Compositions and Methods for Enhanced Lymphocyte-Mediated Immunotherapy

Abstract

Lymphocytes with inhibited autophagy genes that can be used for immunotherapy are disclosed. The lymphocytes can express antigen-targeting receptors, such as chimeric antigen receptors (CARs) or endogenous or engineered T cell receptors, to target cells expressing tumor-specific antigens. Methods for preparing and using such lymphocytes are disclosed. Some such lymphocytes can be used for CAR-T or TCR-T therapy.

Description

[0001] Citation of Related Applications

[0002] This application claims priority and the benefit of U.S. Provisional Patent Application No. 62 / 804,658, filed on February 12, 2019, the entire content of which is incorporated herein by reference in its entirety for all purposes.

[0003] Government Licensing Rights

[0004] This invention was made in part with government support under Award Number W81XWH-18-1-0264, funded by OC170169, awarded by the U.S. Army Medical Research and Development Command. The government has certain rights in the invention. Technical Field

[0005] Some embodiments of the present invention relate to genetically modified lymphocytes with improved potency as immunotherapeutic agents. Some embodiments of the present invention relate to methods and compositions for modifying the metabolism of lymphocytes to improve their potency as immunotherapeutic agents. Some embodiments relate to methods for genetically manipulating autophagy in chimeric antigen receptor T cells (CAR-T) or engineered or endogenous T cell receptor T cells (TCR-T) to enhance their effectiveness for cancer immunotherapy. Background Art

[0006] CAR-T cells are engineered with antigen-binding domains, such as antibody single chain variable fragments (scFv), to bind antigens expressed on the cell surface of tumor cells. In standard therapy, the CAR construct is transduced into autologous CD3+ T cells, expanded in vitro, and then infused into patients. "Next-generation" CAR-T cells contain an optimized CD3ζ signaling domain (3) fused in combination with co-stimulatory molecules, such as CD28, 41BBL, and CD27. Despite these modifications, the persistence of CAR-T cells in solid tumors remains poor. Thus, other barriers besides pro-survival signals control the function of CAR-T cells in the tumor microenvironment.

[0007] Despite decades of research, the treatment for ovarian cancer has not improved patient outcomes. High-grade serous carcinoma (HGSC), the most common histological type, is typically diagnosed at stage 3 to 4 disease, and patients undergo debulking surgery followed by several rounds of chemotherapy. The 5-year survival rate for stage 4 disease is <20%. Although vaccines, checkpoint blockade, and T cell therapies have been explored, early trials have not improved overall patient survival. However, there is clear evidence that the presence and function of tumor infiltrating lymphocytes (TIL) are strongly associated with improved survival, suggesting that the immune system is beneficial against this disease (4).

[0008] The folate receptor (FR) exists in three isoforms, α, β, and γ, and plays a role in folate and folate salt uptake. αFR has been observed to be highly expressed in ovarian, breast, and lung cancers but low in normal tissues (5). In one trial, 14 ovarian cancer patients who received αFR-CAR-T cell infusions with or without IL-2 did not show evidence of clinical response, although the treatment was well tolerated. The authors concluded using radiolabeled tracer imaging that αFR-CAR-T cells were unable to persist shortly after infusion (2). Thus, the current approach of using αFR-CAR-T in ovarian cancer has not been successful, partly due to the lack of persistence of the cells after infusion. However, this work has provided a defined safety profile for αFR-CAR-T therapy.

[0009] The preparation of CAR-T cells requires specialized infrastructure, patients must undergo lymphodepletion prior to T cell infusion, and acute life-threatening adverse immune events can occur. In addition, CAR-T cells have shown limited efficacy in solid tumors (6). One possibility to explain the lack of observed efficacy in solid tumors is the metabolic barrier imposed by the tumor ecosystem due to the high metabolic demands of rapidly proliferating tumor cells. Ultimately, this can lead to the loss of T cell function and persistence. Thus, it seems that metabolism can significantly affect T cell behavior, providing a unique opportunity to modify T cell metabolism and achieve better therapeutic success in solid cancers.

[0010] Central metabolic dysregulation is a common hallmark of cancer, which has been reported to be observed in ovarian cancer (7). It is widely recognized that cancer uses glucose and glutamine at high rates as the main biosynthetic precursors for cell growth and proliferation (8). Recent work has shown that T cells have adaptive metabolism depending on their activation and differentiation status (7, 9 - 12). For example, the transition from naive T cells to activated effector cells is accompanied by a shift from oxidative metabolism to a more glycolytic phenotype (9). The metabolic similarity between proliferating T cells and tumor cells is striking and implies that insufficient glucose and other nutrients necessary to support proliferation can lead to reduced T cell function and exhaustion (10).

[0011] Metabolic competition can inhibit T cells that have been infused as part of T cell therapy. One report found that CD8+ tumor - infiltrating lymphocytes (TILs) in murine tumors functioned better in tumors with reduced glucose consumption compared to tumors with a high glycolytic rate, indicating that tumor glucose consumption directly impairs T cell activity (10). This defect was rescued by expressing metabolic enzymes that restored T cell glycolysis. In another report, loss of mitochondrial mass in tumor - infiltrating lymphocytes (TILs) was associated with reduced type 1 cytokines, increased checkpoint inhibitor expression, and loss of anti - tumor activity (13). However, forced expression of PGC1α, a transcription factor involved in mitochondrial biogenesis, restored anti - tumor immunity. Reprogramming TILs to use alternative fuels can help maintain their anti - tumor activity in the face of metabolic stress. Despite these studies, no reports have investigated the effects of metabolism on human TILs known to the present inventors.

[0012] Autophagy is a form of catabolism in which cells engulf portions of the cytosol and degrade the cell contents in lysosomes for metabolite recycling, protein quality control, or the destruction of damaged organelles (14). Autophagy is mainly a survival pathway activated by nutrient and growth factor deprivation (14). T cells lacking autophagy genes, such as Atg5 or Atg7, impair thymocyte development and reduce peripheral T cells (15). Consistent with this, autophagy has been reported to be crucial for CD8+ effector T cell survival and memory development (16, 17).

[0013] Given the fundamental role of metabolism in homeostasis and cancer in organisms, deleterious or pro-carcinogenic phenotypes associated with manipulating the autophagy pathway can be expected. In the case of autophagy deficiency, haploinsufficiency of an autophagy gene, Beclin-1, has been found to promote tumor formation, and monoallelic deletions have been observed in 40% to 75% of sporadic breast, ovarian, and prostate cancers (18). In addition, liver-specific knockout of aging Atg5 or Atg7 develops into spontaneous liver tumors (19). According to the inventors' own observations, it is considered that the loss of Atg5 in T cells does not lead to carcinogenesis. In addition, gain-of-function or loss-of-function of metabolic genes is necessary for tumorigenesis but is not sufficient to cause tumorigenesis. For example, T cell-specific Glut1 transgenic mice do not spontaneously develop tumors (20).

[0014] There have been reports of gene editing using CRISPR / Cas9 in primary human T cells (21, 22). A Chinese group has successfully knocked out PD-1 in T cells, but the details of their strategy have not been reported. Another group was able to target CD19 CAR to the T cell receptor-α locus and induce enhanced tumor rejection in a mouse model (22). Recently, a group at the University of Pennsylvania led by Carl June successfully conducted the first human Phase 1 trial testing the safety and feasibility of multiplex CRISPR-Cas9 editing in T cells (24).

[0015] Many types of cells are involved in killing tumor cells, including: NK cells; T cells including CD34+, CD4+ or CD8+ T cells, Treg cells, tissue-resident memory T cells (TRM cells), natural killer T cells (NKT); B cells, etc. These cells act through a similar mechanism of recognizing antigens (such as tumor-specific antigens on the surface of tumor cells) and playing the role of killing such cells.

[0016] Some embodiments of the present invention address the unmet need in the art for improved therapies (including CAR-T therapies) for immunotherapy using lymphocytes, particularly for treating solid cancers such as those of the ovary, breast, or lung.

[0017] The foregoing examples of the related art and the limitations related thereto are intended to be illustrative rather than exclusive. After reading this specification and studying the drawings, other limitations of the related art will become apparent to those skilled in the art. Summary of the Invention

[0018] The following embodiments and aspects thereof are described and illustrated in connection with systems, tools, and methods that are intended to be exemplary and illustrative, not limiting. In various embodiments, one or more of the above problems have been reduced or eliminated, while other embodiments relate to additional improvements.

[0019] In one aspect, lymphocytes are provided that have an antigen-targeting receptor and an inhibited autophagy gene. In some aspects, lymphocytes are provided that have a nucleic acid encoding an antigen-targeting receptor, the nucleic acid inserted within the locus of an autophagy gene to disrupt the expression of the autophagy gene. In some aspects, the autophagy gene is located at a first locus in the genome, and the nucleic acid encoding the antigen-targeting receptor is inserted into a second locus in the genome that is different from the first locus. In some such aspects, the autophagy gene is knocked out or disrupted at the first locus, or in some other way, such as using RNAi, the autophagy gene is inhibited.

[0020] In one aspect, a method of performing immunotherapy is provided that includes administering to a subject the engineered lymphocytes as described in this specification. In one aspect, a method of performing immunotherapy is provided, wherein lymphocytes that have been modified to inhibit an autophagy gene are administered to a subject. In some aspects, a method of performing immunotherapy is provided, wherein lymphocytes that have been modified to inhibit both an autophagy gene and express an antigen-targeting receptor are administered to a subject. In some aspects, immunotherapy is used to treat cancer.

[0021] In one aspect, a method of preparing lymphocytes for immunotherapy is provided, and the method includes modifying lymphocytes to inhibit an autophagy gene. In some such aspects, the lymphocytes are further modified to express a desired antigen-targeting receptor.

