A molecular marker linked to the wax powder trait gene of rapeseed and its application

Abstract

The invention discloses a molecular marker closely linked to a wax powder gene of a Chinese cabbage and its application. An F2 population was constructed using 402-3 and H10-8 Chinese cabbage materials. A chromosome region closely linked to the wax powder of a Chinese cabbage was obtained using a BSA population positioning method, and a molecular marker was developed within a candidate interval. A KASP molecular marker was designed based on a SNP single base mutation within the candidate interval, and the marker was used to perform genotype identification on 500 individual plants in the F2 population, with a compliance rate of 100%. The research results not only contribute to the identification of the wax powder of a Chinese cabbage and assist breeding, but also provide a basis for the map-based cloning of the wax powder of a Chinese cabbage and the analysis of the molecular mechanism of the development and formation of the wax powder of a Chinese cabbage, and have a wide range of promotion value.

Description

Technical Field

[0001] The invention relates to the technical field of cauliflower (Brassica campestris L.ssp.chinensis var.perperea Hort.) molecular breeding, in particular to a molecular marker tightly linked to a cauliflower wax powder gene and application of the marker in cauliflower molecular assisted breeding and hybrid purity identification. Background Art

[0002] Chinese cabbage (Brassica campestris L.ssp.chinensis var.perperea Hort.) is a variety of Brassica rapa in the family Cruciferae. It is a local specialty vegetable native to my country and a major vegetable crop in southern China. Wax powder is the main commercial trait of Chinese cabbage, and no wax powder is a mutation type of Chinese cabbage. Its advantages are that the surface of the Chinese cabbage is free of wax powder, bright color, strong flavor, good taste and commercial quality. Therefore, breeding of no wax powder Chinese cabbage is one of the important quality traits that Chinese cabbage breeders generally pay attention to.

[0003] Some genes and mechanisms related to wax synthesis in some cruciferous vegetables have been identified, but there are few studies on wax-related genes in cauliflower, and there are no reports on the precise positioning of wax genes in cauliflower and the cloning of related genes. Therefore, obtaining molecular markers closely linked to wax synthesis genes through relevant research is of great significance for cauliflower genetic breeding and hybrid purity identification. Summary of the invention

[0004] The invention mainly aims at the cauliflower inflorescence wax powder gene and provides a molecular marker closely linked to the cauliflower inflorescence wax powder gene, which can be used to identify the presence of cauliflower inflorescence wax powder and provide a new method for cauliflower wax powder trait quality breeding and purity identification.

[0005] A molecular marker linked to the cauliflower wax powder gene is a point mutation from A to G at position 1412249 on chromosome A01 of the cauliflower genome.

[0006] The primer set designed for this mutation site is as follows:

[0007] Primer name Primer sequence 5'-3' A01_1412249F GCAGAGGAAGCGGTTATGAAAGA A01_1412249R GCAGAGGAAGCGGTTATGAAAGG A01_1412249C CGCTTCATCGTCGTTATTAAGCTT

[0008] The 5' ends of the two forward primers A01_1412249F and A01_1412249R were connected to different fluorescent linker sequences, which were FAM or HEX fluorescent linker sequences from LGC.

[0009] FAM signal: GAAGGTGACCAAGTTCATGCT

[0010] HEX signal: GAAGGTCGGAGTCAACGGATT

[0011] The 5' end of the A01_1412249F primer was connected to the FAM fluorescent linker sequence, and the 5' end of the A01_1412249R primer was connected to the HEX fluorescent linker sequence. The primer sequences after connecting the fluorescent linker are as follows:

[0012] Primer name Primer sequence 5'-3' A01_1412249Fa GAAGGTGACCAAGTTCATGCTGCAGAGGAAGCGGTTATGAAAGA A01_1412249Rb GAAGGTCGGAGTCAACGGATTGCAGAGGAAGCGGTTATGAAAGG A01_1412249C CGCTTCATCGTCGTTATTAAGCTT

[0013] A method for identifying whether cauliflower scapes have wax powder using molecular markers comprises the following steps:

[0014] (1) Using the genomic DNA of the sample to be tested as a template, designing an amplification primer set using molecular markers, and performing PCR amplification to obtain an amplification product;

[0015] (2) Detect and analyze the amplified products.

