Recombinant acid-tolerant yeast with inhibited glycerol production and method for producing lactic acid using the same

Abstract

Disclosed are a recombinant acid-tolerant yeast having lactic acid-producing ability and inhibited glycerol production and a method for producing lactic acid using the same. More specifically, a recombinant acid-tolerant yeast in which a gene involved in lactic acid production is introduced and a gene involved in glycerol production is deleted or attenuated, and a method for producing lactic acid using the same are disclosed. When lactic acid is produced using the recombinant acid-tolerant yeast, lactic acid production is maintained while reducing glycerol production, so that cross-linking by glycerol can be inhibited in an oligomerization reaction for conversion into a lactide, and thus the conversion rate of lactic acid into a lactide can be improved.

Description

TECHNICAL FIELD

[0001] The present application relates to a recombinant acid-tolerant yeast having lactic acid-producing ability and inhibited glycerol production, and a method for preparing lactic acid using the same. More particularly, the present application relates to a recombinant acid-tolerant yeast in which a gene involved in lactic acid production is introduced and a gene involved in glycerol production is deleted or attenuated, and a method for preparing lactic acid using the same. BACKGROUND

[0002] Polylactic acid (PLA) is a biodegradable polymer prepared by converting lactic acid into lactide and allowing it to undergo ring-opening polymerization. The raw material lactic acid is produced by fermentation. PLA is widely used in disposable food containers, and has the advantage that it can be used alone or in the form of a composition or a copolymer in plastic in various industries, including the automobile industry and the fiber industry. In addition, it is a representative polymer that has been used in 3D printing in recent years, and is an environmentally friendly polymer that produces a smaller amount of harmful gas and odor when used in a 3D printer.

[0003] A conventional lactic acid production process is performed using lactic acid bacteria, and includes fermentation while maintaining a neutral pH of 6 to 8 using various forms of calcium salt / Ma salt or a neutralizing agent such as ammonia, to prevent death or slow growth of the bacteria due to lactic acid produced and accumulated by the lactic acid bacteria. When the fermentation is completed, the microorganisms are separated, and sulfuric acid is added to convert lactate into lactic acid, while the calcium salt is removed in the form of CaSO4 due to the difficulty in separating the salt from water and converting it into lactide. In this method, the amount of the by-product CaSO4 produced is greater than the amount of lactic acid, thus reducing the process efficiency.

[0004] In general, PLA is produced by fermenting lactic acid, and then converting the produced lactic acid into lactide through a purification process. In order to be converted into lactide, a process of converting lactic acid into a hydrogenated form is required, and the pH of the neutral fermentation is generally 6 to 7, so a large amount of sulfuric acid is used to change the neutral pH to an acidic pH. In this process, a large amount of neutralizing salt is produced, and the economic feasibility is reduced due to the low value of the neutralizing salt and the investment cost of the process for removing the neutralizing salt.

[0005] Meanwhile, lactic acid has an L-type optical isomer and a D-type optical isomer. There are a wide variety of microbial populations. For example, lactic acid bacteria that mainly produce an L-type optical isomer also generally produce about 5-10% of a D-type optical isomer, strains that mainly produce a D-type optical isomer include strains that produce a D-type optical isomer and an L-type optical isomer, strains that produce a D-type optical isomer and ethanol, etc. (Ellen I. Garvie, Microbiological Reviews, 106-139, 1980).

[0006] Meanwhile, in the case of Lactobacillus that naturally produces lactic acid, in order to produce lactic acid commercially, a large amount of expensive nutrients must be used as a culture medium. These excessive nutrient components greatly hinder downstream polymerization processes or lactide conversion processes when lactide is used as an intermediate, in order to obtain a polymer or a precursor thereof with a high yield and high purity, resulting in the cost of purification processes such as adsorption, distillation, and ion exchange, thereby further increasing the production cost. In order to solve these problems, research using yeast has been proposed. It is well known that yeast can grow / ferment even using inexpensive nutrients, and also has high acid tolerance.

[0007] When lactic acid is produced using yeast that grows well in acid (hereinafter referred to as "acid-tolerant yeast"), there is no need to maintain the pH of the culture medium at 6 to 7 during fermentation using a neutralizing agent, thus simplifying the fermentation process, and there is no need for a downstream purification process for removing the neutralizing agent. In addition, yeast itself produces many components required for metabolism, and thus, compared to bacteria, especially Lactobacillus, can be cultured in a culture medium with a relatively low level of nutrients, thus avoiding downstream purification processes and significantly reducing production costs.

[0008] However, there are requirements for a technology for producing lactic acid using yeast. The requirements are that the yield, productivity, and concentration of lactic acid, which are indicators of the fermentation performance of a strain, must be maintained at a high level similar to the performance of Lactobacillus, in order for the technology to be applied commercially.

[0009] Although a technology for producing lactic acid using acid-tolerant yeast has been developed, in practice, since the technology is accompanied by a neutralization reaction in many cases during fermentation, it exhibits high fermentation performance only when fermentation is performed while maintaining the pH value at at least 3.7 (not lower than the pKa value of lactic acid), and thus it is not reasonable to determine the technology as a practical method for achieving acid tolerance, and it is difficult to expect the effect of reducing the production cost in the process (Michael Sauer et al., Biotechnology and Genetic Engineering Reviews, 27:229-256, 2010).

[0010] Accordingly, acid-tolerant yeast that can reduce the process cost can be commercially applied only when it can complete fermentation without using a neutralizing agent or with a minimum amount of a neutralizing agent while the pH value of the fermentation solution does not exceed the pKa value, and three major fermentation indicators reach a level similar to that of Lactobacillus.

[0011] Generally, yeast metabolizes ethanol as a main product, glucose as a byproduct, and hardly produces lactic acid. In addition, since the possibility of selecting a lactic acid-producing strain from microorganisms having high acid resistance is very low, the present inventors selected a yeast strain having excellent acid resistance and tried to construct a strain having lactic acid-producing ability and having inhibited ethanol and glycerol-producing ability by a genetic engineering method.

[0012] Accordingly, as a result of efforts to produce an acid-resistant strain having lactic acid-producing ability and having inhibited glycerol-producing ability, the present inventors constructed a recombinant strain by removing a gene involved in glycerol production from an acid-resistant yeast and further introducing a gene encoding lactate dehydrogenase into the yeast, and found that the amount of glycerol, which is an impurity in lactic acid production using the recombinant yeast, is reduced when lactic acid is produced using the recombinant strain. Based on this finding, the present invention was completed. SUMMARY

[0013] Accordingly, the present invention has been made in view of the above problems, and it is an object of the present invention to provide a recombinant acid-resistant yeast strain having lactic acid-producing ability and having inhibited glycerol-producing ability.

[0014] It is another object of the present invention to provide a method of preparing lactic acid using the recombinant acid-resistant yeast strain.

[0015] It is another object of the present invention to provide a gene encoding an enzyme that converts dihydroxyacetone phosphate into glycerol-3-phosphate, which is derived from an acid-resistant yeast.

[0016] According to an aspect of the present invention, the above and other objects can be achieved by providing a recombinant strain having lactic acid-producing ability, in which a gene encoding an enzyme that converts dihydroxyacetone phosphate into glycerol-3-phosphate is deleted or attenuated from an acid-resistant yeast YBC strain (KCTC 13508BP), and a gene encoding lactate dehydrogenase is introduced into the acid-resistant yeast YBC strain.

[0017] According to another aspect of the present invention, there is provided a recombinant strain having lactic acid-producing ability, in which a GPD1 gene encoding an enzyme that converts dihydroxyacetone phosphate into glycerol-3-phosphate, a CYB2 gene encoding an enzyme that converts lactate into pyruvate, an ADH gene encoding alcohol dehydrogenase, and a PDC gene encoding pyruvate decarboxylase are deleted from an acid-resistant yeast YBC strain (KCTC 13508BP); and

[0018] wherein a gene encoding lactate dehydrogenase is introduced into the acid-resistant yeast YBC strain.

[0019] According to another aspect of the present application, there is provided a method of producing lactic acid, the method comprising: (a) culturing a recombinant strain to produce lactic acid; and (b) collecting the produced lactic acid.

[0020] According to another aspect of the present application, there is provided a gene having an enzyme activity of converting dihydroxyacetone phosphate into glycerol-3-phosphate, the gene encoding a protein having 90% or more homology with a protein comprising the amino acid sequence of SEQ ID NO: 3.

[0021] According to another aspect of the present application, there is provided a protein having an enzyme activity of converting dihydroxyacetone phosphate into glycerol-3-phosphate, the protein having 90% or more homology with a protein comprising the amino acid sequence of SEQ ID NO: 3.

[0022] According to another aspect of the present application, there is provided a promoter of a GPD1 gene, comprising the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 5.

[0023] Effects of the present application

[0024] When lactic acid is produced using the recombinant acid-tolerant yeast according to the present application, the production of lactic acid is maintained while reducing the production of glycerol, so that cross-linking caused by glycerol can be inhibited in an oligomerization reaction for converting into lactide, and thus the conversion yield of lactic acid into lactide can be improved. BRIEF DESCRIPTION OF DRAWINGS

[0025] The above and other objects, features and other advantages of the present application will be more clearly understood from the following detailed description taken in conjunction with the accompanying drawings, in which:

[0026] Figure 1 An example of a deletion cassette for deleting GPD1 (g1544) / GPD2 (g5617) genes from the genome of the YBC4 strain of the present application or deleting the genes and inserting an LDH gene in place thereof is shown.

[0027] Figure 2 A fermentation profile curve of the recombinant yeast strain YBC5 strain according to the present application is shown. DETAILED DESCRIPTION

[0028] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as would be understood by one of ordinary skill in the art to which the application belongs. Generally, the terms used herein are well known in the art and are generally used as commonly used.

[0029] Acid-tolerant yeast is characterized by consuming sugar at a high rate even at an acidic pH, exhibiting a high growth rate, and converting consumed sugar into a desired product under fermentation conditions. In the present inventor's previous research, an acid-tolerant yeast strain (KCTC 13508BP) was selected from yeasts having these characteristics in several yeast libraries, and the acid-tolerant yeast strain (KCTC 13508BP) has a high growth rate and a high sugar consumption rate even in the presence of a lactic acid concentration of 40 g / L to 80 g / L. By controlling a metabolic circuit to improve lactic acid production ability and inhibit ethanol production ability of the acid-tolerant yeast YBC strain, a recombinant strain was produced by deleting a gene encoding cytochrome b2 enzyme that converts lactate into pyruvate from a strain obtained by deleting a gene encoding ethanol dehydrogenase and a gene encoding pyruvate decarboxylase from the YBC strain and introducing a lactate dehydrogenase gene into the YBC strain. In addition, in order to inhibit the production of glycerol in the constructed strain, a recombinant strain was constructed by deleting a gene encoding glycerol-3-phosphate dehydrogenase that converts dihydroxyacetone phosphate into glycerol-3-phosphate, and it was found that the recombinant strain has improved lactic acid production ability and inhibited ethanol production ability and glycerol production ability.

[0030] In addition, excess carbon due to glycerol reduction can be distributed to other byproducts. However, when converted into lactic acid, it is possible to further improve the yield of lactic acid production (e.g., enhance lactate dehydrogenase).

[0031] Accordingly, in one aspect, the present application relates to a recombinant strain having lactic acid production ability, in which a gene encoding an enzyme that converts dihydroxyacetone phosphate into glycerol-3-phosphate is deleted or attenuated from an acid-tolerant yeast YBC strain (KCTC 13508BP), and a gene encoding lactate dehydrogenase is introduced into the acid-tolerant yeast YBC strain.

[0032] In general, glycerol is a major byproduct of yeast, which functions to balance redox in a cell, particularly, to regulate the balance of intracellular NAD / NADH occurring in the process of ethanol or lactate production, which plays an important role in inhibiting the loss of intracellular water due to osmotic pressure generated by the decrease in extracellular water activity, and also serves as a precursor of glycerol-3-phosphate, which is a precursor of major energy storage glycerol triester (Roeland Costenoble et al., Yeast 16: 1483-1495, 2000; Elke Nevoigt and Ulf Stahl, FEMS Microbiology Reviews 21: 231, 1997).

[0033] A known method of inhibiting the glycerol production reaction in yeast includes removing or weakening genes directly related to glycerol production, and modifying genes related to regulatory mechanisms such as osmotic pressure. For regulatory mechanisms such as osmotic pressure, there is a HOG (high osmotic glycerol) signaling pathway (Joseph P Dexter et al., BMC Systems Biology, 9: 17, 2015), and glycerol production is inhibited by removing or modifying the related main factor SSK1 (cytoplasmic phosphorelay intermediate osmosensor and regulator) and the like (Hubmann et al., Biotechnology for Biofuels, 6: 87, 2013; Hubmann et al., Metabolic Engineering, 17: 68, 2013).

[0034] However, it takes a lot of research to regulate these signaling pathways by mutation, and for some strains, such as the acid-tolerant yeast YBC strain (KCTC13508BP), verification is required for each step. Therefore, a more general method was used, which is a method of removing genes directly related to GPD (NAD-dependent glycerol-3-phosphate dehydrogenase) and GPP (DL-glycerol-3-phosphate phosphatase). GPD1 mainly functions to regulate the osmotic resistance of yeast, and GPD2 is an isoform of GPD1, which is expressed in S. cerevisiae to regulate cell activity under anaerobic conditions. In addition, two GPP genes for converting glycerol-3-phosphate to glycerol in S. cerevisiae are well known. GPP1 is expressed under anaerobic conditions, and GPP2 is expressed under osmotic stress. After removing each isoform of GPD and GPP, the effect of each case on glycerol production varies depending on the culture conditions and the corresponding strain (Roeland Costenoble et al., Yeast 16: 1483, 2000; Jacobus Albertyn et al., Molecular and cellular biology, 4135, 1994). Therefore, it was considered that the best method is to use experiments to detect the effect of each case.

[0035] According to the present application, the gene encoding the enzyme that converts dihydroxyacetone phosphate into glycerol-3-phosphate can be a GPD1 or GPD2 gene, and preferably, the gene encoding the enzyme that converts dihydroxyacetone phosphate into glycerol-3-phosphate is a GPD1 (g1544) gene, wherein the gene can include the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2.