[0022] In some aspects, any suitable technique can be used to inhibit the expression of an autophagy gene, including using CRISPR-Cas, zinc-finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), Sleeping Beauty (SB), RNAi, meganuclease, or megaTAL. In some aspects, the autophagy gene is disrupted or knocked out, such as using CRISPR-Cas, zinc-finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), Sleeping Beauty (SB), meganuclease, or megaTAL.

[0023] In some aspects, methods and compositions for improving the anti-tumor efficacy of lymphocytes are provided. In some aspects, methods and compositions for improving the anti-tumor efficacy of cytotoxic lymphocytes are provided. In some aspects, methods and compositions for improving the anti-tumor efficacy of cytotoxic cells are provided. In some aspects, methods and compositions for improving the anti-tumor efficacy of lymphocytes are provided, where the lymphocytes include NK cells; T cells including CD34+, CD4+ or CD8+ T cells, Treg cells, tissue-resident memory T cells (TRM cells), natural killer T cells (NKT); B cells, etc.

[0024] In some aspects, genetically engineered lymphocytes express antigen-targeting receptors, such as chimeric antigen receptors (CARs) or endogenous or engineered T cell receptors, which target a desired tumor-specific antigen.

[0025] In some aspects, methods and compositions for improving the anti-tumor efficacy of T cells (T lymphocytes) for adoptive cell cancer immunotherapy are provided, which include inhibiting autophagy in the T cells.

[0026] In one aspect, a method for improving the anti-tumor efficacy of chimeric antigen receptor (CAR) T cells (CAR-T) for treating cancer by inhibiting autophagy in the CAR-T cells is provided.

[0027] In one aspect, a new use of gene editing methods (including but not limited to CRISPR-Cas9) for inserting a CAR nucleic acid sequence at the autophagy (ATG) locus in primary human autologous T cells to generate "knock-in" CAR-T cells lacking autophagy is provided. These CAR-T cells are defective in expressing the ATG gene targeted by the CAR sequence using CRISPR-Cas9 and are considered to have improved anti-tumor efficacy (against tumors specifically targeted by CAR-T) due to ablation or inhibition of the ATG gene.

[0028] In one aspect, the T cell autophagy (ATG) genes targeted for CRISPR-Cas9 gene editing-mediated CAR sequence "knock-in" (or in other aspects for knock-out or suppression targeting) can be any autophagy-related (ATG) genes known to those skilled in the art and can include, but are not limited to, ATG1, ATG4, ATG5, ATG7, ATG8, ATG13, ATG4, ATG18, ATG16L1, and GABARP. In some aspects, the autophagy genes inhibited in lymphocytes are one or more of ULK1, ULK2, ULK3, FIP200, Vps34, Beclin-1, p150, UVRAG, ATG1, ATG4, ATG5, ATG7, ATG8, ATG9, ATG10, ATG12, ATG13, ATG14L, ATG16L, ATG16L1, ATG18, VMP1, GABARAP, etc.

[0029] In one aspect, the CAR sequence for CRISPR-Cas9 knock-in at the selected ATG gene locus for T cells can be targeted to any desired tumor (or disease / target) antigen (specific thereto). In some aspects, the antigen targeted by the antigen-targeting receptor is a tumor-specific antigen, which includes, but is not limited to, for example, CD19, CD20, BCMA, Her2, EGFRvIII, PSMA (prostate specific membrane antigen), and FR (folate receptor). In some aspects, the tumor-specific antigen is folate receptor (FR), α-folate receptor, β-folate receptor, γ-folate receptor, CD19, CD20, CD133, CD138, CEA, sealing protein 18.2, EGFR, EGFRvIII, EphA2, EpCAM, GD2, GPC3, HER2, MSLN, MG7, MUC1, NY-ESO-1, LMP1, PSMA, Fra, NKG2D1, BCMA, IL13Rα2, LeY, CD70, B7-H3, ROR1, PSCA, etc.

[0030] In one aspect, a modified CAR-T cell (where the CAR sequence is specific for the alpha-folate receptor (αFR)) is "knocked in" to the locus of the ATG5 gene of a T cell using CRISPR-Cas9 gene editing. This generates a new modified CAR-T cell (referred to as αFR-CAR-T) with eliminated ATG5 gene activity / function, which has improved anti-tumor activity (relative to ATG wild-type T cells) for treating cancers that express α-FR, including but not limited to ovarian cancer, breast cancer, and lung cancer. Expression of αFR-CAR after targeted integration into the ATG5 locus can be driven by an endogenous gene promoter or using a heterologous promoter. Methods for nuclease and donor delivery are known to those skilled in the art and can include electroporation of nucleic acids or ribonucleoprotein (RNP) complexes or recombinant virus-mediated delivery.

[0031] In one aspect, a modified CAR-T cell (where the CAR sequence is specific for the alpha-folate receptor (αFR)) is "knocked in" to the locus of the ATG14 gene of a T cell using CRISPR-Cas9 gene editing. This generates a modified CAR-T cell (referred to as αFR-CAR-T) with eliminated ATG14 gene activity / function, which has improved anti-tumor activity (relative to ATG wild-type T cells) for treating cancers that express α-FR, including but not limited to ovarian cancer, breast cancer, and lung cancer.

[0032] In one aspect, the αFR-CAR sequence for knock-in is targeted to intron 2 of the ATG5 locus. In one aspect, αFR-CAR is introduced by any suitable method (e.g., by electroporation or a suitable lentiviral vector or retroviral vector), and then ATG5 is knocked out. In some such aspects, ATG5 is knocked out at exon 4 or exon 5 of the ATG5 locus.

[0033] In one aspect, the sgRNA construct designed for CRISPR-Cas9-mediated knock-in to the ATG5 locus has a nucleotide sequence of SEQ ID NO: 1 to 7 or 24 to 25.

[0034] In one aspect, the primary T cells for generating CAR-T knock-in at the locus of various ATG genes of the present invention can be induced pluripotent stem cells, CD34+, CD4+, or CD8+ T cells.

[0035] In one aspect, more than one ATG locus / gene (i.e., two or more different ATG genes) can be simultaneously edited for knock-in of a specific CAR sequence / construct to improve anti-tumor efficacy.

[0036] In one aspect, the αFR-CAR sequence for knock-in is targeted to an intron or exon other than intron 2 of the ATG5 locus / gene (i.e., exon 1, 2, 3, 4, etc.).

[0037] Other aspects of the invention will become apparent by considering the following description of some preferred embodiments of the invention. Those skilled in the art will recognize that other embodiments of the invention are possible and that details of the invention can be modified in many ways, all without departing from the concept of the invention. Accordingly, the drawings, the following description, and the examples are to be regarded as illustrative in nature and not restrictive. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Some exemplary embodiments are illustrated by way of example in the figures of the accompanying drawings. The embodiments disclosed herein and the drawings are intended to be illustrative rather than restrictive.

[0039] Figure 1 is a schematic diagram schematically showing an exemplary embodiment of a chimeric antigen receptor (CAR).

[0040] Figure 2 is a schematic diagram of an embodiment in which DNA encoding a CAR has been inserted at a locus in the genome of a cytotoxic lymphocyte at a location other than the locus of an autophagy gene that has been disrupted.

[0041] Figure 3 is a schematic diagram of an embodiment in which DNA encoding a CAR has been inserted at the locus of an autophagy gene within the genome of a cytotoxic lymphocyte.

[0042] Figure 4 shows an exemplary embodiment of a method for generating genetically modified lymphocytes for immunotherapy.

[0043] Figure 5 shows another exemplary embodiment of a method for generating genetically modified lymphocytes for immunotherapy.

[0044] Figure 6 shows another exemplary embodiment of a method for generating genetically modified lymphocytes for immunotherapy.

[0045] Figure 7 , columns A to E, shows the results of an example demonstrating that autophagy enhances anti-tumor immunity and that this effect is T cell-dependent.

[0046] Figure 8 , columns A to K, shows the metabolomics of Atg5 - / - CD8+ T cells.

[0047] Figure 9 , columns A and B, show the results of an example demonstrating that Atg5 deficiency leads to increased effector memory CD8+ T cells.

[0048] Figure 10 , columns A to E, show an example of the results demonstrating that Atg5 - / - CD8+ T cells have enhanced anti-tumor function.

[0049] Figure 11 , columns A to J, show the experimental results demonstrating that Atg5 - / - T cells have changes in histone trimethylation and increased methylation at immune response gene loci.

[0050] Figure 12 , columns A to I, show the CRISPR-Cas9 strategy and verify its successful implementation for gene editing at the ATG5 locus to target CAR to the ATG5 locus, along with functional knockout of ATG5 and targeting integration of a gene capture vector using CRISPR-Cas9.

[0051] Figure 13 Show the experimental results demonstrating the delivery of Cas9 RNP targeting ATG5 in primary T cells.

[0052] Figure 14 Show the expression of an exemplary αFR-CAR construct on human T cells.

[0053] Figure 15 , columns A to E, show the experimental results demonstrating the effective targeting of ATG5 and AAVS1 in CD34+ hematopoietic stem cells and activated CD8+ T cells.

[0054] Figure 16 Show the incorporation of the desired αFR-CAR targeting ATG5 into intron 2 of ATG5 in CD8+ T cells.

[0055] Figure 17 Show a strategy for incorporating the desired αFR-CAR construct transduced by a lentiviral vector into the T cell genome, followed by electroporation of ATG5 sgRNA into exon 4 or exon 5 of the ATG5 gene to knockout ATG5. Column A shows the strategy for incorporating the construct into T cells and knocking out ATG5. Column B shows the results of TIDE analysis demonstrating a successful deletion at exon 4 of ATG5. Detailed Description

[0056] Throughout the following description, specific details are set forth in order to provide a more thorough understanding of the present invention. However, the present invention may be practiced without these details. In other instances, well-known elements have not been shown or described in detail to avoid unnecessarily obscuring the present invention. Accordingly, the specification and drawings are to be regarded in an illustrative rather than a restrictive sense.

