ran et al. describe a set of tools for Cas9-mediated genome editing via non-homologous end joining (NHEJ) or homology-directed repair (HDR) in mammalian cells, along with the generation of modified cell lines for downstream functional studies. To minimize off-target cleavage, these authors further describe a double-nicking strategy using Cas9 nickase mutants with paired guide RNAs. The protocol provided by these authors experimentally derived guidelines for selecting target sites, evaluating cleavage efficiency, and analyzing off-target activity. These studies showed that, starting with target design, gene modification can be achieved in as little as 1-2 weeks, and modified clonal cell lines can be derived within 2-3 weeks.

[0283] ■Shalem et al. describe a new way to interrogate gene function across the genome. Their research shows that delivering a genome-wide CRISPR-Cas9 knockout (GeCKO) library targets 18,080 genes using 64,751 unique guide sequences that enable both negative and positive selection screening in human cells. First, these authors show that the GeCKO library is used to identify genes that are crucial for cell viability in cancer and pluripotent stem cells. Then, in a melanoma model, these authors screen for genes whose loss is related to resistance to vemurafenib (a therapeutic agent that inhibits mutant protein kinase BRAF). Their research shows that the top candidates include previously validated genes NF1 and MED12 together with novel hits NF2, CUL3, TADA2B, and TADA1. These authors observed a high level of consistency between independent guide RNAs targeting the same gene and a high rate of hit confirmation, and therefore confirmed the prospect of genome-wide screening using Cas9.

[0284] ■ Nishimasu et al. reported the crystal structure of Streptococcus pyogenes Cas9 in complex with sgRNA and its target DNA at 2.5 Å resolution. The structure reveals a two-lobed architecture consisting of a target recognition and nuclease lobe that accommodates the sgRNA:DNA heteroduplex in a positively charged groove at their interface. While the recognition lobe is crucial for binding sgRNA and DNA, the nuclease lobe contains HNH and RuvC nuclease domains that are suitably positioned for cleavage of the complementary and non-complementary strands of the target DNA, respectively. The nuclease lobe also contains a carboxyl-terminal domain responsible for interaction with the protospacer adjacent motif (PAM). This high-resolution structure and accompanying functional analysis have revealed the molecular mechanism of RNA-guided DNA targeting by Cas9, thereby paving the way for the rational design of new universal genome editing technologies.

[0285] ■ Wu et al. mapped the genome-wide binding sites of catalytically inactive Cas9 (dCas9) from Streptococcus pyogenes, loaded with a single guide RNA (sgRNA), in mouse embryonic stem cells (mESCs). The authors showed that each of the four sgRNAs tested targeted dCas9 to between tens and thousands of genomic sites, which were frequently characterized by a 5-nucleotide seed region and an NGG protospacer adjacent motif (PAM) in the sgRNA. Chromatin inaccessibility reduced dCas9 binding to other sites with matching seed sequences; thus, 70% of off-target sites were associated with genes. The authors showed that targeted sequencing of 295 dCas9 binding sites in mESCs transfected with catalytically active Cas9 identified only one mutation site above background levels. The authors proposed a two-state model for Cas9 binding and cleavage, in which seed matching triggers binding but requires extensive pairing with the target DNA for cleavage.

[0286] Hsu 2014 is a review article that generally discusses the history of CRISPR-Cas9 from yogurt to genome editing, including genetic screening in cells, and the information, data, and discoveries in applications filed before June 5, 2014, in the lineage of this specification. Hsu 2014's general teachings do not address the specific models or animals used in this specification.

[0287] The present invention relates to the engineering and optimization of systems, methods, and compositions for controlling gene expression involving sequence targeting, such as genome perturbations or gene editing involving CRISPR-Cas systems and components thereof. In advantageous embodiments, the Cas enzyme is Cas9.

[0288] CRISPRS-Cas polynucleotide sequences are often referred to herein as guides, or even guide RNAs (sgRNAs), but it will be appreciated that this term is not as commonplace as previously. In addition, the CRISPR-Cas9 system is mentioned herein, but it will be understood that the present invention can be practiced broadly with respect to any CRISPR-Cas system. Advantageously, the Cas has a nuclease function that induces DSBs, nicks, or double nicks. Cas9 is preferred and SaCas9 is particularly preferred.

[0289] Example 38 shows that both genotypic and, crucially, phenotypic changes are found in the CRISPR-Cas system. Not only that, but the CRISPR-Cas9 system is also effective in inducing phenotypic changes in vivo.

[0290] Specifically, the target is ApoB, a lipid metabolism gene. Encouragingly, ApoB is considered the "gold standard" for liver delivery and is widely used in mouse obesity models.

[0291] Delivery was via intravenous injection using an AAV vector with a liver-specific promoter (TBG) for Cas9.

[0292] As seen here, compared to the hydrodynamic delivery used by Anderson / Yin's (NBT 2884) as a delivery method, the delivery performed by expressing from a viral vector is an improvement because hydrodynamic delivery requires the injection of several milliliters of fluid, which is stressful and can be fatal for the mouse body. Hydrodynamic delivery is best suited for delivering plasmid (naked) DNA, and we have shown that packaging the guide sequence and Cas9 sequence within a viral delivery vector is preferred in terms of greatly increasing efficiency. In fact, only a relatively small volume needs to be introduced, and this can be performed intravenously (iv), which may be more acceptable in therapeutics.

[0293] Particularly encouraging is not only the genotypic changes seen in liver "gold standard" genes (such as ApoB), but also the phenotypic changes. Previous work with PCSK9 has shown not only genotypic changes, but also phenotypic changes, so the phenotypic changes seen with ApoB validate the rationality of CRISPR delivery to the liver and its ability to achieve phenotypic changes in the liver. This is combined with a more acceptable means of delivery (iv, compared to hydrodynamic delivery) in therapeutics. In this way, viral delivery of CRISPR-Cas9 systems (guides and Cas9) is preferred, especially intravenously.

[0294] Potential targets include: PCSK9, HMGCR, APOB, LDLR, ANGPTL3, F8, F9 / FIX, AAT, FAH, HPD, TAT, ATP7B, UGT1A1, OTC, ARH.

[0295] Thus, methods for inducing phenotypic changes in vivo are provided, comprising administering a CRISPR-Cas9 system to target cells, such as the liver. Suitable delivery routes are described herein, but in some embodiments, iv injection is preferred. Viral vectors are preferred, particularly AAV, particularly AAV serotype 2 / 8.

[0296] Also provided are CRISPR-Cas9 systems comprising one or more guides targeting lipid metabolism genes (e.g., ApoB). Methods for treating obesity comprising administering the CRISPR-Cas9 system are also contemplated. Mouse models comprising knockdown of one or more liver genes (particularly one or more lipid metabolism genes, such as ApoB) are preferred.

[0297] Liver-specific promoters for Cas9 will be clear, but may include those listed above. A preferred example is TBG.

[0298] As shown in Example 39, the guide can be 18-23 nucleotides long. It can be 18-22, or 19-22, or 18-21, 20-22, but is preferably 22, and most preferably 21 nucleotides long.

[0299] A proof of principle for the successful packaging of guide sequences into SaCas9 introns is also provided. Thus, CRISPR-Cas9 systems in which one or more guide sequences are packaged (located or inserted) into Cas9 introns are preferred.

[0300] The H1 promoter can be used and may be preferred in some cases.

[0301] Expanding on the work by Ran (Cell, 154, Aug. 21, 2013), the degree of overlap in a dual-guide approach using the D10A dual-nickase was investigated. Optimal results were shown between -5 and +1 bp (5' to 5'). Therefore, it is more preferred to use a dual-guide approach to minimize off-target effects. These preferably overlap, or come close to overlapping, at their 5' ends, on different strands of the DNA at the genomic target. Preferably, the overlap is in the range of -5 to +1 bp. In these cases, it will be understood that the Cas9 is a dual-nickase, such as the preferred D10A variant.

[0302] Example 40 provides, among other things: the first demonstration of successful AAV-mediated Cas9 delivery in vivo in postmitotic neurons along with efficient genome modification; the development of a nuclear labeling technique that enables easy isolation of neuronal nuclei from cells expressing Cas9 and sgRNA; the demonstration of the application of RNAseq analysis of neuronal transcriptomes; how electrophysiological studies and other techniques can be integrated with Cas9-mediated genome perturbation to determine phenotypic changes; how electrophysiological studies and other techniques can be integrated with Cas9-mediated genome perturbation to determine phenotypic changes; how electrophysiological studies and other techniques can be integrated with Cas9-mediated genome perturbation to determine phenotypic changes; and the demonstration of multiplexed targeting and the ability to study gene function with respect to rodent behavior using Cas9-mediated genome editing.

[0303] The present invention provides for: understanding and testing of gene function, including creation and testing of models; including with respect to gene therapy and therefore gene therapy, gene therapy methods and their uses for gene therapy are within the scope of the skilled artisan based on this disclosure.

[0304] Another aspect, discussed further below, relates to methods for nuclear labeling.

[0305] It will be understood that references herein to the CRISPR-Cas9 system are shorthand for referring to the Cas9 enzyme provided herein in combination with a guide or guides for targeting one or more genomic sequences. (And the invention may also be considered broadly with respect to CRISPR-Cas systems.) References to one or more guides include sgRNAs, together with the chimeric polynucleotide sequences described herein, comprising a guide sequence capable of hybridizing to a target sequence in the genome of a subject, a tracr mate sequence, and a tracr sequence.

[0306] These data essentially show the phenotypic changes caused by gene knockdown by using, in this case, two separate CRISPR-Cas9 systems according to the invention (guide RNA combined with the Cas9 enzyme) to successfully perturb gene function. The tissue of choice was brain tissue, and the results provide insights into a wide range of Postmitosis This is an important distinction, as previous work has focused on dividing cells (i.e., pre-mitotic cells).

[0307] In other words, given that SpCas9 has been widely used to engineer dividing cells, we demonstrated that SpCas9 can also be used to engineer the genome of post-mitotic neurons. This was done with high efficiency via NHEJ-mediated indel generation to produce knockdown, but therapeutic uses involving correction via HDR mechanisms (when a repair template is provided) are also envisioned. Both depend on the successful delivery and functional expression of Cas9 and one or more RNA guides, which are shown here.

[0308] The fact that genotypic changes induced by the CRISPR-Cas9 system then lead to phenotypic changes is important for both aspects (gene function and gene therapy).

[0309] The first CRISPR-Cas9 system uses a guide sequence for (targeting) Mecp2. Successfully adopting a dual-vector CRISPR-Cas9 system, wherein a vector comprises a guide and a vector comprises Cas9, shows a further principle demonstration for such a dual-vector system. The dual-vector CRISPR-Cas9 system is successfully delivered to two independent positions in the brain via stereotactic injection, specifically the hippocampal dentate gyrus and the visual cortex. In both cases, the gene interference of the same gene Mecp2 was seen, indicating that the dual-vector system was successfully delivered, and as expected by the transcription and functional activity in the Cas9 enzyme (in this case, SpCas9) and the successful recruitment of Cas9 to the genomic target sequence through the guide sequence.

[0310] AAV-mediated in vivo delivery of SpCas9 and sgRNA provides a promising approach for achieving whole A rapid and powerful technique for precise genomic perturbations within neural circuits. The vectors used were AAV vectors, adding further evidence for their general use and for dual-vector CRISPR-Cas9 systems, particularly in postmitotic cells and tissues, and in the brain in particular.

[0311] It will of course be understood that the choice of promoter is important in achieving expression from the CRISPR-Cas9 system (particularly Cas9 or both one or more guides and Cas9). Suitable examples for cell and cell life cycle stage specificity can be determined from the literature. Nevertheless, we provide some non-limiting examples: TBG, a liver-specific promoter and used herein to drive expression of SaCas9; the H1 promoter; the truncated H1 promoter; the U6 promoter. Moreover, because guides do not necessarily require specific promoters, one or more guides can similarly be packaged into one / the Cas9 intron.

[0312] The second CRISPR-Cas9 system used includes multiplex approach. A key advantage of the SpCas9 system is that it can promote multiplex genome editing. The second system successfully targets three or more genes (in this case, Dmnt1, 3a and 3b) from the same family by including suitable guides, and causes the stable knockout of multiple genes. This has the broad significance for exploring not only single genes but also the function of entire gene families in living animal tissues. In the past, this has not yet become possible or this can only be achieved by long-term classical genetics, which is particularly important for tissues (such as brain). The applicant has shown that single or multiple gene interferences (even completely knocking down) can occur in post-mitotic cells of normal animals. However, this can be equally applied to model organisms (such as a model organism for having carried a gene mutation or interference or including the expression of a certain class of changes) or transgenic organisms, providing a rapid alternative to existing production model organisms and the method for understanding gene function using model organisms. Additional guides (and / or the complete CRISPR-Cas9 system) can be employed to make subsequent rounds of gene perturbation and / or restoration (restoring gene function, e.g., correcting a perturbed gene by providing, e.g., a repair template such as ssDNA suitable for HDR) within the same organism.

[0313] Indeed, in general, SpCas9-mediated targeting of single or multiple genes can recapitulate morphological, electrophysiological, and behavioral phenotypes observed using classic, more time-consuming genetic mouse models.

[0314] Instead of knocking down entire gene families or related genes, the data here also provide proof of principle that simultaneous knockdown of three or more unrelated genes is equally feasible. This applies to all tissues but is particularly strongly suggested for postmitotic tissues, especially the brain.

[0315] Another useful aspect of this work is that it shows that a combinatorial, or integrated, approach to studying gene function can be taken, employing CRISPR to generate genotypic changes and then using classical tools such as electrophysiology (particularly relevant to brain and CNS tissue), biochemistry, sequencing, electrophysiology, and / or behavioral readouts to establish what, if any, phenotypic changes are due to the genotypic changes induced by the CRISPR-Cas9 system. For example, in the brain, this allows us to study the function of individual genes and groups of genes in neural processes in vivo and their role in brain disorders.

[0316] The successful disruption of genes in this work also applies to correcting or restoring gene function, i.e., using the CRISPR-Cas9 system in gene therapy. This is particularly relevant for targeting post-mitotic cells, especially the brain.

[0317] Overall, the use of the CRISPR-Cas9 system showed improvements over existing technologies such as Zn fingers, which take a long time to design and produce and cannot be multiplexed; and shRNA, which has too many off-target effects that CRISPR off-target effects can be minimized by using a dual nickase approach.

[0318] Targeted tissue

[0319] New work supports the use of the CRISPR-Cas9 system to target genes in post-mitotic cells by delivering the system to the appropriate location (i.e., to cells within the organ or tissue of interest). Preferred tissues are within the following organs:

[0320] kidney;

[0321] digestive system, including the stomach, pancreas, duodenum, ileum, and / or colon;

[0322] heart;

[0323] lung;

[0324] brain, particularly neurons, and / or the CNS in general;

[0325] eyes, including retinal tissue;

[0326] the ear, including the inner ear;

[0327] skin;

[0328] muscle;

[0329] bone; and / or

[0330] Liver (generally), although this was excluded in some examples as it was also the sole subject of administration.

[0331] It will be appreciated that many of the above-mentioned organs may include pre-mitotic cells, but this aspect of the invention is directed to post-mitotic cells or tissues within those organs.

[0332] Specifically, we prefer that the organ is kidney or brain.In the brain, data specifically show delivery to the hippocampus dentate gyrus and visual cortex (being preferred tissue), although in some embodiments also preferably include any one or more of the following other tissues: primary motor cortex, primary auditory cortex, primary somatosensory cortex, cerebellum, main olfactory bulb, prefrontal cortex, piriform nucleus, amygdala, substantia nigra, striatum, globus pallidus, thalamus, hypothalamus, parabrachial nucleus, superior olive complex, cochlear nucleus, mammillary nucleus.In certain embodiments, liver tissue is also preferred.

[0333] Cells from the brain, and in particular neurons, are especially preferred.

[0334] The choice of promoter to drive expression of the CRISPR-Cas9 system (especially Cas9) is important, as mentioned above. The stage of the cell cycle (early / late) and the cell type should be considered when selecting a promoter, as the promoter will be specific for one or more cell types and cell cycle stages. In some embodiments, suitable promoters may include one or more of the following: In some embodiments, suitable promoters may include one or more of the following:

[0335]

[0336] The dual-vector CRISPR-Cas9 system used in targeting the brain, particularly the dentate gyrus of the hippocampus, packages SpCas9 and sgRNA on two separate viral vectors. Therefore, Cas9, particularly SpCAs9, is preferably delivered via an adenoviral vector, particularly AAV (i.e., as AAV-SpCas9). The guide is preferably delivered as an sgRNA expression cassette via an adenoviral vector, particularly AAV (i.e., as AAV-SpGuide). The preferred approach generally used for this tissue (dentate gyrus of the hippocampus) and for the brain is stereotactic injection.

[0337] Understanding and testing gene function and the creation and use of models for this purpose

[0338] Disorders include Huntington's disease, but include essentially any disorder found in post-mitotic cells, and particularly those that can benefit from in vivo study or for which a useful model is lacking.

[0339] As described above, the CRISPR-Cas9 system can be used to inquire about the function of one or more genes in post-mitotic cells. This can be achieved by delivering the CRISPR-Cas9 system to post-mitotic cells and expressing it therein, wherein one or more guides of the CRISPR-Cas9 system are designed to recruit Cas9 to one or more genomic targets of interest. Similarly, in the case where Cas9 is already included in the post-mitotic cell in the form of protein (transcribed), then the delivery of the guide to the post-mitotic cell will be enough. In the case where Cas9 is already included in the post-mitotic cell in the form of polynucleotides (untranscribed), then the delivery of the guide to the post-mitotic cell together with the transcription of the induction Cas9 polynucleotides will be necessary. Advantageously, the Cas9 can be placed under the control of an inducible or repressible promoter such as a tet (tetracycline) switch system.

[0340] A particularly promising aspect is to integrate CRISPR technology with phenotypic determination, to determine the phenotypic changes (if any) caused by gene interference, especially knocking down. For example, example 40 shows what can be achieved by coupling quantitative readout of the genome interference of targeting, to provide an understanding of the biological function of specific genomic elements. Specifically, the in vivo genome editing of Cas9-mediation in the brain can also be coupled with electrophysiological recordings to study the impact of genome interference on specific cell types or circuit components. In a broader sense, using CRISPR-Cas9 system (to provide Cas9-mediated genome interference) can be combined with biochemistry, sequencing, electrophysiology and behavioral analysis to study the function of the genomic elements of targeting.

[0341] Thus, in one aspect, there is provided: a method of interrogating the function of one or more genes in a post-mitotic cell, the method comprising:

[0342] Inducing a defective genotype or gene knockdown as described below; and

[0343] The changes in expression of the one or more genes in the disorder are determined, thereby interrogating the function of the one or more genes.

[0344] Optionally, the method may further comprise:

[0345] The second cell population is transplanted into the subject, thereby inducing a condition associated with the defective genotype or gene knockdown. This may precede the determining step.

[0346] The following is broadly applicable to various appropriate aspects of the present invention. The cells may be in a subject, such as a human, an animal, or a model organism, so that gene function can be interrogated in vivo. However, it is also envisioned that the cells may be isolated, such as in cell culture or in a model organ or organoid. In some embodiments, the method may include isolating a first cell population from a subject, optionally culturing them, and transducing them with one or more CRISPR-Cas9 systems. Other optional cultures may follow. The transduced cells may then be transplanted back into the subject.

[0347] The cell can be from any tissue or organ described herein. The brain is a preferred embodiment, The method for inquiring about the function of one or more genes is provided, wherein the post-mitotic cell is a brain cell, such as a neuron. In particular, in vivo, this allows for inquiry into the gene function of animal behavior. The animal is preferably a mammal, such as a rodent. Taking into account the complexity of the nervous system composed of an intricate network of heterogeneous cell types, the genome of neurons in vivo can be efficiently edited to enable guidance of the test of gene function in the relevant cell type embedded in the natural background. This is supported by our data, in which knockout mice show impaired memory consolidation when tested under training context conditions. Our results confirm that the knockout of DNMT family members mediated by CRIPSR-Cas9- in dentate gyrus neurons is sufficient to probe the function of genes in behavioral tasks.