[0036] In one embodiment of the present application, the g4423 gene, which is a major ADH gene, is removed from the YBC strain, the LDH gene of SEQ ID NO: 12 derived from Lactobacillus plantarum is introduced at the position of the g4423 gene, the g3002 gene, which is a CYB2 gene (hereinafter referred to as "g3002-1 gene"), is removed therefrom, and the LDH gene is introduced at the position of the g3002-1 gene to construct a recombinant strain YBC2. The g2947 gene is removed from the recombinant strain YBC2, and the LDH gene is introduced thereinto to construct a recombinant strain YBC4. The g1544 gene, which is a GPD1 gene, is removed from the recombinant strain YBC4 to construct a recombinant strain YBC5. The recombinant strain is cultured, and it is confirmed that the lactic acid production ability of the strain is increased, and the ethanol production ability and the glycerol production ability are inhibited.

[0037] According to the present application, the recombinant strain is characterized in that a gene encoding an alcohol dehydrogenase (ADH gene) can be further deleted, the gene encoding an alcohol dehydrogenase is a g4423 gene, and the g4423 gene includes the sequence of SEQ ID NO: 6 or SEQ ID NO: 7.

[0038] According to the present application, the recombinant strain is characterized in that an LDH gene can be further introduced instead of the ADH gene.

[0039] According to the present application, the recombinant strain is characterized in that a gene encoding a pyruvate decarboxylase (PDC gene) can be further deleted, the gene encoding a pyruvate decarboxylase is a g3002 gene, and the g3002 gene includes the sequence of SEQ ID NO: 8 or SEQ ID NO: 9.

[0040] According to the present application, the recombinant strain is characterized in that an LDH gene can be further introduced instead of the PDC gene.

[0041] According to the present application, the recombinant strain is characterized in that a cytochrome b2 gene (CYB2 gene) that converts lactate into pyruvate can be further deleted, the cytochrome b2 gene is a g2947 gene, and the g2947 gene includes the sequence of SEQ ID NO: 10 or SEQ ID NO: 11.

[0042] According to the present application, the recombinant strain is characterized in that the LDH gene can be further introduced in place of the CYB2 gene.

[0043] According to the present application, the recombinant strain is characterized in that the LDH gene can be further introduced in place of the GPD1 gene.

[0044] According to the present application, the YBC5 strain derived from the parent strain by deletion or attenuation of the g1544 gene has a reduced or inhibited glycerol production ability compared to the parent strain, i.e., the YBC strain (KCTC 13508BP), and the mutant strains YBC1 / YBC2 / YBC4 strains.

[0045] According to the present application, the introduced gene encoding lactate dehydrogenase is preferably an LDH gene derived from L. helveticus, an LDH gene derived from R. oryzae, or an LDH gene derived from L. plantarum, more preferably an LDH gene derived from L. plantarum.

[0046] In another aspect, the present application is a recombinant strain having a lactic acid production ability, wherein a GPD1 gene encoding an enzyme that converts dihydroxyacetone phosphate into glycerol-3-phosphate, a CYB2 gene encoding an enzyme that converts lactate into pyruvate, an ADH gene encoding ethanol dehydrogenase, and a PDC gene encoding pyruvate decarboxylase are deleted from an acid-tolerant yeast YBC strain (KCTC 13508BP), and wherein a gene encoding lactate dehydrogenase is introduced into the acid-tolerant yeast YBC strain.

[0047] According to the present application, the gene encoding lactate dehydrogenase is introduced at a position where at least one of the deleted CYB2 gene, ADH gene, PDC gene, and GPD1 gene, and is regulated by the promoter of the gene that is deleted and replaced.

[0048] In one embodiment of the present application, the YBC5 strain (Δg4423::ldh / Δg3002-1::ldh / Δg2947::ldh / Δg1544) exhibits a greatly reduced glycerol production ability compared to the YBC4 strain (Δg4423::ldh / Δg3002-1::ldh / Δg2947::ldh). Although glycerol is not completely removed, this is quite advantageous in terms of environmental adaptability of the strain. In other words, a strain that completely loses glycerol production ability loses the ability to adapt to a stress environment such as external osmotic pressure as its original function, and becomes weak. These strains cannot withstand stresses such as pressure, salt concentration, and product inhibition of general commercial scale, and thus cannot normally perform fermentation. Therefore, the strain of the present application exhibits very excellent performance to achieve the desired glycerol reduction without causing adverse effects.

[0049] Accordingly, in another aspect, the present application relates to a method of producing lactic acid, comprising (a) culturing a recombinant strain to produce lactic acid, and (b) collecting the produced lactic acid.

[0050] According to the present application, an excellent acid-tolerant strain having a greatly increased lactate production, a greatly reduced ethanol production, and a greatly reduced glycerol by-product can be expected.

[0051] In another aspect, the present application relates to a gene having an enzyme activity of converting dihydroxyacetone phosphate to glycerol-3-phosphate, which encodes a protein having 90% or more homology to a protein comprising the amino acid sequence of SEQ ID NO: 3.

[0052] According to the present application, the gene has an enzyme activity of converting dihydroxyacetone phosphate to glycerol-3-phosphate, and encodes a protein having 90% or more, preferably 95% or more, even more preferably 98% or more, and still more preferably 99% or more homology to a protein comprising the amino acid sequence of SEQ ID NO: 3.

[0053] In the present application, the gene can comprise the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2.

[0054] In another aspect, the present application relates to a protein having an enzyme activity of converting dihydroxyacetone phosphate to glycerol-3-phosphate, which has 90% or more homology to a protein comprising the amino acid sequence of SEQ ID NO: 3.

[0055] In the present application, the protein has an enzyme activity of converting dihydroxyacetone phosphate into glycerol-3-phosphate, and has a homology of 90% or more, preferably 95% or more, even more preferably 98% or more, and still more preferably 99% or more, with a protein comprising the amino acid sequence of SEQ ID NO: 3.

[0056] In another aspect, the present application relates to a promoter of a GPD1 gene comprising the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 5.

[0057] As used herein, the term "acid-tolerant yeast" is defined as yeast that is capable of maintaining a biomass consumption rate (e.g., sugar consumption rate) of at least 10% or a specific growth rate of at least 10% at a pH of less than the pKa value of an organic acid (particularly lactic acid) when the medium contains the organic acid at a concentration of at least 1 M, as compared to when the medium does not contain the organic acid. More specifically, the term "acid-tolerant yeast" is defined as yeast that is capable of maintaining a biomass consumption rate (e.g., sugar consumption rate) of at least 10% or a specific growth rate of at least 10% at a pH of 2 to 4, as compared to at a pH of 5 or more.

[0058] The recombinant yeast according to the present application can be produced by inserting a gene into a chromosome of a host yeast according to a conventional method or by introducing a vector including the gene into a host yeast.

[0059] As a host yeast, a host cell having a high DNA introduction efficiency and a high expression efficiency of introduced DNA is generally used. In one embodiment of the present application, an acid-tolerant yeast is used, but the present application is not limited thereto, and any type of yeast can be used as long as it is capable of sufficiently expressing a target DNA.

[0060] The recombinant yeast can be produced according to any transformation method. The term "transformation" refers to a phenomenon in which DNA is introduced into a host to allow the DNA to be replicated as a coefficient of a chromosome or to introduce DNA by chromosomal integration, and refers to a phenomenon in which a genetic change is artificially induced by introducing external DNA into a cell. General transformation methods include electroporation, lithium acetate-PEG, etc.

[0061] In addition, in the present application, any generally known genetic engineering method can be used as a method of inserting a gene into the chromosome of a host microorganism. For example, there are methods using retroviral vectors, adenoviral vectors, adeno-associated viral vectors, herpes simplex viral vectors, poxviral vectors, lentiviral vectors, non-viral vectors, and the like. The "vector" refers to a DNA product that includes a DNA sequence operably linked to a suitable regulatory sequence that can express DNA in a suitable host. The vector can be a plasmid, a phage particle, or simply a potential genomic insert. When transformed into a suitable host, the vector can replicate independently of the host genome or perform a function, or some of them can be integrated with the genome. The plasmid is the most commonly used vector form at present, but linear DNA is also a common form of yeast genome integration.

[0062] A typical plasmid vector includes (a) an origin of replication effective to replicate including a predetermined amount of plasmid vector in each host cell, (b) an antibiotic resistance gene or an auxotrophic marker gene to screen a host cell transformed with a plasmid vector, and (c) a restriction enzyme cleavage site into which a foreign DNA fragment is inserted. Even if there is no appropriate restriction enzyme cleavage site, a synthetic oligonucleotide adapter or linker can be easily connected to the vector and the foreign DNA according to the conventional method (Gibson assembly). If necessary, a method of synthesizing and using the entire desired sequence is also commonly used.

[0063] In addition, when a nucleic acid sequence is aligned with another nucleic acid sequence based on the functional relationship between them, it is said to be "operably linked" thereto. Genes and control sequences can be linked in such a way that gene expression can be carried out when a suitable molecule (e.g., a transcription activation protein) is linked to the control sequence. For example, when expressed as a preprotein involved in polypeptide secretion, the DNA of the pre-sequence or the secretory leader is operably linked to the DNA of the polypeptide; when the promoter or enhancer affects the transcription of the sequence, the promoter or enhancer is operably linked to the coding sequence; when the ribosome binding site affects the transcription of the sequence, the ribosome binding site is operably linked to the coding sequence; or when the ribosome binding site is placed to facilitate translation, the ribosome binding site is operably linked to the coding sequence.

[0064] In general, the term "operably linked" means that the linked DNA sequences are in contact with each other, or the secretory leader is in contact with each other and is present in the reading frame. However, the enhancer does not necessarily contact it. The connection of these sequences is made by ligation (binding) at a convenient restriction enzyme cleavage site. When such a site is not present, a synthetic oligonucleotide adapter or linker according to the conventional method is used.

[0065] It should be understood that, in terms of expressing the DNA sequence of the present application, not all vectors have the same function. Also, for the same expression system, not all hosts have the same function. However, one of ordinary skill in the art will be able to make an appropriate selection from a variety of vectors, expression control sequences, and hosts without undue experimentation and without departing from the scope of the present application. For example, the selection of a vector should be made considering the host, because the vector should replicate in the host. The number of times the vector replicates, the ability to control the number of times the vector replicates, and the expression of other proteins encoded by the corresponding vector, such as the expression of an antibiotic marker, should also be considered.

[0066] In the present application, the carbon source can include, but is not limited to, one or more selected from the group consisting of glucose, xylose, arabinose, sucrose, fructose, cellulose, galactose, glucose oligomers, and glycerol.

[0067] In the present application, the cultivation can be performed under conditions such that a microorganism such as E. coli becomes inoperable (e.g., is unable to produce a metabolite), for example. For example, the cultivation can be performed at a pH of 1.0 to 6.5, preferably a pH of 1.0 to 6.0, more preferably a pH of 2.6 to 4.0, but is not limited thereto.

[0068] Hereinafter, the present application will be described in greater detail with reference to Examples. However, it will be apparent to those skilled in the art that these Examples are provided only for illustrating the present application, and should not be construed to limit the scope of the present application.

[0069] Example 1: Analysis of glycerol-producing genes in the genome of acid-tolerant strain YBC

[0070] The present inventors selected a strain having acid tolerance by testing various yeast strains, and determined a strain having the best acid tolerance, i.e., the YBC strain, by adding lactic acid to a culture medium at the start of cultivation of the yeast strain and monitoring the growth of the microorganism and the rate of sugar consumption, and deposited the strain as accession number KCTC13508BP in the Biological Resource Center of the Korea Research Institute of Bioscience and Biotechnology.

[0071] Phylogenetic analysis showed that the YBC strain (KCTC13508BP) is a strain similar to S. cerevisiae, is diploid, and is Crabtree positive.

[0072] Using Saccharomyces cerevisiae and bioinformatics information from the whole genome sequence data of the YBC strain, g1544 and g5617 were identified as genes annotated with GPD1 (glycerol-3-phosphate dehydrogenase 1) and GPD2, respectively, which are genes present in the genome of the YBC strain that encode enzymes that convert dihydroxyacetone phosphate to glycerol-3-phosphate. Two GPP genes, g4356 and g5443, were identified that encode enzymes that convert glycerol-3-phosphate to glycerol, which have very similar homology in the genome of the YBC strain, and according to the current information, it is difficult to distinguish the functions of the two genes based on GPP1 and GPP2. Therefore, these genes are referred to as "GPP1 v.1" and "GPP1 v.2".

[0073] Table 1 compares the similarity of the amino acid sequences of GPD1 and GPD2 of YBC and Saccharomyces cerevisiae.

[0074] [Table 1]

[0075] Comparison of protein sequence homology of GPD1 and GPD2 of YBC and Saccharomyces cerevisiae strains

[0076] YBCGPD1 YBCGPD2 ScGPD1 ScGPD2 YBCGPD1 100 69.78 78.06 63.49 YBCGPD2 69.78 100 71.25 63.60 S. cerevisiae GPD1 78.06 71.25 100 65.08 S. cerevisiae GPD2 63.49 63.60 65.08 100

[0077] Accordingly, a deletion cassette capable of removing the GPD1 gene (g1544 gene) (SEQ ID NO: 1 and SEQ ID NO: 2) and its protein (SEQ ID NO: 3), a deletion cassette capable of removing the GPD2 gene (g5617 gene) (SEQ ID NO: 13 and SEQ ID NO: 14) and its protein (SEQ ID NO: 15), and a deletion cassette capable of removing the GPP1 gene (v.1; g4356 gene) (SEQ ID NO: 16 and SEQ ID NO: 17), GPP1 gene (v.2; g5443 gene) (SEQ ID NO: 19 and SEQ ID NO: 20) and its protein (SEQ ID NO: 18 and SEQ ID NO: 21) were constructed.

[0078] The deletion cassette used herein is as shown in Figure 1 The method of selecting the corresponding restriction enzyme site or antibiotic resistance gene and removing the antibiotic resistance gene is well known in the related art, and various modifications can be made for use.