[0057] The present inventors have now discovered methods and compositions for improving the anti-tumor efficacy of lymphocytes that have been used, for example, in chimeric antigen receptor (CAR) T cell therapy or T cell receptor-engineered T cell therapy. Gene editing methods have been developed for eliminating autophagy gene expression in lymphocytes (including CAR-T cells) to enhance the therapeutic efficacy of the cells (including against solid tumors). In some embodiments, the gene editing methods cause engineered lymphocytes (e.g., CAR-T cells) to specifically target the alpha-folate receptor (αFR) to improve their effectiveness in treating cancers that express αFR (e.g., ovarian cancer, breast cancer, and lung cancer).

[0058] In one aspect, the present inventors designed a novel CRISPR-Cas9 gene editing strategy to engineer autophagy-deficient lymphocytes, including CAR-T cells, against the ovarian cancer antigen folate receptor alpha (αFR) as an exemplary tumor-specific antigen. By using a gene-trap method to target the αFR chimeric antigen receptor (CAR), as an exemplary antigen-targeting receptor, to the locus of an exemplary autophagy gene (autophagy-related gene 5 (ATG5)), the present inventors disrupted autophagy while placing the CAR under the control of the endogenous ATG5 promoter. Thus, the expression of the CAR is upregulated in hypoxic and stress regions (e.g., in the solid tumor microenvironment).

[0059] Without being bound by theory, it is believed that placing an antigen-targeting receptor (e.g., a CAR construct or an engineered T cell receptor (TCR) construct) under the control of a promoter that induces stress-responsive expression (e.g., an endogenous autophagy gene promoter) means that the expression level of the antigen-targeting receptor (e.g., CAR or TCR) will be low in the peripheral body but will increase in the tumor microenvironment. This can potentially reduce the toxicity associated with high doses of cells that express the antigen-targeting receptor (e.g., CAR-T cells). For example, ATG5 is constitutively expressed at a low level, but its stress-responsive expression level is increased.

[0060] Furthermore, without being bound by theory, autophagy-deficient murine T cells do not generate memory following in vivo infection (25). Without being bound by theory, this can be beneficial for the safety of treatments using genetically modified lymphocytes, as they will die after the modified cells reach peak responsiveness (i.e., because no memory is formed), thereby clearing all genetically modified lymphocytes from the subject. This provides a safety measure in the administration of treatments to patients.

[0061] In one embodiment, the inventors have determined that Atg5-deficient mice have significantly enhanced anti-tumor activity against hormone-insensitive prostate and estrogen-positive breast tumor cell lines. This anti-tumor response is T cell-dependent and can be fully replicated in animals deficient in other Atg genes (e.g., Atg14, ATG16L1). When Atg5-deficient T cells were used in adoptive T cell therapy experiments, the inventors observed a therapeutic effect on tumors when compared to wild-type CD8+ T cells. Thus, it has been shown that loss of T cell-intrinsic ATG5 or other autophagy genes results in enhanced anti-tumor immune responses.

[0062] Despite the defects in Atg5 loss in other immune subsets, including antigen-presenting cells, without being bound by theory, specific loss of autophagy in T cells can have several benefits for T cell therapy. Atg5 - / - T cells from tumor-bearing mice have been found to have a high rate of glycolysis and a low rate of oxidative metabolism. This can be a metabolic advantage, as increased glucose metabolism can make tumor-infiltrating lymphocytes (TILs) more competitive for glucose. These metabolic changes are associated with skewing of Atg5 - / - T cells towards effector cells with enhanced antigen-specific T cell responses. Without being bound by theory, Atg5 - / - Reduced T cell proliferation can have an unexpected benefit. Since Atg5 - / - T cells are highly antigen-specific, fewer cells will be required for infusion to achieve an equivalent anti-tumor response and the recipient patient may not require lymphocyte depletion, which is a procedure that can have a significant risk of adverse events. Atg5 - / - Another characteristic of Atg5 T cells is a metabolism-dependent change in histone trimethylation at specific loci of immune response genes and increased transcriptional expression of those targets.

[0063] Such benefits provided by suppressed autophagy genes can extend to other lymphocytes and other cells involved in tumor killing. Some examples of such cells include NK cells; multiple types of T cells including CD34+, CD4+ or CD8+ T cells, Treg cells, tissue-resident memory T cells (TRM cells), natural killer T (NKT) cells; B cells, etc. These cells function through similar mechanisms of recognizing antigens (such as tumor-specific antigens on the surface of tumor cells) and playing a role in killing such tumor cells. Without being bound by theory, inhibiting autophagy in such cells can enhance effector anti-tumor activity through a metabolomic shift to more glycolysis and more IFNγ secretion. Similarly, in the case of Treg cells, inhibition of autophagy can also lead to the loss of inhibitory function against effector T cells.

[0064] In some embodiments, engineered lymphocytes with one or more disruptions in autophagy genes or otherwise inhibiting autophagy genes are provided, such as CAR T cells. In some embodiments, disruption of the autophagy gene inhibits or eliminates the expression of the autophagy gene. In some embodiments, the "knock-in" genetic engineering strategy is used to provide disruption of the autophagy gene. In some embodiments, disruption of the autophagy gene is provided by using the knockout genetic engineering strategy. In some alternative embodiments, any desired strategy can be used to inhibit one or more autophagy genes in lymphocytes (such as CAR T cells). Similarly, any suitable genetic engineering strategy can be used to make the engineered lymphocytes (such as CAR T cells) express the desired antigen-targeting receptor, such as a chimeric antigen receptor (CAR) or an engineered T cell receptor. For example, cells can be transduced with a viral vector (such as a lentiviral vector or a retroviral vector) to introduce a nucleotide construct encoding a CAR or an engineered T cell receptor into the cells. In some embodiments, the CRISPR-Cas9 gene editing system (which includes the CRISPR-Cas gene editing system using any suitable Cas protein (such as Cas9, Cas12a, etc.)) or other similar gene editing techniques can be used to disrupt the autophagy gene and / or introduce the antigen-targeting receptor construct into the cells for expression. In some embodiments, a combination of different genetic engineering techniques can be used to both disrupt the autophagy gene and introduce the CAR construct into T cells for expression. In some embodiments, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), Sleeping Beauty (SB), RNAi, meganucleases, megaTALs or other gene knockout methods can be used to disrupt or inhibit the autophagy gene.

[0065] In some embodiments, the engineered lymphocytes (e.g., CAR T cells) express an antigen-targeting receptor that is selective for a tumor-specific antigen, such as a chimeric antigen receptor (CAR) or an endogenous or engineered T cell receptor. In some embodiments, the tumor-specific antigen is alpha-folate receptor (α-FR), which is an antigen highly expressed in certain types of cancer, including ovarian cancer, breast cancer, and lung cancer, but not expressed at high levels in normal cells. In some embodiments, the tumor-specific antigen is folate receptor (FR), beta-folate receptor, gamma-folate receptor, CD19, CD20, BCMA, Her2, EGFRvIII, or prostate-specific membrane antigen (PSMA). In some embodiments, the tumor-specific antigen is folate receptor (FR), alpha-folate receptor, beta-folate receptor, gamma-folate receptor, CD19, CD20, CD133, CD138, CEA, Claudin 18.2, EGFR, EGFRvIII, EphA2, EpCAM, GD2, GPC3, HER2, MSLN, MG7, MUC1, NY-ESO-1, LMP1, PSMA, Fra, NKG2D1, BCMA, IL13Rα2, LeY, CD70, B7-H3, ROR1, PSCA, etc. In some alternative embodiments, the tumor-specific antigen targeted by the antigen-targeting receptor can be any desired tumor-specific antigen. A non-exhaustive list of some exemplary tumor-specific antigens being evaluated for the treatment of certain cancers is given in Table 1. In some embodiments, the cancer is B-cell acute lymphoblastic leukemia (B-ALL), chronic lymphocytic leukemia (CLL), B-cell lymphoma, or other lymphoid malignancies, liver cancer, pancreatic cancer, brain cancer, breast cancer, ovarian cancer, colorectal cancer, acute myeloid leukemia (AML), multiple myeloma, lung cancer, gastric cancer, glioma, EGFR-positive solid tumors, glioblastoma multiforme, gastric cancer, nasopharyngeal cancer, esophageal cancer, prostate cancer, neuroblastoma, hepatocellular carcinoma, squamous cell lung cancer, MSLN-positive solid tumors, non-small-cell lung carcinoma (NSCLC), triple-negative breast cancer (TNBC), sarcoma, advanced solid tumors, renal cell carcinoma, central nervous system cancer, or ROR1-positive malignancies.

[0066] Table 1. Some exemplary tumor-specific antigens that can be targeted with antigen-targeting receptor constructs (e.g., CARs).

[0067]

[0068]

[0069]

[0070] In some embodiments, a knock-in strategy is used to insert an antigen-targeting receptor (e.g., a CAR construct or an endogenous or engineered T cell receptor (TCR) construct) into the locus of an autophagy gene to be inhibited. This places the antigen-targeting receptor (e.g., a CAR construct or a TCR construct) under the control of the endogenous promoter of the autophagy gene. In some embodiments, the antigen-targeting receptor (e.g., a CAR construct or a TCR construct) is inserted into the genome of a lymphocyte (e.g., a T cell) at a locus other than the autophagy gene to be inhibited. In some such embodiments, the expression of the antigen-targeting receptor (e.g., a CAR construct or a TCR construct) is controlled by a heterologous promoter. In some embodiments, the antigen-targeting receptor (e.g., a CAR construct or a TCR construct) is inserted together with a desired heterologous promoter to control the expression of the antigen-targeting receptor (e.g., a CAR or a TCR) by lymphocytes (e.g., T cells) under the control of the heterologous promoter. In some embodiments, the antigen-targeting receptor (e.g., a CAR or a TCR construct) is placed under the control of a promoter that increases the expression of the antigen-targeting receptor in response to stress. In some embodiments, the promoter that increases the expression of the antigen-targeting receptor in response to stress is the promoter of an autophagy gene.