[0348] This demonstrates the versatility of Cas9 in promoting targeted gene knockout in the mammalian brain in vivo for studying gene function and, in particular, for dissecting neuronal circuits. Introducing stable knockout of multiple genes in the brain of living animals has potentially profound applications, such as causal interrogation of multigenic mechanisms in physiological and neuropathological conditions.

[0349] The characteristic of this work is that we selected the mouse Mecp2 promoter (235bp, pMecp2)7 and the minimum polyadenylation signal (48bp, spA) based on their ability to achieve sufficient levels of SpCas9 expression in cultured primary mouse cortical neurons. The Mecp2 gene plays a major role in Rett syndrome, a type of autism spectrum disorder. In order to target Mecp2, we first designed several sgRNAs targeting exon 3 of the mouse Mecp2 gene and evaluated their efficacy using Neuro-2a cells. The most efficient sgRNA was identified using the SURVEYOR nuclease assay. The delivery was via stereotactic injection of a mixture of high-titer AAV-SpCas9 and AAV-SpGuide (1: 1 ratio). We also successfully tested the possibility of multivariate genome editing in the brain. We designed a multivariate sgRNA expression vector consisting of three tandem sgRNAs together with GFP-KASH for nuclear labeling.

[0350] Therefore, methods of inducing conditions are also provided that involve knocking down one or more genes in post-mitotic cells. Examples of such conditions are numerous, but examples may include Rett syndrome. Suitable promoters will be clear, and the Mecp2 promoter is ideal for Rett syndrome. One way to select a promoter to drive expression of a CRISPR-Cas9 system (particularly Cas9) is to select the promoter for the gene of interest.

[0351] Thus, in one aspect, there is provided: a method of inducing a condition involving one or more defective genes (or genotypes) or gene knockdown in a post-mitotic cell, the method comprising:

[0352] The first cell population is transduced with a non-naturally occurring or engineered composition comprising a vector system comprising one or more vectors comprising

[0353] A first regulatory element operably linked to a CRISPR-Cas system chimeric RNA (chiRNA) polynucleotide sequence, wherein the polynucleotide sequence comprises

[0354] one or more, preferably three or more, guide sequences capable of hybridizing to three or more target sequences in the genome of the subject,

[0355] tracr mate sequence, and

[0356] tracr sequence, and

[0357] a second regulatory element operably linked to an enzyme-coding sequence encoding a CRISPR enzyme comprising at least one or more nuclear localization sequences (NLS), wherein (a), (b) and (c) are arranged in a 5' to 3' direction,

[0358] wherein components I and II are located on the same or different vectors of the system, wherein upon transcription, the tracr mate sequence hybridizes to the tracr sequence and the guide sequence directs sequence-specific binding of the CRISPR complex to the target sequence,

[0359] wherein the CRISPR complex comprises a CRISPR enzyme complexed with (1) the guide sequence that is hybridized or hybridizable to the target sequence, and (2) the tracr mate sequence that is hybridized or hybridizable to the tracr sequence,

[0360] The CRISPR enzyme alters the genome of the first cell population to obtain a second cell population carrying the one or more defective genes or knocked-down genes.

[0361] Optionally, the method may further comprise:

[0362] A first cell population is isolated from the subject.

[0363] Optionally, the method may further comprise:

[0364] The second cell population is transplanted into the subject thereby inducing a proliferative disorder.

[0365] This essentially involves inducing a non-functional (including partially non-functional) genotype into target cells to thereby provide a model for study including future restoration of a functional genotype.

[0366] In cellular assays, the CRISPR-Cas9 system can also be used to facilitate the study of gene function by enabling targeted knockout in postmitotic neurons.

[0367] Methods for delivering nucleotides to neuronal cells are well known and reviewed by Karra and Dahm in the Journal of Neuroscience (May 5, 2010, 30(18):6171-6177; doi: 10.1523 / JNEUROSCI.0183-10.2010). Examples include electrofection methods (e.g., electroporation, nucleofection, and single-cell electroporation); chemical transfection methods (e.g., Ca2+ phosphate co-precipitation and lipofection); viral delivery (e.g., adenovirus, adeno-associated virus (AAV), lentivirus, and herpes simplex virus); and physical transfection methods (e.g., microinjection and gene gun (DNA-coated gold particles). All of these can be used to deliver the CRISPR-Cas9 system, but lipofection or viral methods, especially AAV or lentivirus, are preferred.

[0368] Model

[0369] Model is provided with single or multiple gene knockdown. An example will be the rodent model for Rett syndrome, Mecp2 knockdown. Others include Dmnt family knockdown, particularly Dmnt1, 3a and 3b knockdown. In this way, a model for studying neurological disorders is provided. All that needs to be accomplished is to identify the target gene of interest, design one or more guides that are suitable, and include these in a suitable CRISPR-Cas9 system and deliver it to one or more post-mitotic cells, either in vivo or in vitro (as needed). For example, these models can have a dendritic tree morphology that changes, and / or dendritic spine density is provided.

[0370] As mentioned above, model tissues are also provided, such as organoids or "liver on a chip" or their non-liver equivalents, such as ear, kidney and brain tissue, for example on a chip or supported on a scaffold. Animal models and model tissues are preferred. These may have been transformed with Cas9 so that they include Cas9 in nucleotide or protein form, as mentioned above. These have the advantage that Cas9 does not need to be delivered accompanied by one or more guides, and this in turn can allow a greater degree of (guide) diversity to be accommodated within the delivery vector. Again, it may be advantageous to use inducible or repressible systems such as tet-on or tet-off here.

[0371] Models that can be obtained using the CRISPR-Cas9 system are described herein and are within the scope of the skilled artisan based on this disclosure and the knowledge in the art. Due to the versatility of the CRISPR-Cas9 system, the range of possible models, whether human, rodent, mammalian, or otherwise, is vastly different and can be established by simply selecting one or more appropriate guides. Methods for creating such models are also provided.

[0372] Gene therapy

[0373] The data in embodiment 40 focus on gene interference, mainly knock down.Gene knockdown may only be a small (if important) part in the total population of the possible application of CRISPR-Cas9 system in gene therapy. As shown in Yin (Yin) and Anderson (Anderson) paper (《Nature Biotechnology》 (Nature Biotech) 2884 online disclosure, March 30, 2014), functional phenotype can be restored after the defective mutation in correction type I hereditary tyrosinemia (HTI), the I type hereditary tyrosinemia is a disease that would otherwise be fatal, it is caused by the mutation (G becomes A in the last nucleotide of exon 8) of fumarylacetoacetate hydrolase (FAH), the mutation causes the skipping of exon 8 during splicing and leads to the formation of the unstable FAH protein of truncation, causing the accumulation of toxic metabolites. A mutation correction back to wild type G genotype leads to the phenotype of recovery.

[0374] Like this, the approach taken in this work can be reasonably applied to gene therapy.Specifically, the characteristics of the dual vector approach, nuclear labeling approach, brain delivery (injection form used, promoter box / or viral vector), together with diversified (using multiple guides for multiple targets in the same gene or different genes) can be applied to correction gene therapy (that is, wherein defective genotype is corrected) as the gene knockout applied to illustration.The main difference between correction gene therapy and gene knockout is that, in order to correct defective genotype, such as point mutation (for example, cystic fibrosis, referring to reference Shi Wanke (Schwank) et al., " cell-stem cell " (Cell Stem Cell) 13, 653-658, December 5, 2013), it is advantageous to provide repair template to stimulate HDR mechanism and also ideally provide suitable Cas9 nickase.

[0375] Therefore, the vector of the present invention preferably targets post-mitotic cells. When one or more guides target defective genotypes, a repair template corresponding to the corrected sequence (genotype providing a functional phenotype), such as ssDNA, is also preferably provided. The repair template is described herein. Cas9 can be provided in a vector that is the same as or different from the vector of the one or more guides. These vectors are preferably viral vectors, more preferably adenoviral vectors, and most preferably AAV vectors. Delivery to cells is preferably by intravenous injection or by stereotactic injection, as the case may be. The choice of promoter can also be important, and preferred examples are provided herein.

[0376] Provided is a method for treating a genetic disease or condition caused by or associated with a defective genotype in a post-mitotic cell, the method comprising delivering a CRISPR-Cas9 system to an appropriate cell. The defective genotype may be a non-wild-type genotype. Specifically, single point mutations and / or monogenic disorders are particularly suitable for treatment using the CRISPR-Cas9 system. When multiple genes need to be edited or corrected, a multi-pronged approach can be used to target all of them simultaneously. Alternatively, two or more rounds of different CRISPR-Cas9 systems can be envisioned. Preferably, the wild-type genotype is corrected. It does not necessarily have to be the most common genotype, provided that the function is restored or improved in terms of phenotype.

[0377] An example of a restored phenotype is hearing restoration, restoring VGLUT3 function and thereby restoring inner ear hearing in mice (Omar Akil, Rebecca P. Seal, Kevin Burke, Chuansong Wang, Aurash Alemi, Matthew During, Robert H. Edwards, Lawrence R. Lustig. Restoration of Hearing in the VGLUT3 Knockout Mouse Using Virally Mediated Gene Therapy. Neuron, 2012; 75(2): 283 DOI: 10.1016 / j.neuron.2012.05.019). This is the use of AAV-mediated delivery of VGLUT3 itself, but it is entirely reasonable to use the CRISPR-Cas9 system, preferably also using an AAV vector, to target inner ear cells and correct the non-functional VGLUT3 genotype, with a similar phenotypic outcome, i.e., restoration of hearing. Thus, it is preferred to use an AAV vector to deliver the CRISPR-Cas9 system to the inner ear, thereby treating hearing loss. In fact, it is preferred to restore gene function in sensory organs such as the eye (including the retina), nose, and ear (particularly the inner ear).

[0378] A relatively recent review that includes a discussion of disorders in postmitotic tissues (eye, ear, etc.) is by Kaufmann et al. (EMBO Mol Med) (2013(5, p1642-1661). This confirms the usefulness of AAV in correcting monogenic disorders in postmitotic tissues. It states, "Combined with other features such as low inflammatory activity, they have been shown to have an excellent safety profile and are therefore very attractive tools for in vivo gene therapy. Indeed, Glybera is a recombinant AAV for direct intramuscular injection...” The paper with the citation reviews gene therapy in the retina, central nervous system, liver, bone and myocardium as target tissues. And, under the citation, it is indicated that “Initial studies explored the prototype AAV serotype 2 vector, and the collection of AAV vectors has recently expanded to include additional serotypes and even engineered capsids.” The references cited in Kaufman and Kaufman are hereby incorporated herein by reference.

[0379] RNAseq analysis of the transcriptome

[0380] The combination of SpCas9-mediated genome interference and population-level RNAseq analysis provides a way to characterize transcriptional regulation and suggest that genes for specific functions or disease processes in the cells under consideration may be important genes. Specifically, cells are from the brain, particularly neurons. Rapid-acting technologies such as CRISPR-Cas9 systems are advantageous in studying transcriptomes, as they are instantaneous in nature. Thus, the use of the CRISPR-Cas9 system according to the present invention in analyzing transcriptomes (RNAseq) is provided.

[0381] Nuclear labeling method

[0382] To facilitate immunofluorescence identification of neurons expressing SpCas9, we tagged SpCas9 with an HA-epitope tag (derived from human influenza hemagglutinin, a universal epitope tag widely used in expression vectors).

[0383] For the AAV-SpGuide vector, we packaged the U6-sgRNA expression cassette along with green fluorescent protein (GFP) driven by the human synapsin I promoter fused to the KASH nuclear transmembrane domain. This GFP-KASH fusion protein directs GFP to the outer nuclear membrane and enables fluorescence-based identification and purification of intact neuronal nuclei transduced by AAV-SpGuide.

[0384] Therefore, these vectors of the present invention are preferably adapted in a similar manner. Therefore, these vectors are provided, wherein the Cas9 is labeled with an epitope tag such as an HA-epitope tag. The Cas9 can be any Cas9 described herein, such as Sp or SaCas9, and can be any variant (such as D10A double nickase, etc.), provided that it is or can be appropriately labeled.

[0385] The vectors of the invention can also be adapted such that the guide RNA is packaged within an expression cassette comprising:

[0386] reporter protein; and

[0387] Optionally, a suitable promoter for the guide RNA, such as U6;

[0388] The reporter protein is fused to a nuclear transmembrane domain, and the nuclear transmembrane domain is operably linked to a suitable promoter.

[0389] The reporter protein is preferably a fluorescent protein, such as one of green, red or yellow fluorescent proteins (GFP, RFP, YFP) and the like.

[0390] Examples of nuclear transmembrane domains include KASH-like domains, Sun2 domains, and LEM domains. In some preferred embodiments, the nuclear transmembrane domain is a KASH nuclear transmembrane domain. Preferably, the promoter used for the transmembrane domain is the human synapsin I promoter; see also the documents cited herein.

[0391] This labeling approach can be used in either single or dual vector systems, but is preferred in dual vector systems because space is limited in single vector systems and also reduces the need for separate tags.

[0392] Furthermore, each aspect of this labeling technology can be used independently of the other, such that epitope tagging of Cas9 can be used alone, or the reporter protein / fluorescent protein cassette approach can be used alone, or more preferably, both can be used together.

[0393] Multiple or repeat epitope tags are preferred for this Cas9. Specifically, a triple epitope tag is shown in Example 41 to improve detection. The tag is preferably a repeat, more preferably a triplicate. HA is a preferred Cas9 epitope tag. Therefore, a triple HA epitope tag is preferred in some embodiments.

[0394] Kanasty and Anderson (Nature Materials, Vol. 12, November 2013) is a useful review originally submitted on March 11, 2013 and published online on October 23, 2013 on the delivery of RNAi. Due to the similarities between RNAi and CRISPR guide sequences, the teachings in this and other fields on RNAi provide information on the mechanisms of guide delivery in our CRISPR-Cas9 system. Some of the techniques described are also applicable to the delivery of Cas9. In some cases, it may be useful to deliver the guides of our CRISPR-Cas9 system independently of Cas9. This can be part of a two-vector delivery system, where the vectors are considered in the broadest sense to be simply any means of delivery, rather than specific viral vectors. It is envisioned that the Cas9 can be delivered via a viral vector, and the guide specific for the genomic target delivered separately. As discussed herein, the guide can be delivered via the same vector type as Cas9, such as a dual vector system in which the Cas9 is delivered in an AAV vector and the one or more guides are delivered in separate AAV vectors. This can be done essentially simultaneously (i.e., co-delivery), but it can also be done at separate time points, even weeks or months apart. For example, if the first round of the CRISPR-Cas9 system has been delivered, but then additional guides need to be provided subsequently, the original Cas9, which is expected to still be functional in the target cells, can be reused. If the Cas9 is under the control of an inducible promoter, induction of transcription of the new CAs9 in the target cells is preferred. Similarly, if the CAs9-expression model provided for this article is used, only the delivery of one or more guides is necessary. Therefore, when the delivery of one or more guides needs to be independent of Cas9, they can be delivered in a manner very similar to RNAi. In this way, Canast's review helps to point out the number of known pathways that are suitable, particularly focused on the liver, although these delivery methods are generally appropriate for a wide range of cells. Examples include:

[0395] "The liposomal delivery system, along with siRNA conjugated to a lipophilic molecule, interacts with serum lipoproteins and subsequently gains access to liver cells that take up those lipoproteins;"

[0396] PEGylation;

[0397] Conjugates such as:

[0398] a. Dynamic Polyconjugate (DPC, 10 nm nanoparticles), which have been shown to deliver RNAi to successfully inhibit ApoB (thus intersecting with our work on targeting ApoB via the CRISPR-Cas9 system); and

[0399] b. Tribranched GalNAc conjugate

[0400] c. are "all highly effective", especially GalNAc;

[0401] Other nanoparticles include:

[0402] d. Cyclodextrin polymer nanoparticles (CDP) comprising additional formulation components such as adamantane-PEG (AD-PEG) and adamantane-PEG-transferrin (AD-PEG-Tf);

[0403] e. Lipid nanoparticles (LNPs), including cationic or ionizable lipids, shielding lipids, cholesterol, and endogenous or exogenous targeting ligands. An example of an endogenous targeting ligand is retinol binding protein (RBP), which can be used to target liver and pancreatic stellate cells that express RBP receptors. An example of an exogenous targeting ligand is GalNac, which also targets the liver via the asialoglycoprotein receptor on hepatocytes. A combined approach is described in Anlylams ALN-VSP;

[0404] "Fenestrations in the liver endothelium allow molecules 100-200 nm in diameter to diffuse out of the bloodstream and into hepatocytes and other liver cells"

[0405] Ligands such as GalNAc are suitable for delivery to non-parenchymal liver cells that express the mannose receptor, and to hepatocytes, where conjugation of suitable siRNA to the GalNAc ligand has been shown to successfully inhibit PCSK9; and

[0406] Oligonucleotide nanoparticles (ONPs) are composed of complementary DNA fragments designed to hybridize to predefined 3D structures. Using appropriate 3' overhang sequences, six siRNA strands can be attached to each particle, even at specific locations. The hydrodynamic diameter is approximately 29 nm.

[0407] These methods are preferred in some embodiments for delivering at least guides for CRISPR-Cas9 systems. Particularly preferred are dynamic polyconjugates or the use of endogenous targeting ligands (e.g., retinol binding protein) or exogenous targeting ligands (e.g., GalNac).

[0408] One advantage of the present method is that the CRISPR system avoids off-target binding and its resulting side effects. This is achieved by using a system that is designed to have a high degree of sequence specificity for the target DNA.

[0409] Cas9

[0410] Cas9 optimization can be used to enhance function or to develop new functions, and people can produce chimeric Cas9 proteins. Examples that the applicant has produced are provided in Example 6. Chimeric Cas9 proteins can be made by combining fragments from different Cas9 homologs. For example, two exemplary chimeric Cas9 proteins are from the Cas9 described herein. For example, the applicant fused the N-terminus of St1Cas9 (the fragment from this protein is bold) to the C-terminus of SpCas9. The benefits of making chimeric Cas9 include any or all of the following: reduced toxicity; improved expression in eukaryotic cells; enhanced specificity; reduced protein molecular weight, for example, by combining the minimum domains from different Cas9 homologs to make the protein smaller; and / or changing the PAM sequence requirements.

[0411] The Cas9 can be used as a universal DNA binding protein. For example, as shown in Example 7, By mutating the two catalytic domains (D10 and H840) responsible for cutting the two chains of the DNA target, the applicant uses Cas9 as a universal DNA binding protein. In order to increase gene transcription at the target seat, the applicant fuses the transcription activation structural domain (VP64) to Cas9. Other transcription activation domains are known. As shown in Example 17, transcriptional activation is possible. As also shown in Example 17, using the Cas9 repressor (DNA binding domain) bound to the target gene sequence, gene repression (in the case of the β-catenin gene) is possible, thereby suppressing its activity.

[0412] Cas9 and one or more guide RNAs can be delivered using adeno-associated virus (AAV), lentivirus, adenovirus or other plasmid or viral vector types, in particular, using formulations and dosages from the following literature: for example, U.S. Patent Nos. 8,454,972 (formulations, dosages for adenovirus), 8,404,658 (formulations, dosages for AAV) and 5,846,946 (formulations, dosages for DNA plasmids) and publications from clinical trials and clinical trials involving lentivirus, AAV, and adenovirus. For example, for AAV, the route of administration, formulation and dosage can be as in U.S. Patent No. 8,454,972 and as in clinical trials involving AAV. For adenovirus, the route of administration, formulation and dosage can be as in U.S. Patent No. 8,404,658 and as in clinical trials involving adenovirus. For plasmid delivery, the route of administration, formulation and dosage can be as in U.S. Patent No. 5,846,946 and as in clinical trials involving plasmids. Dosage can be based on or extrapolated to an average 70 kg individual and can be adjusted for patients, subjects, mammals of different weights and species. The frequency of administration is within the scope of the medical or veterinary practitioner (e.g., physician, veterinarian) and depends on conventional factors, including the patient's or subject's age, sex, general health, other conditions, and the particular condition or symptom being addressed.