[0079] Generally, when GPD1 and GPD2 or GPP1 and GPP2 in the genes producing glycerol are removed at the same time, the growth and the ability to adapt to the external environment of the strain are completely blocked, so the strain is very sensitive to osmotic pressure, etc. and is not suitable for fermentation, which is well known in the art. Therefore, when glycerol reduction is not sufficient enough after removing GPD1 or GPD2, GPP1 v1 or GPP1 v2 is further removed from each GPD1 / 2-removed strain as a strategy to enhance glycerol reduction.

[0080] Example 2: Measurement of GPD gene expression level

[0081] To confirm the expression level of GPD1 (g1544) and GPD2 (g5617) of the YBC strain, RT-qPCR was performed using the following primers and the ALG9 gene as a housekeeping gene. The RT-qPCR method used in this example will be described below. RNA of the YBC strain during the logarithmic growth was extracted, and cDNA was generated using the RNA as a template. Specific primers for each of the target genes (GPD1 and GPD2) and the housekeeping gene (used as a Ref gene) were synthesized and used for qPCR. The Ref gene used in the experiment was ALG9, and the fragment size amplified with the used primers was 147 ± 3 bp.

[0082] ALG9 forward primer: CTTTGAGTGCAAGTATCGCC (SEQ ID NO: 22)

[0083] ALG9 reverse primer: TGTGTAATTGTTCACCAAAGCC (SEQ ID NO: 23)

[0084] GPD1 (g1544) forward primer: GTCGATTCTCATGTTCGTGC (SEQ ID NO: 24)

[0085] GPD1 reverse primer: CTTAGCGACTTCAGTAGCGA (SEQ ID NO: 25)

[0086] GPD2 (g5617) forward primer: CATGTATCGAATCAAGTTCGTG (SEQ ID NO: 26)

[0087] GPD2 reverse primer: CAACTTCTGGTGCTAAATTTGC (SEQ ID NO: 27)

[0088] As to the expression level of the gene in the YBC strain, the YBC strain exhibited about 20 times the expression rate of GPD1 than that of ALG9 after 14 hours of cultivation, about 70 times the expression rate of GPD1 than that of ALG9 after 23 hours of cultivation, and very low GPD2 expression rate similar to that of ALG9.

[0089] The above results preliminarily indicate that GPD1 plays a major role as an enzyme converting dihydroxyacetone phosphate into glycerol-3-phosphate in the YBC strain. To verify its actual role, a strain in which each gene has been removed was constructed.

[0090] Example 3: Construction of recombinant acid-tolerant yeast strain in which GPD genes are removed

[0091] The g1544 gene, g5617 gene, g5443 gene, and g4356 gene annotated with GPD1 gene, GPD2 gene, GPP1v1 gene, and GPP1v2 gene, respectively, were removed from the genome of the YBC strain to construct a strain.

[0092] The acid-tolerant yeast strain used to remove the genes is YBC1 strain, which is constructed by introducing LDH gene into the conventional YBC strain (not YBC wild type strain) and deleting ADH (alcohol dehydrogenase) therefrom, whereby YBC2 strain capable of efficiently producing lactic acid and inhibiting ethanol production is constructed by removing g3002-1 gene (PDC gene) from YBC1 strain and introducing LDH thereinto, and YBC4 strain in which lactic acid consumption ability is removed is constructed by introducing LDH gene into the strain and removing lactic acid consuming gene g2947.

[0093] YBC5 was constructed by removing GPD1 (g1544) gene from YBC4 strain (as a diploid strain, removing allele 1 and allele 2), the genotype of the strain was identified using primers prepared in Table 1 below, and the genotype of the strain was determined based on the genomic DNA of the strain. In addition, at the same time, a strain was constructed by removing GPD2 (g5617) gene from YBC5 strain, and the glycerol production ability during fermentation was compared between the prepared strains.

[0094] The method for constructing the strain is as follows:

[0095] The YBC1 strain was obtained by removing the g4423 gene, which is a major ADH gene of the YBC strain, from the YBC strain and introducing an LDH gene of SEQ ID NO: 12 derived from Lactobacillus plantarum into the position of g4423. Based on the information of g4423 and its UTR, a gene cassette removing the ORF of each gene and containing the 5' UTR and 3' UTR was constructed and used as donor DNA. For each allele of g4423, the corresponding 5' UTR contains the sequence of SEQ ID NO: 28 and SEQ ID NO: 29, and the 3' UTR contains the sequence of SEQ ID NO: 30 and SEQ ID NO: 31. The donor DNA was prepared using the cloning method using restriction enzymes as described above, Gibson assembly, and a method using gene synthesis. The LDH of SEQ ID NO: 12 was synthesized and then introduced into the ORF site of g4423 to prepare the donor DNA, and the donor DNA was introduced into YBC to construct the recombinant strain YBC1.

[0096] In addition, in the genome sequencing of the YBC strain, the g3002-1 gene is a gene located at scaffold 72 and serves as a PDC gene. The g3002-1 gene (gene located at scaffold 72) was removed from the YBC1 strain and an LDH gene of SEQ ID NO: 12 was introduced therein to construct the recombinant strain YBC2.

[0097] A cassette for replacing the g3002 gene was constructed using the corresponding UTR as a recombination site. Similar to the method of introducing LDH into the site of the g4423 gene (ADH) of YBC1 described above, a cassette was constructed using the UTR of g3002-1. However, in order to simplify the gene replacement process, a donor cassette for one allele was prepared without considering allelic variation, but one donor cassette can also be prepared for each allele. In addition, for primers for gene replacement, in addition to primers for preparing a deletion strain, the following pair of primers capable of detecting the UTR of LDH and g3002-1 was used, respectively, to improve the accuracy of gene replacement.

[0098] g3002-1 UTR-LDH-Forward: GCAGGATATCAGTTGTTTG (SEQ ID NO: 32)

[0099] g3002-1 UTR-LDH-Reverse: AATACCTTGTTGAGCCATAG (SEQ ID NO: 33)

[0100] In addition, the YBC4 strain is a strain constructed by deleting the g2947 gene, which is a major CYB2 gene of the YBC2 strain, from the YBC strain and introducing an LDH gene derived from Lactobacillus plantarum of SEQ ID NO: 13 at the position of g2947. The g2947 gene is a gene located at backbone 41 in the genome sequencing of the YBC strain. Based on the information of g2947 and its UTR, a gene cassette removing the ORF of each gene and containing the 5' UTR and 3' UTR was constructed and used as donor DNA. For each allele of g2947, the corresponding 5' UTR contains the sequences of SEQ ID NO: 34 and SEQ ID NO: 35, and the 3' UTR contains the sequences of SEQ ID NO: 36 and SEQ ID NO: 37. The donor DNA was prepared using the cloning method using restriction enzymes, Gibson assembly, and the method using gene synthesis as described above.

[0101] However, in order to simplify the gene replacement process, a donor cassette for one allele was prepared without considering allelic variation, but one donor cassette can also be prepared for each allele.

[0102] The method of constructing the strain is as follows:

[0103] The YBC5 strain is a strain constructed by deleting the g1544 gene, which is a GPD1 gene of the YBC4 strain, from the YBC4 strain. The g1544 gene is a gene located at backbone 19 in the genome sequencing of the YBC strain. Based on the information of g1544 and its UTR, a gene cassette removing the ORF of each gene and containing the 5' UTR and 3' UTR was constructed and used as donor DNA. For each allele of g1544, the corresponding 5' UTR contains the sequences of SEQ ID NO: 38 and SEQ ID NO: 39, and the 3' UTR contains the sequences of SEQ ID NO: 40 and SEQ ID NO: 41. The donor DNA was prepared using the cloning method using restriction enzymes, Gibson assembly, and the method using gene synthesis as described above.

[0104] In order to simplify the gene replacement process, a donor cassette for one allele was prepared without considering allelic variation, but one donor cassette can also be prepared for each allele. In addition, when using the currently commercialized genetic engineering technology (CRISPR), the donor cassette can be prepared and applied without using an antibiotic marker.

[0105] In addition, for primers for genotyping after gene replacement, as shown in Table 2 below, primer pairs that can be used to identify the genotypes of g1544 and g5617 to increase the accuracy of gene replacement identification will be described in detail later, as shown in Table 2.

[0106] [Table 2]

[0107] Primer sets for identifying introduction of g1544 and g5617

[0108]

[0109] The genotypes of the prepared recombinant strains are as follows:

[0110] YBC2: Δg4423::ldh / Δg3002-1::ldh,

[0111] YBC4: Δg4423::ldh / Δg3002-1::ldh / Δg2947::ldh,

[0112] YBC5: Δg4423::ldh / Δg3002-1::ldh / Δg2947::ldh / Δg1544,

[0113] YBC5a: Δg4423::ldh / Δg3002-1::ldh / Δg2947::ldh / Δg5617.

[0114] Example 4: Confirmation of lactic acid production and glycerol production inhibition in recombinant YBC strains constructed by deleting the GPD1 gene from the YBC4 strain

[0115] For the recombinant strain YBC5 and the recombinant strain YBC5a constructed in Example 3, inoculation OD was 0.5, and the medium used here was m-YP medium (5 g / L peptone, 4 g / L yeast extract, 5 g / L KH2PO4, 2 g / L MgSO4·7H2O, 0.15 g / L uracil) supplemented with 10% glucose, and was cultured in a 500 ml flask at 30°C and 150 rpm for 64 hours.

[0116] [Table 3]

[0117] Culture results of YBC4, YBC5, and YBC5a

[0118]

[0119] As a result, as can be seen from Table 3, the YBC5 strain showed 80% glycerol-producing inhibition compared to the YBC4 strain, but a small amount of glycerol was produced. As described above, glycerol plays a key role in the adaptation of microorganisms to the environment, particularly to osmotic pressure, and complete inhibition of glycerol production by simultaneous removal of GPD1 and GPD2 or simultaneous removal of GPP1 and GPP2 makes the strain extremely sensitive to osmotic pressure and makes the strain unable to grow and ferment normally. Therefore, it was considered that the current glycerol reduction rate of YBC5 was appropriate. However, in this strain, the reduction of glycerol did not directly greatly affect the increase in lactic acid production, but glycerol was distributed in various other by-products. Therefore, a method for improving the yield of future lactic acid fermentation was required.

[0120] Glycerol can also affect the polymerization reaction in the production process of the environmentally friendly polymer PLA, and it has been reported that in the presence of glycerol, the structure of PLA changes from a linear form to a branched form due to the structure of glycerol (Wen Shen et al., R. Soc. Open Sci. 5:180134, 2018). This change in the structure of PLA can act as an impurity in many subsequent processes, for example, it can affect the physical properties and formation of stereocomplex PLA through van der Waals forces between L-type PLA and D-type PLA (which are optical isomers of each other), and the formation of lactic acid oligomers for conversion into lactide. Of course, there can be a method for reducing glycerol through a purification process for removing glycerol, but reducing glycerol through genetic engineering in the present invention is an effective strategy for reducing the incidence of such problems in subsequent processes.

[0121] The YBC5a strain in which GPD2 was removed showed somewhat unintelligible results compared to the YBC5 strain in which GPD1 was removed, including little effect of reducing glycerol, reducing lactic acid production, and increasing ethanol production. It was determined that the YBC5a strain from which GPD2 was removed was not suitable for use as a lactic acid-producing strain because it inhibited the overall lactic acid fermentation.

[0122] In the preparation of the YBC1 strain to the YBC4 strain for constructing the YBC5 strain, the LDH gene was introduced when the master gene was removed to improve the lactic acid production ability of the strain. However, in the preparation of the YBC5 strain, the LDH gene was not introduced when the GPD1 gene was removed. The reason is that two LDH genes (total of 6 genes) derived from Lactobacillus plantarum of SEQ ID NO: 12 were introduced at three positions, and thus it can be predicted that, considering internal feedback regulation, the effect of introducing the same genes as described above on additional increase in activity can be negligible, and as described in Example 2, the expression rate of GPD1 / 2 under general conditions is higher than that of the Ref gene ALG9, but lower than that of ADH or PDC, and when there are multiple genes of the same type in the genome, the genome can be unstable.

[0123] Example 5: Evaluation of the fermentation performance of the YBC5 strain

[0124] In this example, the YBC5 strain was cultured in a bioreactor, not in a flask culture, to confirm its lactic acid fermentation performance.

[0125] The YBC5 strain was cultured in mYP medium (5 g / L peptone, 4 g / L yeast extract, 5 g / L KH2PO4, 2 g / L MgSO4·7H2O, and 0.15 g / L uracil), and first seed culture was performed in 40 ml of mYP medium and second seed culture was performed in 220 ml of mYP medium in 2 days, and then all cells were harvested and inoculated in 2 L of mYP medium. The inoculation OD was 0.85, and the culture was started in mYP medium supplemented with 12% glucose, and a CaCO3 solution was intermittently injected into the medium to maintain the pH at 3. The culture was performed at 30°C and 500 rpm with an air flow of 0.25 vvm.

[0126] As a result, from Figure 2 It can be seen that the YBC5 strain consumed all the glucose and produced lactic acid in a short time in the bioreactor, and at the final pH of 3.3, the lactic acid yield was 0.81 (g / g), the productivity was 1.6 g / L / hour, the concentration of the produced lactic acid was 88.2 g / L, and the glycerol yield was 0.01 (g / g). This indicates that the same results as in Example 3 were obtained in the bioreactor. In addition, based on the initial OD and improvement of the culture conditions in the future, further improvement of the performance is expected to be possible.