[0071] In some embodiments, lymphocytes are engineered to express an endogenous or engineered T cell receptor instead of a CAR as the antigen-targeting receptor. Currently, TCR-engineered T cells are being developed for various types of immunotherapy, including the treatment of solid tumors, and can be used in a manner similar to CAR-T cells to specifically target and kill cells expressing a specific antigen (e.g., a tumor-specific antigen).

[0072] In some embodiments, the autophagy gene (ATG) inhibited in lymphocytes is any gene now known or later discovered to be essential for autophagy. In some embodiments, the autophagy gene is one or more of ATG1, ATG4, ATG5, ATG7, ATG8, ATG13, ATG18, ATG16L1, and GABARAP. In some embodiments, the autophagy gene is one or more of ULK1, ULK2, ULK3, FIP200, Vps34, Beclin-1, p150, UVRAG, ATG1, ATG4, ATG5, ATG7, ATG8, ATG9, ATG10, ATG12, ATG13, ATG14L, ATG16L, ATG16L1, ATG18, VMP1, GABARAP, etc.

[0073] In some embodiments, the CAR construct has a targeting moiety, a transmembrane domain, and a CD3ζ intracellular domain. In some embodiments, the targeting moiety is an antigen-binding fragment of an antibody. In some embodiments, the targeting moiety is the ScFV of an antibody. In some alternative embodiments, any CAR construct now known or later developed can be used.

[0074] In some alternative embodiments, an engineered T cell receptor is used as an antigen-targeting receptor. An example of an engineered T cell receptor has an α chain and a β chain, each containing a variable domain (v) and a constant domain (c), as well as a transmembrane domain and six CD3 chains for T cell activation. In some alternative embodiments, any T cell receptor construct now known or later developed can be used.

[0075] An exemplary embodiment of a CAR construct 30 for some embodiments is shown in Figure 1 The CAR construct has a targeting moiety 32, such as a suitable ScFV targeting a desired tumor-specific antigen, a transmembrane domain 34, and a CD3ζ intracellular domain 38. In some embodiments, the CAR construct 30 can have other domains, such as a suitable co-stimulatory domain 36 (e.g., CD27, CD28, 4-1BB, ICOS, OX40, MYD88, IL1R1, CD70, etc.) or other domains designed to enhance the characteristics of the CAR construct.

[0076] Figure 2An exemplary embodiment of a modified lymphocyte 50 is schematically shown. The modified lymphocyte 50 has been genetically modified to inhibit one or more genes required for autophagy at locus 52 of the lymphocyte genomic DNA. The genes required for autophagy are under the control of the endogenous promoter 56. The modified lymphocyte 50 has also been genetically modified to express a desired antigen-targeting receptor construct at locus 54 of the lymphocyte genomic DNA that is different from locus 52. Expression of the antigen-targeting receptor construct from locus 54 is under the control of promoter 58, which can be an endogenous promoter in some embodiments or a heterologous promoter in some embodiments.

[0077] Figure 3 An exemplary embodiment of a modified lymphocyte 70 is schematically shown. The modified lymphocyte 70 has been genetically modified to both inhibit one or more genes required for autophagy at locus 72 of the lymphocyte genomic DNA and express a desired antigen-targeting receptor construct. For example, a knock-in strategy can be employed to disrupt the genes required for autophagy and insert the desired antigen-targeting receptor construct at locus 72 of the lymphocyte genomic DNA. In this embodiment, expression of the desired antigen-targeting receptor construct from locus 72 is under the control of the endogenous promoter 76 of the gene required for autophagy.

[0078] According to any other embodiment, the modified lymphocytes 50, 70 or the modified lymphocytes (including modified T cells) can be prepared by any suitable genetic modification techniques known to those skilled in the art now or available later. In Figure 4 an exemplary embodiment shown, a method 100 for generating modified lymphocytes (such as T cells) by using a gene editing strategy to insert a desired antigen-targeting receptor construct at the locus of the autophagy gene to be disrupted is shown. In step 102, the desired lymphocytes, such as T cells, are obtained from a cell source. The cell source can be any suitable source, such as a subject to whom immunotherapeutic lymphocytes are to be administered, a healthy donor, a pluripotent stem cell line, etc. In some embodiments, the lymphocytes are autologous cells, i.e., the lymphocytes are obtained from the subject to be treated. In some embodiments, the lymphocytes are allogeneic, i.e., obtained from a cell source other than the subject to be treated, such as a healthy donor or a cell line such as induced pluripotent stem cells. Lymphocytes from any source known or discovered now or later can be used in certain embodiments.

[0079] In step 104, lymphocytes are genetically engineered to insert DNA encoding an antigen-targeting receptor construct into the lymphocyte genomic DNA and to inhibit the function of at least one autophagy gene. In some embodiments, step 104 is performed using a CRISPR-Cas gene editing strategy by designing a suitable sgRNA to insert the antigen-targeting receptor construct at a suitable location within the autophagy gene such that the antigen-targeting receptor construct can be inserted using a knock-in strategy while simultaneously inhibiting the autophagy gene. The sgRNA, DNA encoding the antigen-targeting receptor construct, and Cas protein (such as Cas9) are delivered to the lymphocytes in any suitable manner, such as by electroporation or chemical transfection techniques, or other suitable techniques (as appropriate), such as using a lentivirus-, adenovirus-, or adeno-associated virus-based delivery system to deliver to the lymphocytes.

[0080] In step 106, the genetically engineered lymphocytes in which the antigen-targeting receptor construct has been successfully inserted into the correct locus are amplified. In step 108, the engineered lymphocytes are introduced into a subject as an immunotherapeutic agent.

[0081] Figure 5 An alternative embodiment of method 150 for generating modified lymphocytes (such as T cells) for immunotherapy is shown. In step 152, lymphocytes are obtained from a cell source in a similar manner as described for step 102. In step 154, lymphocytes (such as T cells) are genetically engineered in any suitable manner to inhibit one or more autophagy genes. Some examples of techniques that can be used to inhibit autophagy genes include elimination by gene knockout techniques using CRISPR-Cas, TALEN, ZFN, SB, meganucleases, megaTAL, or inhibition by gene knockdown using RNAi or other suitable techniques.

[0082] In step 156, in some embodiments, the genetically engineered lymphocytes in which the autophagy gene has been inhibited are amplified. In step 158, the lymphocytes are introduced into a subject as an immunotherapeutic agent.

[0083] Figure 6Shows an alternative embodiment of method 170 for generating modified lymphocytes (e.g., T cells) for immunotherapy. Steps 172 and 174 are carried out in a manner similar to steps 152 and 154 of method 150 to generate lymphocytes, e.g., T cells, genetically engineered to inhibit one or more autophagy genes. In step 176, the lymphocytes (e.g., T cells) are further genetically engineered in any suitable manner to express a desired antigen-targeting receptor, such as a CAR construct or an engineered T cell receptor construct. Some examples of techniques that can be used to engineer lymphocytes (e.g., T cells) to express a desired antigen-targeting receptor (e.g., a CAR construct or an engineered T cell receptor) include the CRISPR-Cas editing system or transduction with a suitable lentiviral or retroviral vector. In step 178, lymphocytes, e.g., T cells, that have been genetically engineered to have inhibited autophagy genes and to express a desired antigen-targeting receptor (e.g., a CAR construct or an engineered T cell receptor) are amplified. In step 180, the amplified cells are introduced into a subject as an immunotherapeutic agent. In some alternative embodiments, the order of performing steps 174 and 176 can be reversed, i.e., the lymphocytes (e.g., T cells) can first be engineered to express a desired antigen-targeting receptor (e.g., a CAR construct or an engineered T cell receptor) and then be engineered to inhibit one or more autophagy genes.

[0084] In some embodiments, the genetically engineered lymphocytes (e.g., T cells) are used as an immunotherapeutic agent to treat cancer. In some embodiments, the cancer is ovarian cancer, breast cancer, or lung cancer. In some embodiments, the cancer is B cell acute lymphoblastic leukemia (B-ALL), chronic lymphocytic leukemia (CLL), B cell lymphoma, or other lymphoid malignancies, liver cancer, pancreatic cancer, brain cancer, breast cancer, ovarian cancer, colorectal cancer, acute myeloid leukemia (AML), multiple myeloma, lung cancer, gastric cancer, glioma, EGFR-positive solid tumors, glioblastoma multiforme, gastric cancer, nasopharyngeal cancer, esophageal cancer, prostate cancer, neuroblastoma, hepatocellular carcinoma, squamous cell lung cancer, MSLN-positive solid tumors, non-small cell lung cancer (NSCLC), triple-negative breast cancer (TNBC), sarcoma, advanced solid tumors, renal cell cancer, central nervous system cancer, or ROR1-positive malignancies. The genetically engineered lymphocytes (e.g., T cells) can be administered to the subject in any suitable manner, such as by intravenous infusion.

[0085] In some embodiments in which the CRISPR-Cas strategy is used to introduce an antigen-targeting receptor construct into lymphocytes for expression, the CRISPR-Cas strategy is also used to simultaneously inhibit the expression of autophagy genes. Those skilled in the art can develop suitable single guide RNAs (sgRNAs) to achieve insertion of an antigen-targeting receptor (e.g., a CAR) at a desired location in the lymphocyte genome. In some embodiments, the CRISPR-Cas strategy is used to insert an antigen-targeting receptor (e.g., a CAR) into the locus of the ATG5 gene in the lymphocyte genome. In some embodiments, the CRISPR-Cas strategy is used to insert an antigen-targeting receptor (e.g., a CAR) into intron 2 of the ATG5 gene. In some embodiments, the CRISPR-Cas strategy is used to disrupt the ATG5 gene at exon 4 or exon 5 of the ATG5 gene while inserting the antigen-targeting receptor at a different locus within the genome, such as by transduction using a suitable lentiviral, retroviral, or adeno-associated viral vector. In some embodiments, the CRISPR-Cas strategy is used to insert DNA encoding a modified T cell receptor rather than DNA encoding a CAR.