[0016] Preferably, the amplification primers in step (1) include primers shown in SEQ ID NO:5, SEQ ID NO:7 and SEQ ID NO:3.

[0017] Preferably, the PCR amplification in step (1) adopts Touchdown PCR amplification, and the Touchdown PCR amplification program is: 94°C for 15 min; 95°C for 20 s; 65°C-56°C for 60 s, 10 cycles, with the annealing extension temperature decreasing by 0.8°C in each cycle; 94°C for 20 s; 57°C for 60 s, 26 cycles.

[0018] The application of the molecular marker is conducive to the early breeding of the wax-free trait of cauliflower, and lays a foundation for cloning wax-regulating genes and studying the molecular mechanism of wax-regulating cauliflower.

[0019] (1) Molecular markers were used to identify and assist in the screening of wax-free cauliflower materials.

[0020] (2) Molecular markers are used in the breeding of wax-free cauliflower.

[0021] When the amplified product is subjected to fluorescence detection, if the sample PCR product only detects the fluorescence signal corresponding to the primer A01_1412249Fa, the detection site is the A:A genotype, and it is determined to be a phenotypic individual plant with wax powder; if the sample PCR product only detects the fluorescence signal corresponding to the primer A01_1412249Rb, the detection site is the G:G genotype, and it is determined to be a phenotype individual plant without wax powder; if both fluorescence signals are detected at the same time, the detection site is the A:G genotype, and it is determined to be a heterozygous individual plant with wax powder.

[0022] When molecular markers were applied, Touchdown PCR was used, and the amplification program was: 94°C for 15 min; 95°C for 20 s; 65°C-56°C for 60 s, for 10 cycles, with the annealing extension temperature decreasing by 0.8°C in each cycle; 94°C for 20 s; 57°C for 60 s, for 26 cycles.

[0023] The present invention utilizes the method of BSA positioning to locate an interval that controls the wax powder of the cauliflower, develops a marker in the interval for fine positioning, finds a completely linked mutation site, and develops a KASP molecular marker associated with the wax powder gene of the cauliflower based on the site. The method can be directly used for the identification of whether the cauliflower has wax powder and the corresponding genotype, and then the molecular marker is relied on for auxiliary breeding, which can effectively solve the problem that the conventional breeding cycle is long and is susceptible to environmental influences. By using the molecular marker in the early stage, satisfactory plants can be quickly screened, the planting scale is effectively reduced, and the workload of later identification is reduced. The efficiency and accuracy of selection are improved. The method can be used for the identification of cauliflowers of various varieties, and is of great significance to the study of the molecular mechanism of the wax powder of the cauliflower. Therefore, the present invention is of great significance in the practice and research of the wax powder gene breeding of the cauliflower. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 Plants with wax powder (left) and without wax powder (right).

[0025] Figure 2 This is the wax powder gene location map.

[0026] Figure 3 KASP marker genotyping diagram. DETAILED DESCRIPTION

[0027] In order to make the purpose, technical solutions and advantages of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in combination with the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0028] The present invention uses the BSA positioning method to locate an interval controlling the wax powder of rapeseed, develops markers within the interval for fine positioning, finds a completely linked mutation site, and develops a KASP molecular marker associated with the rapeseed wax powder gene based on the site.

[0029] Example 1 Construction of Population

[0030] Using a multi-generation inbred line wax powder material "402-3" (P1) and another multi-generation inbred line wax powder-free material "H10-8" (P2), such as Figure 1The two parental materials were crossed to obtain F1, and the F1 was self-pollinated to obtain F2. F1 was backcrossed with both parents to obtain BC1P1 and BC1P2, and a six-generation population was constructed.

[0031] Example 2 Identification of flower stem wax powder

[0032] During the flower stalk harvest period, the presence or absence of wax powder on the flower stalk of each group was identified by visual inspection. According to statistics, among the 500 individual plants in the F2 group, there were 382 plants with wax powder and 118 plants without wax powder. The chi-square test showed that the separation ratio was 3:1; all the plants in the BC1P1 group had wax powder; the separation ratio of the plants with wax powder and those without wax powder in the BC1P2 group was 1:1. The results showed that the wax powder trait of the cauliflower was controlled by a pair of completely dominant genes, with wax powder being a dominant trait and the absence of wax powder being a recessive trait.