[0127] Although specific configurations of the invention have been described in detail, those skilled in the art will understand that this description is provided for illustrative purposes, presenting preferred embodiments, and should not be construed as limiting the scope of the invention. Therefore, the essential scope of the invention is defined by the appended claims and their equivalents. sequence list <110> SK Innovation Co., Ltd. <120> Recombinant acid-resistant yeast with inhibited glycerol production and methods for producing lactic acid using it <130> KHP212110301.1 <150> 10-2020-0046779 <151> 2020-04-17 <160> 53 <170> PatentIn version 3.5 <210> 1 <211> 1170 <212> DNA <213> Artificial Sequence <220> <223> GPD1_g1544 gene allele 1_ORF <400> 1 atggttgcta ccgatagatt aaatcaaact tctaatattt tacataaatc aatgaaaaga 60 gcttcaagta tagcgcatct aactgcttta gatcatcctt ttaaaattgc tgttatcggt 120 tccggtaact ggggtactac tatcgctaaa gtagtctctg aaaatgcagc tttaaatcca 180 caattatttg cttccgaagt aagaatgtgg gtctttgaag aaaaaattga tggtaaaaat 240 ttaacagaaa ttataaatac agatcatgaa aatgttaaat atttaccaaa tattaaatta 300 GAGAATAGTA ATAGTAATAG TAATAGTAAT AGTAATAGTA ATAGTAATAG TAATAGTAA TGGATCCATT CTTATTAATTA TTATTATTAT TAATTATTAT TATTATTATT A 60 AATTAATTA TTATTATTAT TAATTATTAT TATTATTATT A 120 AATTAATTA TTATTATTAT TAATTATTAT TATTATTATT A 120 AATTAATTA TTATTATTAT TAATTATTAT TATTATTATT A 120 AATTAATTA TTATTATTAT TAATTATTAT TATTATTATT A 120 AATTAATTA TTATTATTAT TAATTATTAT TATTATTATT A 120 AATTAATTA TTATTATTAT TAATTATTAT TATTATTATT A 120 AATTAATTA TTATTATTAT TAATTATTAT TATTATTATT A 120 AATTAATTA TTATTATTAT TAATTATTAT TATTATTATT A 120 AATTAATTA TTATTATTAT TAATTATTAT TATTATTATT A 120 AATTAATTA TTATTATTAT TAATTATTAT TATTATTATT A 120 AATTAATTA TTATTATTAT TAATTATTAT TATTATTATT A 120 attacttgta aagaagttca tgaatggtta gaaacttgta attcaatttc tgaattccca 1080 ttatttgaag ccgtttatca aattatttac aataatttac caatggaaaa tatacctgat 1140 atgatcgatg aattagaagt tttccgttaa 1170 <210> 2 <211> 1170 <212> DNA <213> Artificial Sequence <220> <223> GPD1_g1544 gene allele 2 ORF <400> 2 atggttgcta ccgatagatt aaatcaaact tctaatattt tacataaatc aatgaaaaga 60 gcttcaagta tagcgcatct aactgcttta gatcatcctt ttaaaatcgc tgttatcggt 120 tccggtaact ggggtactac tatcgctaaa gtagtctctg aaaatgcagc tttaaatcca 180 caattatttg cttccgaagt aagaatgtgg gtctttgaag aaaaaattga tggtaaaaat 240 ttaacagaaa ttataaatac agatcatgaa aatgttaaat atttaccaaa tatcaaatta 300 ccagtaaatt taatcgctac tccagatctt ttaaagactg tcgagggtgc agatataatc 360 attttcaata ttcctcatca attcttaact agaattgtac aacaattgaa aggtcatgtc 420 gattctcatg ttcgtgcaat ctcatgtcta aagggtttcg aagtcggtgc tagaggtgta 480 caattactat ccacttatat caccgatgaa ttaggtatcg aatgtggtgc tttatcaggt 540 gctaatatcg ctactgaagt cgctaaggaa aactggtccg aaactaccgt tgcttatcat 600 atcccagaag atttcagagg tgaaggttac gatgtagatc ataaagtatt aaaggcttta 660 ttccatagac cttatttcca cgtctccgtg attgaagatg tcgcaggtat ctctgttgcc 720 ggtgctttga aaaacgttgt cgctttaggt tgtggtttcg tcgaaggttt aggctggggt 780 aataatgctt ctgcagctat tcaaagagtc ggtcttggtg aaattatcaa gtttggtcaa 840 atgttcttcc cagaatctcg tgtcgaaact tattatcaag aatccgcagg tgtcgcagat 900 ttaattacta cttgtgcagg tggtagaaac gttaaagttg ctaaattaat ggctgaaagt 960 ggtatgagtg ccttagatgc tgaaaagaaa ttattaaatg gtcaatctgc tcaaggtatt 1020 attacttgta aagaagttca tgaatggtta gaaacttgta attcaatttc tgaattccca 1080 ttatttgaag ccgtttatca aattatttac aataatttac caatggaaaa tatacctgat 1140 atgatcgatg aattagaagt tttccgttaa 1170 <210> 3 <211> 389 <212> PRT <213> Artificial Sequence <220> <223> GPD1(g1544) allele 1 / 2_ORF <400> 3 Met Val Ala Thr Asp Arg Leu Asn Gln Thr Ser Asn Ile Leu His Lys 1 5 10 15 Ser Met Lys Arg Ala Ser Ser Ile Ala His Leu Thr Ala Leu Asp His 20 25 30 Pro Phe Lys Ile Ala Val Ile Gly Ser Gly Asn Trp Gly Thr Thr Ile 35 40 45 Ala Lys Val Val Ser Glu Asn Ala Ala Leu Asn Pro Gln Leu Phe Ala 50 55 60 Ser Glu Val Arg Met Trp Val Phe Glu Glu Lys Ile Asp Gly Lys Asn 65 70 75 80 Leu Thr Glu Ile Ile Asn Thr Asp His Glu Asn Val Lys Tyr Leu Pro 85 90 95 Asn Ile Lys Leu Pro Val Asn Leu Ile Ala Thr Pro Asp Leu Leu Lys 100 105 110 Thr Val Glu Gly Ala Asp Ile Ile Ile Phe Asn Ile Pro His Gln Phe 115 120 125 Leu Thr Arg Ile Val Gin Gin Leu Lys Gly His Val Asp Ser His Val 130 135 140 Arg Ala Ile Ser Cys Leu Lys Gly Phe Glu Val Gly Ala Arg Gly Val 145 150 155 160 Gln Leu Leu Ser Thr Tyr Ile Thr Asp Glu Leu Gly Ile Glu Cys Gly 165 170 175 Ala Leu Ser Gly Ala Asn Ile Ala Thr Glu Val Ala Lys Glu Asn Trp 180 185 190 Ser Glu Thr Thr Val Ala Tyr His Ile Pro Glu Asp Phe Arg Gly Glu 195 200 205 Gly Tyr Asp Val Asp His Lys Val Leu Lys Ala Leu Phe His Arg Pro 210 215 220 Tyr Phe His Val Ser Val Ile Glu Asp Val Ala Gly Ile Ser Val Ala 225 230 235 240 Gly Ala Leu Lys Asn Val Val Ala Leu Gly Cys Gly Phe Val Glu Gly 245 250 255 Leu Gly Trp Gly Asn Asn Ala Ser Ala Ala Ile Gin Arg Val Gly Leu 260 265 270 Gly Glu Ile Ile Lys Phe Gly Gin Met Phe Phe Pro Glu Ser Arg Val 275 280 285 Glu Thr Tyr Tyr Gln Glu Ser Ala Gly Val Ala Asp Leu Ile Thr Thr 290 295 300 Cys Ala Gly Gly Arg Asn Val Lys Val Ala Lys Leu Met Ala Glu Ser 305 310 315 320 Gly Met Ser Ala Leu Asp Ala Glu Lys Lys Leu Leu Asn Gly Gln Ser 325 330 335 Ala Gln Gly Ile Ile Thr Cys Lys Glu Val His Glu Trp Leu Glu Thr 340 345 350 Cys Asn Ser Ile Ser Glu Phe Pro Leu Phe Glu Ala Val Tyr Gln Ile 355 360 365 Ile Tyr Asn Asn Leu Pro Met Glu Asn Ile Pro Asp Met Ile Asp Glu 370 375 380 Leu Glu Val Phe Arg 385 <210> 4 <211> 1328 <212> DNA <213> Artificial Sequence <220> <223> g1544 gene promoter allele 1 <400> 4 agaaaatagt ttctccgatt aaattttttt ttcaaatcaa atctttattt aagaattggt 60 agtgtatagt agtataatat tgcctaagaa attggagtag tccgtaaaaa atgggacaaa 120 attgttgaaa ttgagcaacc tgaaaatttt atgctggtct caagtagaga aacagacgta 180 gaaccaaaat tgacccaatt tcttgttgcc tttaattggg tcattcataa gaattcaaaa 240 tattttcttt tcccactcac gcgagagata tgcgcacacg atatagttaa taccgcttgt 300 aacaatacgt agatggccaa aaatgaacaa aaggggacac tcctcaaaag aaaaaattgc 360 ttgtttggct gtcttctcca attgaaatat acacacacac cgcggtaaaa aaaaaattga 420 aatggaaatc gcggtgggac aaaagtagca accacaacaa gggaattttc cttactgctg 480 cggcagatcc ttactcatct ctcgaatata tatagcctct tgggtccacg ggcaaaaaag 540 aaataaaaaa aagagaagca acagaaccgc acgcaacgta cgcagtgatc catccatttt 600 ccacaaaatt tatctatttt cttgtctata ttttttacgt acaactaact gatcttcttg 660 tccccctccc cccatttacc cgttaaaatg aaagctgaac aacagaaaat aataattcgc 720 tctggtggac aaaaaataca agaacaagag agtatcataa ttatgtgggt cacaaatgac 780 CCTACAACCT GTCACCTAGT TGGTACAAAA TTGACCCTCA TTCTCAAATA ATTACTACAT 840 TTGGGTCTGT ATTAATGCTA ATATTTCAAT ATATCTCTAT CTATCAGTCA CATCAAATTA 900 TATCTTTCAT CTTAAAGGGA CTCACCTACT CAATAATGGT CATCTTTTAT ATTTTTTTCA 960 ACGTATGTAT GTACGTA GTA AAGGGCCAT CAATGATCCC TTCCTACTAT TATTCCTTAA 1020 GTTATTTC TAAGCAACAAA AAGGTCTGT ACCACAGTTTC AGTGTCTGTA ACCTCTTCTT 1080 TAATTTCTTTTCGGGGAGGG ATGTCTTAAT GCTAATTCTG TCTCCTATTA ACAGTAAG 1140 TCGTATTAAT CTCAATATAT ATATAAAGGG TTGATATTTT CCACCGTTTT AAAAATTATT 1200 CCCTTGT TTCCTATTATTA TTTCAGCCTC TTATTCTATT ATTCTTTCTT CCTTTTTTAC 1260 TTATTATATA TATATAACTA TATATTACCA ATAATAATAT ATAGCAATCAC ATATATTAT 1320 CCCATTAA 1328 <210> 5 <211> 1328 <212> DNA <213> Artificial Sequence <220> <223> g1544 Gene Promoter Allele 2 <400> 5 agaaaatagt ttctccgatt aaattttttt ttcaaatcaa atctttattt aagaattggt 60 agtgtatagt agtataatat tgcctaagaa attggagtag tccgtaaaaa atgggacaaa 120 attgttgaaa ttgagcaacc tgaaaatttt atgctggtca caagtagaga aataggcgta 180 gaaccaaaat tgacccaatt tcttgttgcc tttaattggg tcattcataa gaattcaaaa 240 tattttcttt tcccactcac gcgagagata tgcgcacacg atataattaa taccgtttgt 300 aacaatacgt agatggccaa aaatgaacaa aatgggacac tcctcaaaag gaaaaattgc 360 ttgtttggct gtcttctcca attgaaatat acacacacac cgcggtaaaa aaaaaattga 420 aattgaaatc gcggtgggac aaaagtagca accacaacaa gggaattttc cttactgctg 480 cggcagatcc ttactcatct cttgaatata tatagcctct tgggtccacg ggcaaaaaag 540 aaaaaaaaaa aagagaagca acagaaccgc acacaacgta cgcagtgatc catccatttt 600 ccacaaaatt tatttatttt cttgtctgta ttatttacgt acaactaact gatcttcttg 660 tccccccccc cccatttacc cgttaaaatg aaagctgaac aacagaaaat aataattcgc 720 tctgatggac aaaaaataca agaacaagag agtatcatca ctatgtgggt cacaaatgac 780 cctacaactg taatctagtt gatacaaaat ttgaccctca ttctcaaata attactacat 840 ttgggtctgt attaatacta atatctgtat atctctctat ctatcagtca catacaaatt 900 tatcttcatc ttaaagggac tcacttactc aataatggtc tatctttata tttttatcat 960 acgtatgtat gtacgtagta aagggccatc aatgatccat attattatta ttattcttta 1020 gttatttcta agcaacaaaa ggtctgtacc acagtttcag tgtcgtcata tctcttattt 1080 taatttcttt tcggggaggg atgtcttaat gctaacttct gtctcactat taacggtaaa 1140 tcttattaat ctcaatatat atataaaggg ttgatatttt ccaacgtttt aaaacttatt 1200 cccttgtttc tatattacta atttaacatt acttatttta attatttttc ccttttttac ttattatata tatataagta catattacca ataataatat aagcaatcac atatatttat 1320 cccattaa 1328 <210> 6 <211> 1047 <212> DNA <213> Artificial Sequence <220> <223> ADH gene (g4423) allele 1 ORF <400> 6 atgtctattc caactactca aaagggtgtt atcttctacg aatctagagg taagctagaa 60 tacaaggaca ttccagtccc aactccaaag gctaacgaat tattaatcaa cgttaagtac 120 tctggtgttt gtcacactga tttacacgct tggcacggtg actggccatt gccagttaag 180 ctacctttag tcggtggtca cgaaggtgcc ggtgttgtcg tcgccattgg tgaatccgtt 240 aagggctgga agatcggtga ttacgccggt attaaatggt taaacggttc ttgtatgaac 300 tgtgaatact gtgaattagg taacgaatct aactgtccag aagctgattt atctggttac 360 actcacgatg gttctttcca acaatacgct accgctgatg ctatccaagc tgctaagatc 420 ccagccggta ccgatctagc cgaagttgct ccaatcttat gtgctggtgt taccgtctac 480 aaggctctaa agtccgctaa cctaagagct ggtgaatggt gtgctatctc cggtgctgct 540 ggtggtctag gttctctagc tgtccaatac gctaaggcta tgggttacag agtcgtcggt 600 attgacggtg gtgaagaaaa ggaaaagcta ttcaagtcta ttggtggtga agttttcgtc 660 gatttcacta aggaaaagga tatcattggt actattgtca aggccactaa cggtggtgct 720 cacggtgtta tcaacgtctc cgtctctgaa gccgctatcg aagcttctac caagtacgtt 780 agagctaacg gtacctccgt tttagtcggt atgccagctg gtgccgtctg tagatccgat 840 gtctttgacc acgtcgtcaa gtccatctct attgtcggtt cttacgtcgg taacagagct 900 gataccagag aagctctaga cttcttcgcc agaggtttag tcaagtctcc aatcaagatt 960 gctccattat ctgacttacc agaaattttc gaaaagatgg aaaagggtca aatcgttggt 1020 agatacgttg ttgacacttc taactaa 1047 <210> 7 <211> 1047 <212> DNA <213> Artificial Sequence <220> <223> ADH gene (g4423) allele 2 ORF <400> 7 atgtctattc caactactca aaagggtgtt atcttctacg aatctagagg taagctagaa 60 tacaaggaca ttccagtccc aactccaaag gctaacgaat tattaatcaa cgttaagtac 120 tctggtgttt gtcacactga tttacacgct tggcacggtg actggccatt gccagttaag 180 ctacctttag tcggtggtca cgaaggtgcc ggtgttgtcg tcgccatggg tgaatccgtt 240 aagggctgga agatcggtga ttacgccggt attaaatggt taaacggttc ttgtatgaac 300 tgtgaatact gtgaattagg taacgaatct aactgtccag aagctgattt atctggttac 360 actcacgatg gttctttcca acaatacgct accgctgatg ctatccaagc tgctaagatc 420 ccagccggta ccgatctagc cgaagttgcc ccaatcttat gtgctggtgt taccgtctac 480 aaggctctaa agtccgctaa cctaagagct ggtgaatggt gtgctatctc cggtgctgct 540 ggtggtctag gttctctagc tgtccaatac gctaaggcta tgggttacag agtcgtcggt 600 attgacggtg gtgatgaaaa ggaaaagcta ttcaagtcca ttggtggtga agttttcgtc 660 gatttcacta aggaaaagga tatcattggt actattgtta aggccactaa cggtggtgct 720 cacggtgtta tcaacgtctc cgtctctgaa gccgctatcg aagcttctac caagtacgtt 780 agagctaacg gtacctccgt tttagtcggt atgccagctg gtgctgtctg tagatccgat 840 gtctttgacc acgtcgtcaa gtccatctct attgtcggtt cttacgtcgg taacagagct 900 GATACTGAGA AGCTCTAGAC TTCTTCGCCA GAGGTTTAGT CAAGTCTCCA ATCAAGATT 960 GCTCCATTA TCTGACTTAC CAGAAATTTT CGAAAAGATG GAAAAGGGTC AAATCATTGG 1020 AGATACGTTG TTGACACTTC TAAC TAA 1047 <210> 8 <211> 1690 <212> DNA <213> Artificial Sequence <220> <223> PDC gene (g3002) allele 1 ORF <400> 8 ATGGCTGAAA TTCAATTAGG TCCTTACTTA TTCGAAAGAT