[0086] In one exemplary embodiment, the sgRNA for targeting intron 2 of ATG5 has a sequence of one of SEQ ID NOs: 1 to 7 listed in Table 2. In one exemplary embodiment, the sgRNA for targeting exon 4 of ATG5 has the sequence of SEQ ID NO: 24. In one exemplary embodiment, the sgRNA for targeting exon 5 of ATG5 has the sequence of SEQ ID NO: 25.

[0087] In one exemplary embodiment, the nucleotide construct for inserting a CAR into T cells has one of SEQ ID NO: 8 or SEQ ID NO: 9.

[0088] Examples

[0089] Certain embodiments are further described with reference to the following examples, which are intended to be illustrative in nature and not limiting. Although the following examples demonstrate inhibition of autophagy genes and expression of CARs in T cells, the techniques described below are equally applicable to genetically modifying other types of lymphocytes to inhibit the expression of autophagy genes and express a desired CAR or modified T cell receptor.

[0090] The inventors designed and tested several single-guide RNAs (sgRNAs) targeting the locus of autophagy-related gene 5 (ATG5), and quantified indel formation by sequencing and mismatch cleavage assays. The inventors optimized the conditions for homology-directed repair (HDR) in K562 cells using a fluorescent reporter construct. Construct integration and autophagy activity were evaluated using out-out polymerase chain reaction (PCR) and Western blotting. To determine the transfection parameters that would result in optimal editing and expansion in human T cells, the inventors subsequently performed a series of electroporations with sgRNAs and recombinant Cas9 protein. The inventors combined these electroporation parameters with adeno-associated virus (AAV) vectors to target the αFR chimeric receptor to the locus of ATG5 in healthy donor T cells.

[0091] The inventors observed a loss of functional autophagy in clones with donor integration. In addition, the inventors confirmed that these results were due to on-target editing by delivering ATG5 cDNA to the intergenic locus and restoring autophagy function. After screening multiple transfection parameters (cell density, RNP concentration, electroporation pulse code, and addition of anionic polymers), the inventors determined a set of RNP delivery conditions that resulted in more than 80% indel formation in healthy donor T cells. The inventors combined these parameters with an AAV vector encoding the αFR CAR and successfully generated 24.1% of ATG5 - / - αFR-CAR-T cells.

[0092] Figure 7 The results of experiments showing that the loss of autophagy enhances anti-tumor immunity and is T cell-dependent are presented. The inventors generated inducible Cre-ERT2 mice to delete Atg5 in all tissues after tamoxifen injection. Four days after tamoxifen treatment, e0771 mammary (Figure A) or TRAMP-C2 prostate (Figure B) tumor cell lines were subcutaneously injected, and tumor volume was measured over time. n = 12 to 13 mice / group.

[0093] Figure C shows that the enhancement of anti-tumor immunity dependent on Atg14, an autophagy gene, is cell-intrinsic to T cells. The inventors performed bone marrow chimera experiments in which wild-type (WT) mice were reconstituted with Atg5 - / - or Atg5 + / - bone marrow (BM). Atg5- / - BMC mice exhibited enhanced tumor rejection. n = 10 mice / group. Experiments were performed using Atg14 - / - or Atg14 + / - BM in similar experiments (data not shown).

[0094] Figure D shows that antibody depletion of CD8+ T cells (achieved using anti-CD8 antibody) led to loss of tumor control in Atg5 - / - mice. n = 4 - 7 mice / group. ****p < 0.0001, two-way ANOVA. Error bars represent + / -SEM. Figure E shows adoptive transfer of naive CD8+ Atg5-deficient (AA) or Atg5 wild-type (Aa) T cells into EG7 tumor-bearing mice. Tumors were implanted and donor T cells (ACT) were transferred on day 11. ****p < 0.0001, Student t test. Error bars represent + / -SD.

[0095] Figure 8 shows the results of experiments evaluating the metabolomics of Atg5 - / - CD8+ T cells and showing that Atg5 - / - CD8+ T cells glycolyze more. *p < 0.01, **p < 0.01, ***p < 0.001, ****p < 0.001. Figure A shows the relative lactate levels determined by metabolomics. Error bars represent + / -SD. Figure B shows the oxygen consumption rate (OCR) results of CD8+ T cells isolated from the spleens of e0771 tumor-bearing mice and subjected to Seahorse Bioanalyzer in the presence or absence of oligomycin, FCCP, and antimycin / rotenone (Ant / Rot). Data were normalized relative to protein concentration. Error bars represent + / -SEM. Atg5 + / - and Atg5 - / - CD8+ T cells were examined for OCR (Figure C), extracellular acidification rate (ECAR) (Figure D), and OCR:ECAR (Figure E) ratios at the basal level. Atg5 - / - T cells exhibited increased oxygen consumption rate and increased extracellular acidification rate.

[0096] The left panel of Figure F shows a representative flow cytometry plot showing Atg5 from the spleens of e0771 tumor-bearing mice + / - (lower trace) and Atg5 - / -(Upper trace line) Fluorescent glucose analog 2-NBDG uptake in CD8+ T cells. The graphs in the right half of Figure F show the mean fluorescence intensity (MFI) of 2-NBDG + / - SEM, where Atg5 - / - showed significantly higher fluorescence and thus had higher glucose uptake.

[0097] Figure G shows the quantitative RT-PCR of Hxk2 expression in Atg5 + / - and Atg5 - / - CD8+ T cells. Results were normalized to Actb. Data are represented as mean + / - SEM. Figure H shows spare respiratory capacity, which is represented by subtracting the baseline OCR from the maximal OCR, and Figure I shows mitochondrial mass measured by Mito Tracker Green, as determined in Atg5 + / - and Atg5 - / - CD8+ T cells isolated from e0771 tumor-bearing mice. Data are represented as mean + / - SEM. n = 4-5 mice / group.

[0098] Figure J shows the T metabolomics analysis of cells harvested from tumor-bearing Atg5 - / - (n = 5) or Atg5 + / - (n = 4) mice at day 14 (10,000 cells) after tumor implantation. Figure K shows the volcano plot analysis, which reveals a significant increase in glycolysis (e.g., lactate) accompanied by a decrease in oxidative metabolism (e.g., glutamate, aspartate).

[0099] Figure 9 shows the results of experiments demonstrating that Atg5 deficiency leads to an increase in effector memory CD8+ T cells. Figure A shows a representative flow cytometry plot, which shows naive (CD62LhiCD44lo), central memory (CD62LhiCD44hi), and effector memory (CD62LloCD44hi) CD8+ T cells isolated from the blood (left), spleen (middle), and tumor (right) of e0771 tumor-bearing mice. Figure B shows the percentage of CD62LloCD44hi effector memory CD8+ T cells in the blood, spleen, and tumor of e0771 tumor-bearing mice. *p < 0.05, **p < 0.01.

[0100] Refer to Figure 10 and the present inventors conducted experiments demonstrating that Atg5 - / - CD8+ T cells have enhanced anti-tumor function. The left two images in Figure A show representative flow cytometry plots, which show Atg5 + / - and Atg5- / - IFNγ and TNFα expression after PMA / ionomycin stimulation of CD8+ T cells. The graphs shown on the right side of Figure A represent the percentage of IFNγ+TNFα+CD8+ T cells + / - SEM in e0771 and Tramp-C2 tumor-bearing mice, where Atg5 - / - The percentage of cells is higher. Figure B shows sera from e0771 or Tramp-C2 tumor-bearing mice analyzed by ELISA. The graphs represent the mean + / - SEM. Atg5 - / - The IFNγ levels in the mice are higher. Figure C shows splenocytes harvested from Atg5 + / - and Atg5 - / - e0771 tumor-bearing mice, which were stimulated with e0771 cells and subjected to IFNγ ELISPOT assay. Data are represented as mean + / - SEM. In another experiment, splenocytes harvested from Tramp-C2 tumor-bearing mice were stimulated with Tramp-C2 cells (Figure D) or Spas-1 peptide (Figure E) and subjected to IFNγ ELISPOT assay. Data are represented as mean + / - SEM. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. An increase in TNFα and IFNγ was observed in Atg5 - / - T cells.

[0101] Reference Figure 11 , the present inventors conducted experiments to show that Atg5 - / - T cells have changes in histone trimethylation and increased methylation at immune response gene loci. Figure A shows pathways and gene ontology analysis of H3K4me3-marked promoters unique to Atg5 + / - CD8+ T cells, which are strongly enriched in genes related to T cell activation and adaptive immunity (Benjamini q value < 10e-12) compared to Atg5 - / - CD8+ T cells. Figure B shows the differential normalized marker density of H3K27me3 and H3K4m3 in a subset of immune response genes. Figures C and D show ChIP-Seq of H3K4me3 for Atg5 + / - and Atg5 - / - CD8+ T cells for Ifng. Figure C shows the normalized marker density of Ifng in knockout or control CD8+ T cells. Figure D shows quantitative RT-PCR of Ifng expression in Atg14 + / - and Atg14 - / - CD8+ T cells. The results are related to Actb. Data are represented as the mean + / - SEM of three replicate experiments with at least 2 mice / group. Figures E to G show ChIP-Seq of H3K4me3 for Atg5 + / -and Atg5 - / - ChIP-Seq for H3K4me3 was performed on CD8+ T cells. Figure E shows the normalized tag density of Glut1 in knockout or control CD8+ T cells. Figure F shows Atg5 + / - and Atg5 - / - CD8+ T cells or (Figure G) Atg14 + / - and Atg14 - / - Quantitative RT-PCR of Glut1 expression in CD8+ T cells. Results were normalized to Actb. Data are represented as the mean ± SEM of three replicate experiments with at least 2 mice / group. Figures H to J show the quantification of Atg5 + / - and Atg5 - / - ChIP-Seq for H3K4me3 was performed on CD8+ T cells. Figure H shows the normalized tag density of Hk2 in knockout or control CD8+ T cells. Figure I shows Atg5 + / - and Atg5 - / - CD8+ T cells or (Figure J) Atg14 + / - and Atg14 - / - Quantitative RT-PCR of Hk2 expression in CD8+ T cells. Results were normalized to Actb. Data are represented as the mean ± SEM of three replicate experiments with at least 2 to 3 mice / group. *p < 0.01, **p < 0.01, ****p < 0.001, n.s. not significant.