[0033] χ 2 =∑(OE) 2 / E

[0034] Table 1 Statistics on the presence or absence of flower stem wax powder in each group

[0035]

[0036] Example 3 Location of the cauliflower wax powder gene

[0037] In the F2 population of H10-8×402-3, 30 leaves of plants without wax powder and 30 leaves of plants with wax powder were selected at the inflorescence harvest period, and equal amounts of DNA were mixed into pool samples: dominant progeny pool sample R03; recessive progeny pool sample R04; dominant parent pool 402-3 and recessive parent H10-8, and library construction and sequencing were performed to obtain whole genome sequencing data. The total DNA of the four pools was extracted using the CTAB method. TruSeq DNA LT Sample Prep Kit (Illumina) was used to build libraries for the four pooled DNAs, and sequencing was performed on the Illumina HiSeq platform for genome resequencing. The obtained data was used for SNP calling using samtools, and the base quality value was screened to be greater than or equal to 20, the mapping quality value was greater than or equal to 20, the base depth was greater than or equal to 4 and less than or equal to 60 in the two F2 pools, and greater than or equal to 4 and less than or equal to 60 in the two parents, and a total of 623,920 high-quality differential SNPs were obtained. The plot was made with 10 SNPs as the window and 4 SNPs as the step size, as shown in the figure. Figure 3(SNP-index distribution diagram) For genomic regions that are not related to phenotypic differences, the average Δ(SNP-index) is 0, while the Δ(SNP-index) of the candidate interval is greater than 0.5. The SNPs associated with the target trait are linked to the surrounding SNPs on the chromosome and concentrated in a candidate region located from 0Mb to 1.44Mb on chromosome 1. Figure 2 .exist Figure 2 a: Distribution of SNP-index association values ​​on chromosomes; b: Fine positioning map of rapeseed wax powder.

[0038] Example 4 Fine positioning of the cauliflower stem wax gene

[0039] The candidate region of the gene controlling the wax powder of the cauliflower stem was obtained by Example 3. In order to further narrow the candidate region of the gene controlling the wax powder of the cauliflower stem, the reference genome sequence was compared according to the parent resequencing results. The reference genome was the cauliflower (Brassica parachinensis LHBailey) genome. The assembled genome size was 355.32 Mb, the GC content was 36.83%, the genome was assembled to the chromosome level, there was gene annotation information, the version number was v3, and the reference genome sequence download address was http: / / brassicadb.org / brad / datasets / pub / Genomes / Brassica_rapa / V3.0 / , find the SNP variation site, develop KASP markers, use the developed KASP molecular markers to genotype the individual plants in the F2 population, and determine the exchange individual plants. Based on the phenotypic survey data of flower stem wax powder and the genotype of the determined exchange individual plants, the gene controlling wax powder was located in the 1412249-1439836 interval of chromosome 1, such as Figure 2 b.

[0040] Example 5 Development of Molecular Markers Linked to the Chinese Cabbage Inflorescence Wax Powder Gene

[0041] A 401 bp sequence was obtained by selecting a 200 bp sequence in the upstream and downstream directions of the 1412249 position of the chromosome A01 genome of the cauliflower genome, and the 401 bp nucleotide sequence was shown in SEQ ID NO:8; the molecular marker was a SNP mutation site of the chromosome A01 of the cauliflower genome, and the molecular marker was located at the 1412249 position on the chromosome A01 of the cauliflower genome, corresponding to the 201st position of SEQ ID NO:8, and the nucleotide was A or G.

[0042] The primer set designed for the SNP mutation site is shown in Table 2:

[0043] Table 2 Primer sets for amplifying SNP mutation sites

[0044]

[0045]

[0046] The 5' ends of the two forward primers A01_1412249F and A01_1412249R were connected to different fluorescent linker sequences, which were FAM or HEX fluorescent linker sequences from LGC.