TAAAGCAAGT TAAATGTACT 60 ACCCTTTTCG GTTTACCAGG TGATTTCAAC TTGGTCTTAT TAGACAAGTT TATACGAAGT C 120 GAAGGTATGA GATGGTCCGG TGACACTAAC GAATTAAACG CTGCTTACGC TGCTGATGGT 180 TACGCTAGAG TTAAGGATAT GGCCGCTATG ATCACCACCT TC GGTGTGGTG AATTATCC 240 GCTTTAAACG GTATTGCCGG TTCTTACTCT GAACACGTCG GTGTTCACAC ATTGTCGGT 300 TGTCCATCTA CTTTACTACA AGCTAAGGAT CTATTATTAC ACCACACCTT AGCTGATGGT 360 GACTTCGATG TCTTCCACAG AATGTCTGCT AACATCTCTT GTACTACCTC TATGATCACT 420 GACATTGCCAC TGCCTCAAGT GAAATTGACA GATGTATCAG AGCTACTTAC ATCAACCAA 480 AGACCAGTCT ACTTAGGTTT CCCATCTGAC TACTTTGAAA AGACTGTTCC AGCTTCTCTA 540 TTACAAACTC CAATTGACTT ATCTCTAAAG GCTAACGATG CTGCTTCTGA AGATGAAGTT 600 ATTGAAGAAA TCTTAACCAT GGTAAAGGCT GCTAAGAACC CAATCATCAT TGCTGATGCT 660 TGTTCCTCCA GACACAACGT TAAGGCTGAA ACCAAGAAGT TAGTCGATGT TACCAACTTC 720 CCAGCCTTCG CTACTCCTCT AGGTAAGGCC GTCATTGACG AAAC TCA CCC AAGATTCGGT 780 G GT ATCTACG TTGGTTCTCT ATCCAGACCA GCTGTCAAGG AAGCCGTTGA ATCCGCTGAT 840 TTAATCTTAT CTGTCGGTGC TCTATTATCC GATTACAACA CTGCTTCTTT CACTTACGGT 900 TACAACACCA AGAACATTTG TGAATTCCAC TCCGACCATG AAGATCAGAA ACGCTACC 960 TTCCCAGGTG TCCAAATGAA ATTCTTTCTA CAAAGATTA CTAAGGTCAT CGGTGAAGCT 1020 AACAAGGGTT ACAAGGCCGT TGCTACCCCA GCTAAGGCTC CAGCTAACGC TGAAGTC CCA 1080 GCTTCTACTC CATTGAAGCA AGAATGGTTA TGGAACGAAG TTTCCAAC TTCTTCCAAGA A 1140 ggtgatgtta tcatcactga aaccggtact tcttccttcg gtatcaactc ctctgtcttc 1200 ccagccaaca ctattggtat ctctcaagtc ttatggggtt ccattggtta cgctggtggt 1260 gctgttgccg gtgctgcttt cgccgctgaa gaaattgacc cagctaagag agtcattcta 1320 ttcattggtg acggttctct acaattaacc gttcaagaaa tctccaccat tgttagatgg 1380 ggtctaaagc catacttatt cgtcttaaac aacgatggtt acaccattga aagattaatt 1440 cacggtccaa aggctcaata caacgaaatt caaaactggg ataacttaaa gattctacca 1500​​​​​​​​​​​​​​​​​​​​​​​atggctgaag ttcaattagg tcgttactta ttcgaaagat taaagcaagt taactgtact 60 accgttttcg gtttaccagg tgatttcaac ttggtcttat tagacaagtt atacgaagtc 120 gaaggtatga gatggtccgg tgacactaac gaattaaacg ctgcttacgc tgctgatggt 180 tacgctagag ttaagggtat ggccgctatg atcaccactt tcggtgtcgg tgaattatcc 240 gctttaaacg gtattgccgg ttcttactct gaacacgtcg gtgttttaca cattgtcggt 300 tgtccatcta ctttactaca agctaagggt ctattattac accacacctt agctgatggt 360 gacttcgatg tcttccacag aatgtctgct aacatctctt gtactacctc tatgatcact 420 gacattgcca ctgctccaag tgaaattgac agatgtatca gagctactta catcaaccaa 480 agaccagtct acttaggttt cccatctgac tactttgaaa agactgttcc agcttctcta 540 ttacaaactc caattgactt atctctaaag gctaacgatg ctgcttctga agatgaagtt 600 attgaagaaa tcttaaccat ggttaaggct gctaagaacc caatcatcat tgctgatgct 660 tgttcttcca gacacaacgt taaggctgaa accaagaagt tagtcgatgt taccaacttc 720 ccagccttcg ctactcctct aggtaaggcc gtcattgacg aaactcaccc aagattcggt 780 ggtatctacg ttggttctct atccagacca gctgtcaagg aagccgttga atccgctgat 840 ttaatcttat ctgtcggtgc tctattatcc gattacaaca ctgcttcttt cacttacggt 900 tacaacacca agaacattgt tgaattccac tccgaccaca tgaagatcag aaacgctacc 960 ttcccaggtg tccaaatgaa attcgttcta caaagattac taaaggtcat cggtgaagct 1020 aacaagggtt acaaggccgt tgctacccca gctaaggctc cagctaacgc tgaagtccca 1080 gcttctactc cattgaagca agaatggtta tggaacgaag tttccaactt cttccaagaa 1140 ggtgatgtta tcatcactga aaccggtact tcttccttcg gtatcaactc ctctgtcttc 1200 ccagccaaca ctattggtat ctctcaagtc ttatggggtt ccattggtta cgctggtggt 1260 gctgttgccg gtgctgcttt cgccgctgaa gaaattgacc cagctaagag agtcattcta 1320 ttcattggtg acggttctct acaattaacc gttcaagaaa tctccaccat tgttagatgg 1380 ggtctaaagc catacttatt cgtcttaaac aacgatggtt acaccattga aagattaatt 1440 CAGAAGTGTT TTAGTTGCTG ACAAGGCCTT CAACGTTCCA TCTAAGATTA TTATTTCGGT GCTAAGGACT ACGAAACTCA CAGAGTTGCT ACTACCGGTG AATGGAAGAGA 1560 TATGTTGTTG ATGTTTATTA TTTTATTTAT TTTTATTTAT TTTATTTATT TTTATTTAT 1860 CCAGTTATGG ACGGTCCAGC TGCTTTGATT GCTCAAGGTA AGCTATCCGA AGAAATGAC 1680 GCTGCTATG 1689 <210> 10 <211> 1851 <212> DNA <213> Artificial Sequence <220> <223> CYB2 gene (g2947) allele 1 ORF <400> 10 ATGCAAGCAA TTTCAAaaaa TTCAACATTT TTACGTAATT GTAaaaattt GAAATTTATT 60 TCAAAGAACa TTAATAATAG GAAGTTATCT TCTTCTATTA TAACttATCA CATTACAAT 120 TCAATTAAAA CTAATACCaa TTATAAGAAT TATTCTTCCA AAAATTTACG TAATTcatta 180 ATTttATTAT CGTCTGTATC ATTTTTAGCT TATTACGCTA ATGATCAATT ACAACATAAT 240 ACTAATTCA TTAATATCTA ATGATAATGG TAAGAATCCA GCTGCTAATA AGAAACCAAT 300 tctccagcag aagttgctaa acataacaaa ccagatgatt gttgggtagt tattgacggt 360 tacgtttacg atgtctcttt ctttattcca aatcatccag gtggtgaaga tgtcattaga 420 gctaatgcag gtaaggatgt taccgctatc ttcatgccat tacatgctaa gggtaccctt 480 gaaaagaata ttccaattga aaatcaatta ggtccattaa gtaaaccaat gcctaaaaaa 540 ttagtttgtc caccttatgc tcctggtgag acaccttatg aaattatgac taaacaaaaa 600 ttaagagata atatgccacc attaggcaca attttaaatc tttatgattt tgagagatta 660 gcttcaaaaa ttttaactaa tcaagcttgg gcttattatt cttctggtgc agatgatgaa 720 attacatata gagaaaacca taacgcttat catagaatct ttttcaaacc acatatttta 780 gtcgatgtta aggatgtcga tttgaagact actatgttag gtaataagac cgatgttcca 840 ttctatgtta gtgctactgc tttatgtaaa ttaggtaatc cagaaggtgg tgaagttgat 900 atcgctaaag gttgtggttc aacttcttat atggttcctc aaatgatttc tactttagct 960 tcttgttcat tagatgaagt cgcccagggg aaagctaacg ataaacaatt acaatggttt 1020 caattatatg ttaattccga tagaaagatt actagaaatt taattaaaca tgctgaagat 1080 ttaggtatga aggctatctt cgtcacagtt gatgctcctt ctttaggtaa tagagaaaag 1140 gatcaaaaga ttaaatttac tactcaaggt tctgagggtc caaagatttt acaaaagaaa 1200 ggtgattcct ccaatgctgc tgctgaagca aagaagaaag aaaataaatc cgatggtgcc 1260 tctaaagctt tatctaaatt tatcgatcct tctttgtcct gggaagatat cgcaaagatg 1320 agaaaattga ctaaattacc aatcgttatt aagggtgttc aaagagctga agatgctgta 1380 agagcagctc aaatgggttg tcaaggtgtt gttctttcaa atcatggtgg tagacaatta 1440 gatttctcaa gagccccaat tgaagttctt gcagagacta tgccaatttt gaaacatcat 1500 ggtctagata agaatttcga tgtctttgtc gatggtggta ttcgccgtgg tactgatatc 1560 ttaaaggcat tgtgtcttgg tgctacaggt gttggtttag gtagaccttt cttatatgct 1620 aattcttgtt atggtagaga tggtgttgct catgctattg atatcattac caaagaatta 1680 gaaatgtcta tgagattatt aggtgttagc aaaattgagg atttgaatcc aggtttctta 1740 gatttacaat ctttacatgc cagatctgtt cttgttgcta aggatgcatt atatgaaaat 1800 tcatacaagg aaccacaact agctaaattc ttaattgacg acgatgatta g 1851 <210> 11 <211> 1827 <212> DNA <213> Artificial Sequence <220> <223> CYB2 gene (g2947) allele 2 ORF <400> 11 atgcaagcaa ttaattttaa aaatttgaaa tttatttcaa agaacattaa taataggaag 60 ttatcttctt catctataac tttatcacaa ttacaatcaa ttaaaacaaa taccaattac 120 aagaattatt cttccaaaaa tttacgtaat tcattaattt tattatcttc tgtatcattt 180 ttagcttatt acgctaatga tcagttacaa cagaatacta attcattaat atctaatgaa 240 aatggtaaga atccagctgc taataagaaa ccaatctctc cagcagaagt tgctaaacat 300 aacaaaccag atgattgttg ggtagttatt gacggttacg tttacgatgt ctctttcttt 360 attccaaatc atccaggtgg tgaagatgtc attagagcta atgcaggtaa ggatgttacc 420 gctatcttca tgccattgca tgctaagggt acccttgaaa agaatattcc aattgaaaat 480 CAATTAAGGT CCGTAATGTA ACCAATAGCC TAAAAATAGT TTGTCCACCT TATGCTCCT 540 GTTGAGACACC TTATGAAATT ATGACTAAAC AAAATCGAGA GATAATATGC CACCATA 600 GTTACAATTT TAAATCTTTA TGATTTTGAA AGATTAGCTT CAAAAATTTT AACTAATCAA 660 GCTTGGGCTT ATTATTCTTC TGGTGCAGAT GATGAAATTA CATATAGAGA AAACCAT AAC 720 GCTTATCATAGAATCTTTTT CAAACCACAT ATTTTAGTCG ATGTTAAGGA TGCATTGTTG 780 AAGACTACTA TGTAGGTAAT AAGACCgAT GTTCCATTCT ATGTTAGTGC TACTGCTTTA 840 TGTAATTAGGTAATCCAGA AGGTGgtGAAGTTGATATCGCTAAAGGTTGTGgtTCAACT 900 TCTTATATGGTTCCtCAAT GATTTCtACAT TAGCTTCTTG TTCATTAGAT GAAGTCGCC 960 CAAGGGAAAA CTAACGATAA ACAATTACAA TGTTTCAATT ATATGTTATT TCCTATAGA 1020 AAGATTACTA GAAATTTGAT TAAACATGCT GAAGATTGAG GTATGAAGGC TATCTTCGTC 1080 ACAGTTGATG CTCCTTCTTT AGGTAATAGA GAAAAGGAT CAAAAGATTAA ATTACTACT 1140 CAAGGTTCTG AGGgtCCAAA GATTTCACAA AAGAAAGGTG ATTCCTCCAA TGCTGCTGCT 1200 gaagcaaaga agaaagaaaa taaatccgat ggtgcctcta aagctttatc taaatttatc 1260 gatccttctt tgtcttggga agatatcgca aagatgagaa aattgactaa attaccaatc 1320 gttattaagg gtgttcaaag agctgaagat gctgtcagag cagctcaaat gggttgtcaa 1380 ggtgttgttc tttcaaatca tggtggtaga caattagatt tctcaagagc cccaattgaa 1440 gttcttgcag agactatgcc aattttgaaa catcatggtc tagataagaa tttcgatgtc 1500 tttgtcgatg gtggtattcg tcgtggtact gatatcttaa aggcattatg tcttggtgct 1560 acaggtgttg gtttaggtag acctttctta tatgctaatt cttgttatgg tagagatggt 1620 gttgctcatg ctattgatat cattaccaaa gaattagaaa tgtctatgag actattaggt 1680 gttagtaaaa ttgaggattt gaatccaggt ttcttagatt tacaatcttt acatgccaga 1740 tctgttcttg ttgctaagga tgcattatat gaaaattcat acaaggaacc acaactagct 1800 aaattcttaa ttgacgacga tgattag 1827 <210> 12 <211> 963 <212> DNA <213> Artificial Sequence <220> <223> Idh gene derived from Lactobacillus plantarum <400> 12 atgtcttcta tgccaaatca tcaaaaagtt gttttggttg gtgatggtgc tgttggttct 60 tcttatgctt ttgctatggc tcaacaaggt attgctgaag aatttgttat tgttgatgtt 120 gttaaagata gaactaaagg tgatgctttg gatttggaag atgctcaagc ttttactgct 180 ccaaaaaaaa tttattctgg tgaatattct gattgtaaag atgctgattt ggttgttatt 240 actgctggtg ctccacaaaa accaggtgaa tctagattgg atttggttaa taaaaatttg 300 aatattttgt cttctattgt taaaccagtt gttgattctg gttttgatgg tatttttttg 360 gttgctgcta atccagttga tattttgact tatgctactt ggaaattttc tggttttcca 420 aaagaaagag ttattggttc tggtacttct ttggattctt ctagattgag agttgctttg 480 ggtaaacaat ttaatgttga tccaagatct gttgatgctt atattatggg tgaacatggt 540 gattctgaat ttgctgctta ttctactgct actattggta ctagaccagt tagagatgtt 600 gctaaagaac aaggtgtttc tgatgatgat ttggctaaat tggaagatgg tgttagaaat 660 aaagcttatg atattattaa tttgaaaggt gctacttttt atggtattgg tactgctttg 720 atgagaattt ctaaagctat tttgagagat gaaaatgctg ttttgccagt tggtgcttat 780 atggatggtc aatatggttt gaatgatatt tatattggta ctccagctat tattggtggt 840 actggtttga aacaaattat tgaatctcca ttgtctgctg atgaattgaa aaaaatgcaa 900 gattctgctg ctactttgaa aaaagttttg aatgatggtt tggctgaatt ggaaaataaa 960 taa 963 <210> 13 <211> 1134 <212> DNA <213> Artificial Sequence <220> <223> GPD2 (g5617) gene allele 1 ORF <400> 13 atgcatcgtc aaccatttaa agtcacagtt attggttcag gtaattgggg tacaactatt 60 gcaaaagttg ttgcggagaa tacagttcaa aatcctcatt tatttaataa agatgttaat 120 atgtgggtat ttgaagaaat gattgatgga gaaaaattaa cagaaattat aaatacaaga 180 catcaaaatg ttaaatattt acctggaatt gatttaccac ataatttaat tgcaaatcca 240 tcattattag atagtgttaa aggtgcagat attcttgtat ttaatgtacc acatcaattt 300 ttacctaaaa ttgtatcaca attaaaggga catgtatcga atcaagttcg tgcaatttca 360 tgtttaaaag ggtttgaagt tggtgctaaaa ggggtacaat tattatcatc atatattaaa 420 gatgaattag atattcaatg tggtgcatta tcaggtgcaa atttagcacc agaagttgca 480 aaagagcatt ggtcagagac aactgttgca tatcaattac catctgattt taaaggtgaa 540 ggatttgatg tagatcataa agtattaaag atgttatttc atagaccata tttccatgtt 600 aatgtaattg atgatgttgc aggtatttca attgcaggtg cattgaaaaa tgttgttgca 660 ttagcatgtg gttttgttga aggtttagga tggggtaata atgcagcagc agctatacaa 720 agagttggac ttggtgaaat tattaaattt ggtcaaatgt ttttcccaga gagtcgtgtt 780 gaaacatatt atcaagaatc tgcaggtgtt gcagatttaa ttactacatg ttcaggtggt 840 agaaatgtta aagttgcaaa atatatgtca aagaatcatg ttgatgcatt tcaagctgag 900 aaagaattat taaatggtca atctgcacaa ggtgtaatta cttgtaaaga agttcatgaa 960 tggttatcaa catgtgaatt aacagaagat ttcccattat ttgaagcagt ttatcaaatt 1020 gtttataata atatgccaat ggaacaaatt cctgatatga ttgatgaatt agaaccattt 1080 gaagttgaag aagatgatga accgcaacaa gaacaacaac cagttactaa ctag 1134 <210> 14 <211> 1134 <212> DNA <213> Artificial Sequence <220> <223> GPD2 (g56l7) gene allele 2_ORF <400> 14 atgcatcgtc aaccatttaa agttacagtt attggttcag gtaattgggg tacaactatt 60 gcaaaagttg ttgcagagaa tacagttcaa aatcctcatt tatttaataa agatgttaat 120 atgtgggtat ttgaagaaat gattgatgga gaaaaattaa cagaaattat aaatacaaga 180 catcaaaatg ttaaatattt acctggaatt gatttaccac ataatttaat tgcaaatcca 240 tcattattag atagtgttaa aggtgcagat attcttgtat ttaatgtacc acatcaattt 300 ttacctaaaa ttgtatcaca attaaaggga catgtatcga atcaagttcg tgcaatttca 360 tgtttaaaag gttttgaagt tggtgctaaa ggggtacaat tattgtcatc atatattaaa