[0102] Reference Figure 12 , a CRISPR-Cas9 strategy for targeting CAR to the ATG5 locus and validation of gene editing at the ATG5 locus were developed. Concomitant functional knockout of ATG5 and targeted integration of a gene trapping vector using CRISPR-Cas9 were confirmed. Figure A shows a schematic of the ATG5 locus and the regions screened to identify functional SpCas9-sgRNAs. Exons E2 and E3 of the ATG5 gene are shown as open boxes. The genomic structure and target regions within intron 2 (I2) of ATG5 are illustrated schematically. A, B, and C represent non-repetitive target DNA sequences for designing sgRNAs using the online CRISPOR tool. Intron 2 was selected as the preferred target region because all reported mRNA isoforms of ATG5 contain this region (i.e., this ensures that all potential transcripts are captured).

[0103] Figure 12 Figure B of

[0104] Table 2. Exemplary sgRNA sequences for ATG5 ablation by intron 2 insertion.

[0105] Locus Name DNA Sequence (5’-3’) SEQ ID NO I2A Target 719 GCTACGGAAAGTCAGATTAC SEQ ID NO: 1 I2A Target 696 GTAATCTGACTTTCCGTAGC SEQ ID NO: 2 I2A Target 824 GCACCGAGTAGTACCACTTG SEQ ID NO: 3 I2A Target 950 AAGTTCGGCAATCTTGTTAC SEQ ID NO: 4 I2B Target 905 CGGATCGCTGCCTAATGTTA SEQ ID NO: 5 I2B Target 945 CCGTTTATGTATCCTTAGTC SEQ ID NO: 6 I2C Target 710 GTCACGTTCTCCTACCTAGT SEQ ID NO: 7

[0106] Figure 12 Figure C shows the identification of active sgRNAs using the Surveyor nuclease assay. In this assay, a mismatch-sensitive nuclease is used to determine the frequency of small insertions and deletions (indels) indicative of nuclease activity. As an example, sgRNA 824 was shown to be the most active nuclease for the I2A portion of intron 2 and was selected for further experiments.

[0107] Figure 12 Figure D shows a schematic of the ATG5 locus after addition of the CAR. The first and second schematics show the genomic structure of the CAR-T integration site and the donor template. The positions of the splice acceptor site (SA), 2A self-cleaving peptide sequence (2A), polyadenylation sequence (pA), and left and right homology arms (HA-L, HA-R) are shown. The third schematic shows the integrated CAR construct at the ATG5 locus.

[0108] Figure 12 Figure E shows out-out PCR, which shows the integration of the test SA-2A-mScarlet-pA reporter sequence in intron 2 of ATG5. Complete integration at all alleles was observed for K562 clones 5, 6, 7, 8, 10. Figure F is a Western blot, which shows that the loss of ATG5 in K562 clones correlates with complete integration of the mScarlet construct (i.e., loss of ATG5 was observed for clones 5, 6, 7, 8, 10). Figure G is an immunofluorescence image of K562 cells showing nuclear staining (left) and mScarlet expression (right), which shows good expression of the mScarlet reporter construct. Figure H is a Western blot, which shows the response to treatment with hydroxychloroquine and / or rapamycin. Loss of LC3-II indicative of inhibited autophagic flux was observed in K562 clones 5, 6, 7 (clones 8 and 10 were not tested). Figure I is a Western blot, which shows that autophagy was restored for clones (clones 5.1, 5.3, and 5.6) in which ATG5 cDNA was targeted to the intergenic locus (AAVS1) to restore ATG5 expression, as confirmed by the return of LC3-II.

[0109] Figure 13Shows the experimental results demonstrating the delivery of Cas9 RNP targeting ATG5 in primary T cells. Using amaxa 4D Nucleofector, purified CD3 cells stimulated with CD3 / CD28 beads were electroporated with recombinant SpCas9 complexed with a chemically modified sgRNA (824). Two different pulses were tested. Genomic DNA was extracted 3 days after transfection and a Surveyor assay was performed to determine the frequency of indels.

[0110] Figure 14 Shows the expression of an exemplary αFR-CAR (CD3zBB) from human CD8+ T cells transduced with lentivirus encoding the construct with GFP reporter. The left panel is the empty vector. The right panel is the αFR-CAR construct showing the expression of the desired protein on human T cells.

[0111] The sequences of the CAR constructs for inserting αFR-CAR at the ATG5 locus are given as SEQ ID NO: 8 and 9. The sequences of the CAR constructs for inserting αFR-CAR as a control within the AAVS1 locus are given as SEQ ID NO: 10 and 11. SEQ ID NO: 8 encodes a CAR construct with an anti-folate receptor ScFv, transmembrane domain, CD27 co-stimulatory domain, and CD3ζ intracellular domain. SEQ ID NO: 9 encodes a CAR construct with an anti-folate receptor ScFv, transmembrane domain, CD28 co-stimulatory domain, and CD3ζ intracellular domain. SEQ ID NO: 10 encodes a CAR construct with an anti-folate receptor ScFv, transmembrane domain, CD27 co-stimulatory domain, and CD3ζ intracellular domain. SEQ ID NO: 11 encodes a CAR construct with an anti-folate receptor ScFv, transmembrane domain, CD28 co-stimulatory domain, and CD3ζ intracellular domain.

[0112] Figure 15Shows efficient targeting of ATG5 and AAVS1 in CD34+ hematopoietic stem cells and activated CD8+ T cells (no donor CAR construct was present in these experiments). Figure A is a histogram showing the editing efficiency of ATG5 and AAVS1 in cord blood-derived CD34+ HSCs after electroporation with Cas9 protein and 100 to 300 pmol of the indicated sgRNA. Genomic DNA from each target region was amplified and sequenced, and sequence traces were analyzed using the decomposition algorithm TIDE. Figures B and C are flow cytometry dot plots showing 47.5% viability (ATG5) and 31.6% viability (AAVS1) in CD8+ T cells three days after electroporation with a ribonucleoprotein (RNP) complex consisting of Cas9 protein and sgRNA. Figures D and E are histograms showing 54.1% total editing efficiency of ATG5 and 53.9% total editing efficiency of AAVS1 in CD8+ T cells determined by TIDE analysis.

[0113] Figure 16 Shows validation of incorporation of the CAR construct into intron 2 of ATG5 in healthy donor T cells. CD8+ T cells were isolated from healthy donor PBMCs by magnetic bead separation, stimulated with TransAct (Miltenyi), and cultured in 100 U / ml IL-2. On day 4 after activation, the cells were electroporated with an RNP consisting of 100 pmol of sgRNA targeting ATG5 and 61 pmol Cas9 protein. Fifteen minutes after electroporation, C4-CD28-CD3z AAV (with SEQ ID NO: 9) was given at an MOI of 2e5. The cells were expanded for 13 days and then stained for flow cytometry on a Cytek Aurora. The results showed that 24.1% of the cells were the desired ATG5 - / - αFR-CAR-T cells.

[0114] Figure 17 Shows a strategy for incorporating the desired αFR-CAR transduced by a lentiviral vector into the T cell genome and subsequently electroporating an sgRNA targeting ATG5 into exon 4 or exon 5 of the ATG5 gene using the sgRNA sequences shown in Table 3. Figure A shows the strategy for incorporating the construct into T cells and eliminating ATG5 at exon 4 (target 56) or exon 5 (target 150). Figure B shows the results of TIDE analysis, which shows successful deletion at exon 4 of ATG5 using an sgRNA with the sequence of SEQ ID NO: 24 (target 56).

[0115] Table 3. Exemplary sgRNA sequences for ATG5 ablation by exon 4 or exon 5 insertion

[0116] Locus Name DNA Sequence (5’-3’) SEQ ID NO E4 Target 56 CATCAAGTTCAGCTCTTCCT SEQ ID NO: 24 E5 Target 150 GATCACAAGCAACTCTGGAT SEQ ID NO: 25

[0117] The foregoing examples demonstrate that a desired antigen-targeting receptor construct can be integrated into the genome of lymphocytes (e.g., T cells) at a locus in the lymphocyte genome, while autophagy genes, such as ATG5, can be knocked out at different loci using CRISPR-Cas gene editing.

[0118] References

[0119] The following references are relevant to the subject matter described herein. Each of the following references is hereby incorporated by reference in its entirety.