[0413] Viral vectors can be injected into the tissue of interest. For cell type-specific genome modification, Cas9 expression can be driven by a cell type-specific promoter. For example, liver-specific expression can use the albumin promoter, while neuron-specific expression can use the synapsin I promoter.

[0414] genetically modified animals and plants

[0415] Transgenic animals (models) are also provided, and the following are equally applicable to the collection of in vitro model tissues and tissues, such as organoids, liver on a chip, etc. Preferred examples include animals containing Cas9 (with respect to the polynucleotides encoding Cas9 or the protein itself). Mice, rats and rabbits are preferred. In order to produce transgenic mice with these constructs as exemplified herein, people can inject pure linear DNA into the pronucleus of the zygote from a pseudopregnant female (e.g., CB56 female). The founder mice (founder) are then identified, genotyped and backcrossed with CB57. Then, these constructs are cloned and optionally confirmed, for example, by Sanger sequencing. In the case where, for example, one or more genes are knocked out in the model, knockout is envisioned. However, knock-in (alone or in combination) is also envisioned. A kind of exemplary knock-in Cas9 mouse has been produced, and this is exemplary, but Cas9 knock-in is preferred. In order to produce Cas9 knock-in mice, people can target the same constitutive or conditional construct to the Rosa26 seat, as described herein ( Figure 25A -B and 26). The methods of U.S. Patent Publication Nos. 20120017290 and 20110265198 for targeting the Rosa locus, assigned to Sangamo BioSciences, Inc., can be modified to utilize the CRISPR Cas system of the present invention. In another embodiment, the method of U.S. Patent Publication No. 20130236946 for targeting the Rosa locus, assigned to Cellectis, can also be modified to utilize the CRISPR Cas system of the present invention.

[0416] Practicality of conditional Cas9 mice: Applicants have shown in 293 cells that Cas9 conditional expression constructs can be activated by co-expression with Cre. Applicants have also shown that correctly targeted R1 mESCs can have active Cas9 when Cre is expressed. Because Cas9 is followed by a P2A peptide cleavage sequence and then EGFP, Applicants identified successful expression by observing EGFP. Applicants have shown Cas9 activation in mESCs. This same concept is what makes conditional Cas9 mice so useful. Applicants can cross their conditional Cas9 mice with mice that ubiquitously express Cre (ACTB-Cre line) and can obtain mice that express Cas9 in every cell. Only the delivery of chimeric RNA should be used to induce genome editing in embryonic or adult mice. Interestingly, if conditional Cas9 mice are crossed with mice that express Cre under a tissue-specific promoter, Cas9 will only be present in tissues that also express Cre. By delivering chimeric RNA to the same tissue, this approach can be used to edit the genome only in precise tissues.

[0417] As mentioned above, transgenic animals are also provided. In this respect, transgenic animals, especially mammals such as livestock (cows, sheep, goats and pigs), but also poultry and edible insects, are preferred.

[0418] Adeno-associated virus (AAV)

[0419] AAV is advantageous over other viral vectors for in vivo delivery for several reasons:

[0420] Low toxicity (this may be due to the purification method not requiring ultracentrifugation of cell pellets, which could activate an immune response)

[0421] Low probability of causing insertional mutagenesis because it is not integrated into the host genome.

[0422] AAV has a packaging limit of 4.5 or 4.75 Kb. This means that Cas9, as well as the promoter and transcription terminator, must all fit into the same viral vector. Constructs larger than 4.5 or 4.75 Kb will result in a significant reduction in viral production. SpCas9 is quite large, with the gene itself exceeding 4.1 Kb, making it difficult to package into AAV. Therefore, embodiments of the present invention include the use of shorter Cas9 homologs. For example:

[0423]

[0424] These species are therefore generally preferred Cas9 species.Applicants have shown delivery and in vivo mouse brain Cas9 expression data.

[0425] Two ways of mediating in vivo genome modification, packaging of Cas9 encoding nucleic acid molecules such as DNA into viral vectors, are preferred:

[0426] To achieve NHEJ-mediated gene knockout:

[0427] Single viral vector:

[0428] Vectors containing two or more expression cassettes:

[0429] Promoter-Cas9 encoding nucleic acid molecule-terminator

[0430] Promoter-gRNA1-terminator

[0431] Promoter-gRNA2-terminator

[0432] Promoter-gRNA(N)-terminator (until the size limit of the vector)

[0433] Dual viral vectors:

[0434] Vector 1 containing an expression cassette for driving Cas9 expression

[0435] Promoter-Cas9 encoding nucleic acid molecule-terminator

[0436] Vector 2 containing one or more expression cassettes for driving expression of one or more guide RNAs

[0437] Promoter-gRNA1-terminator

[0438] Promoter-gRNA(N)-terminator (until the size limit of the vector)

[0439] To mediate homology-directed repair. In addition to the single and dual viral vector approaches described above, additional vectors can be used to deliver homology-directed repair templates.

[0440] Promoters used to drive expression of Cas9-encoding nucleic acid molecules include:

[0441] AAV ITR can be used as a promoter: This is advantageous in that it eliminates the need for additional promoter elements (which can take up space in the vector). The freed-up space can be used to drive the expression of additional elements (gRNA, etc.). Similarly, ITR activity is relatively weak and can therefore be used to reduce the toxicity caused by overexpression of Cas9.

[0442] For ubiquitous expression, promoters CMV, CAG, CBh, PGK, SV40, ferritin heavy or light chain, etc. can be used.

[0443] For brain expression, promoters can be used: Synapsin I for all neurons, CaMKIIα for excitatory neurons, GAD67 or GAD65 or VGAT for GABAergic neurons, etc.

[0444] For liver expression, the albumin promoter can be used.

[0445] For lung expression, SP-B can be used.

[0446] For endothelial cells, ICAM can be used.

[0447] For hematopoietic cells, IFNβ or CD45 can be used.

[0448] For osteoblasts, OG-2 can be used.

[0449] Promoters used to drive guide RNAs can include:

[0450] Pol III promoters, such as U6 or H1

[0451] Use Pol II promoters and intronic cassettes to express gRNA

[0452] With respect to AAV, the AAV can be AAV1, AAV2, AAV5, or any combination thereof. The AAV can be selected relative to the AAV of the cell to be targeted; for example, AAV serotypes 1, 2, 5, or hybrid capsids AAV1, AAV2, AAV5, or any combination thereof can be selected for targeting brain or neuronal cells; and AAV4 can be selected for targeting cardiac tissue. AAV8 can be used for delivery to the liver. The above promoters and vectors are individually preferred.

[0453] RNA delivery is also a useful in vivo delivery method. Figure 27 Delivery and in vivo mouse brain Cas9 expression data are shown. It is possible to use liposomes or nanoparticles to deliver Cas9 and gRNA (and, for example, HR repair templates) into cells. Therefore, the delivery of CRISPR enzymes such as Cas9 and / or the delivery of the RNA of the present invention can be in the form of RNA and carried out via microvesicles, liposomes or nanoparticles. For example, Cas9 mRNA and gRNA can be packaged into liposome particles for in vivo delivery. Liposome transfection reagents such as lipofectamine from Life Technologies and other commercially available reagents can effectively deliver RNA molecules to the liver.

[0454] Improving NHEJ or HR efficiency also helps delivery. Preferably, NHEJ efficiency is enhanced by co-expressing end-processing enzymes such as Trex2 (Dumitrache et al. Genetics August 2011; 188(4):787-797). Preferably, HR efficiency is increased by transient inhibition of NHEJ mechanisms such as Ku70 and Ku86. HR efficiency can also be increased by co-expressing prokaryotic or eukaryotic homologous recombination enzymes such as RecBCD, RecA.

[0455] Various means of delivery are described herein and discussed further in this section.

[0456] Viral delivery: The CRISPR enzyme, such as Cas9, and / or any RNA of the invention, such as a guide RNA, can be delivered using adeno-associated virus (AAV), lentivirus, adenovirus or other viral vector types, or a combination thereof. Cas9 and one or more guide RNAs can be packaged into one or more viral vectors. In some embodiments, viral vectors can be delivered to the tissue of interest, for example, by intramuscular injection, while viral delivery is sometimes performed via intravenous, transdermal, intranasal, oral, mucosal, or other delivery methods. Such delivery can be performed via a single dose or multiple doses. It is understood by those skilled in the art that the actual dose to be delivered herein can vary greatly depending on a variety of factors, such as vector selection, target cell, organism, or tissue, the general condition of the subject to be treated, the degree of transformation / modification sought, route of administration, mode of administration, type of transformation / modification sought, and the like.

[0457] Such dosage forms may further contain, for example, a carrier (water, saline, ethanol, glycerol, lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, peanut oil, sesame oil, etc.), a diluent, a pharmaceutically acceptable carrier (e.g., phosphate-buffered saline), a pharmaceutically acceptable excipient, and / or other compounds known in the art. Such a dosage formulation can be readily determined by one skilled in the art. The dosage form may further contain one or more pharmaceutically acceptable salts, such as, for example, inorganic acid salts such as hydrochlorides, hydrobromides, phosphates, sulfates, etc.; and organic acid salts such as acetates, propionates, malonates, benzoates, etc. In addition, auxiliary substances may also be present, such as wetting agents or emulsifiers, pH buffering substances, gels or gelling materials, flavorings, colorants, microspheres, polymers, suspending agents, etc. In addition, one or more other conventional pharmaceutical ingredients may be present, such as preservatives, wetting agents, suspending agents, surfactants, antioxidants, anticaking agents, fillers, chelating agents, coating agents, chemical stabilizers or the like, especially when the dosage form is a reconstituted form. Suitable exemplary ingredients include microcrystalline cellulose, sodium carboxymethyl cellulose, polysorbate 80, phenylethyl alcohol, chlorobutanol, potassium sorbate, ascorbic acid, sulfur dioxide, propyl gallate, parabens, ethyl vanillin, glycerol, phenol, parachlorophenol, gelatin, albumin and a combination thereof. The thorough discussion of pharmaceutically acceptable excipients is available from REMINGTON'S PHARMACEUTICAL SCIENCES (Mark Publishing Company, New York, 1991), which is incorporated herein by reference.

[0458] In one embodiment herein, delivery is via an adenovirus, which may contain at least 1 x 10 5 A single booster dose of adenoviral vector particles (also referred to as particle units, pu). In one embodiment herein, the dose is preferably at least about 1x10 6 particles (e.g., approximately 1x10 6 -1x10 12 particles), more preferably at least about 1×10 7 particles, more preferably at least about 1x10 8 particles (e.g., approximately 1x10 8 -1x10 11 particles or about 1x10 8 -1x10 12 particles), and most preferably at least about 1 x 10 0 particles (e.g., approximately 1x10 9 -1x10 10 particles or about 1x10 9-1x10 12 particles), or even at least about 1x10 10 particles (e.g., approximately 1x10 10 - 1x10 12 particles). Alternatively, the dose comprises no more than about 1 x 10 14 particles, preferably no more than about 1x10 13 particles, even more preferably no more than about 1 x 10 12 particles, even more preferably no more than about 1 x 10 11 particles, and most preferably no more than about 1 x 10 10 particles (e.g., no more than about 1 x 10 9 particles). Thus, the dose may contain a single dose of adenoviral vector having, for example, approximately 1 x 10 6 Particle unit (pu), about 2x10 6 pu, about 4x10 6 pu, about 1x10 7 pu, about 2x 10 7 pu, about 4x10 7 pu, about 1x10 8 pu, about 2x10 8 pu, about 4x10 8 pu, about 1x10 9 pu, about 2x10 9 pu, about 4x10 9 pu, about 1x10 10 pu, about 2x10 10 pu, about 4x10 10 pu, about 1x10 11 pu, about 2x10 11 pu, about 4x10 11 pu, about 1x10 12 pu, about 2x10 12 pu, or about 4x10 12 See, for example, the adenoviral vectors in U.S. Patent No. 8,454,972 B2 to Nabel et al., issued June 4, 2013 (incorporated herein by reference) and the dosage forms at column 29, lines 36-58 thereof. In one embodiment herein, the adenovirus is delivered via multiple doses.

[0459] In one embodiment herein, the delivery is via AAV. A therapeutically effective dose for in vivo delivery of AAV to humans is believed to be in the range of about 1 x 10 10 to about 1x 10 10The dosage ranges from about 20 to about 50 ml of saline solution per ml of functional AAV. The dosage can be adjusted to balance the therapeutic benefit against any side effects. In one embodiment herein, the AAV dosage ranges from about 1 x 10 5 to 1x10 50 AAV genomes, from approximately 1x10 8 to 1x 10 20 AAV genomes, from approximately 1x10 10 to about 1x10 16 genomes, or approximately 1x10 11 to about 1 x10 16 AAV genome concentrations are in the range of 1x10 13 genome AAV. Such concentrations can be delivered in volumes of from about 0.001 ml to about 100 ml, from about 0.05 ml to about 50 ml, or from about 10 ml to about 25 ml of vector solution. Other effective doses can be readily established by one of ordinary skill in the art through routine experimentation to establish dose-response curves. See, e.g., U.S. Patent No. 8,404,658 B2 to Hajjar et al., issued March 26, 2013, at column 27, lines 45-60.

[0460] In one embodiment herein, the delivery is via a plasmid. In such a plasmid composition, the dosage should be an amount of plasmid sufficient to elicit a response. For example, an appropriate amount of plasmid DNA in a plasmid composition can be from about 0.1 to about 2 mg, or from about 1 μg to about 10 μg.

[0461] The dosage herein is based on an average 70 kg individual. The frequency of administration is within the scope of a medical or veterinary practitioner (e.g., physician, veterinarian) or a scientist skilled in the art. The mice used in the experiment are approximately 20 g. Based on the amount given to a 20 g mouse, one can extrapolate to a 70 kg individual.

[0462] Lentivirus

[0463] Lentiviruses are complex retroviruses that have the ability to infect and express their genes in both mitotic and post-mitotic cells. The best-known lentivirus is the human immunodeficiency virus (HIV), which uses the envelope glycoproteins of other viruses to target a wide range of cell types.

[0464] Slow virus can be prepared as follows. After cloning pCasES10 (containing slow virus transfer plasmid backbone), HEK293FT at low passage number (p=5) is seeded in a T-75 flask until 50% confluence in DMEM with 10% fetal bovine serum and no antibiotics the day before transfection. After 20 hours, the culture medium was replaced with OptiMEM (serum-free) culture medium, and transfection was performed after 4 hours. The cells were transfected with 10 μg of slow virus transfer plasmid (pCasES10) and the following packaging plasmids: 5 μg of pMD2.G (VSV-g pseudotype) and 7.5 μg of psPAX2 (gag / pol / rev / tat). Transfection was performed in 4 mL of OptiMEM with a cationic lipid delivery agent (50 μL of Lipofectamine 2000 and 100 μl of Plus reagent). After 6 hours, the culture medium was replaced with DMEM without antibiotics with 10% fetal bovine serum.

[0465] Lentivirus can be purified as follows. Harvest the viral supernatant after 48 hours. First, remove the supernatant from debris and filter through a 0.45 μm low protein binding (PVDF) filter. Then spin them in an ultracentrifuge at 24,000 rpm for 2 hours. Resuspend the viral pellet in 50 μl of DMEM at 4°C overnight. Then aliquot them and immediately freeze at -80°C.

[0466] In another embodiment, minimal non-primate lentiviral vectors based on equine infectious anemia virus (EIAV) are also contemplated, particularly for ocular gene therapy (see, e.g., Balagaan, J Gene Med 2006;8:275-285, published online in Wiley InterScience on November 21, 2005; available at interscience.wiley.com. DOI:10.1002 / jgm.845). In another embodiment, minimal non-primate lentiviral vectors based on equine infectious anemia virus (EIAV) are also contemplated, particularly for ocular gene therapy (see, e.g., Balagaan, J Gene Med 2006;8:275-285, published online in Wiley InterScience on November 21, 2005; available at interscience.wiley.com. DOI:10.1002 / jgm.845). An equine infectious anemia virus-based lentiviral gene therapy vector expressing angiostatic proteins (endostatin and angiostatin) for the treatment of the wet form of age-related macular degeneration via subretinal injection (see, e.g., Binley et al., HUMANGENE THERAPY 23:980-991 (September 2012)) can be modified for use with the CRISPR-Cas system of the present invention.

[0467] In another embodiment, a self-inactivating lentiviral vector having siRNA targeting a common exon shared by HIV tat / rev, a nucleolar-localized TAR decoy, and an anti-CCR5 specific hammerhead ribozyme (see, e.g., DiGiusto et al. (2010) Sci Transl Med 2:36ra43) can be used and / or adapted for the CRISPR-Cas system of the present invention. A minimum of 2.5×10 6 CD34+ cells / kg patient body weight, and 2×10 6 Cells were pre-stimulated for 16 to 20 hours at a density of 10 cells / ml in X-VIVO 15 medium (Lonza) containing 2 μM L-glutamine, stem cell factor (100 ng / ml), Flt-3 ligand (Flt-3L) (100 ng / ml), and thrombopoietin (10 ng / ml) (CellGenix). Lentivirus was used at a multiplicity of infection of 5 in a 75-cm 2 Coated with fibronectin (25 mg / cm 2 Prestimulated cells were transduced in tissue culture flasks containing 5-nitro-1,2-dihydro-1,3 ...

[0468] Lentiviral vectors have also been disclosed in the treatment of Parkinson's disease, see, for example, U.S. Patent Publication No. 20120295960 and U.S. Patent Nos. 7303910 and 7351585. Lentiviral vectors have also been disclosed in the treatment of ocular diseases, see, for example, U.S. Patent Publication Nos. 20060281180, 20090007284, US 20110117189; US 20090017543; US 20070054961, US 20100317109. Lentiviral vectors have also been disclosed for delivery into the brain, see, for example, US Patent Publication Nos. US 20110293571; US ​​20110293571, US 20040013648, US 20070025970, US 20090111106 and US Patent No. US 7259015.

[0469] RNA delivery

[0470] RNA delivery: The CRISPR enzyme, such as Cas9, and / or any RNA of the present invention, such as guide RNA, can also be delivered in the form of RNA. Cas9 mRNA can be produced using in vitro transcription. For example, a PCR cassette containing the following elements can be used to synthesize Cas9 mRNA: T7_promoter-kozak sequence (GCCACC)-Cas9-3'UTR from β-globin-polyA tail (a string of 120 or more adenines). The cassette can be used for transcription via T7 polymerase. Guide RNA can also be transcribed from a cassette containing a T7_promoter-GG-guide RNA sequence using in vitro transcription.

[0471] To enhance expression and reduce toxicity, the CRISPR enzyme and / or guide RNA can be modified with pseudo-U or 5-methyl-C.

[0472] mRNA delivery methods are particularly promising for current liver delivery. Specifically, AAV8 is particularly preferred for delivery to the liver.

[0473] Particle delivery systems and / or formulations:

[0474] Some types of particle delivery systems and / or formulations are known to be useful in various biomedical applications. In general, a particle is defined as a small object that behaves as a whole unit in terms of its transport and properties. Particles are further classified according to their diameter. Coarse particles cover a range between 2,500 and 10,000 nanometers. Fine particles have a size between 100 and 2,500 nanometers. Ultrafine particles, or nanoparticles, are typically between 1 and 100 nanometers in size. The basis of the 100-nm limit is the fact that the novel properties that distinguish particles from bulk materials typically appear at a critical length scale below 100 nm.