[420] ] gatgaattag atattcaatg tggtgcatta tcaggtgcaa atttagcacc agaagttgca 480 aaagaacatt ggtcagagac aactgttgca tatcaattac catctgattt taaaggtgaa 540 ggatttgatg tagatcataa agtattaaaa atgttatttc atagaccata ttttcatgtt 600 aatgtaattg atgatgttgc aggtatttca attgcgggtg cattgaaaaa tgttgttgca 660 ttagcatgtg gttttgttga aggtttagga tggggtaata atgctgctgc agctatacaa 720 agagttggac ttggtgaaat tattaaattt ggtcaaatgt ttttcccaga gagtcgtgtt 780 gaaacatatt atcaagaatc tgcaggtgtt gcagatttaa ttactacatg ttcaggtggt 840 agaaatgtta aagttgcaaa atatatgtca aagaatcatg ttgatgcatt tcaagctgag 900 aaagaattat taaatggtca atctgcacaa ggtgtaatta cttgtaaaga agttcatgaa 960 tggttatcaa catgtgaatt aacagaagat ttcccattat ttgaagcagt ttatcaaatt 1020 gtttataata atatgccaat ggaacaaatt cctgatatga ttgatgaatt agaaccattt 1080 gaagttgaag aagatgatga accgcaacaa gaacaacaac cagttactaa ctag 1134 <210> 15 <211> 377 <212> PRT <213> Artificial Sequence <220> <223> GPD2 (g5617) gene allele 1 / 2 ORF <400> 15 Met His Arg Gin Pro Phe Lys Val Thr Val lie Gly Ser Gly Asn Trp 1 5 10 15 Gly Thr Thr lie Ala Lys Val Val Ala Glu Asn Thr Val Gin Asn Pro 20 25 30 His Leu Phe Asn Lys Asp Val Asn Met Trp Val Phe Glu Glu Met lie 35 40 45 Asp Gly Glu Lys Leu Thr Glu lie lie Asn Thr Arg His Gin Asn Val 50 55 60 Lys Tyr Leu Pro Gly lie Asp Leu Pro His Asn Leu lie Ala Asn Pro 65 70 75 80 Ser Leu Leu Asp Ser Val Lys Gly Ala Asp lie Leu Val Phe Asn Val 85 90 95 Pro His Gin Phe Leu Pro Lys lie Val Ser Gin Leu Lys Gly His Val 100 105 110 Ser Asn Gin Val Arg Ala lie Ser Cys Leu Lys Gly Phe Glu Val Gly 115 120 125 Ala Lys Gly Val Gin Leu Leu Ser Ser Tyr He Lys Asp Glu Leu Asp 130 135 140 He Gin Cys Gly Ala Leu Ser Gly Ala Asn Leu Ala Pro Glu Val Ala 145 150 155 160 Lys Glu His Trp Ser Glu Thr Thr Val Ala Tyr Gin Leu Pro Ser Asp 165 170 175 Phe Lys Gly Glu Gly Phe Asp Val Asp His Lys Val Leu Lys Met Leu 180 185 190 Phe His Arg Pro Tyr Phe His Val Asn Val He Asp Asp Val Ala Gly 195 200 205 He Ser He Ala Gly Ala Leu Lys Asn Val Val Ala Leu Ala Cys Gly 210 215 220 Phe Val Glu Gly Leu Gly Trp Gly Asn Asn Ala Ala Ala Ala He Gin 225 230 235 240 Arg Val Gly Leu Gly Glu He He Lys Phe Gly Gin Met Phe Phe Pro 245 250 255 Glu Ser Arg Val Glu Thr Tyr Tyr Gin Glu Ser Ala Gly Val Ala Asp 260 265 270 Leu He Thr Thr Cys Ser Gly Gly Arg Asn Val Lys Val Ala Lys Tyr 275 280 285 Met Ser Lys Asn His Val Asp Ala Phe Gin Ala Glu Lys Glu Leu Leu 290 295 300 Asn Gly Gin Ser Ala Gin Gly Val He Thr Cys Lys Glu Val His Glu 305 310 315 320 Trp Leu Ser Thr Cys Glu Leu Thr Glu Asp Phe Pro Leu Phe Glu Ala 325 330 335 Val Tyr Gin He Val Tyr Asn Asn Met Pro Met Glu Gin He Pro Asp 340 345 350 Met He Asp Glu Leu Glu Pro Phe Glu Val Glu Glu Asp Asp Glu Pro 355 360 365 Gln Gin Glu Gin Gin Pro Val Thr Asn 370 375 <210> 16 <211> 753 <212> DNA <213> Artificial Sequence <220> <223> GPP1 (g4356) Gene Allele 1 ORF <400> 16 atgccactaa ctgaaaaacc actatctgtt aaagttaacg catgtctact agatgtagat 60 ggtacaatta ttatatcaca acctgcaatt gcagaaatgt ggagagattt tggtaaggat 120 aaaccttatt ttgattcaga acatgtaatt aaaatttctc atggttggag aacttatgat 180 gcaattgcaa aatttgctcc agattttgct actcatgaat ttgttgctaa attagaaggt 240 gcaattcctg aaaaatatgg gaaatttgct gttcaagtcc ctggtgctgt taaattttgt 300 aatgatatga attctttacc aaaggaaaaa tgggctgtag ctacttctgg tacatttgaa 360 atggcttctc aatggtttaa attcttaaat attaagagac ctgaaaattt tattactgct 420 tcaagtgtta aggaagggaa acccgctcct gaatgttat taaagggtag aaatggttta 480 ggtttcccaa taaataaaaca agatccaagt aaatcaaaag tatttgtatt tgaagatgct 540 cctgctggta tcgctgcagg taaagctgca ggttgtaaaa tcgtcggtat tgcaactact 600 tttgacgctg ataccttaaa ggagaaaggt tgtgatatta tcattaaaaa cttcgaatct 660 gttaaacttg gtaactacga cccagcaacc gatgaagttg aattgatttt caatgattat 720 ctttacgcta aggacgattt attgaaatgg taa 753 <210> 17 <211> 753 <212> DNA <213> Artificial Sequence <220> <223> GPP1 (g4356) gene allele 2 ORF <400> 17 atgccactaa ctgaaaaacc actatctgtt aaagttaatg catgtctact agatgtagat 60 ggtacaatta ttatatcaca acctgcaatt gcagaaatgt ggagagattt tggtaaggat 120 aaaccttatt ttgattcaga gcatgtaatt aaaatttctc atggttggag aacttatgat 180 gcaattgcaa aatttgctcc agattttgct actcatgaat ttgttgctaa attagaaggt 240 gcaattcctg aaaaatatgg gaaatttgct gttcaagtcc ctggtgctgt taaattttgt 300 aatgatatga attctttacc aaaggaaaaa tgggctgttg ctacttctgg tacatttgaa 360 atggcttctc aatggtttaa attcttaaat attaaaagac ctgaaaattt tattactgct 420 tcaagtgtta aggaagggaa accagctcct gaatgttatt taaagggtag aaatggttta 480 ggtttcccaa taaataaaca agatccaagt aaatcaaaag ttttcgtatt tgaagatgct 540 cctgctggta tcgctgcagg taaagctgca ggttgtaaaa tcgtcggtat tgcaactact 600 tttgacgctg atactttaaa ggagaaaggt tgtgatatta tcattaaaaa cttcgaatct 660 gttaaacttg gtaactacga tccagcaact gatgaagttg aattgatttt caatgattat 720 ctttacgcta aggacgattt attgaaatgg taa 753 <210> 18 <211> 250 <212> PRT <213> Artificial Sequence <220> <223> GPP1 (g4356) Gene Allele 1 / 2 ORF <400> 18 Met Pro Leu Thr Glu Lys Pro Leu Ser Val Lys Val Asn Ala Cys Leu 1 5 10 15 Leu Asp Val Asp Gly Thr Ile Ile Ile Ser Gln Pro Ala Ile Ala Glu 20 25 30 Met Trp Arg Asp Phe Gly Lys Asp Lys Pro Tyr Phe Asp Ser Glu His 35 40 45 Val Ile Lys Ile Ser His Gly Trp Arg Thr Tyr Asp Ala Ile Ala Lys 50 55 60 Phe Ala Pro Asp Phe Ala Thr His Glu Phe Val Ala Lys Leu Glu Gly 65 70 75 80 Ala Ile Pro Glu Lys Tyr Gly Lys Phe Ala Val Gln Val Pro Gly Ala 85 90 95 Val Lys Phe Cys Asn Asp Met Asn Ser Leu Pro Lys Glu Lys Trp Ala 100 105 110 Val Ala Thr Ser Gly Thr Phe Glu Met Ala Ser Gln Trp Phe Lys Phe 115 120 125 Leu Asn Ile Lys Arg Pro Glu Asn Phe Ile Thr Ala Ser Ser Val Lys 130 135 140 Glu Gly Lys Pro Ala Pro Glu Cys Tyr Leu Lys Gly Arg Asn Gly Leu 145 150 155 160 Gly Phe Pro Ile Asn Lys Gln Asp Pro Ser Lys Ser Lys Val Phe Val 165 170 175 Phe Glu Asp Ala Pro Ala Gly Ile Ala Ala Gly Lys Ala Ala Gly Cys 180 185 190 Lys Ile Val Gly Ile Ala Thr Thr Phe Asp Ala Asp Thr Leu Lys Glu 195 200 205 Lys Gly Cys Asp Ile Ile Ile Lys Asn Phe Glu Ser Val Lys Leu Gly 210 215 220 Asn Tyr Asp Pro Ala Thr Asp Glu Val Glu Leu Ile Phe Asn Asp Tyr 225 230 235 240 Leu Tyr Ala Lys Asp Asp Leu Leu Lys Trp 245 250 <210> 19 <211> 753 <212> DNA <213> Artificial Sequence <220> <223> GPP1 (g5443) gene allele 1 ORF <400> 19 atgcctctaa ctgaaaaacc tctatctcta aaaatcaacg ccgctttatt cgatgttgat 60 ggtaccatta tcatctctca accagctatt gctgctatgt ggagagattt cggtaaggac 120 aagccatact tcgatgctga acatgttatt cacatctctc acggttggag aaccttcgat 180 gccatcgcta aatttgctcc agatttcgct gatgaaaaat tcgttgctga attagaaggt 240 tccattccag ataaattcgg tgaacattcc atcgaagttc caggtgccgt caagttatgc 300 ggtgatctaa acaagctacc aaaggaaaag tgggctgttg ccacttctgg tacttgggaa 360 atggctcaca aatggttcga tatcctaggt attaaaagac catctaactt cattaccgcc 420 ggtgatgtta agaacggtaa gccacatcca gaaccataca ccaagggtag aaacggtcta 480 ggttacccag ttaacgaaca agacccatct aaatccaagg ttgttgtctt tgaagatgct 540 ccagctggta ttgctgccgg taaggctgct ggttgtaaga ttgttggtat tgctaccact 600 ttcgatctag atttcttaat tgaaaagggt tgtgatatca ttgtcaagaa ccacgaatct 660 attaaggttg gtggttacga tccagttact gatgaagtcg aattaatctt caccgattac 720 ttatatgcta aggatgattt actaaaatgg taa 753 <210> 20 <211> 753 <212> DNA <213> Artificial Sequence <220> <223> GPP1 (g5443) Gene Allele 2 ORF <400> 20 atgcctctaa ctgaaaaacc tctatctcta aaaatcaacg ccgctttatt cgatgttgat 60 ggtaccatta tcatctctca accagctatt gctgctatgt ggagagattt cggtaaggac 120 aagccatact tcgatgctga acatgttatt cacatctctc acggttggag aaccttcgat 180 gccatcgcta aatttgctcc agatttcgct gatgaaaaat tcgttgctga attagaaggt 240 tccattccag ataaattcgg tgaacattcc atcgaagttc caggtgccgt caagttatgc 300 ggtgatctaa acaagctacc aaaggaaaag tgggctgttg ccacttctgg tacttgggaa 360 atggctcaca aatggttcga tatcctaggt attaaaagac catctaactt cattaccgcc 420 ggtgatgtta agaacggtaa gccacatcca gaaccataca ccaagggtag aaacggtcta 480 ggttacccag ttaacgaaca agacccatct aaatccaagg ttgttgtctt tgaagatgct 540 ccagctggta ttgctgccgg taaggctgct ggttgtaaga ttgttggtat tgctaccact 600 ttcgatctag atttcttaat tgaaaagggt tgtgatatca ttgtcaagaa ccacgaatct 660 attaaggttg gtggttacga tccagttact gatgaagtcg aattaatctt caccgattac 720 ttatatgcta aggatgattt actaaaatgg taa 753 <210> 21 <211> 250 <212> PRT <213> Artificial Sequence <220> <223> GPP1 (g5443) Gene Allele 1 / 2 ORF <400> 21 Met Pro Leu Thr Glu Lys Pro Leu Ser Leu Lys Ile Asn Ala Ala Leu 1 5 10 15 Phe Asp Val Asp Gly Thr Ile Ile Ile Ser Gln Pro Ala Ile Ala Ala 20 25 30 Met Trp Arg Asp Phe Gly Lys Asp Lys Pro Tyr Phe Asp Ala Glu His 35 40 45 Val Ile His Ile Ser His Gly Trp Arg Thr Phe Asp Ala Ile Ala Lys 50 55 60 Phe Ala Pro Asp Phe Ala Asp Glu Lys Phe Val Ala Glu Leu Glu Gly 65 70 75 80 Ser Ile Pro Asp Lys Phe Gly Glu His Ser Ile Glu Val Pro Gly Ala 85 90 95 Val Lys Leu Cys Gly Asp Leu Asn Lys Leu Pro Lys Glu Lys Trp Ala 100 105 110 Val Ala Thr Ser Gly Thr Trp Glu Met Ala His Lys Trp Phe Asp Ile 115 120 125 Leu Gly Ile Lys Arg Pro Ser Asn Phe Ile Thr Ala Gly Asp Val Lys 130 135 140 Asn Gly Lys Pro His Pro Glu Pro Tyr Thr Lys Gly Arg Asn Gly Leu 145 150 155 160 Gly Tyr Pro Val Asn Glu Gln Asp Pro Ser Lys Ser Lys Val Val Val 165 170 175 Phe Glu Asp Ala Pro Ala Gly Ile Ala Ala Gly Lys Ala Ala Gly Cys 180 185 190 Lys Ile Val Gly Ile Ala Thr Thr Phe Asp Leu Asp Phe Leu Ile Glu 195 200 205 Lys Gly Cys Asp Ile Ile Val Lys Asn His Glu Ser Ile Lys Val Gly 210 215 220 Gly Tyr Asp Pro Val Thr Asp Glu Val Glu Leu Ile Phe Thr Asp Tyr 225 230 235 240 Leu Tyr Ala Lys Asp Asp Leu Leu Lys Trp 245 250 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PRIMER <400> 22 ctttgagtgc aagtatcgcc 20 <210> 23 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PRIMER <400> 23 tgtgtaattg ttcaccaaag cc 22 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PRIMER <400> 24 gtcgattctc atgttcgtgc 20 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PRIMER <400> 25 cttagcgact tcagtagcga 20 <210> 26 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 26 catgtatcga atcaagttcg tg 22 <210> 27 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 27 caacttctgg tgctaaattt gc 22 <210> 28 <211> 988 <212> DNA <213> Artificial Sequence <220> <223> 5' UTR of g4423 allele 1 <400> 28 gttaactcag ttttctctct ttccctccac cccacgttac tctgcgaaca aaaatacgca 60 cagaatgaac atctgattga ttaatattta tatattactt agtggcaccc ctacaaacaa 120 accaattttg aatatttctc accatcatga tatttattta gggcaagaat ttcatgtaca 180 tacgtgcgtg tactgcatag ttttgttata tgtaaataac cagcaatata tcaccaatga 240 taaatgctca gtaatttatt tggaaccaaa atagtttcag taatcaaata atacaataac 300 taacaagtgc tgattataca acagctgtta acaacacaaa cacgctctct tctattctct 360 tccctgcttg ttcgtgtggt atattcccga atttgcaatt tagaaattat attttttaaa 420 agaattgttc tccattttct ggtagtcgta agtggcaaat tggatcataa gacacaatct 480 tgttagttcg actgctaaca ccagacaaga ccgaacgaaa acagaaaaaa aagataattt 540 tgttattctg ttcaattctc tctctctttt taaggtatct ttacattaca ttacatatcc 600 caaattacaa caagagcaag aaatgaagca caacaacacg ccatctttcg tgattatttt 660 atcatttcta tatcgtaact aaattaacaa atgctatgtt tcttaatttt taatgataaa 720 tctaactgct accttaattt ctcatggaaa gtggcaaata cagaaattat atattcttat 780 tcattttctt ataattttta tcaattacca aatatatata aatgcaatta attgattgtt 840 cctgtcacat aatttttttt gtttgttacc tttattcttt atccatttag tttagttctt 900 atatctttct tttctatttc tctttttcgt ttaatctcac cgtacacata tatatccata 960 tatcaataca aataaaaatc atttaaaa 988 <210> 29 <211> 961 <212> DNA <213> Artificial Sequence <220> <223> 5' UTR of g4423 allele 2 <400> 29 gttaactcag