[0120] 1. Geyer MB, Brentjens RJ. 2016. Review: Current clinical applications of chimeric antigen receptor (CAR) modified T-cells. Cytotherapy 18:1393-409

[0121] 2. Kershaw MH, et al., 2006. A phase I study on adoptive immunotherapy using gene-modified T-cells for ovarian cancer. Clin Cancer Res 12:6106-15

[0122] 3. Zhao Z, et al., 2015. Structural Design of Engineered Costimulation Determines Tumor Rejection Kinetics and Persistence of CAR T-cells. Cancer Cell 28:415-28

[0123] 4. Milne K, et al., 2009. Systematic analysis of immune infiltrates in high-grade serous ovarian cancer reveals CD20, FoxP3 and TIA-1 as positive prognostic factors. PLoS One 4:e6412

[0124] 5. Cheung A, et al., 2016. Targeting folate receptor alpha for cancer treatment. Oncotarget

[0125] 6. Newick K, et al., 2017. CAR T-cell Therapy for Solid Tumors. Annu Rev Med 68:139-52

[0126] 7. Townsend KN, et al., 2013. Markers of T-cell infiltration and function associate with favorable outcome in vascularized high-grade serous ovarian carcinoma. PLoS One 8:e82406

[0127] 8. Vander Heiden MG, DeBerardinis RJ. 2017. Understanding the Intersections between Metabolism and Cancer Biology. Cell 168:657-69

[0128] 9. Chang CH, Pearce EL. 2016. Emerging concepts of T-cell metabolism as a target of immunotherapy. Nat Immunol 17:364-8

[0129] 10. Chang CH, et al., 2015. Metabolic Competition in the Tumor Microenvironment Is a Driver of Cancer Progression. Cell 162: 1229 - 41

[0130] 11. MacPherson S, et al., 2017. STAT3 regulation of citrate synthase is essential during the initiation of lymphocyte cell growth. Cell Rep 19(5): 910 - 918

[0131] 12. Ma EH, et al., 2017. Serine Is an Essential Metabolite for Effector T - cell Expansion. Cell Metab 25: 345 - 57

[0132] 13. Scharping NE, et al., 2016. The Tumor Microenvironment Represses T - cell Mitochondrial Biogenesis to Drive Intratumoral T - cell Metabolic Insufficiency and Dysfunction. Immunity

[0133] 14. Lum JJ, DeBerardinis RJ, Thompson CB. 2005. Autophagy in metazoans: cell survival in the land of plenty. Nat Rev Mol Cell Biol 6: 439 - 48

[0134] 15. Pua HH, He YW. 2009. Autophagy and lymphocyte homeostasis. Curr Top Microbiol Immunol 335: 85 - 105

[0135] 16. Schlie K, et al., 2015. Survival of effector CD8+ T-cells during influenza infection is dependent on autophagy. J Immunol 194: 4277-86

[0136] 17. Puleston DJ, et al., 2014. Autophagy is a critical regulator of memory CD8+ T-cell formation. Elife 3

[0137] 18. Qu X, et al., 2003. Promotion of tumorigenesis by heterozygous disruption of the beclin 1 autophagy gene. J Clin Invest 112: 1809-20

[0138] 19. Takamura A, et al., 2011. Autophagy-deficient mice develop multiple liver tumors. Genes Dev 25: 795-800

[0139] 20. Macintyre AN, et al., 2014. The glucose transporter Glut1 is selectively essential for CD4 T-cell activation and effector function. Cell Metab 20: 61-72

[0140] 21. Hultquist JF, et al., 2016. A Cas9 Ribonucleoprotein Platform for Functional Genetic Studies of HIV-Host Interactions in Primary Human T-cells. Cell Rep 17: 1438-52

[0141] 22. Eyquem J, et al., 2017. Targeting a CAR to the TRAC locus with CRISPR / Cas9 enhances tumour rejection. Nature 543: 113 - 7.

[0142] 23. DeVorkin L, et al., 2019. Autophagy regulation of metabolism is required for CD8+ T-cell anti-tumour immunity. Cell Rep 27(2): 502 - 513.

[0143] 24. Stadtmauer, EA, et al., 2020. CRISPR-engineered T cells in patients with refractory cancer. Science 06 Feb 2020. DOI: 10.1126 / science.aba7365.

[0144] 25. Schlie et al., 2015. Survival of effector CD8+ T-Cells during influenza infection is dependent on autophagy. J. Immunol. 194(9): 4277 - 4286.