[0475] As used herein, a particle delivery system / preparation is defined as any biological delivery system / preparation that includes particles according to the present invention. A particle according to the present invention is any entity having a maximum dimension (e.g., diameter) of less than 100 microns (μm). In some embodiments, the particles of the present invention have a maximum dimension of less than 10 μm. In some embodiments, the particles of the present invention have a maximum dimension of less than 2000 nanometers (nm). In some embodiments, the particles of the present invention have a maximum dimension of less than 1000 nanometers (nm). In some embodiments, the particles of the present invention have a maximum dimension of less than 900 nm, 800 nm, 700 nm, 600 nm, 500 nm, 400 nm, 300 nm, 200 nm, or 100 nm. Typically, the particles of the present invention have a maximum dimension (e.g., diameter) of 500 nm or less. In some embodiments, the particles of the present invention have a maximum dimension (e.g., diameter) of 250 nm or less. In some embodiments, the particles of the present invention have a maximum dimension (e.g., diameter) of 200 nm or less. In some embodiments, the particles of the present invention have a maximum dimension (e.g., diameter) of 150 nm or less. In some embodiments, the particles of the present invention have a maximum dimension (e.g., diameter) of 100 nm or less. Smaller particles (eg, having a maximum dimension of 50 nm or less) are used in some embodiments of the invention. In some embodiments, particles of the invention have a maximum dimension ranging between 25 nm and 200 nm.

[0476] Particle characterization (including, for example, characterizing morphology, size, etc.) is carried out using various techniques. Common techniques are electron microscopy (TEM, SEM), atomic force microscopy (AFM), dynamic light scattering (DLS), X-ray photoelectron spectroscopy (XPS), powder X-ray diffraction (XRD), Fourier transform infrared spectroscopy (FTIR), matrix-assisted laser desorption / ionization time-of-flight mass spectrometry (MALDI-TOF), UV-visible spectroscopy, dual polarization interferometry, and nuclear magnetic resonance (NMR). Characterization (size measurement) can be for natural particles (i.e., preloaded) or in loading a load (here load refers to one or more components of a CRISPR-Cas system, such as a CRISPR enzyme or mRNA or guide RNA or any combination thereof, and can include additional components, carriers, and / or excipients) to provide ions with optimal size for use in any in vitro, ex vivo, and / or in vivo delivery of the present invention. In certain preferred embodiments, particle size (e.g., diameter) characterization is based on the measurement using dynamic laser scattering (DLS). Mention may be made of U.S. Patent No. 8,709,843; U.S. Patent No. 6,007,845; U.S. Patent No. 5,855,913; U.S. Patent No. 5,985,309; U.S. Patent No. 5,543,158; and the publication by James E. Dahlman and Carmen Barnes et al. in Nature Nanotechnology (2014), published online on May 11, 2014, doi:10.1038 / nnano.2014.84, which relate to particles, methods of making and using them, and measurements thereof.

[0477] Particle delivery systems within the scope of the present invention can be provided in any form, including but not limited to solid, semi-solid, emulsion, or colloidal particles. Thus, any delivery system described herein, including but not limited to, for example, lipid-based systems, liposomes, micelles, microvesicles, exosomes, or gene guns, can be provided as a particle delivery system within the scope of the present invention.

[0478] Nanoparticles

[0479] For the present invention, it is preferred to use nanoparticles or lipid envelopes to deliver one or more components of the CRISPR complex, such as a CRISPR enzyme or mRNA or guide RNA. Nanoparticles or lipid envelopes can be used to deliver CRISPR enzyme mRNA and guide RNA simultaneously. Other delivery systems or vectors can be used in conjunction with the nanoparticle aspects of the present invention.

[0480] In some preferred embodiments, nanoparticle of the present invention has a maximum size of 500nm or less. In other preferred embodiments, nanoparticle of the present invention has a maximum size of 25nm and 200nm. In other preferred embodiments, nanoparticle of the present invention has a maximum size of 100nm or less. In other preferred embodiments, nanoparticle of the present invention has a maximum size of 35nm and 60nm.

[0481] The nanoparticles included in the present invention can be provided as different forms, for example, are provided as solid nanoparticles (for example, metals such as silver, gold, iron, titanium, non-metallic, lipid-based solids, polymers), nanoparticle suspensions or its combination. Metal nanoparticles, dielectric nanoparticles and semiconductor nanoparticles can be prepared together with hybrid structures (for example, core-shell nanoparticles). The nanoparticles made of semiconductor materials can also be marked with quantum dots, if they are sufficiently small (typically lower than 10nm) so that the quantization of the electronic energy level occurs. This type of nanometer-sized particles is used in biomedical applications as drug carriers or imaging agents, and can be adapted to be used for the similar purposes among the present invention.

[0482] Semi-solid and soft nanoparticles have been produced, and are within the scope of the present invention. The prototype nanoparticle with semi-solid properties is liposome. Various types of liposome nanoparticles are currently used as the delivery system for anticancer drugs and vaccines clinically. The nanoparticles of half hydrophilic and the other half hydrophobic are called Janus particles, and are particularly effective for stabilizing emulsions. They can self-assemble at the water / oil interface and serve as solid surfactants. U.S. Patent number 8,709,843 (incorporated herein by reference) provides a drug delivery system for the targeted delivery of particles comprising therapeutic agents to tissues, cells and intracellular compartments. The invention provides targeted particles comprising polymers, which are conjugated to surfactants, hydrophilic polymers or lipids.

[0483] US Patent No. 6,007,845, incorporated herein by reference, provides particles having a core of a multi-block copolymer formed by covalently linking a polyfunctional compound to one or more hydrophobic polymers and one or more hydrophilic polymers, and comprising a bioactive material.

[0484] US Patent No. 5,855,913, incorporated herein by reference, provides a particulate composition having aerodynamically light particles having a particle size of less than 0.4 g / cm 3The tap density of the drug is between 5 μm and 30 μm, and a surfactant is bound to its surface for drug delivery to the pulmonary system.

[0485] US Patent No. 5,985,309, incorporated herein by reference, provides particles that incorporate surfactants and / or hydrophilic or hydrophobic complexes of positively or negatively charged therapeutic or diagnostic agents and oppositely charged molecules for delivery to the pulmonary system.

[0486] US Patent No. 5,543,158, incorporated herein by reference, provides biodegradable injectable nanoparticles having a biodegradable solid core comprising a bioactive material and poly(alkylene glycol) moieties on the surface.

[0487] WO 2012135025 (also published as US 20120251560), incorporated herein by reference, describes conjugated polyethyleneimine (PEI) polymers and conjugated aza-macrocycles (collectively referred to as "conjugated lipomers" or "liposomes"). In certain embodiments, it is contemplated that such conjugated liposomes can be used in the context of a CRISPR-Cas system to achieve in vitro, ex vivo, and in vivo genome perturbations to modify gene expression, including regulating protein expression.

[0488] In one embodiment, the nanoparticles can be epoxide-modified lipid-polymers, advantageously 7C1 (see, e.g., James E. Dahlman and Carmen Barnes et al., Nature Nanotechnology (2014), published online May 11, 2014, doi: 10.1038 / nnano.2014.84). C71 is synthesized by reacting a C15 epoxide-terminated lipid with PEI600 in a 14:1 molar ratio and formulated with C14PEG2000 to produce nanoparticles (diameter between 35 and 60 nm) that are stable in PBS solution for at least 40 days.

[0489] The CRISPR-Cas system of the present invention can be delivered to lung cells, cardiovascular cells, or kidney cells using epoxide-modified lipid-polymers, however, one skilled in the art can adapt the system for delivery to other target organs. Dosages ranging from about 0.05 to about 0.6 mg / kg are envisioned. Dosages over several days or weeks are also envisioned, with a total dose of about 2 mg / kg.

[0490] For example, Su X, Fricke J, Kavanagh DG, Irvine DJ (“In vitro and in vivo mRNA delivery using lipid-enveloped pH-responsive polymer nanoparticles”) Mol Pharm. 2011 Jun 6;8(3):774-87. doi:10.1021 / mp100390w. Epub 2011 Apr 1 describe biodegradable core-shell nanoparticles having a poly(β-amino ester) (PBAE) core encapsulated by a phospholipid bilayer shell. These were developed for in vivo mRNA delivery. The pH-responsive PBAE was selected to promote endosomal disruption, while the lipid surface layer was selected to minimize the toxicity of the polycationic core. Therefore, these are preferred for delivering the RNA of the present invention.

[0491] In one embodiment, nanoparticles based on self-assembling bioadhesive polymers are contemplated, which can be applied to oral delivery of peptides, intravenous delivery of peptides, and nasal delivery of peptides, all to the brain. Other embodiments, such as oral absorption and ocular delivery of hydrophobic drugs, are also contemplated. Molecular envelope technology involves engineered polymeric coatings that are protected and delivered to the site of disease (see, e.g., Mazza M. et al. ACS Nano, 2013. 7(2): 1016-1026; Siew A. et al. Mol Pharm, 2012. 9(1): 14-28; Lalatsa A. et al. J Contr Rel, 2012. 161(2): 523-36; Lalatsa A. et al. Mol Pharm, 2012. 9(6): 1665-80; Lalatsa A. et al. Mol Pharm, 2012. 9(6): 1764-74; Garrett NL et al. J Biophotonics, 2012. 9(6): 1764-74). 2012.5(5-6):458-68; Garrett NL et al. J Raman Spect, 2012.43(5):681-688; Ahmad S. et al. J Royal Soc Interface, 2010.7:S423-33; Uchegbu IF. Expert Opin Drug Deliv, 2006.3(5):629-40; Qu X. et al. Biomacromolecules, 2006.7(12):3452-9 and Uchegbu IF et al. Int J Pharm, 2001.224:185-199). Doses of about 5 mg / kg are contemplated, either in single or multiple doses, depending on the target tissue.

[0492] In one embodiment, nanoparticles developed by Dan Anderson's lab at MIT that can deliver RNA to cancer cells to stop tumor growth can be used and / or adapted for use with the CRISPR Cas system of the present invention. Specifically, the Anderson lab has developed a fully automated combinatorial system for the synthesis, purification, characterization, and formulation of new biomaterials and nanoformulations. See, e.g., Alabi et al., Proc Natl Acad Sci US A. 2013 Aug 6;110(32):12881-6; Zhang et al., Adv Mater. 2013 Sep 6;25(33):4641-5; Jiang et al., Nano Lett. 2013 Mar 13;13(3):1059-64; Karagiannis et al., ACS Nano. 2012 Oct 23;6(10):8484-7; Whitehead et al., ACS Nano. Nano. 2012 Aug 28;6(8):6922-9 and Lee et al., Nat Nanotechnol. 2012 Jun 3;7(6):389-93.

[0493] U.S. Patent Application 20110293703 relates to lipidoid compounds, which are also particularly useful in the administration of polynucleotides, which may be suitable for delivering the CRISPR Cas system of the present invention. In one aspect, aminoalcohol lipidoid compounds are combined with an agent to be delivered to a cell or subject to form microparticles, nanoparticles, liposomes, or micelles. The agent to be delivered by particles, liposomes, or micelles can be in the form of a gas, liquid, or solid, and the agent can be a polynucleotide, protein, peptide, or small molecule. These aminoalcohol lipidoid compounds can form particles with other aminoalcohol lipidoid compounds, polymers (synthetic or natural), surfactants, cholesterol, carbohydrates, proteins, lipids, etc. These particles can then optionally be combined with a pharmaceutical excipient to form a pharmaceutical composition.

[0494] U.S. Patent Publication No. 0110293703 also provides a method for preparing aminoalcohol lipidoid compounds. One or more equivalents of an amine are reacted with one or more equivalents of an epoxide-terminated compound under appropriate conditions to form the aminoalcohol lipidoid compounds of the present invention. In certain embodiments, all of the amino groups of the amine react fully with the epoxide-terminated compound to form a tertiary amine. In other embodiments, all of the amino groups of the amine do not react completely with the epoxide-terminated compound to form a tertiary amine, thereby generating a primary or secondary amine in the aminoalcohol lipidoid compound. These primary or secondary amines are left as is or can be reacted with another electrophile, such as a different epoxide-terminated compound. As will be understood by those skilled in the art, reacting an amine with a non-excess amount of epoxide-terminated compound will produce a variety of different aminoalcohol lipidoid compounds with different numbers of tails. Certain amines can be fully functionalized with two epoxide-derived compound tails, while other molecules will not be fully functionalized with the epoxide-derived compound tails. For example, a diamine or polyamine may include one, two, three, or four epoxide-derived compound tails leaving different amino moieties of the molecule, thereby producing primary, secondary, and tertiary amines. In certain embodiments, not all amino groups are fully functionalized. In certain embodiments, two of the same type of epoxide-terminated compounds are used. In other embodiments, two or more different epoxide-terminated compounds are used. The synthesis of the amino alcohol lipidoid compound is carried out with or without a solvent, and the synthesis can be carried out at a higher temperature ranging from 30°C to 100°C, preferably at approximately 50°C to 90°C. Optionally, the prepared amino alcohol lipidoid compound can be purified. For example, a mixture of amino alcohol lipidoid compounds can be purified to produce an amino alcohol lipidoid compound with a specific number of epoxide-derived compound tails. Alternatively, the mixture can be purified to produce a specific stereoisomer or regioisomer. These amino alcohol lipidoid compounds can also be alkylated using alkyl halides (e.g., methyl iodide) or other alkylating agents, and / or they can be acylated.

[0495] U.S. Patent Publication No. 0110293703 also provides a library of amino alcohol lipidoid compounds prepared by the inventive method. These amino alcohol lipidoid compounds can be prepared and / or screened using high-throughput technologies involving liquid handlers, robots, microtiter plates, computers, etc. In certain embodiments, these amino alcohol lipidoid compounds are screened for their ability to transfect polynucleotides or other agents (e.g., proteins, peptides, small molecules) into cells.

[0496] U.S. Patent Publication No. 20130302401 relates to a class of poly(β-amino alcohols) (PBAAs) that have been prepared using combinatorial polymerization. These invented PBAAs can be used as coatings (such as coatings for thin films or multilayer films for medical devices or implants), additives, materials, excipients, non-biofouling agents, micropatterning agents, and cellular encapsulation agents in biotechnology and biomedical applications. When used as surface coatings, these PBAAs induce different levels of inflammation both in vitro and in vivo, depending on their chemical structure. The huge chemical diversity of this class of materials has allowed us to identify polymer coatings that inhibit macrophage activation in vitro. In addition, after subcutaneous implantation of carboxylated polystyrene microparticles, these coatings reduced the recruitment of inflammatory cells and alleviated fibrosis. These polymers can be used to form polyelectrolyte complex capsules for cell encapsulation. The present invention may also have many other biological applications, such as antimicrobial coatings, DNA or siRNA delivery, and stem cell tissue engineering. The teachings of U.S. Patent Publication No. 20130302401 can be applied to the CRISPR Cas system of the present invention.

[0497] In another embodiment, lipid nanoparticles (LNPs) are contemplated. Specifically, anti-transthyretin small interfering RNA (see, e.g., Coelho et al., N Engl J Med 2013; 369: 819-29) encapsulated in lipid nanoparticles can be applied to the CRISPR Cas system of the present invention. Intravenous administration of a dose of about 0.01 to about 1 mg / kg body weight is contemplated. Medication that reduces the risk of infusion-related reactions is contemplated, such as dexamethasone, acetampinophen, diphenhydramine or cetirizine, and ranitidine. Multiple doses of about 0.3 mg / kg are contemplated, once every 4 weeks for five doses.

[0498] LNP has been shown to be highly effective in delivering siRNA to the liver (see, e.g., Tabernero et al., Cancer Discovery, April 2013, Vol. 3, No. 4, pp. 363-470), and is therefore considered for delivery of CRISPR Cas to the liver. A dosage of about four doses of 6 mg / kg of LNP (or RNA of CRISPR-Cas) can be considered, once every two weeks. Tabernero et al. demonstrated that after the first two cycles of LNP administration at 0.7 mg / kg, tumor regression was observed, and after the end of six cycles, the patient had achieved a partial response, with complete regression of lymph node metastases and significant shrinkage of liver tumors. A complete response was obtained after 40 doses were administered in this patient, who remained in remission and completely cured after receiving the dose for 26 months. Two patients with RCC and extrahepatic sites of disease, including the kidneys, lungs, and lymph nodes, that progressed after prior treatment with a VEGF pathway inhibitor had stable disease at all sites for approximately 8 to 12 months, and one patient with PNET and liver metastases continued to have stable disease in the 18-month (36 doses) extension study.

[0499] In some embodiments, LNP is a kind of cationic lipid.But, the electric charge of LNP must be taken into account.When cationic lipid is combined with negatively charged lipid, induction promotes the non-double-layer structure of intracellular delivery.Because charged LNP is removed rapidly from circulation after intravenous injection, developed ionizable cationic lipid with the pKa value lower than 7 (referring to, for example, Luo Xin (Rosin) et al., " molecular therapy " (Molecular Therapy), the 19th volume, the 12th phase, 1286-2200 page, December 2011).Negatively charged polymer such as siRNA oligonucleotide can be loaded into LNP with low pH value (for example, pH 4), and ionizable lipid demonstrates positive charge when this pH.But, when physiological pH value, LNP demonstrates the low surface charge compatible with longer circulation time. Four ionizable cationic lipids have been studied, namely 1,2-dilinoleoyl-3-dimethylammonium-propane (DLinDAP), 1,2-dilinoleyloxy-3-N,N-dimethylaminopropane (DLinDMA), 1,2-dilinoleyloxy-keto-N,N-dimethyl-3-aminopropane (DLinKDMA), and 1,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLinKC2-DMA). It has been shown that LNP siRNA systems containing these lipids exhibit significantly different gene silencing properties in hepatocytes in vivo, with potentials varying according to the DLinKC2-DMA>DLinKDMA>DLinDMA>DLinDAP series employing a Factor VII gene silencing model (see, e.g., Rosin et al., Molecular Therapy, Vol. 19, No. 12, pp. 1286-2200, December 2011). Doses of 1 μg / ml levels may be considered, particularly for formulations containing DLinKC2-DMA.

[0500] LNP preparation and CRISPR Cas encapsulation may be used and or adapted from Rosin et al., Molecular Therapy, Vol. 19, No. 12, pp. 1286-2200, December 2011). Cationic lipids 1,2-dilinoleoyl-3-dimethylammonium-propane (DLinDAP), 1,2-dilinoleyloxy-3-N,N-dimethylaminopropane (DLinDMA), 1,2-dilinoleyloxyketo-N,N-dimethyl-3-aminopropane (DLinK-DMA), 1,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLinKC2-DMA), (3-o-[2″-(methoxypolyethylene glycol 2000)succinyl]-1,2-dimyristoyl-sn-diol (PEG-S-DMG), and R-3-[(ω-methoxy-poly(ethylene glycol) 2000)carbamoyl]-1,2-dimyristoyloxypropyl-3-amine (PEG-C-DOMG) can be obtained from Tekmira Pharmaceuticals (Vancouver, Canada) or synthesized. Cholesterol can be purchased from Sigma (St. Louis, MO). Specific CRISPR Cas RNA can be encapsulated in LNPs containing DLinDAP, DLinDMA, DLinK-DMA, and DLinKC2-DMA (cationic lipid: DSPC: CHOL: PEGS-DMG or PEG-c-DOMG molar ratio is 40:10:40:10). When needed, 0.2% SP-DiOC18 (Invitrogen, Burlington, Canada) can be combined to evaluate cellular uptake, intracellular delivery, and biodistribution. Encapsulation is performed by dissolving a mixture consisting of cationic lipid: DSPC: cholesterol: PEG-c-DOMG (40:10:40:10 molar ratio) in ethanol until the final lipid concentration is 10 mmol / l. This ethanolic solution of lipids can be added dropwise to 50 μl of a 40% ethanol solution at pH 4.0. Multilamellar vesicles were formed in 100 mmol / l citrate to give a final concentration of 30% (vol / vol) ethanol. Large unilamellar vesicles were formed after extrusion of multilamellar vesicles through two overlapping 80 nm Nuclepore polycarbonate filters using an extruder (Northern Lipids, Vancouver, Canada).Encapsulation can be achieved by the following steps: 2 mg / ml of RNA dissolved in 50 mmol / l citrate at pH 4.0 containing 30% ethanol (vol / vol) is added dropwise to the extruded large unilamellar vesicles and incubated at 31 ° C for 30 minutes with continuous mixing until the final RNA / lipid weight ratio is 0.06 / 1 (wt / wt). Ethanol removal and formulation buffer neutralization are performed by dialyzing in phosphate buffered saline (PBS) at pH 7.4 for 16 hours using a Spectra / Por 2 regenerated cellulose dialysis membrane. Nanoparticle size distribution can be determined by dynamic light scattering using a NICOMP 370 particle size analyzer, vesicle / intensity mode and Gaussian fit (Nicomp Particle Size Analyzer, Santa Barbara, California). The particle size for all three LNP systems can be a diameter of about 70 nm. Can be by using VivaPureD MiniH post (Sartorius Stedim Biotech) to remove free siRNA from the sample collected before and after analysis and determine siRNA encapsulation efficiency.Extract the RNA of encapsulation from the nanoparticle of wash-out and with it at 260nm quantitative.Measure the cholesterol content in vesicle by using the cholesterol E enzymatic assay method from Wako Chemicals USA (Richmond (Richmond), Virginia), determine the ratio of siRNA and lipid.The liposome (or LNP) of PEGization also can be used for sending.