[0047] FAM signal: GAAGGTGACCAAGTTCATGCT

[0048] HEX signal: GAAGGTCGGAGTCAACGGATT

[0049] The 5' end of the A01_1412249F primer is connected to the FAM fluorescent linker sequence, and the 5' end of the A01_1412249R primer is connected to the HEX fluorescent linker sequence. The primer sequences after connecting the fluorescent linker are shown in Table 3:

[0050] Table 3 Primer sequences after connecting with fluorescent linkers

[0051] Primer name Primer sequence 5'-3' A01_1412249Fa GAAGGTGACCAAGTTCATGCTGCAGAGGAAGCGGTTATGAAAGA A01_1412249Rb GAAGGTCGGAGTCAACGGATTGCAGAGGAAGCGGTTATGAAAGG A01_1412249C CGCTTCATCGTCGTTATTAAGCTT

[0052] The molecular marker was used to genotype 500 individual plants of the F2 population constructed by 402-3 and H10-8. Figure 3 . Three kinds of fluorescence signals appeared, among which A:A fluorescence signal had 125 individual plants, A:G fluorescence signal had 247 individual plants, and G:G fluorescence signal had 128 individual plants. Combining the phenotypic survey data, it was found that the genotype was highly consistent with the wax powder phenotype, and the conformity rate reached 100%. The above results fully illustrate that the molecular marker at A01_1412249 of the present invention has versatility and accuracy, and can be applied to the prediction, identification and screening of the wax powder trait of cauliflower flower stems.

[0053] When molecular markers are used, the following steps are specifically included:

[0054] (1) Using the genomic DNA of the sample to be tested as a template, a primer set is designed using molecular markers to perform touchdown PCR amplification to obtain an amplified product;

[0055] (2) Detect and analyze the amplified products.

[0056] Reverse primer A01_1412249C: CGCTTCATCGTCGTTATTAAGCTT.

[0057] Primer A01_1412249Fa: GAAGGTGACCAAGTTCATGCTGCAGAGGAAGCGGTTATGAAAGA

[0058] Primer A01_1412249Rb: GAAGGTCGGAGTCAACGGATTGCAGAGGAAGCGGTTATGAAAGG

[0059] The two forward primers are connected to different fluorescent linker sequences respectively; the fluorescent linker sequence is FAM or HEX.

[0060] FAM signal: GAAGGTGACCAAGTTCATGCT

[0061] HEX signal: GAAGGTCGGAGTCAACGGATT

[0062] When molecular markers are used, Touchdown PCR is used. The Touchdown PCR reaction system is shown in Table 4:

[0063] Table 4 Touchdown PCR reaction system

[0064]

[0065] The touchdown PCR amplification program was as follows: 94°C for 15 min; 95°C for 20 s; 65°C-56°C for 60 s, for 10 cycles, with the annealing extension temperature decreasing by 0.8°C in each cycle; 94°C for 20 s; 57°C for 60 s, for 26 cycles.

[0066] When the amplification product is subjected to fluorescence detection, if the sample PCR product only detects the fluorescence signal corresponding to the primer A01_1412249Fa connected to the fluorescent linker sequence, the detection site is an A:A genotype, and it is determined to be an individual plant with a wax powder phenotype; if the sample PCR product only detects the fluorescence signal corresponding to the primer A01_1412249Rb connected to the fluorescent linker sequence, the detection site is a G:G genotype, and it is determined to be an individual plant without a wax powder phenotype; if two fluorescence signals corresponding to the primers A01_1412249Fa and A01_1412249Rb connected to the fluorescent linker sequence are detected at the same time, the detection site is an A:G genotype, and it is determined to be a heterozygous individual plant with a wax powder phenotype.

[0067] The sample to be tested is a leaf.

[0068] Table 5 shows the presence or absence of wax powder and genotype examples of 98 individual plants in the F2 population constructed by H10-8 and 402-3.