ttttctctct ttccctccac cccacgttac tctgcgaaca aaaaatacgc 60 acagaatgaa catctgattg attaatattt atatattact cagtggcacc cctacaaaca 120 aaccaatttt gaatattgtt caccatcatg atatttattt agggcaagaa tttcatgtac 180 atacgtgcgt gtactgcata gttttgttat atgaaaataa ccagcaatat atcaccaatg 240 aataaattct caataattta tttggaacca aataatgcaa taactagcaa actaagtggt 300 gattatacaa cagctgttaa caacacaaac atacgctctc ttctattatc tcttccctgc 360 ttgttcgtgt ggtatattca cgaatttgca atttagaaat tatatttttt aaaagaattg 420 ttctccattt tctggtagtc gtaagtggca aattggatca taagacacaa tcttgttagt 480 tcgactgcta acaccagaca acaccgaacg aaaacaagaa aaaataatta ttctctctct 540 ttttaaggta tcttacatta catatcccaa attacaacaa gagcaagaaa tgaggcacaa 600 caacacacca tcatctttcg tgattatttt tatcatttct atcatgtaat taaattaaca 660 aatgttaagt ttattaattt ttaatgataa atctagttgc taccttaatt tctcatggaa 720 agtggcaaat actgaaatta tttaattcta ctttcatttt cttataattt ttatcaatta 780 ccaaatatat ataaatgcaa ttaattgatt gttcctgtca cataattttt tttgtttgtt 840 acctttattc tttatccatt taatttattt cttgtatctt tcttttctat ttctcttttc 900 tgtttaatct caccgtacac atatatatcc atatatcaat acaaataaaa atcatttaaa 960 a 961 <210> 30 <211> 256 <212> DNA <213> Artificial Sequence <220> <223> 3' UTR of g4423 allele 1 <400> 30 taagtcattt aatttattct tttagaatat atttattttg tctttatttt tgaaatgtta 60 atagtctttt ttttttactt tgaacaaaaa aaagtaaaat taaaacttat cttatatacg 120 cttttaaaca ttaaactcgt taacgaatta tataatgatt ttatcgaact actttatgtt 180 ttttaataga ataatcttct ttattaatat aacttactac ttcttaatct tgttgtcctc 240 ccattcgaaa ctcgag 256 <210> 31 <211> 255 <212> DNA <213> Artificial Sequence <220> <223> 3' UTR of g4423 allele 2 <400> 31 taagtcattt aatttattct tttagaatat atttattttg tctttatttt tgaaatgtta 60 atagtctttt ttttactttg aaaaaaaaaa aaagtaaaat taaacttatc ttatatacgc 120 ttttaaacat taaactcgtt aacgaattat ataatgattt tatcgaacta ctttatgttt 180 ttttaataga ataatcttct ttattaatat aacttactac ttcttaatct tgttgtcctc 240 cattcgaaac tcgag 255 <210> 32 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 32 gcaggatatc agttgtttg 19 <210> 33 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 33 aataccttgt tgagccatag 20 <210> 34 <211> 375 <212> DNA <213> Artificial Sequence <220> <223> 5' UTR of g2947 allele 1 <400> 34 atatattttg gctgacattg taattagatg agatccacaa tttttctttt gtttgactgt 60 tcgatatgga gaaggtggga tgcactatta ttatattcag aagtttattt gtacagttta 120 aagaacaaat agtggctaat cctatcctcg gactaaaaaa atcgttcac ttctatccta 180 ctgtaaatct tatgaaaatg atgtaattca tatagttact atattttctt tcttttagaa 240 actttatgat atatatatat atataaaagg actaatcacc caactctcaa attcattaaa 300 aagaaatatg tttctatcat cttcttttct tattatacct cgtctaataa taaaaccaaa 360 caattttctg taaag 375 <210> 35 <211> 375 <212> DNA <213> Artificial Sequence <220> <223> 5' UTR of g2947 allele 2 <400> 35 atatattttg gctgacattg taattagatg agatccacaa tttttctttt gtttgactgt 60 tcgatatgga gaaggtggga tgcactatta ttatattcag aagtttattt gtacagcttg 120 aagaacaaat agtggctaat cctatcctcg gactaaaaaa aattgttcac ttttatccta 180 ctgtaaatct tatgaaaatg atgtaattca tatagttact atattttctt tcttttagaa 240 acttcatgat atatatatat atataaaagg actaatcacc caactctcaa atttattaaa 300 aagaaatatg tttctatcat cttcttttct tattatacct tctctaataa taaaaataaa 360 caactttctg taaag 375 <210> 36 <211> 997 <212> DNA <213> Artificial Sequence <220> <223> 3' UTR of g2947 Allele 1 <400> 36 ttgtgactct atggagttta cctattttat ataccactat atcacaaaaa gtaataacaa 60 cttttcaaat ataatacaat attcaataaa tatatttata tattctaaaa tctacgtttt 120 tctctttctt aaaaaaataa acaaactgac cctttcaatc ttcaatgtga tactttactt 180 attttatttc attacacaga aaggtataaa tatatacata acttaatggt ttatcattt 240 cttcttatta gacaacgtgg ttagttgttg tttaacccat tccaataata aatcagtttg 300 taaataacct tcactgttaa atacttttat aatctctaat gaactagtta aagttttctt 360 cttattatct atcaaagtca tattgtaaat tggtttattt tcttcaaatt ctgtctttaa 420 tttaattatt tcagtaccat tcttaccact atatacgata gatttttcaa catatttctt 480 aaaaaccaa aatattacag atagtacaaa atatgtaccg actaaaaattt gttgatattt 540 aacgatatta tcatgaacaa atttttatc aatgaatgaaa ctgattgctg caacgatggc 600 660 tcttttcatg acatcaggta gactttcatt tatagtttgt gatacttcag agatggata 720 aacgttaacg ggcttactca ttgtgcttta aaggaagaatg cggaattaat gagctcttta 780 840 tgaattttgt ctgttctttt ataatggatt tcccaaattg atgattattg 900 gttcactaag aaagctagaa agaagatgag atttctcgaa tagtaaaata ttacgttaac 960 atatctgaga ttaaaccgat agtcaatttg tacgtta 997 <210> 37 <211> 997 <212> DNA <213> Artificial Sequence <220> <223> 3' UTR of g2947 allele 2 <400> 37 ttgtgactct atggagttta cctattttat ataccactgt atcacaaaaa gtaataacaa 60 cttctcaaat ataatacaat atttaataaa tatatttata tattctaaaa tctacgtttt 120 tctctttctt aaaaaaataa acaaactgac cctttcaatc ttcaatgtga tactttactt 180 attttatttc attacacaga aaggtataaa tatatacata acttaatggt ttattcattt 240 cttcttatta gacagagtgg ttagttgttg tttaacccat tccaataata aatcagtttg 300 taaataacct tcactgttaa atactttatt aatctctaat gaactagtta aagttttctt 360 cttattatct atcaaagtca tattgtaaat tggtttattt tcttcaaatt ctgtctttaa 420 tttaattatt tcagtaccat tcttaccact atatacgata gatttttcaa catatttctt 480 aaagaaccaa aatattacag atagtacaaa atatgtaccg actaaaattt gttgatattt 540 aacgatatta tcatgaacaa attttttatc aatgatgaaa ctgattgctg caacgatggc 600 agttgaataa ccaattaata atttctgatc aactaattca aaggtttctt cataacctaa 660 tcttttcata acatcaggta gactttcatt tatagtttgt gatacttcag agatggaata 720 aacgttaaca ggtttactca ttgtgcttta aaggagaatg cggaattaat gagctcttta 780 ctatgtatca gaactcgaac taatgcaaag aaaaatggaa taaacttgtt acaatatgta 840 tgaattttgt ctattctttt ataataaatt ataatagatt tcccaaattg atgattattg 900 gttcactaag aaagctagaa agaagatgag atttctcgaa tagtaaaata ttaccttaac 960 atatctgaga ttaaaccgat agtcaatttg tacgtta 997 <210> 38 <211> 1328 <212> DNA <213> Artificial Sequence <220> <223> 5' UTR of allele 1 of g1544 <400> 38 agaaaatagt ttctccgatt aaattttttt ttcaaatcaa atctttattt aagaattggt 60 agtgtatagt agtataatat tgcctaagaa attggagtag tccgtaaaaa atgggacaaa 120 attgttgaaa ttgagcaacc tgaaaatttt atgctggtct caagtagaga aacagacgta 180 gaaccaaaat tgacccaatt tcttgttgcc tttaattggg tcattcataa gaattcaaaa 240 tattttcttt tcccactcac gcgagagata tgcgcacacg atatagttaa taccgcttgt 300 aacaatacgt agatggccaa aaatgaacaa aaggggacac tcctcaaaag aaaaaattgc 360 ttgtttggct gtcttctcca attgaaatat acacacacac cgcggtaaaa aaaaaattga 420 aatggaaatc gcggtgggac aaaagtagca accacaacaa gggaattttc cttactgctg 480 cggcagatcc ttactcatct ctcgaatata tatagcctct tgggtccacg ggcaaaaaag 540 aaataaaaaa aagagaagca acagaaccgc acgcaacgta cgcagtgatc catccatttt 600 ccacaaaatt tatctatttt cttgtctata ttttttacgt acaactaact gatcttcttg 660 tccccctccc cccatttacc cgttaaaatg aaagctgaac aacagaaaat aataattcgc 720 tctggtggac aaaaaataca agaacaagag agtatcataa ttatgtgggt cacaaatgac 780 CCTACAACCT GTCACCTAGT TGGTACAAAA TTTGACCCTC ATTCTCAATA ATTACTACAT 840 TTGGGTCTGT ATTAATGCTA ATATTTCAAT ATATCTCTAT CTATCAGTCA CATCAAATT 900 TATCTTTCAT CTAAAAGGGA CTCACCTACT CAATAATGGT CATCTTTATA TTTTTTTCAT 960 ACGTATGTAT GTACGTA GTA AAGGGCCAT CAATGATCCC TTCCTACTAT TATTATTCTT A 1020 GTTATTTC TAAGCAACAA AAGGTCTGT ACCACAGTTT CAGTGTCTCA TCCTCTTCTT T 1080 TAATTTCTTTTCGGGGAGGG ATGTCTTAAT GCTAATTCTG TCTCCTATTA ACAGTAAG 1140 TCGTATTAAT CTCAATATAT ATATAAAGGG TTGATATTTT CCACCGTTTT AAAAATTATT 1200 CCCTTGT TTC TCTATTATTA ATT TTAGACTACTTATTTTA ATTATTTTTTC CCTTTTTTAC 1260 TTATTATATA TATATAACTA TATATTACCA ATAATAATAT ATAGCAATCAC ATATATTAT 1320 CCCATTAA 1328 <210> 39 <211> 1328 <212> DNA <213> Artificial Sequence <220> <223> 5' UTR of g1544 Allele 2 <400> 39 agaaaatagt ttctccgatt aaattttttt ttcaaatcaa atctttattt aagaattggt 60 agtgtatagt agtataatat tgcctaagaa attggagtag tccgtaaaaa atgggacaaa 120 attgttgaaa ttgagcaacc tgaaaatttt atgctggtca caagtagaga aataggcgta 180 gaaccaaaat tgacccaatt tcttgttgcc tttaattggg tcattcataa gaattcaaaa 240 tattttcttt tcccactcac gcgagagata tgcgcacacg atataattaa taccgtttgt 300 aacaatacgt agatggccaa aaatgaacaa aatgggacac tcctcaaaag gaaaaattgc 360 ttgtttggct gtcttctcca attgaaatat acacacacac cgcggtaaaa aaaaaattga 420 aattgaaatc gcggtgggac aaaagtagca accacaacaa gggaattttc cttactgctg 480 cggcagatcc ttactcatct cttgaatata tatagcctct tgggtccacg ggcaaaaaag 540 aaaaaaaaaa aagagaagca acagaaccgc acacaacgta cgcagtgatc catccatttt 600 ccacaaaatt tatttatttt cttgtctgta ttatttacgt acaactaact gatcttcttg 660 tccccccccc cccatttacc cgttaaaatg aaagctgaac aacagaaaat aataattcgc 720 tctgatggac aaaaaataca agaacaagag agtatcatca ctatgtgggt cacaaatgac 780 cctacaactg taatctagtt gatacaaaat ttgaccctca ttctcaaata attactacat 840 ttgggtctgt attaatacta atatctgtat atctctctat ctatcagtca catacaaatt 900 tatcttcatc ttaaagggac tcacttactc aataatggtc tatctttata tttttatcat 960 acgtatgtat gtacgtagta aagggccatc aatgatccat attattatta ttattcttta 1020 gttatttcta agcaacaaaa ggtctgtacc acagtttcag tgtcgtcata tctcttattt 1080 taatttcttt tcggggaggg atgtcttaat gctaacttct gtctcactat taacggtaaa 1140 tcttattaat ctcaatatat atataaaggg ttgatatttt ccaacgtttt aaaacttatt 1200 cccttgtttc tatattacta atttaacatt acttatttta attatttttc ccttttttac 1260 ttattatata tatataagta catattacca ataataatat aagcaatcac atatatttat 1320 cccattaa 1328 <210> 40 <211> 402 <212> DNA <213> Artificial Sequence <220> <223> 3' UTR of g1544 allele 1 <400> 40 tccatcatca agaatatata tatataataa agccatccct tttacgaacc tgcctgcatt 60 tgcttaagac cgagcaaaaa aaataaatta caacataacg aaaaaaacaa acaaacttaa 120 gggggagaaa aaaaaataat atcccataac ttacatacac aacatacata aaattaaaaa 180 aataaacatt ttatcaataa ttttttttta aagtatatag agctactaat attatagaaa 240 tacagacgca acttaaagaa ctttgttcaa tcttttcaat cttctcagtc ttttctagtc 300 ataataaatt atcaaatgcg aatatttaaa tcaaaattat ataaggggta tatcgtatat 360 atataaattt atcaaatgtg tatatgtatt ttattatgtt ta 402 <210> 41 <211> 402 <212> DNA <213> Artificial Sequence <220> <223> 3' UTR of g1544 allele 2 <400> 41 tccatcatca aaaatatata tatataataa agccatccct tttacgaacc tgcctgcatt 60 tgcttaagac cgagcaaaaa aaataaatta caatataacg aaaaaaacaa acaaacttaa 120 gggggagaaa aaaaaataat atcccataac ttacatacac aacatacata aaattaaaaa 180 aataaacatt ttatcaataa ttttttttta aagtatatat agctactaat attatagaaa 240 tacaaatgca acttaaagaa ctttgttcaa tcttttcaat cttctcaatc ttttctagtc 300 ataataaatt atcaaatgcg aatatttaaa ttaaaattat ataaagggta tatcatatat 360 atataaattt atcaattgtg tatatgtatt ttattatgtt ta 402 <210> 42 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> PRIMER <400> 42 gggtactact atcgctaa 18 <210> 43 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> PRIMER <400> 43 caccggcaac agagatac 18 <210> 44 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> PRIMER <400> 44 cgtacgcagt gatccatc 18 <210> 45 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 45 caccggcaac agagatac 18 <210> 46 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 46 cgtacgcagt gatccatc 18 <210> 47 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 47 gctcggtctt aagcaaat 18 <210> 48 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 48 gcatcgtcaa ccatttaaag 20 <210> 49 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 49 ctcagcttga aatgcatc 18 <210> 50 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> PRIMER <400> 50 gctgcacgtt tactgtat 18 <210> 51 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> PRIMER <400> 51 ctcagcttga aatgcatc 18 <210> 52 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> PRIMER <400> 52 gctgcacgtt tactgtat 18 <210> 53 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> PRIMER <400> 53 cttagatttc actgctgc 18