[0501] The preparation of large LNP can use / and or be adapted from " molecular therapy " (Molecular Therapy) of people such as Luo Xin (Rosin), the 19th volume, the 12th phase, 1286-2200 page, December, 2011.Can prepare lipid premix solution (20.4mg / ml total lipid concentration) in the ethanol of DLinKC2-DMA, DSPC and cholesterol containing the mol ratio of 50:10:38.5.Can add sodium acetate in the lipid premix according to the mol ratio (sodium acetate: DLinKC2-DMA) of 0.75:1.Subsequently can merge and make lipid hydration by the citrate buffer (10mmol / l, pH 3.0) of this mixture and 1.85 times of volumes under vigorous stirring, thereby cause the spontaneous liposome formation containing 35% in aqueous buffer.Can hatch this liposome solution at 37 DEG C to allow the time-dependent increase of particle diameter. Aliquots can be removed at different times of hatching to study the change of liposome size by dynamic light scattering (nanoparticle size potential analyzer (Zetasizer Nano ZS), Malvern Instruments (Malvern Instruments), Worcestershire (Worcestershire, Britain). Once desired particle diameter is achieved, aqueous PEG lipid solution (stock solution=10mg / ml PEG-DMG in 35% (vol / vol) ethanol) can be added to the liposome mixture to produce a final PEG molar concentration of 3.5% total lipid. After adding PEG-lipid, these liposomes should be of their size, effectively inhibiting further growth. Then RNA is added to empty liposomes with siRNA and total lipid ratio of approximately 1: 10 (wt: wt), then hatched 30 minutes at 37 ° C to form the LNP loaded. Subsequently, the mixture is dialyzed overnight in PBS, and with a 0.45-μm syringe filter.

[0502] Spherical nucleic acid (SNA) TM ) constructs and other nanoparticles (especially gold nanoparticles) have also been considered as a means of delivering CRISPR / Cas systems to the intended target. Important data show that AuraSense therapeutic spherical nucleic acids (SNAs) based on nucleic acid-functionalized gold nanoparticles TM ) construct outperforms alternative platforms based on several key success factors, such as:

[0503] High in vivo stability. Due to their dense loading, the majority of the cargo (DNA or siRNA) remains attached to the construct inside the cell, conferring nucleic acid stability and resistance to enzymatic degradation.

[0504] Deliverability. For all cell types studied (eg, neurons, tumor cell lines, etc.), these constructs demonstrated 99% transfection efficiency without the need for vectors or transfection agents.

[0505] Therapeutic Targeting. The unique target binding affinity and specificity of these constructs allow exquisite specificity for matched target sequences (ie, limiting off-target effects).

[0506] Superior Efficacy: These constructs significantly outperform leading conventional transfection reagents (Lipofectamine 2000 and Cytofectin).

[0507] Low toxicity. These constructs can enter a variety of cultured cells, primary cells, and tissues without significant toxicity.

[0508] There was no significant immune response. These constructs caused minimal changes in global gene expression as measured by whole-genome microarray studies and cytokine-specific protein analysis.

[0509] Chemically Tailorable. Any number of single or combined agents (eg, proteins, peptides, small molecules) can be used to tailor the surface of these constructs.

[0510] This platform for nucleic acid-based therapeutics could be applicable to many disease states, including inflammatory and infectious diseases, cancer, skin disorders, and cardiovascular disease.

[0511] References that may be cited include: Cutler et al., J. Am. Chem. Soc. 2011 133:9254-9257, Hao et al., Small. 2011 7:3158-3162, Zhang et al., ACS Nano. 2011 5:6962-6970, Cutler et al., J. Am. Chem. Soc. 2012 134:1376-1391, Young et al., Nano Lett. 2012 12:3867-71, Zheng et al., Proc. Natl. Acad. Sci. USA. 2012 109:11975-80, Mirkin et al., Nanomedicine (Nanomedicine) 2012 7:635-638 Zhang et al., J. Am. Chem. Soc. 2012 134:16488-1691, Weintraub, Nature 2013495:S14-S16, Choi et al., Proc. Natl. Acad. Sci. USA. 2013110(19):7625-7630, Jensen et al., Sci Transl Med 5, 209ra152 (2013) and Mirkin et al., Small, doi.org / 10.1002 / smll.201302143.

[0512] Self-assembled nanoparticles with siRNA can be constructed using polyethyleneimine (PEI) that is pegylated, wherein an Arg-Gly-Asp (RGD) peptide ligand is attached to the distal end of the polyethylene glycol (PEG), for example, as a means of targeting integrin-expressing tumor neovasculature and for delivering siRNA that inhibits vascular endothelial growth factor receptor 2 (VEGF R2) expression and thereby inhibits tumor angiogenesis (see, e.g., Schiffelers et al., Nucleic Acids Research, 2004, Vol. 32, No. 19). Nanobundles are prepared by mixing equal volumes of an aqueous solution of a cationic polymer and an aqueous solution of nucleic acids to produce a net molar excess of ionizable nitrogen (polymer) to phosphate (nucleic acid) in the range of 2 to 6. Electrostatic interactions between the cationic polymer and the nucleic acid result in the formation of polyplexes with an average particle size distribution of approximately 100 nm, hereinafter referred to as nanobundles. Doses of approximately 100 to 200 mg of CRISPR Cas are envisioned for delivery in the self-assembling nanoparticles of Schiffelers et al.

[0513] Bartlett et al.'s nanobeams (PNAS, September 25, 2007, Vol. 104, No. 39) can also be used in the present invention. Bartlett et al.'s nanobeams are prepared by mixing equal volumes of an aqueous cationic polymer solution and an aqueous nucleic acid solution to produce a net molar excess of ionizable nitrogen (polymer) to phosphate (nucleic acid) ranging from 2 to 6. Electrostatic interactions between the cationic polymer and the nucleic acid lead to the formation of polyplexes with an average particle size distribution of approximately 100 nm, hereinafter referred to as nanobeams. Bartlett et al.'s DOTA-siRNA was synthesized as follows: 1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid mono(N-hydroxysuccinimide ester) (DOTA-NHSester) was ordered from Macrocyclics (Dallas, TX). Amine-modified RNA sense strands with a 100-fold molar excess of DOTA-NHS-ester in carbonate buffer (pH 9) were added to microcentrifuge tubes. The contents were reacted by stirring at room temperature for 4 hours. The DOTA-RNA sense conjugate was ethanol-precipitated, resuspended in water, and annealed to the unmodified antisense strand to produce DOTA-siRNA. All liquids were pretreated with Chelex-100 (Bio-Rad, Hercules, CA) to remove trace metal contaminants. Tf-targeted and non-targeted siRNA nanoparticles can be formed using polycations containing cyclodextrin. Typically, nanoparticles were formed in water at a feed ratio of 3 (+ / -) and an siRNA concentration of 0.5 g / L. One percent of the adamantane-PEG molecules on the surface of the targeted nanoparticles were modified with Tf (adamantane-PEG-Tf). The nanoparticles were suspended in a 5% (wt / vol) glucose carrier solution for injection.

[0514] Davis et al. (Nature, Vol. 464, April 15, 2010) conducted a siRNA clinical trial (clinical trial registration number NCT00689065) using a targeted nanoparticle delivery system. Patients with solid cancers refractory to standard of care treatment were given targeted nanoparticle doses by 30-minute intravenous infusion on days 1, 3, 8, and 10 of a 21-day cycle. These nanoparticles comprised a synthetic delivery system containing: (1) a linear, cyclodextrin-based polymer (CDP), (2) a human transferrin protein (TF) targeting ligand displayed on the exterior of the nanoparticle for binding to the TF receptor (TFR) on the surface of cancer cells, (3) a hydrophilic polymer (polyethylene glycol (PEG) to promote nanoparticle stability in biological fluids), and (4) an siRNA designed to reduce the expression of RRM2 (the sequence used in the clinic, previously denoted as siR2B+5). TFR has long been known to be downregulated in malignant cells, and RRM2 is an established anti-cancer target. These nanoparticles (the clinical version is designated CALAA-01) have been shown to be well tolerated in multiple-dose studies in non-human primates. Although siRNA has been administered to a single patient with chronic myeloid leukemia via liposome delivery, the clinical trial by Davis et al. is the first human trial to use a targeted delivery system to deliver siRNA systemically and treat patients with solid cancers. To determine whether the targeted delivery system could effectively deliver functional siRNA to human tumors, Davis et al. studied biopsies from three patients in three different dose cohorts; patients A, B, and C all had metastatic melanoma and received 18, 24, and 30 mg m -2 CALAA-01 dosage of siRNA. Similar dosages can also be considered for the CRISPR Cas system of the present invention. Delivery of the present invention can be achieved using nanoparticles containing a linear cyclodextrin-based polymer (CDP), a human transferrin (TF) targeting ligand displayed on the exterior of the nanoparticle for engaging the TF receptor (TFR) on the surface of cancer cells, and / or a hydrophilic polymer (e.g., polyethylene glycol (PEG) to promote nanoparticle stability in biological fluids).

[0515] exosomes

[0516] Exosomes are endogenous nanovesicles that transport RNA and proteins that can deliver short interfering (si)RNA to the mouse brain. To reduce immunogenicity, Alvarez-Erviti et al. (2011, Nature Biotechnology, 29:341) used self-derived dendritic cells for exosome production. Targeting was achieved by engineering dendritic cells to express Lamp2b, an exosomal membrane protein fused to a neuron-specific RVG peptide. Purified exosomes were loaded with exogenous siRNA by electroporation. Intravenously injected RVG-targeted exosomes specifically delivered GAPDH siRNA to neurons, microglia, and oligodendrocytes in the brain, resulting in specific gene knockdown. Pre-exposure to RVG exosomes did not attenuate knockdown, and no nonspecific uptake was observed in other tissues. The therapeutic potential of exosome-mediated siRNA delivery was demonstrated by robust mRNA (60%) and protein (62%) knockdown of BACE1, a therapeutic target in Alzheimer's disease.

[0517] To obtain an immunologically inert pool of exosomes, Alvarez-Erviti et al. harvested bone marrow from inbred C57BL / 6 mice with homologous major histocompatibility complex (MHC) haplotypes. Because immature dendritic cells produce large amounts of exosomes lacking T cell activators such as MHC-II and CD86, Alvarez-Erviti et al. selected dendritic cells with granulocyte / macrophage colony-stimulating factor (GM-CSF) for 7 days. The following day, exosomes were purified from the culture supernatant using a well-established ultracentrifugation protocol. The exosomes produced were physically homogenous, with a size distribution peak of 80 nm in diameter, as determined by nanoparticle tracking analysis (NTA) and electron microscopy. Alvarez-Erviti et al. obtained 6-12 μg of exosomes (based on protein concentration measurements) per 10 6 cells.

[0518] Secondly, Alvarez-Erviti et al. investigated the possibility of loading modified exosomes with exogenous cargo using a perforation protocol suitable for nanoscale applications. Because electroporation for nanoscale membrane particles is not well characterized, nonspecific Cy5-labeled siRNA was used for empirical optimization of the electroporation protocol. The amount of encapsulated siRNA was determined after ultracentrifugation and lysis of the exosomes. Electroporation at 400 V and 125 μF resulted in the best siRNA retention and was used for all subsequent experiments.

[0519] Alvarez-Erviti administered 150 μg of each BACE1 siRNA encapsulated in 150 μg of RVG exosomes to normal C57BL / 6 mice and compared the knockdown efficiency with four controls: untreated mice, mice injected with RVG exosomes alone, mice injected with BACE1 siRNA complexed with an in vivo cationic liposome reagent, and mice injected with BACE1 siRNA complexed with RVG-9R, an RVG peptide conjugated to nine D-arginines electrostatically bound to the siRNA. Three days after dosing, cortical tissue samples were analyzed and significant protein knockdown was observed in both siRNA-RVG-9R-treated and siRNARVG exosome-treated mice (45%, P < 0.05, compared to 62%, P < 0.01), driven by a significant reduction in BACE1 mRNA levels (66% [+ or -] 15%, P < 0.001 and 61% [+ or -] 13%, P < 0.01, respectively). Furthermore, Applicants demonstrated a significant reduction in total [β]-amyloid 1-42 levels (55%, P < 0.05), a major component of amyloid plaques in Alzheimer's pathology, in RVG-exosome-treated animals. The observed reduction was greater than the reduction in [β]-amyloid 1-40 demonstrated in normal mice following intraventricular injection of a BACE1 inhibitor. Alvarez-Erviti et al. performed 5′-rapid amplification of cDNA ends (RACE) on BACE1 cleavage products, which provided evidence for RNAi-mediated knockdown via siRNA.

[0520] Finally, Alvarez-Erviti et al. investigated whether siRNA-RVG exosomes induced an immune response in vivo by assessing serum concentrations of IL-6, IP-10, TNFα, and IFN-α. Following siRNA-RVG exosome treatment, similar to siRNA transfection reagent treatment, nonsignificant changes in all cytokines were registered, confirming the immunologically inert nature of this exosome treatment, in contrast to siRNA-RVG-9R, which potently stimulated IL-6 secretion. Given that exosomes encapsulate only 20% of the siRNA, delivery using RVG-exosomes appears more effective than RVG-9R, as comparable mRNA knockdown and superior protein knockdown were achieved with fivefold less siRNA, without a corresponding level of immune stimulation. This experiment demonstrates the therapeutic potential of RVG-exosome technology, which is potentially suitable for long-term silencing of genes associated with neurodegenerative diseases. The exosome delivery system of Alvarez-Erviti et al. can be used to deliver the CRISPR-Cas system of the present invention to therapeutic targets, particularly neurodegenerative diseases. A dosage of about 100 to 1000 mg of CRISPR Cas encapsulated in about 100 to 1000 mg of RVG exosomes is contemplated for the present invention.

[0521] El-Andaloussi et al. (Nature Protocols 7, 2112-2126 (2012)) describe how exosomes derived from cultured cells can be used to deliver siRNA in vitro and in vivo. This protocol first describes the generation of targeted exosomes by transfecting an expression vector containing an exosomal protein fused to a peptide ligand. Next, El-Andaloussi et al. explain how to purify and characterize exosomes from the supernatant of transfected cells. They then detail the key steps for loading siRNA into exosomes. Finally, they outline how to use exosomes to efficiently deliver siRNA in vitro and in vivo into the mouse brain. Examples of expected results are also provided, in which exosome-mediated siRNA delivery is assessed through functional assays and imaging. The entire protocol takes approximately three weeks. Delivery or administration according to the present invention can be performed using exosomes produced from self-derived dendritic cells.

[0522] In another example, the plasma exosomes of Wahlgren et al. (Nucleic Acids Research, 2012, Vol. 40, No. 17, e130) are considered. Exosomes are nanovesicles (30-90 nm in size) produced by many cell types, including dendritic cells (DCs), B cells, T cells, mast cells, epithelial cells, and tumor cells. These vesicles are formed by inward budding of late endosomes and are then released into the extracellular environment after fusion with the plasma membrane. Since exosomes naturally transport RNA between cells, this property may be useful in gene therapy.

[0523] Exosomes from plasma were prepared by centrifuging the buffy coat at 900 g for 20 minutes to separate the plasma, followed by harvesting the cell supernatant, centrifuging at 300 g for 10 minutes to remove the cells, and centrifuging at 16,500 g for 30 minutes before filtering through a 0.22 mm filter. Exosomes were pelleted by centrifugation at 120,000 g for 70 minutes. Chemical transfection of siRNA into exosomes was performed according to the manufacturer's instructions for the RNAi Human / Mouse Starter Kit (Quiagen, Hilden, Germany). siRNA was added to 100 ml of PBS at a final concentration of 2 mmol / ml. After adding HiPerFect transfection reagent, the mixture was incubated at room temperature for 10 minutes. To remove excess micelles, the exosomes were reisolated using aldehyde / sulfate latex beads. Chemical transfection of CRISPR Cas into exosomes can be performed similarly to siRNA. Exosomes were co-cultured with monocytes and lymphocytes isolated from the peripheral blood of healthy donors. Therefore, it is contemplated that exosomes containing CRISPR Cas can be introduced into human monocytes and lymphocytes and reintroduced in an autologous manner. Thus, plasma exosomes can be used for delivery or administration according to the present invention.

[0524] liposomes

[0525] Liposome can be used for delivering or administering according to the present invention.Liposome is a spherical vesicle structure, which consists of a single layer or multilayer lipid bilayer around an internal aqueous compartment and a relatively impermeable external lipophilic phospholipid bilayer.Liposome has received considerable attention as a drug delivery vehicle because it is biocompatible, nontoxic, can deliver hydrophilic and lipophilic drug molecules, protect their payload from being degraded by plasma enzymes, and transport their load across biomembrane and blood-brain barrier (BBB) ​​(for review, see, e.g., Spuch and Navarro << Drug Delivery Magazine>> (Journal of Drug Delivery), 2011 volumes, document identifier 469679, page 12, 2011.doi:10.1155 / 2011 / 469679).

[0526] Liposomes can be made from several different types of lipids; however, phospholipids are most commonly used to produce liposomes as drug carriers. Although liposome formation is spontaneous when the lipid film is mixed with an aqueous solution, it can also be accelerated by applying force in the form of shaking using a homogenizer, ultrasonic generator, or extrusion equipment (for review, see, e.g., Spuch and Navarro, Journal of Drug Delivery, 2011, document identifier 469679, page 12, 2011. doi: 10.1155 / 2011 / 469679).

[0527] In some embodiments, the present invention provides the liposome of the present invention.Several other additives can be added to liposome to modify its structure and characteristic.For example, cholesterol or sphingomyelin can be added to the liposome mixture to help stabilize the liposome structure and prevent the leakage of the liposome internal load.In addition, liposome is prepared from hydrogenated egg phosphatidylcholine or egg phosphatidylcholine, cholesterol and dicetyl phosphate, and the average vesicle size of liposome is adjusted to about 50 to 100nm.(for review, referring to, for example, Spuch and Navarro " drug delivery magazine " (Journal of Drug Delivery), 2011 volumes, document identification code 469679, page 12, 2011.doi:10.1155 / 2011 / 469679).