[0069]

[0070]

[0071]

[0072]

[0073] The above identification results show that by screening through molecular marker identification in breeding, retaining the material in which the fluorescent signal corresponding to the primer A01_1412249Fa connected to the fluorescent linker sequence is detected, homozygous material with wax powder can be bred. Retaining the material in which the fluorescent signal corresponding to the primer A01_1412249Rb connected to the fluorescent linker sequence is detected, homozygous material without wax powder can be bred. Retaining the material in which the two fluorescent signals of primers A01_1412249Fa and A01_1412249Rb connected to the fluorescent linker sequence are detected, heterozygous material with wax powder can be bred. Screening of molecular markers in the early stage can reduce the workload of later screening and identification, and accelerate the breeding process. Sequence Listing <110> Hunan Vegetable Research Institute <120> A molecular marker linked to the wax powder trait gene of rapeseed and its application <141> 2021-06-04 <160> 8 <170> SIPOSequenceListing 1.0 <210> 1 <211> twenty three <212> DNA <213> Artificial sequence <400> 1 gcagaggaag cggttatgaa aga 23 <210> 2 <211> twenty three <212> DNA <213> Artificial sequence <400> 2 gcagaggaag cggttatgaa agg 23 <210> 3 <211> twenty four <212> DNA <213> Artificial sequence <400> 3 cgcttcatcg tcgttattaa gctt 24 <210> 4 <211> 21 <212> DNA <213> Artificial sequence (Artificial sequence) <400> 4 gaaggtgacc aagttcatgc t <210> 5 <211> 44 <212> DNA <213> Artificial sequence (Artificial sequence) <400> 5 gaaggtgacc aagttcatgc tgcagagga gcggttatga aaga <210> 6 <211> 21 <212> DNA <213> Artificial sequence (Artificial sequence) <400> 6 gaggtcgga gtcaacggat t <210> 7 <211> 44 <212> DNA <213> Artificial sequence (Artificial sequence) <400> 7 gaaggtcgga gtcaacggat tgcagagga gcggttatga aagg <210> 8 <211> 401 <212> DNA <213> Brassica parachinensis LH Bailey <400> 8 agactcctcc gatgagcaat ggagcgacga agaatccgcc atgagagaaa tcgttctcgg tctccctgct ctatcgatca gcagcgcaac cttcggtgtt agtatcgccg tcgatgaaga ggaagaggcg cgtctgaacg agcaagcggt tgttgcggcg gagttggtca tcgctgcggc 180 agaggaagcg gttatgaaag agagagcga tggcaaaag agaaagtga gggagagag 240 gagacgatg aagcttaata acgacgatga agcgggtggt tcgagtaag gtggagaagc 300 gagaaaaag cagaggaga agactcaga gttcactaat ctgccaagag gaccacccgt 360 call 401

Claims

1. A method for identifying whether the flower stem of purple cauliflower has wax powder by using a molecular marker linked to a wax powder trait gene of purple cauliflower, characterized in that: The following steps are involved: (1) Using the genomic DNA of the sample to be tested as a template, a primer set is designed using a molecular marker linked to the wax powder trait gene of the cauliflower to perform PCR amplification to obtain an amplification product, wherein the nucleotide sequence of the molecular marker linked to the wax powder trait gene of the cauliflower is shown in SEQ ID NO: 8, and the 201st position is A or G; the cauliflower is purple cauliflower ( Brassica campestris L.ssp.chinensis var.perperea Hort. ); (2) Detect and analyze the amplified products.

2. The method according to claim 1, characterized in that The primer set in step (1) includes primers with nucleotide sequences as shown in SEQ ID NO:5, SEQ ID NO:7 and SEQ ID NO:

3.

3. The method according to claim 2, characterized in that In step (1), the PCR amplification adopts Touchdown PCR amplification, and the Touchdown PCR amplification program is: 94°C for 15 min; 95°C for 20 s; 65°C-56°C for 60 s, 10 cycles, with the annealing extension temperature decreasing by 0.8°C in each cycle; 94°C for 20 s; 57°C for 60 s, 26 cycles.

4. The method according to any one of claims 1 to 3, characterized in that: When the amplified product is subjected to fluorescence detection in step (2), A:A is a wild genotype showing wax powder, A:G is a heterozygous genotype showing wax powder, and G:G is a mutant genotype showing no wax powder.

5. Use of a molecular marker linked to a gene for the wax powder trait of cauliflower in the identification, screening or breeding of the presence or absence of wax powder on cauliflower inflorescences, characterized in that: The molecular marker nucleotide sequence linked to the wax powder trait gene of the cauliflower is shown in SEQ ID NO: 8, and the 201st position is A or G; the cauliflower is purple cauliflower ( Brassica campestris L.ssp.chinensis var.perperea Hort. ).

Images