Claims

1. A recombinant strain having lactic acid-producing ability, wherein, from the acid-tolerant yeast YBC strain having accession number KCTC 13508BP, the GPD1 gene encoding an enzyme that converts dihydroxyacetone phosphate into glycerol-3-phosphate, the CYB2 gene encoding an enzyme that converts lactate into pyruvate, the ADH gene encoding an alcohol dehydrogenase, and the PDC gene encoding a pyruvate decarboxylase are deleted; and wherein a gene encoding lactate dehydrogenase is introduced into the acid-tolerant yeast YBC strain, wherein the nucleotide sequence of the GPD1 gene is SEQ ID NO: 1 or SEQ ID NO: 2, the nucleotide sequence of the CYB2 gene is SEQ ID NO: 10 or SEQ ID NO: 11, the nucleotide sequence of the ADH gene is SEQ ID NO: 6 or SEQ ID NO: 7, the nucleotide sequence of the PDC gene is SEQ ID NO: 8 or SEQ ID NO: 9, and the nucleotide sequence of the gene encoding lactate dehydrogenase is SEQ ID NO:

12.

2. The recombinant strain according to claim 1, wherein the gene encoding lactate dehydrogenase is introduced into a position of at least one of the CYB2 gene, the ADH gene, the PDC gene, and the GPD1 gene that are deleted, and is regulated by a promoter of the deleted or replaced gene.

3. A method of producing lactic acid, comprising: (a) culturing the recombinant strain according to claim 1 or 2 to produce lactic acid; and (b) collecting the produced lactic acid. ​

Images