[0528] Conventional liposome formulations are primarily composed of natural phospholipids and lipids such as 1,2-distearoyl-sn-glycero-3-phosphatidylcholine (DSPC), sphingomyelin, egg phosphatidylcholine, and monosialoganglioside. Because such formulations consist solely of phospholipids, liposome formulations have encountered numerous challenges, one of which is instability in plasma. Several attempts have been made to overcome these challenges, particularly in the manipulation of lipid membranes. One such attempt has focused on the manipulation of cholesterol. Adding cholesterol to conventional formulations slows the rapid release of encapsulated bioactive compounds into plasma, or adding 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) increases stability (for review, see, e.g., Spuch and Navarro, Journal of Drug Delivery, Vol. 2011, Article ID 469679, p. 12, 2011. doi:10.1155 / 2011 / 469679).

[0529] In a particularly advantageous embodiment, Trojan Horse liposomes (also known as molecular Trojan horses) are desirable and protocols can be found at http: / / cshprotocols.cshlp.org / content / 2010 / 4 / pdb.prot5407.long. These particles allow transgenes to be delivered to the entire brain after intravascular injection. Without limitation, neutral lipid particles with specific antibodies bound to the surface allow for crossing the blood-brain barrier via endocytosis. Applicants hypothesize that the use of Trojan Horse liposomes to deliver the CRISPR family of nucleases to the brain via intravascular injection will allow whole-brain transgenic animals without the need for embryonic manipulation. For in vivo administration in liposomes, approximately 1-5 g of nucleic acid molecules, such as DNA, RNA, can be considered.

[0530] In another embodiment, the CRISPR Cas system can be administered in liposomes, such as a stable nucleic acid-lipid particle (SNALP) (see, e.g., Morrissey et al., Nature Biotechnology, Vol. 23, No. 8, August 2005). Daily intravenous injections of about 1, 3, or 5 mg / kg / day of specific CRISPR Cas targeted in SNALP are contemplated. Daily treatment can be over about three days, followed by weekly treatment for about five weeks. In another embodiment, SNALP encapsulated with specific CRISPR Cas administered by intravenous injection at a dose of about 1 or 2.5 mg / kg are also contemplated (see, e.g., Zimmerman et al., Nature Letters, Vol. 441, May 4, 2006). The SNALP formulation can contain the lipids 3-N-[(w-methoxypoly(ethylene glycol)2000)carbamoyl]-1,2-dimyristyloxy-propylamine (PEG-C-DMA), 1,2-dilinoleyloxy-N,N-dimethyl-3-aminopropane (DLinDMA), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), and cholesterol in a molar percentage of 2:40:10:48 (see, e.g., Zimmerman et al., Nature Letters, Vol. 441, May 4, 2006).

[0531] In another embodiment, stable nucleic acid-lipid particles (SNALP) have been shown to effectively deliver molecules to highly vascularized HepG2-derived liver tumors, but not to poorly vascularized HCT-116-derived liver tumors (see, e.g., Li, Gene Therapy (2012) 19, 775-780). These SNALP liposomes can be prepared as follows: D-Lin-DMA and PEG-C-DMA are formulated with distearoylphosphatidylcholine (DSPC), cholesterol, and siRNA using a lipid / siRNA ratio of 25:1 and a molar ratio of cholesterol / D-Lin-DMA / DSPC / PEG-C-DMA of 48 / 40 / 10 / 2. The resulting SNALP liposomes are approximately 80-100 nm in size.

[0532] In yet another embodiment, SNALP can comprise synthetic cholesterol (Sigma-Aldrich, St. Louis, MO, USA), dipalmitoylphosphatidylcholine (Avanti Polar Lipids, Alabaster, AL, USA), 3-N-[(w-methoxypoly(ethylene glycol) 2000)carbamoyl]-1,2-dimyristyloxypropylamine, and cationic 1,2-dilinoleyloxy-3-N,N-dimethylaminopropane (see, e.g., Geisbert et al., Lancet 2010; 375: 1896-905). For example, a dose of about 2 mg / kg total CRISPR Cas per dose can be contemplated by intravenous bolus administration.

[0533] In yet another embodiment, SNALP can comprise synthetic cholesterol (Sigma-Aldrich), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC; Avanti Polar Lipids), PEG-cDMA, and 1,2-dilinoleyloxy-3-(N;N-dimethyl)aminopropane (DLinDMA) (see, e.g., Judge, J. Clin. Invest. 119:661-673 (2009). Formulations for in vivo studies can comprise a final lipid / RNA mass ratio of about 9:1.

[0534] The safety of RNAi nanomedicine has been commented on by Barros and Gollob of Alnylam Pharmaceuticals (Alnylam Pharmaceuticals) (see, for example, " Advanced Drug Delivery Reviews " (Advanced Drug Delivery Reviews) 64 (2012) 1730-1737). Stable nucleic acid lipid particles (SNALP) are made up of four different lipids - a cationic ionizable lipid (DLinDMA), a neutral auxiliary lipid, cholesterol and a diffusible polyethylene glycol (PEG)-lipid at low pH. The particle diameter is approximately 80nm and is electrically neutral at physiological pH. In the formulation, the ionizable lipid is used to condense lipid and anionic siRNA in the particle formation process. When positively charged under the acidic endosome conditions that increase gradually, the ionizable lipid also mediates the fusion of SNALP and endosome membrane, thereby enabling siRNA to be released into the cytoplasm. The PEG-lipid stabilizes the particles and reduces aggregation during formulation, and subsequently provides a neutral hydrophilic exterior to improve pharmacokinetic properties.

[0535] So far, two clinical projects have been started using SNALPsiRNA formulations. Tekmira Pharmaceuticals has recently completed a Phase I single-dose study of SNALP-ApoB in adult volunteers with increased LDL cholesterol. ApoB is mainly expressed in the liver and jejunum and is essential for the assembly and secretion of VLDL and LDL. ApoB is also successfully targeted by our CrISPR-Cas system, referring to Examples 38-39. Seventeen subjects received a single dose of SNALP-ApoB (across 7 dose escalations). There was no evidence of liver toxicity (expected to be the potential dose-limiting toxicity based on preclinical studies). One subject at the highest dose (two of them) experienced flu-like symptoms consistent with immune system stimulation, so the decision to end the trial was made.

[0536] Alnylam Pharmaceuticals has similarly launched ALN-TTR01, which uses the above-mentioned SNALP technology and targets hepatocyte production of mutant and wild-type TTR to treat TTR amyloidosis (ATTR). Three ATTR syndromes have been described: familial amyloid polyneuropathy (FAP) and familial amyloid cardiomyopathy (FAC) - both caused by autosomal dominant mutations in TTR; and senile systemic amyloidosis (SSA) caused by wild-type TTR. A placebo-controlled single-dose escalation Phase I trial of ALN-TTR01 was recently completed in patients with ATTR. ALN-TTR01 was administered to 31 patients (23 with study drug and 8 with placebo) as a 15-minute intravenous infusion at a dose range of 0.01 to 1.0 mg / kg (based on siRNA). Treatment was well tolerated, with no significant increases in liver function tests. Infusion-related reactions were noted in 3 of 23 patients at ≥0.4 mg / kg; all patients responded with a slowing of the infusion rate and all remained on study. Minimal and transient elevations in serum cytokines IL-6, IP-10, and IL-1ra were noted in two patients at the highest dose of 1 mg / kg (as expected based on preclinical and NHP studies). The expected pharmacological effect of ALN-TTR01, namely, a decrease in serum TTR, was observed at 1 mg / kg.

[0537] In another embodiment, SNALP can be made by dissolving cationic lipid, DSPC, cholesterol and PEG-lipid in ethanol at a molar ratio of 40:10:40:10 (see, Semple et al., " Nature Biotechnology " (Nature Niotechnology), Vol. 28, No. 2, February 2010, pp. 172-177). The lipid mixture is added to an aqueous buffer (50 mM citrate, pH 4), mixed to a final ethanol and lipid concentration of 30% (vol / vol) and 6.1 mg / ml, allowed to balance at 22 ° C for 2 minutes, and then extruded. Using Lipex extruder (Northern Lipids), hydrated lipids are passed through two layers of 80 nm pore size filters (Nuclepore) at 22 ° C until vesicles of 70-90 nm diameter are obtained, as determined by dynamic light scattering analysis. This generally requires 1-3 passes. The siRNA (dissolved in 50mM citrate, a pH of 4 aqueous solution containing 30% ethanol) was added to pre-equilibrated (35°C) vesicles at a rate of approximately 5 ml / min under mixing. After reaching a final target siRNA / lipid ratio of 0.06 (wt / wt), the mixture was incubated at 35°C for 30 minutes to allow vesicle reorganization and the encapsulation of the siRNA. Ethanol was then removed and the external buffer was replaced with PBS (155mM NaCl, 3mM Na2HPO4, 1mM KH2PO4, pH 7.5) by dialysis or tangential flow diafiltration. siRNA was encapsulated in SNALP using a controlled stepwise dilution process. The lipid components of KC2-SNALP are DLin-KC2-DMA (cationic lipid), dipalmitoylphosphatidylcholine (DPPC; Avanti Polar Lipids), synthetic cholesterol (Sigma) and PEG-C-DMA used in a molar ratio of 57.1:7.1:34.3:1.4. After forming the loaded particles, SNALP is dialyzed in PBS and sterilized by 0.2 μm filter membrane filtration before use. The average particle size is 75-85 nm, and 90%-95% of siRNA is encapsulated in lipid particles. The final siRNA / lipid ratio in the formulation for in vivo testing is about 0.15 (wt / wt). Immediately before use, the LNP-siRNA system containing Factor VII siRNA is diluted to an appropriate concentration in sterile PBS and administered intravenously with a total volume of 10 ml / kg through the lateral tail vein. This method can be analogized to the CRISPR Cas system of the present invention.

[0538] Other lipids

[0539] Other cationic lipids, such as the amino lipid 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), can be used to encapsulate CRISPR Cas in a similar manner to siRNA (see, e.g., Jayaraman, Angew. Chem. Int. Ed. 2012, 51, 8529-8533). Preformed vesicles having the following lipid composition can be considered: amino lipid, distearoylphosphatidylcholine (DSPC), cholesterol, and (R)-2,3-bis(octadecyloxy)propyl-1-(methoxypoly(ethylene glycol) 2000)propyl carbonate (PEG-lipid) in a molar ratio of 40 / 10 / 40 / 10, respectively, and a FVII siRNA / total lipid ratio of approximately 0.05 (w / w). To ensure a narrow particle size distribution in the range of 70-90 nm and a low polydispersity index of 0.11_0.04 (n=56), the particles can be extruded through an 80 nm membrane up to three times before adding CRISPR Cas RNA. Particles containing the highly potent amino lipid 16 can be used, where the molar ratio of the four lipid components 16, DSPC, cholesterol, and PEG-lipid (50 / 10 / 38.5 / 1.5) can be further optimized to enhance in vivo activity.

[0540] Michael SD Kormann et al. ("Expression of therapeutic proteins after delivery of chemically modified mRNA in mice": Nature Biotechnology, Vol. 29, pp. 154-157, (2011) published online January 9, 2011) describe the use of lipid envelopes for delivering RNA. The use of lipid envelopes is also preferred in the present invention.

[0541] In another embodiment, lipids can be formulated with the CRISPR Cas system of the present invention to form lipid nanoparticles (LNPs). Lipids include, but are not limited to, DLin-KC2-DMA4, C12-200 and auxiliary lipids distearoylphosphatidylcholine, cholesterol, and PEG-DMG, which can be formulated with CRISPR Cas instead of siRNA using a spontaneous vesicle formation procedure (see, e.g., Novobrantseva, Molecular Therapy-Nucleic Acids (2012) 1, e4; doi: 10.1038 / mtna.2011.3). The component molar ratio can be about 50 / 10 / 38.5 / 1.5 (DLin-KC2-DMA or C12-200 / distearoylphosphatidylcholine / cholesterol / PEG-DMG). In the case of DLin-KC2-DMA and C12-200 lipid nanoparticles (LNPs), the final lipid:siRNA weight ratio can be about 12:1 and 9:1, respectively. The formulation can have an average particle size of about 80 nm with an encapsulation efficiency of >90%. A dose of 3 mg / kg can be considered.

[0542] Tekmira has a portfolio of approximately 95 patent families in the U.S. and abroad directed to various aspects of LNPs and LNP formulations (see, e.g., U.S. Patent Nos. 7,982,027; 7,799,565; 8,058,069; 8,283,333; 7,901,708; 7,745,651; 7,803,397; 8,101,741; 8,188,263; 7,915,399; 8,236,943 and 7,838,658 and European Patent Nos. 1766035; 1519714; 1781593 and 1664316), all of which may be used and / or adapted for use with the present invention.

[0543] The CRISPR Cas system can be encapsulated in PLGA microspheres for delivery, as further described in U.S. published applications 20130252281 and 20130245107 and 20130244279 (assigned to Moderna Therapeutics), which relate to formulations of compositions comprising modified nucleic acid molecules that can encode a protein, a protein precursor, or a partially or completely processed form of the protein or protein precursor. The formulation has a molar ratio of 50:10:38.5:1.5-3.0 (cationic lipid: fusogenic lipid: cholesterol: PEG lipid). The PEG lipid can be selected from, but not limited to, PEG-c-DOMG, PEG-DMG. The fusogenic lipid can be DSPC. See also, Schrum et al., "Delivery and Formulation of Engineered Nucleic Acids," U.S. published application 20120251618.

[0544] Nanomerics' technology addresses the bioavailability challenges for a wide range of therapeutics, including those based on low molecular weight hydrophobic drugs, peptides, and nucleic acids (plasmids, siRNA, miRNA). The technology has demonstrated significant advantages in specific routes of administration, including oral administration, transport across the blood-brain barrier, delivery to solid tumors, and delivery to the eye. See, for example, Mazza et al., 2013, ACS Nano. 2013 Feb 26; 7(2): 1016-26; Uchegbu and Siew, 2013, J Pharm Sci. 102(2): 305-10 and Lalatsa et al., 2012, J Control Release, 2012 Jul 20; 161(2): 523-36.

[0545] U.S. Patent Publication No. 20050019923 describes cationic dendrimers for delivering bioactive molecules such as polynucleotide molecules, peptides and polypeptides and / or medicaments to the mammalian body. These dendrimers are suitable for targeting the delivery of bioactive molecules to, for example, the liver, spleen, lungs, kidneys or heart. Dendrimers are 3-dimensional macromolecules prepared in a stepwise manner from simple branched monomer units, and their properties and functionality can be easily controlled and changed. Dendrimers are synthesized by repeatedly adding structural units (building blocks) to a multifunctional core (divergent synthesis) or towards a multifunctional core (convergent synthesis), and each addition of the 3-dimensional shell of the structural unit results in the formation of a higher-level dendrimer. Polypropylene imine dendrimers start from a diaminobutane core and are reacted by a double Michael addition reaction of acrylonitrile to a primary amine to add twice the number of amino groups thereto, followed by hydrogenation of the nitrile. This results in the doubling of the amino groups. Polypropylene imine dendrimers contain 100% protonatable nitrogen and up to 64 terminal amino groups (grade 5, DAB 64). Protonatable groups are often amine groups capable of accepting protons at neutral pH. The use of dendrimers as gene delivery agents has largely focused on the use of polyamidoamines and phosphorus-containing compounds, with amine / amide mixtures or N--P(O2)S as conjugated units, respectively. No work has been reported on the use of lower-grade polypropylene imine dendrimers for gene delivery. Polypropylene imine dendrimers have also been studied as pH-sensitive controlled-release systems for drug delivery and for encapsulation of their guest molecules when chemically modified with peripheral amino acid groups. The cytotoxicity and interaction with DNA of polypropylene imine dendrimers, as well as the transfection efficacy of DAB 64, have also been studied.

[0546] U.S. Patent Publication No. 20050019923 is based on the observation, contrary to earlier reports, that cationic dendrimers, such as polypropyleneimine dendrimers, exhibit suitable properties, such as specific targeting and low toxicity, for use in the targeted delivery of bioactive molecules, such as genetic material. Furthermore, derivatives of cationic dendrimers also exhibit suitable properties for the targeted delivery of bioactive molecules. See also, Bioactive Polymers, U.S. Published Application No. 20080267903, which discloses various polymers, including cationic polyamine polymers and dendrimers, that have been shown to possess antiproliferative activity and are therefore useful for treating disorders characterized by undesirable cell proliferation, such as neoplasms and tumors, inflammatory disorders (including autoimmune disorders), psoriasis, and atherosclerosis. These polymers can be used alone as active agents or as delivery vehicles for other therapeutic agents, such as drug molecules or nucleic acids for gene therapy. In such cases, the inherent antitumor activity of these polymers can complement the activity of the agent to be delivered.

[0547] Supercharged proteins

[0548] Supercharged proteins are engineered or naturally occurring proteins with a very high positive or negative theoretical net charge. Both supernegative and superpositive proteins exhibit significant resistance to thermally or chemically induced aggregation. Superpositively charged proteins are also able to penetrate mammalian cells. Binding cargo to these proteins, such as plasmid DNA, siRNA, or other proteins, can make it possible for these macromolecules to be functionally delivered to mammalian cells in vitro and in vivo. David Liu's lab reported the creation and characterization of supercharged proteins in 2007 (Lawrence et al., 2007, Journal of the American Chemical Society 129, 10110-10112).

[0549] Non-viral delivery of siRNA and plasmid DNA into mammalian cells is valuable for both research and therapeutic applications (Akinc et al., 2010, Nat. Biotech. 26, 561-569). Purified +36 GFP protein (or other superpositively charged protein) is mixed with siRNA in an appropriate serum-free medium and allowed to recombine before being added to cells. The inclusion of serum at this stage will inhibit the formation of supercharged protein-siRNA complexes and reduce the therapeutic effect. The following protocol has been found to be effective for a variety of cell lines (McNaughton et al., 2009, Proc. Natl. Acad. Sci. USA 106, 6111-6116). However, pilot experiments to vary the protein and siRNA dosages should be performed to optimize the procedure for specific cell lines.

[0550] (1) One day before treatment, take 1x10 5 Cells / well were plated in 48-well plates.

[0551] (2) On the day of treatment, dilute purified +36 GFP protein in serum-free medium to a final concentration of 200 nM. Add siRNA to a final concentration of 50 nM. Vortex to mix and incubate at room temperature for 10 minutes.

[0552] (3) During the incubation period, aspirate the culture medium from the cells and wash again with PBS.

[0553] (4) After incubation with +36GFP and siRNA, protein-siRNA complexes were added to the cells.

[0554] (5) Incubate the cells with the complex at 37°C for 4 hours.

[0555] (6) After incubation, the culture medium was aspirated and the cells were washed three times with 20 U / mL heparinized PBS. The cells were incubated with serum-containing medium for an additional 48 hours or longer, depending on the assay used for knockdown.

[0556] (7) Analyze the cells by immunoblotting, qPCR, phenotypic analysis, or other appropriate methods.

[0557] +36GFP has been found to be an effective plasmid delivery agent in a range of cells. Because plasmid DNA is a larger cargo than siRNA, a proportionally larger amount of +36GFP protein is required for efficient plasmid complexation. For efficient plasmid delivery, applicants have developed a +36GFP variant with a C-terminal HA2 peptide tag, a known endosomal disrupting peptide derived from the influenza virus hemagglutinin protein. The following protocol is effective in a variety of cells, but as mentioned above, it is recommended to optimize the dose of plasmid DNA and supercharged protein for the specific cell line and delivery application.

[0558] (1) One day before treatment, take 1x10 5 / well were plated in 48-well plates.

[0559] (2) On the day of treatment, dilute purified p36 GFP protein in serum-free medium to a final concentration of 2 mM. Add 1 mg of plasmid DNA. Vortex to mix and incubate at room temperature for 10 minutes.

[0560] (3) During the incubation period, aspirate the culture medium from the cells and wash again with PBS.

[0561] (4) After incubation of p36 GFP and plasmid DNA, the protein-DNA complex is gently added to the cells.

[0562] (5) Incubate the cells with the complex at 37°C for 4 hours.

[0563] (6) After incubation, the culture medium was aspirated and washed with PBS. The cells were incubated in serum-containing medium for another 24-48 hours.

[0564] (7) Analysis of plasmid delivery (e.g., by plasmid-driven gene expression) where appropriate.

[0565] See also, e.g., McNaughton et al., Proc. Natl. Acad. Sci. USA 106, 6111-6116 (2009); Cronican et al., ACS Chemical Biology 5, 747-752 (2010); Cronican et al., Chemistry & Biology 18, 833-838 (2011); Thompson et al., Methods in Enzymology 503, 293-319 (2012); Thompson DB, et al., Chemistry & Biology 19(7), 831-843 (2012). These methods of supercharged proteins can be used and / or adapted for delivery of the CRISPR Cas system of the present invention.

[0566] Cell-penetrating peptides

[0567] In yet another embodiment, cell penetrating peptides (CPPs) are contemplated for delivery of the CRISPR Cas system. CPPs are short peptides that promote cellular uptake of different molecular cargoes (from nanoscale particles to large fragments of small chemical molecules and DNA). The term "cargo" as used herein includes, but is not limited to, the group consisting of therapeutic agents, diagnostic probes, peptides, nucleic acids, antisense oligonucleotides, plasmids, proteins, nanoparticles, liposomes, chromophores, small molecules, and radioactive substances. In various aspects of the invention, the cargo may also include any component of the CRISPR Cas system or the entire functional CRISPR Cas system. Various aspects of the invention further provide methods for delivering the desired cargo into a subject, comprising: (a) preparing a complex comprising a cell penetrating peptide of the invention and a desired cargo, and (b) administering the complex orally, intraarticularly, intraperitoneally, intrathecally, intraarterially, intranasally, intraparenchymally, subcutaneously, intramuscularly, intravenously, dermally, rectally, or topically to a subject. The cargo is associated with the peptides through chemical bonds, either via covalent bonds or through non-covalent interactions.

[0568] The function of CPP is to deliver the cargo into the cell, which is a process that usually occurs through endocytosis, wherein the cargo is delivered to the endosome of living mammalian cells. Cell penetrating peptides have different sizes, amino acid sequences, and charges, but all CPPs have a different characteristic, which is the ability to translocate the plasma membrane and assist in delivering cargoes of various molecular weights to the cytoplasm or organelles. The CPP translocation can be divided into three main entry mechanisms: direct penetration into the membrane, endocytosis-mediated entry, and translocation by forming a temporary structure. CPP has been found in many applications of drugs (including cancer and viral inhibitors) as drug delivery agents in the treatment of different diseases, as well as in many applications of contrast agents for cell labeling. Examples of the latter include serving as carriers for GFP, MRI contrast agents, or quantum dots. CPP has a very large potential as a delivery carrier in vitro and in vivo for research and medicine. CPPs typically have an amino acid composition that contains a high relative abundance of negatively charged amino acids, such as lysine or arginine, or a sequence containing an alternating pattern of polar / charged amino acids and nonpolar hydrophobic amino acids. These two types of structures are referred to as polycationic or amphipathic, respectively. A third class of CPPs are hydrophobic peptides containing only nonpolar residues, with a low net charge or with hydrophobic amino acid groups that are critical for cellular uptake. One of the initial CPPs discovered was the transactivating transcription factor (Tat) from human immunodeficiency virus 1 (HIV-1), which was found to be efficiently taken up from the surrounding medium by many cell types in culture. Since then, the number of known CPPs has expanded significantly, and small molecule synthetic analogs with more potent protein transduction properties have been generated. CPPs include, but are not limited to, penetratin, Tat (48-60), transportan, and (R-AhX-R4) (Ahx = aminocaproyl).

[0569] As described in U.S. Patent No. 8,372,951, a CPP derived from eosinophil cationic protein (ECP) is provided that exhibits high cell penetration efficiency and low toxicity. Various aspects of delivering the CPP and its cargo into a vertebrate subject are also provided. Other aspects of the CPP and its delivery are described in U.S. Patent Nos. 8,575,305; 8,614,194; and 8,044,019.

[0570] CPPs can be used to deliver CRISPR-Cas systems, as also provided in the manuscript "Gene disruption by cell-penetrating peptide-mediated delivery of Cas9 protein and guide RNA," Suresh Ramakrishna, Abu-Bonsrah Kwaku Dad, Jagadish Beloor, et al., Genome Res. Apr. 2, 2014 [Epub ahead of print], incorporated by reference in its entirety, which demonstrated that treatment with CPP-conjugated recombinant Cas9 protein and CPP-complexed guide RNA resulted in endogenous gene disruption in human cell lines. In this paper, Cas9 protein was conjugated to CPP via a thioether bond, while the guide RNA was complexed with the CPP to form condensed, negatively charged nanoparticles. It has been shown that simultaneous and sequential treatment of human cells, including embryonic stem cells, dermal fibroblasts, HEK293T cells, HeLa cells, and embryonic carcinoma cells, with modified Cas9 and guide RNA results in efficient gene disruption with reduced off-target mutations relative to plasmid transfection.

[0571] Implantable devices

[0572] In another embodiment, implantable devices for delivery of CRISPR Cas systems are also contemplated. For example, U.S. Patent Publication 20110195123 discloses an implantable medical device that elutes drugs locally and over an extended period, including several types of such devices, treatment methods implemented, and implantation methods. The device comprises a polymer substrate, for example, a matrix used as the main body of the device, and a drug, and in some cases comprises additional stent materials, such as metal or another polymer, and materials that enhance visibility and imaging. The choice of drug is based on the advantages of releasing the drug locally and over an extended period, wherein the drug is released directly into the extracellular matrix (ECM) of the diseased area, such as tumors, inflammation, degeneration, or for symptom-directed purposes, or released into damaged smooth muscle cells, or for prevention. One drug is a gene silencing drug based on RNA interference (RNAi), including but not limited to siRNA, shRNA, or antisense RNA / DNA, ribozymes, and nucleoside analogs. Therefore, this system can be used for and / or applicable to the CRISPR Cas system of the present invention. In some embodiments, the implantation method is an existing implantation procedure currently developed and used for other treatments including brachytherapy and needle biopsy. In such cases, the size of the new implant described in the present invention is similar to the original implant. Typically, fewer devices are implanted in the same treatment procedure.

[0573] As described in U.S. Patent Publication 20110195123, a drug delivery implantable or insertable system is provided, including any other type of administration suitable for use in cavities such as the peritoneal cavity and / or where the drug delivery system is not anchored or attached, comprising a biostable and / or degradable and / or bioabsorbable polymer substrate, which may, for example, optionally be a matrix. It should be noted that the term "insertion" also includes implantation. The drug delivery system is preferably implemented as a "Loder" as described in U.S. Patent Publication 20110195123.

[0574] The polymer or polymers are biocompatible and bind the agent and / or agents so that the agents are released at a controlled rate, wherein the total volume of the polymer matrix, such as a matrix, is optionally and preferably no greater than the maximum volume that allows therapeutic levels of the agent to be achieved. As a non-limiting example, such a volume is preferably in the range of 0.1 m 3 Up to 1000mm 3 The Loder is optionally larger, for example when combined with a device whose size is determined by functionality, such as, but not limited to, a knee joint, an intrauterine device, or a cervical ring.

[0575] In some embodiments, the drug delivery system (for delivering the composition) is designed to preferably utilize a degradable polymer in which the primary release mechanism is bulk erosion; or in some embodiments, a non-degradable or slowly degrading polymer is used in which the primary release mechanism is diffusion rather than bulk erosion, such that the outer portion acts as a membrane and the inner portion acts as a drug reservoir that is substantially unaffected by the environment for an extended period (e.g., from about a week to about several months). Combinations of different polymers with different release mechanisms may also optionally be used. During a significant portion of the total drug release period, the concentration gradient at the surface is preferably maintained effectively constant, and thus the diffusion rate is effectively constant (referred to as "zero-mode" diffusion). By the term "constant," it is meant a diffusion rate that is preferably maintained above a low threshold for therapeutic effect, but may still optionally have initial burst characteristics and / or fluctuations, such as increases and decreases to a certain extent. The diffusion rate is preferably maintained in this manner for an extended period, and is considered to be constant relative to a certain level in order to optimize the therapeutically effective period, such as the effective silent period.

[0576] The drug delivery system is optionally and preferably designed to protect the nucleotide-based therapeutic from degradation, whether chemical in nature or due to attack by enzymes and other factors within the subject's body.

[0577] The drug delivery system as described in U.S. Patent Publication 20110195123 is optionally associated with sensing and / or activation devices that are operated during and / or after implantation of the device by non-invasive and / or minimally invasive methods of activation and / or acceleration / deceleration, such as optionally including but not limited to thermal heating and cooling, laser beams and ultrasound, including focused ultrasound and / or RF (radio frequency) methods or devices.

[0578] According to the following examples of U.S. Patent Publication 20110195123, the site for local delivery can optionally include target sites characterized by highly abnormal cell proliferation, suppressed apoptosis, including tumors, active and / or chronic inflammation and infection, including autoimmune disease states, degenerative tissues (including muscle and nerve tissue), chronic pain, degenerative sites, and fracture sites and other wound sites for enhancing tissue regeneration, as well as damaged myocardium, smooth muscle and striated muscle. The site for local delivery can also optionally include sites capable of preventing activities (including pregnancy), preventing infection and aging.

[0579] The site, or target site, for implanting the composition is preferably characterized by a sufficiently small radius, area, and / or volume for targeted local delivery. For example, the target site optionally has a diameter in the range of from about 0.1 mm to about 5 cm.

[0580] The location of the target site is preferably selected for maximum therapeutic efficacy.For example, the composition of the drug delivery system (optionally together with a device for implantation as described above) is optionally and preferably implanted within or near the tumor environment or the blood supply associated therewith.

[0581] For example, the composition (optionally together with the device) is optionally implanted in or near the pancreas, prostate, breast, liver, through the nipple, within the vascular system, and the like.

[0582] The target location is optionally selected from the group consisting of the following (by way of non-limiting example only, as optionally any site in the body may be suitable for implantation of a Loder): 1. Brain in degenerative sites, like the basal ganglia, white matter and gray matter in Parkinson's disease or Alzheimer's disease; 2. Spine as in the case of amyotrophic lateral sclerosis (ALS); 3. Cervix to prevent HPV infection; 4. Active or chronic inflammatory joints; 5. Dermis in the case of psoriasis; 6. Sympathetic and sensory nerve sites for analgesia; 7. Intraosseous implantation; 8. Sites of acute and chronic infection; 9. Intravaginal; 10. Intraauricular - auditory system, labyrinth of the inner ear, vestibular system; 11. Intratracheal; 12. Intracardiac; coronary arteries, epicardium; 13. Bladder; 14. Biliary system; 15. Parenchymal tissue, Including but not limited to the kidneys, liver, spleen; 16. lymph nodes; 17. salivary glands; 18. gums; 19. intra-articular (into the joints); 20. intra-ocular; 21. brain tissue; 22. ventricles; 23. cavities, including the abdominal cavity (for example, but not limited to, ovarian cancer); 24. intra-esophageal and 25. intra-rectal.

[0583] Optionally, insertion of the system (e.g., a device containing the composition) is associated with injection of material into the ECM at the target site and proximal to the site, thereby affecting the local pH and / or temperature in the target site and proximal to the site and / or other biological factors that affect the diffusion and / or pharmacokinetics of the drug.

[0584] Optionally, according to some embodiments, the release of the agent can be associated with sensing and / or activation devices that are operated before and / or during and / or after insertion by non-invasive and / or minimally invasive methods of activation and / or acceleration / deceleration and / or other methods, including laser beams, radiation, thermal heating and cooling, and ultrasound, including focused ultrasound and / or RF (radio frequency) methods or devices, and chemical activation agents.

[0585] According to other embodiments of U.S. Patent Publication 20110195123, the drug preferably comprises a gene silencing biological RNAi drug, for example, for localized cancer conditions, in the breast, pancreas, brain, kidney, bladder, lung, and prostate, as described below. Moreover, many drugs other than siRNA are suitable for encapsulation in a Loder and can be associated with the present invention, as long as such drugs can be encapsulated in a Loder substrate (such as a matrix). Such drugs include currently approved drugs delivered by methods other than the present invention, including amphotericin B for fungal infections; antibiotics such as those used in osteomyelitis; analgesics such as anesthetics; antidegenerative agents such as those in Alzheimer's or Parkinson's disease, in the case of back pain, in a Loder implanted near the spine. Such a system can be used and / or adapted to deliver the CRISPR Cas system of the present invention.

[0586] For example, for special applications, such as preventing the growth and regrowth of smooth muscle cells (which are damaged during the stent placement procedure and therefore tend to proliferate), the drug can optionally be an siRNA that silences smooth muscle cells (including H19 silencing), or a drug selected from the group consisting of paclitaxel, rapamycin, and rapamycin analogs. In such cases, the Loder is preferably a drug eluting stent (DES) that releases at a constant rate for an extended period, or a dedicated device that is implanted separately and associated with the stent. This can all be used and / or adapted for the CRISPR Cas system of the present invention.

[0587] As another example of a special application, neuromuscular degenerative diseases occur due to abnormal gene expression. Local delivery of silencing RNA can have therapeutic properties that interfere with such abnormal gene expression. Local delivery of anti-apoptotic, anti-inflammatory and anti-degenerative drugs, including small molecule drugs and macromolecules, can also be optionally therapeutic. In such cases, the Loder is used to extend the release at a constant rate and / or by a dedicated device that is implanted separately. This can all be used and / or applicable to the CRISPR Cas system of the present invention.

[0588] As another example of special applications, gene modifiers are used to treat mental and cognitive disorders. Knockdown of genes with silencing RNA is a treatment option. Local delivery of nucleotide-based medicaments to the central nervous system is a treatment option for mental and cognitive disorders, including but not limited to psychosis, bipolar disease, neurological disorders and behavioral maladies. These loaders can also deliver drugs including small molecule drugs and macromolecules locally when implanted in specific brain sites. This can be used for and / or applicable to the CRISPR Cas system of the present invention.

[0589] As another example of a special application, the silencing of innate and / or adaptive immune mediators at a local site enables the prevention of organ transplant rejection. Local delivery of silencing RNA and immunomodulatory agents using a Loder implanted into the transplanted organ and / or implantation site results in local immunosuppression via repellent immune cells (such as CD8 activated against the transplanted organ). This can all be used and / or adapted for the CRISPR Cas system of the present invention.

[0590] As another example of a specific application, angiogenic factors, including VEGF and angiopoietin, among others, are essential for the formation of new blood vessels. Local delivery of these factors, peptides, peptidomimetics, or inhibition of their inhibitors is an important therapeutic modality; silencing inhibitors and local delivery of these factors, peptides, macromolecules, and small molecule drugs that stimulate angiogenesis using Loders are therapeutic for peripheral vascular disease, systemic vascular disease, and cardiovascular disease.

[0591] Methods of insertion, such as implantation, may optionally have been used for other types of tissue implantation and / or for tissue sampling, optionally without modification in such methods, or alternatively optionally with only non-critical modifications. Such methods optionally include, but are not limited to, brachytherapy, biopsy, endoscopy with and / or without ultrasound, such as ERCP, stereotactic methods for accessing brain tissue, laparoscopy, including laparoscopic access to joints, abdominal organs, bladder walls, and implantation of body cavities.

[0592] CRISPR enzyme mRNA and guide RNA

[0593] Alternatively, the CRISPR enzyme mRNA and guide RNA may be delivered separately. The CRISPR enzyme mRNA may be delivered before the guide RNA has given time for the CRISPR enzyme to express. The CRISPR enzyme mRNA may be administered 1-12 hours (preferably about 2-6 hours) before the guide RNA is administered.

[0594] Alternatively, CRISPR enzyme mRNA and guide RNA can be administered together. Advantageously, a second booster dose of guide RNA can be administered 1-12 hours (preferably about 2-6 hours) after the initial administration of CRISPR enzyme mRNA + guide RNA.

[0595] To achieve the most efficient level of genome modification, additional administration of CRISPR enzyme mRNA and / or guide RNA may be useful.

[0596] In order to minimize toxicity and off-target effects, it is important to control the concentration of the delivered CRISPR enzyme mRNA and guide RNA. The optimal concentration of CRISPR enzyme mRNA and guide RNA can be determined by testing different concentrations in cells or animal models and using deep sequencing to analyze the range of modifications at potential off-target genomic loci. For example, for a guide sequence targeting 5'-GAGTCCGAGCAGAAGAAGAA-3' in the EMX1 gene of the human genome, deep sequencing can be used to assess the modification levels at the following two off-target sites, 1: 5'-GAGTCCTAGCAGGAGAAGAA-3' and 2: 5'-GAGTCTAAGCAGAAGAAGAA-3'. For in vivo delivery, a concentration that produces the highest on-target modification level while minimizing off-target modification levels should be selected.

[0597] Alternatively, in order to reduce toxicity levels and off-target effects to a minimum, a pair of guide RNAs targeting site of interest can be used to deliver CRISPR enzyme nickase mRNA (e.g., Streptococcus pyogenes Cas9 with D10A modification). These two guide RNAs need to be spaced apart as follows. The guide sequences (these examples are based on the PAM that Streptococcus pyogenes Cas9 needs) are respectively in red (single underline) and blue (double underline).

[0598]

[0599]

[0600]

[0601]

[0602]

[0603] Further interrogation of the system provided Applicants with evidence of 5' overhangs (see, e.g., Ran et al., Cell, Sep 12, 2013; 154(6): 1380-9 and U.S. Provisional Patent Application Serial No. 61 / 871,301 filed Aug 28, 2013). Applicants further identified parameters related to efficient cleavage by Cas9 nickase mutants when combined with two guide RNAs, and these parameters include, but are not limited to, the length of the 5' overhang. In embodiments of the invention, the 5' overhang has at most 200 base pairs, preferably at most 100 base pairs, or more preferably at most 50 base pairs. In embodiments of the invention, the 5' overhang has at least 26 base pairs, preferably at least 30 base pairs, or more preferably 34-50 base pairs or 1-34 base pairs. In other preferred methods of the invention, the first guide sequence directs cleavage of one strand of the DNA duplex adjacent to the first target sequence and the second guide sequence directs cleavage of the other strand adjacent to the second target sequence thereby generating a blunt cut or a 3' overhang. In embodiments of the invention, the 3' overhang is at most 150, 100 or 25 base pairs, or at least 15, 10 or 1 base pairs. In preferred embodiments, the 3' overhang is 1-100 base pairs.

[0604] Aspects of the invention relate to expression of a gene product that is reduced, or a template polynucleotide that is further introduced into a DNA molecule encoding a gene product, or an intervening sequence that is precisely severed by allowing the two 5' overhangs to reanneal and ligate, or the activity or function of a gene product that is altered, or expression of a gene product that is increased. In one embodiment of the invention, the gene product is a protein.

[0605] Only sgRNA pairs that generated 5' overhangs with less than 8 bp overlap between the guide sequences (greater than a -8 bp offset) mediated detectable indels. Importantly, each guide used in these analyses was important for efficient induction of indels when paired with wild-type Cas9, indicating that the relative position of the guide pairs is the most important parameter in predicting double-cleavage activity.

[0606] Since Cas9n and Cas9H840A cut the relative chains of DNA, for a given sgRNA pair, replacing Cas9n with Cas9H840A will result in a reversal of the overhang type. For example, a pair of sgRNAs that will produce a 5' overhang with Cas9n will in principle produce a corresponding 3' overhang instead. Therefore, the sgRNA pairs that result in the production of 3' overhangs with Cas9n can be used together with Cas9H840A to produce a 5' overhang. Unexpectedly, the applicant tested Cas9H840A using a group of sgRNAs designed to produce both 5' and 3' overhangs (offset range from -278 to +58bp), but indel information could not be observed. Further work may be needed to identify the necessary design rules for sgRNA pairing to allow double cutting via Cas9H840A.

[0607] Liver, proprotein convertase subtilisin / kexin9 (PCSK9)

[0608] The data show phenotypic conversion.

[0609] Proprotein convertase subtilisin / Kexin9 (PCSK9) is a member of the subtilisin / Kexin family of serine proteases. PCSK9 is primarily expressed by the liver and is critical for downregulating hepatocyte LDL receptor expression. Plasma LDL-C levels are highly elevated in humans with PCSK9 functional mutations, who are classified as suffering from severe hypercholesterolemia. Therefore, PCSK9 is an attractive target for CRISPR. PCS9K-targeted CRISPR can be formulated in lipid particles and, for example, administered intravenously at about 15, 45, 90, 150, 250, and 400 μg / kg (see, for example, available at www.alnylam.com / capella / wp-content / uploads / 2013 / 08 / ALN-PCS02-001-Protocol-Lancet.pdf).

[0610] Bailey et al., J Mol Med (Berl). 1999 Jan;77(1):244-9, discloses insulin delivery by ex vivo somatic cell gene therapy, which involves removing non-B cell somatic cells (e.g., fibroblasts) from a diabetic patient and genetically altering them in vitro to produce and secrete insulin. These cells can be grown in culture and returned to the donor as a replacement source of insulin. Cells modified in this way can be evaluated before implantation, and stock solutions can be cryopreserved. By using the patient's own cells, the procedure avoids the need for immunosuppression and overcomes the problem of tissue supply while avoiding the recurrence of cell destruction. Ex vivo somatic cell gene therapy requires an accessible and robust cell type that can withstand multiple transfections and is amenable to controlled proliferation. Specific problems associated with the use of non-B cell somatic cells include the processing of proinsulin to insulin, and the conferring of sensitivity to glucose-stimulated proinsulin synthesis and regulated insulin release. Preliminary studies using fibroblasts, pituitary cells, kidney (COS) cells, and ovarian (CHO) cells suggest that these challenges may be met and that ex vivo somatic cell gene therapy provides a viable approach for insulin replacement therapy. The system of Bailey et al. may use and / or be adapted for delivery to the liver using the CRISPR Cas system of the present invention.

[0611] The method of Sato et al. ("Nature Biotechnology" (Nature Biotechnology), Vol. 26, No. 4, April 2008, pp. 431-442) can be applied to the CRISPR Cas system of the present invention for delivery to the liver. Sato et al. found that in mice with cirrhosis induced by otherwise lethal dimethylnitrosamine, liposome treatment with siRNA coupled to vitamin A almost completely resolved liver fibrosis and prolonged survival in a dose-dependent and duration-dependent manner. Cationic liposomes (Lipotrust) containing O, O'-ditetradecanoyl-N-(a-trimethylammonioacetyl) diethanolamine chloride (DC-6-14), cholesterol and dioleoylphosphatidylethanolamine as cationic lipids in a molar ratio of 4:3:3 (which shows high transfection efficiency for in vitro and in vivo gene delivery under serum-containing conditions) were purchased from (Hokkaido System Science Co., Ltd. (Hokkaido System Science)). These liposomes were produced using a freeze-dried empty liposome method and prepared to a 1 mM concentration (DC-16-4) by adding double distilled water (DDW) to the freeze-dried lipid mixture under vortexing before use. To prepare VA-coupled liposomes, 200 nmol of vitamin A (retinol, Sigma) dissolved in DMSO was mixed with the liposome suspension (100 nmol as DC-16-4) in a 1.5 ml tube at 25°C. To prepare VA-coupled liposomes carrying siRNAgp46 (VA-lip-siRNAgp46), a siRNAgp46 solution (580 pmol / ml in DDW) was added to the retinol-coupled liposome solution with stirring at 25°C. The siRNA to DC-16-4 ratio was 1:11.5 (mol / mol) and the siRNA to liposome ratio (wt / wt) was 1:1. Any free vitamin A or siRNA that is not absorbed by the liposomes is separated from the liposome formulation using a micropartitioning system (VIVASPIN 2 concentrator 30,000 MWCO PES, VIVASCIENCE). The liposome suspension is added to the filter and centrifuged at 1,500g for 5 minutes at 25°C for 3 times. The various fractions are collected and the material trapped in the filter is reconstituted with PBS to achieve the desired dose for in vitro or in vivo use. Rats are given 0.75 mg / kg siRNA every other day for three injections. By delivering approximately 0.5 to 1 mg / kg of CRISPR Cas RNA in liposomes as described by Sato et al. to humans, the system of Sato et al. can be used and / or adapted for the CRISPR Cas system of the present invention for delivery to the liver.

[0612] For delivery of siRNA to hepatocytes both in vitro and in vivo, the method of Rozema et al. (PNAS, August 7, 2007, Vol. 104, No. 32), which they have named siRNA Dynamic PolyConjugates, can also be applied to the present invention. Key features of the dynamic polyconjugate technology include membrane-active polymers, the ability to reversibly mask the activity of this polymer until it reaches the acidic environment of the endosome, and the ability to specifically target this modified polymer and its siRNA cargo to hepatocytes in vivo after a simple low-pressure intravenous injection. SATA-modified siRNA was synthesized by reacting 5'-amine-modified siRNA with 1 weight equivalent (wt eq) of N-succinimidyl-S-acetylthioacetate (SATA) reagent (Pierce) and 0.36 wt eq of NaHCO in water at 4°C for 16 h. The modified siRNA was then precipitated by adding 9 volumes of ethanol and incubating at 80°C for 2 hours. The precipitate was resuspended in 1X siRNA buffer (Dharmacon) and quantified by measuring absorbance at a wavelength of 260 nm. PBAVE (30 mg / ml in 5 mM TAPS, pH 9) was modified by adding 1.5 wt% SMPT (Pierce). After a 1-hour incubation, 0.8 mg of SMPT-PBAVE was added to 400 μl of isotonic glucose solution (pH 9) containing 5 mM TAPS. To this solution was added 50 μg of SATA-modified siRNA. For dose-response experiments in which [PBAVE] was constant, varying amounts of siRNA were added. The mixture was then incubated for 16 hours. To this solution was then added 5.6 mg of Hepes free base, followed by a mixture of 3.7 mg of CDM-NAG and 1.9 mg of CDM-PEG. The solution was then incubated at room temperature for at least 1 hour before injection. CDM-PEG and CDM-NAG were synthesized from an acid chloride generated using oxalyl chloride. To this acid chloride was added 1.1 molar equivalents of polyethylene glycol monomethyl ether (average molecular weight 450) to produce CDM-PEG or (aminoethoxy)ethoxy-2-(acetylamino)-2-deoxy-β-D-glucopyranoside, thereby producing CDM-NAG. The final product was purified using reverse-phase HPLC with a 0.1% TFA water / acetonitrile gradient. Approximately 25 to 50 μg of siRNA was delivered to mice.For example, by envisioning a dose of about 50 to about 200 mg of CRISPR Cas for delivery to humans, the system of Rozema et al. can be applied to the CRISPR Cas system of the present invention for delivery to the liver.

[0613] Targeted deletion, therapeutic application

[0614] The targeted deletion of gene is preferred. Examples are exemplified in Example 18. Therefore, it is preferred that the genes related to cholesterol biosynthesis, fatty acid biosynthesis and other metabolic disorders are involved, genes encoding misfolded proteins related to amyloid and other diseases, oncogenes leading to cell transformation, latent viral genes, and genes leading to negative dominant diseases (dominant-negative disorder), other disorders. As an example here, the applicant proposes to use a virus or nanoparticle delivery system to carry out gene delivery of the CRISPR-Cas system to the liver, brain, eye, epithelium, hematopoiesis or another tissue of a subject or patient in need thereof, and the subject or patient has metabolic disorder, amyloidosis, protein accumulation-related disease, cell transformation due to gene mutation and gene dysplasia, negative dominant effect of gene mutation, latent viral infection and other related symptoms.

[0615] Therapeutic applications of the CRISPR-Cas system include glaucoma, amyloidosis, and Huntington's disease. These are exemplified in Example 20, and the features described therein are preferred individually or in combination.

[0616] Another example of a polyglutamine expansion disease that can be treated by the present invention includes spinocerebellar ataxia type 1 (SCA1). After intracerebellar injection, a recombinant adeno-associated virus (AAV) vector expressing short hairpin RNA profoundly improved motor coordination, restored cerebellar morphology, and resolved characteristic spinocerebellar ataxia protein 1 inclusion bodies in Purkinje cells of SCA1 mice (see, e.g., Xia et al., Nature Medicine, Vol. 10, No. 8, August 2004). In particular, AAV1 and AAV5 vectors are preferred, and about 1×10 12 AAV titers of 10 vector genomes / ml are desirable.

[0617] As an example, chronic infection caused by HIV-1 can be treated or prevented. In order to achieve this goal, CRISPR-Cas guide RNAs targeting the vast majority of HIV-1 genomes can be produced, while considering HIV-1 strain variants to maximize coverage and effectiveness. The delivery of the CRISPR-Cas system can be achieved through conventional adenovirus or lentivirus-mediated infection of the host immune system. Depending on the approach, host immune cells can be a) separated, transduced with CRISPR-Cas, selected, and reintroduced into the host or b) transduced in vivo by systemic delivery of the CRISPR-Cas system. The first approach allows the generation of resistant immune populations, while the second is more likely to target the latent viral reservoirs in the host. This is discussed in more detail in the examples section.

[0618] In another example, U.S. Patent Publication No. 20130171732, assigned to Sangamo BioSciences, Inc., relates to the insertion of an anti-HIV transgene into the genome, and its methods can be applied to the CRISPR Cas system of the present invention. In another embodiment, the CXCR4 gene can be targeted and the TALE system assigned to Sangamo BioSciences, Inc., U.S. Patent Publication No. 20100291048, can be modified to the CRISPR Cas system of the present invention. The methods of U.S. Patent Publication Nos. 20130137104 and 20130122591 assigned to Sangamo BioSciences, Inc. and U.S. Patent Publication No. 20100146651 assigned to Cellectis are generally applicable to transgenic expression because they involve modification of the hypoxanthine guanine phosphoribosyltransferase (HPRT) seat for increasing the frequency of gene modification.

[0619] It is also conceivable that the present invention generates a library of knockout cells. Each cell can have a single gene knocked out. This is exemplified in Example 23.

[0620] People can make a library of ES cells, in which each cell has a single gene knocked out, and the entire library of ES cells will have each single gene knocked out. This library is useful for screening the gene functions of cellular processes and diseases. To make this cell library, people can integrate Cas9 driven by an inducible promoter (e.g., a doxycycline-inducible promoter) into ES cells. In addition, people can integrate a single guide RNA targeting a specific gene into ES cells. To make an ES cell library, people can simply mix ES cells with a library of genes encoding guide RNAs targeting each gene in the human genome. People can first introduce a single BxB1 attB site into the AAVS1 locus of human ES cells. Then, the BxB1 integrase can be used to promote the integration of individual guide RNA genes into the BxB1attB site in the AAVS1 locus. To promote integration, each guide RNA gene can be contained on a plasmid carrying a single attP site. In this way, BxB1 will cause the attB site in the genome to recombine with the attP site on the plasmid containing the guide RNA. To generate this cell library, one can take a library of cells with a single guide RNA integrated and induce Cas9 expression. Following induction, Cas9 mediates double-strand breaks at the site specified by the guide RNA.

[0621] Long-term administration of protein therapeutics can elicit unacceptable immune responses against the particular protein. The immunogenicity of protein drugs can be attributed to a small number of immunodominant helper T lymphocyte (HTL) epitopes. Reducing the MHC binding affinity of these HTL epitopes contained within these proteins can produce drugs with lower immunogenicity (Tangri S et al. "Rationally engineered therapeutic proteins with reduced immunogenicity" J Immunol. 2005 Mar 15; 174(6): 3187-96). In the present invention, the immunogenicity of the CRISPR enzyme can be reduced by specifically following the method first proposed by Tangri et al. for erythropoietin and subsequently developed. Therefore, directed evolution or rational design can be used to reduce the immunogenicity of CRISPR enzymes (e.g., Cas9) in host species (human or other species).

[0622] In Example 28, the applicant used three kinds of guide RNAs of interest, and these guide RNAs were able to visualize the effective in vivo DNA cleavage that occurred only in a small subset of cells. In essence, what the applicant has shown here is targeted in vivo cleavage. Specifically, this provides a proof of concept that specific targeting can also be achieved in higher organisms (such as mammals). The multivariate aspect also emphasized is that multiple guide sequences (i.e., separate targets) can be used simultaneously (in the sense of co-delivery). In other words, the applicant used a multi-pathway in which several different sequences are simultaneously and independently targeted.

[0623] An example of a suitable protocol for generating AAV, a preferred vector of the invention, is provided in Example 34.

[0624] Trinucleotide repeat disorders are preferred conditions to be treated. These are also exemplified herein.

[0625] For example, U.S. Patent Publication No. 20110016540 describes the use of zinc finger nucleases to genetically modify cells, animals, and proteins associated with trinucleotide repeat expansion disorders, which are complex, progressive diseases involving developmental neurobiology and often affecting cognitive and sensorimotor function.

[0626] Trinucleotide repeat expansion proteins are a set of diverse proteins that are associated with the susceptibility to trinucleotide repeat expansion disorders, the presence of trinucleotide repeat expansion disorders, the severity of trinucleotide repeat expansion disorders, or any combination thereof. Trinucleotide repeat expansion disorders are divided into two categories determined by the type of repeat. The most common repeat is the triplet CAG, which, when present in the coding region of a gene, encodes the amino acid glutamine (Q). Therefore, these disorders are referred to as polyglutamine (polyQ) disorders and include the following diseases: Huntington's disease (HD); Spinal bulbar muscular atrophy (SBMA); Spinocerebellar ataxia (SCA type 1, 2, 3, 6, 7, and 17); and dentate nucleus, rubral nucleus, pallidum, and hypothalamic nucleus atrophy (DRPLA). The remaining trinucleotide repeat expansion disorders do not involve CAG triplets, or the CAG triplets are not in the coding region of the gene, and are therefore referred to as non-polyglutamine disorders. Non-polyglutamine disorders include fragile X syndrome (FRAXA); fragile XE mental retardation (FRAXE); Friedreich ataxia (FRDA); myotonic dystrophy (DM); and spinocerebellar ataxia (SCA types 8 and 12).

[0627] The protein that is associated with trinucleotide repeat expansion disorder is typically selected based on the experimental association of trinucleotide repeat expansion disorder related protein with trinucleotide repeat expansion disorder.For example, relative to the colony without trinucleotide repeat expansion disorder, in the colony with trinucleotide repeat expansion disorder, the production rate or circulating concentration of the protein related to trinucleotide repeat expansion disorder can be increased or decreased.Proteomic techniques can be used to assess protein level differences, including but not limited to western blotting, immunohistochemical staining, enzyme-linked immunosorbent assay (ELISA) and mass spectrometry.Alternately, genomic techniques can be used to identify the protein related to trinucleotide repeat expansion disorder by obtaining the gene expression profile of the gene encoding these proteins, including but not limited to DNA microarray analysis, gene expression serial analysis (SAGE) and quantitative real-time polymerase chain reaction (Q-PCR).

[0628] Non-limiting examples of proteins associated with trinucleotide repeat expansion disorders include AR (androgen receptor), FMR1 (fragile x mental retardation 1), HTT (huntingtin), DMPK (myotonic dystrophy protein kinase), FXN (mitochondrial ataxia), ATXN2 (spinocerebellar ataxia 2), ATN1 (atrophin 1), FEN1 (fragment structure specific endonuclease 1), TNRC6A (6A containing trinucleotide repeat), PABPN1 (poly(A) binding protein, nuclear 1), JPH3 (junctional protein 3), MED15 (mediator complex subunit 15), ATXN1 (spinocerebellar ataxia 1), ATXN3 (spinocerebellar ataxia 3), TBP (TATA box binding protein), CACNA1A (calcium channel, voltage-dependent, P / Q type, alpha 1A subunit), ATXN80S (ATXN8 opposite chain (non-protein coding)), PPP2R2B (protein phosphatase 2, regulatory subunit B, beta), ATXN7 (spinocerebellar ataxia protein 7), TNRC6B (trinucleotide repeat containing 6B), TNRC6C (trinucleotide repeat containing 6C), CELF3 (CUGBP, Elav-like family member 3), MAB21L1 (mab-21-like 1 (Caenorhabditis elegans)), MSH2 (MutS homolog 2, colon cancer, polyposis type 1 (Escherichia coli)), TMEM185A (transmembrane protein 185A), SIX5 (SIX homeobox 5), CNPY3 (canopy 3 homolog (zebra...

Claims

1. Use of a composition comprising a CRISPR-Cas system in the preparation of a medicament for modifying a target nucleic acid in a liver cell in a subject, wherein the CRISPR-Cas system comprises: I. A polynucleotide sequence comprising: (a) a guide sequence capable of hybridizing to a liver target sequence expressed in a liver cell, (b) a tracr mate sequence, and (c) a tracr sequence, wherein (a), (b) and (c) are arranged in a 5' to 3' direction, and II. a polynucleotide sequence encoding Cas9, wherein the Cas9 comprises at least one nuclear localization signal (NLS); wherein the tracr mate sequence hybridizes to the tracr sequence and the guide sequence directs specific binding of the CRISPR complex to the liver target sequence expressed in liver cells, wherein the CRISPR complex comprises Cas9 complexed with (1) the guide sequence hybridized to the target sequence, and (2) the tracr mate sequence hybridized to the tracr sequence, wherein the polynucleotide sequence encoding Cas9 is RNA, and wherein the CRISPR-Cas system is delivered via lipid nanoparticles.

2. The use of claim 1, wherein the CRISPR-Cas system is capable of altering the expression of gene products in the liver of the subject, thereby producing a phenotypic change.

3. The use of claim 1 or 2, wherein the Cas9 comprises at least two NLSs.

4. The method of claim 1 or 2, wherein the Cas9 is Streptococcus pyogenes Cas9.

5. The use according to claim 1 or 2, wherein the Cas9 is Staphylococcus aureus Cas9.

6. The use of claim 1 or 2, wherein the Cas9 is mutated into a nickase by one or more mutations selected from D10A, E762A, H840A, N854A, N863A and D986A.

7. The method of claim 1 or 2, wherein the Cas9 is fused to one or more heterologous protein domains.

8. The method of claim 7, wherein the heterologous protein domain has one or more of the following activities: methylase activity, demethylase activity, transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, RNA cleavage activity or nucleic acid binding activity.

9. The use of claim 1 or 2, wherein the guide sequence, the tracr mate sequence and the tracr sequence are contained in a CRISPR-Cas system chimeric RNA.

10. The use of claim 1 or 2, wherein the composition comprises two or more CRISPR-Cas system chimeric RNAs targeting different liver target sequences.

11. The use according to claim 1 or 2, wherein the composition further comprises an exogenous polynucleotide for targeted gene insertion.

12. The use of claim 1 or 2, wherein the liver target sequence is PCSK9, HMGCR, SERPINA1, APOB, LDLR, ANGPTL3, F8, F9 / FIX, AAT, FAH, HPD, TAT, ATP7B, UGT1A1, OTC, ARH or TTR.

13. The use according to claim 1 or 2, wherein the liver target sequence is PCSK9 and the medicament is for treating hypercholesterolemia.

14. The use according to claim 1 or 2, wherein the liver target sequence is transthyretin (TTR) and the medicament is for the treatment of amyloidosis.

15. The use according to claim 1 or 2, wherein the liver target sequence is SERPINA1, and the medicament is for treating alpha-1 antitrypsin deficiency.

16. The use of claim 1 or 2, wherein the CRISPR-Cas system is capable of correcting one or more defective genotypes.

17. The use according to claim 1 or 2, wherein the medicament is formulated for systemic or intravenous administration.

Images