[0145] Although many exemplary aspects and embodiments have been discussed above, those skilled in the art will recognize certain modifications, permutations, additions, and sub-combinations thereof. Accordingly, the appended claims and the claims introduced below are intended to be construed to include all such modifications, permutations, additions, and sub-combinations as a whole, consistent with the broadest interpretation of this specification. Sequence Listing <110> Provincial Health Services Agency Laval University <120> Compositions and Methods for Enhanced Lymphocyte-Mediated Immunotherapy <130> B537 0163 / JAM <150> US 62 / 804,658 <151> 2019 - 02 - 12 <160> 25 <170> PatentIn version 3.5 <210> 1 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Target 719 <400> 1 gctacggaaa gtcagattac 20 <210> 2 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Target 696 <400> 2 gtaatctgac tttccgtagc 20 <210> 3 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Target 824 <400> 3 gcaccgagta gtaccacttg 20 <210> 4 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Target 950 <400> 4 aagttcggca atcttgttac 20 <210> 5 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Target 905 <400> 5 cggatcgctg cctaatgtta 20 <210> 6 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Target 945 <400> 6 ccgtttatgt atccttagtc 20 <210> 7 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Target 710 <400> 7 gtcacgttct cctacctagt 20 <210> 8 <211> 10041 <212> DNA <213> Artificial sequence <220> <223> pAAV_ATG5_C4-CD27CD3z-CAR.xdna <400> 8 ctgcgcgctc gctcgctcac tgaggccgcc cgggcaaagc ccgggcgtcg ggcgaccttt 60 ggtcgcccgg cctcagtgag cgagcgagcg cgcagagagg gagtggccaa ctccatcact 120 aggggttcct gcggcctaag cttgagcgga gttccaattg tactgtacag cacatagact 180 tgcaggtgtg agttaatgga ttatgtattt tacaaacact tttcaaatgt cttctgattt 240 tggtgtgctt tgtttccctt ttctaagtgc atgtataatc ccagtttatg cctctgtcag 300 agatgacatc ctgcctgttc actgaatagc ccataatagg caaagatatt ctcaattgtc 360 gttactgttt tttctttttg tgtctcaggt atgcattcta gtgtttacct ggagatgatg 420 tggaaaagta gaagtgtatt tgtgatgagg aaatgcttct tctgtttcac tttaatgaag 480 tctgcccttt gctttccccc tcatctctct gagaggcagt gctgctcctc agcctgctcc 540 agctacggaa agtcagatta ctggaggaag ctacttatta aggagcccat tcgctcactt 600 tttgggtata ggactgtttt tttgtttttg ttttcctctg tgcatcctca gcatctggca 660 caggctcctc aaaagcttct gacctcttct cttcctccca cagggcctcg agagatctgg 720 cggcggagag ggcagaggaa gtcttctaac atgcggtgac gtggaggaga atcccggccc 780 tatggcctta ccagtgaccg ccttgctcct gccgctggcc ttgctgctcc acgccgccag 840 gccgggatcc cagctggtgg agtctggggg aggcttggta cagccagggc ggtccctgag 900 actctcctgc acaacttctg gattcacttt tggtgattat gctatgatct gggcccgcca 960 ggctccaggg aaggggctgg agtgggtctc atccattagt agtagtagta gttacatata 1020 ctacgcagac tcagtgaagg gccgattcac catctccaga gacaacgcca agaactcact 1080 gtatctgcaa atgaacagcc tgagagccga ggacacggct gtgtattact gtgcgagaga 1140 acgatacgat ttttggagtg gaatggacgt ctggggcaaa gggaccacgg tcaccgtctc 1200 gagtggtgga ggcggttcag gcggaggtgg ctctggcggt agtgcacagt ctgccctgac 1260 tcagcctgcc tccgtgtctg ggtctcctgg acagtcgatc accatctcct gcactggaac 1320 cagcagtgat gttgggagtt ataaccttgt ctcctggtac caacagcacc caggcaaagc 1380 ccccaaactc atgatttatg agggcagtaa gcggccctca ggggtttcta atcgcttctc 1440 tggctccaag tctggcaacg cggcctccct gacaatctct gggctccagg ctgaggacga 1500 ggctgattat tactgccagt cctatgacag cagcctgagt gtggtattcg gcggagggac 1560 caagctgacc gtcctaggtg ctagcaccac gacgccagcg ccgcgaccac caacaccggc 1620 gcccaccatc gcgtcgcagc ccctgtccct gcgcccagag gcgtgccggc cagcggcggg 1680 gggcgcagtg cacacgaggg ggctggactt cgcctgtgat atctacatct gggcgccctt 1740 ggccgggact tgtggggtcc ttctcctgtc actggttatc accctttact gccaacgaag 1800 gaaatataga tcaaacaaag gagaaagtcc tgtggagcct gcagagcctt gtcgttacag 1860 ctgccccagg gaggaggagg gcagcaccat ccccatccag gaggattacc gaaaaccgga 1920 gcctgcctgc tcccccagag tgaagttcag caggagcgca gacgcccccg cgtaccagca 1980 gggccagaac cagctctata acgagctcaa tctaggacga agagaggagt acgatgtttt 2040 ggacaagaga cgtggccggg accctgagat ggggggaaag ccgagaagga agaaccctca 2100 ggaaggcctg tacaatgaac tgcagaaaga taagatggcg gaggcctaca gtgagattgg 2160 gatgaaaggc gagcgccgga ggggcaaggg gcacgatggc ctttaccagg gtctcagtac 2220 agccaccaag gacacctacg acgcccttca catgcaggcc ctgccccctc gctgataagc 2280 ggccgcctgt gccttctagt tgccagccat ctgttgtttg cccctccccc gtgccttcct 2340 tgaccctgga aggtgccact cccactgtcc tttcctaata aaatgaggaa attgcatcgc 2400 attgtctgag taggtgtcat tctattctgg ggggtggggt ggggcaggac agcaaggggg 2460 aggattggga agacaatagc aggcatgctg gggatgcggt gggctctatg ggtcgacgtg 2520 gtactactcg gtgcatgaat gtttccccag gctcatgttg ggattttgtt tgaaatcatc 2580 tttatgggtt ttcttactag aaatgatagt tttagagaag ttcggcaatc ttgttactgg 2640 tactcaagct tatatacacg tgagtaatct taactttgga aatatcaacc gttttctgtc 2700 tagaaaaaca tccacagtta aaaaccaagt atggtcatag ttttattttt agaagaattt 2760 catttgttag aggtattttt tctgttcttg ttctgtaata taggttagga taccattttt 2820 tttttccaaa caagtttttg ctgttttaat tacaactttt aaccttcatt ggctttgtaa 2880 tagtatataa gagtatgtga gagtataaga gtatatttgg ccaaattgac aacaactggg 2940 taccctcgag cgcaggaacc cctagtgatg gagttggcca ctccctctct gcgcgctcgc 3000 tcgctcactg aggccgcccg ggctttgccc gggcggcctc agtgagcgag cgagcgcgca 3060 gctgcctgca ggggcagctt gaaggaaata ctaaggcaaa ggtactgcaa gtgctcgcaa 3120 cattcgctta tgcggattat tgccgtagtg ccgcgacgcc gggggcaaga tgcagagatt 3180 gccatggtac aggccgtgcg gttgatattg ccaaaacaga gctgtggggg agagttgtcg 3240 agaaagagtg cggaagatgc aaaggcgtcg gctattcaag gatgccagca agcgcagcat 3300 atcgcgctgt gacgatgcta atcccaaacc ttacccaacc cacctggtca cgcactgtta 3360 agccgctgta tgacgctctg gtggtgcaat gccacaaaga agagtcaatc gcagacaaca 3420 ttttgaatgc ggtcacacgt tagcagcatg attgccacgg atggcaacat attaacggca 3480 tgatattgac ttattgaata aaattgggta aatttgactc aacgatgggt taattcgctc 3540 gttgtggtag tgagatgaaa agaggcggcg cttactaccg attccgccta gttggtcact 3600 tcgacgtatc gtctggaact ccaaccatcg caggcagaga ggtctgcaaa atgcaatccc 3660 gaaacagttc gcaggtaata gttagagcct gcataacggt ttcgggattt tttatatctg 3720 cacaacaggt aagagcattg agtcgataat cgtgaagagt cggcgagcct ggttagccag 3780 tgctctttcc gttgtgctga attaagcgaa taccggaagc agaaccggat caccaaatgc 3840 gtacaggcgt catcgccgcc cagcaacagc acaacccaaa ctgagccgta gccactgtct 3900 gtcctgaatt cattagtaat agttacgctg cggcctttta cacatgacct tcgtgaaagc 3960 gggtggcagg aggtcgcgct aacaacctcc tgccgttttg cccgtgcata tcggtcacga 4020 acaaatctga ttactaaaca cagtagcctg gatttgttct atcagtaatc gaccttattc 4080 ctaattaaat agagcaaatc cccttattgg gggtaagaca tgaagatgcc agaaaaacat 4140 gacctgttgg ccgccattct cgcggcaaag gaacaaggca tcggggcaat ccttgcgttt 4200 gcaatggcgt accttcgcgg cagatataat ggcggtgcgt ttacaaaaac agtaatcgac 4260 gcaacgatgt gcgccattat cgcctggttc attcgtgacc ttctcgactt cgccggacta 4320 agtagcaatc tcgcttatat aacgagcgtg tttatcggct acatcggtac tgactcgatt 4380 ggttcgctta tcaaacgctt cgctgctaaa aaagccggag tagaagatgg tagaaatcaa 4440 taatcaacgt aaggcgttcc tcgatatgct ggcgtggtcg gagggaactg ataacggacg 4500 tcagaaaacc agaaatcatg gttatgacgt cattgtaggc ggagagctat ttactgatta 4560 ctccgatcac cctcgcaaac ttgtcacgct aaacccaaaa ctcaaatcaa caggcgccgg 4620 acgctaccag cttctttccc gttggtggga tgcctaccgc aagcagcttg gcctgaaaga 4680 cttctctccg aaaagtcagg acgctgtggc attgcagcag attaaggagc gtggcgcttt 4740 acctatgatt gatcgtggtg atatccgtca ggcaatcgac cgttgcagca atatctgggc 4800 ttcactgccg ggcgctggtt atggtcagtt cgagcataag gctgacagcc tgattgcaaa 4860 attcaaagaa gcgggcggaa cggtcagaga gattgatgta tgagcagagt caccgcgatt 4920 atctccgctc tggttatctg catcatcgtc tgcctgtcat gggctgttaa tcattaccgt 4980 gataacgcca ttacctacaa agcccagcgc gacaaaaatg ccagagaact gaagctggcg 5040 aacgcggcaa ttactgacat gcagatgcgt cagcgtgatg ttgctgcgct cgatgcaaaa 5100 tacacgaagg agttagctga tgctaaagct gaaaatgatg ctctgcgtga tgatgttgcc 5160 gctggtcgtc gtcggttgca catcaaagca gtctgtcagt cagtgcgtga agccaccacc 5220 gcctccggcg tggataatgc agcctccccc cgactggcag acaccgctga acgggattat 5280 ttcaccctca gagagaggct gatcactatg caaaaacaac tggaaggaac ccagaagtat 5340 attaatgagc agtgcagata gagttgccca tatcgatggg caactcatgc aattattgtg 5400 agcaatacac acgcgcttcc agcggagtat aaatgcctaa agtaataaaa ccgagcaatc 5460 catttacgaa tgtttgctgg gtttctgttt taacaacatt ttctgcgccg ccacaaattt 5520 tggctgcatc gacagttttc ttctgcccaa ttccagaaac gaagaaatga tgggtgatgg 5580 tttcctttgg tgctactgct gccggtttgt tttgaacagt aaacgtctgt tgagcacatc 5640 ctgtaataag cagggccagc gcagtagcga gtagcatttt tttcatggtg ttattcccga 5700 tgctttttga agttcgcaga atcgtatgtg tagaaaatta aacaaaccct aaacaatgag 5760 ttgaaatttc atattgttaa tatttattaa tgtatgtcag gtgcgatgaa tcgtcattgt 5820 attcccggat taactatgtc cacagccctg acggggaact tctctgcggg agtgtccggg 5880 aataattaaa acgatgcaca cagggtttag cgcgtacacg tattgcatta tgccaacgcc 5940 ccggtgctga cacggaagaa accggacgtt atgatttagc gtggaaagat ttgtgtagtg 6000 ttctgaatgc tctcagtaaa tagtaatgaa ttatcaaagg tatagtaata tcttttatgt 6060 tcatggatat ttgtaaccca tcggaaaact cctgctttag caagattttc cctgtattgc 6120 tgaaatgtga tttctcttga tttcaaccta tcataggacg tttctataag atgcgtgttt 6180 cttgagaatt taacatttac aaccttttta agtcctttta ttaacacggt gttatcgttt 6240 tctaacacga tgtgaatatt atctgtggct agatagtaaa tataatgtga gacgttgtga 6300 cgttttagtt cagaataaaa caattcacag tctaaatctt ttcgcacttg atcgaatatt 6360 tctttaaaaa tggcaacctg agccattggt aaaaccttcc atgtgatacg agggcgcgta 6420 gtttgcatta tcgtttttat cgtttcaatc tggtctgacc tccttgtgtt ttgttgatga 6480 tttatgtcaa atattaggaa tgttttcact taatagtatt ggttgcgtaa caaagtgcgg 6540 tcctgctggc attctggagg gaaatacaac cgacagatgt atgtaaggcc aacgtgctca 6600 aatcttcata cagaaagatt tgaagtaata ttttaaccgc tagatgaaga gcaagcgcat 6660 ggagcgacaa aatgaataaa gaacaatctg ctgatgatcc ctccgtggat ctgattcgtg 6720 taaaaaatat gcttaatagc accatttcta tgagttaccc tgatgttgta attgcatgta 6780 tagaacataa ggtgtctctg gaagcattca gagcaattga ggcagcgttg gtgaagcacg 6840 ataataatat gaaggattat tccctggtgg ttgactgatc accataactg ctaatcattc 6900 aaactattta gtctgtgaca gagccaacac gcagtctgtc actgtcagga aagtggtaaa 6960 actgcaactc aattactgca atgccctcgt aattaagtga atttacaata tcgtcctgtt 7020 cggagggaag aacgcgggat gttcattctt catcactttt aattgatgta tatgctctct 7080 tttctgacgt tagtctccga cggcaggctt caatgaccca ggctgagaaa ttcccggacc 7140 ctttttgctc aagagcgatg ttaatttgtt caatcatttg gttaggaaag cggatgttgc 7200 gggttgttgt tctgcgggtt ctgttcttcg ttgacatgag gttgccccgt attcagtgtc 7260 gctgatttgt attgtctgaa gttgttttta cgttaagttg atgcagatca attaatacga 7320 tacctgcgtc ataattgatt atttgacgtg gtttgatggc ctccacgcac gttgtgatat 7380 gtagatgata atcattatca ctttacgggt cctttccggt gatccgacag gttacggcct 7440 gatgcggtat tttctcctta cgcatctgtg cggtatttca caccgcatac gtcaaagcaa 7500 ccatagtacg cgccctgtag cggcgcatta agcgcggcgg gtgtggtggt tacgcgcagc 7560 gtgaccgcta cacttgccag cgccctagcg cccgctcctt tcgctttctt cccttccttt 7620 ctcgccacgt tcgccggctt tccccgtcaa gctctaaatc gggggctccc tttagggttc 7680 cgatttagtg ctttacggca cctcgacccc aaaaaacttg atttgggtga tggttcacgt 7740 agtgggccat cgccctgata gacggttttt cgccctttga cgttggagtc cacgttcttt 7800 aatagtggac tcttgttcca aactggaaca acactcaacc ctatctcggg ctattctttt 7860 gatttataag ggattttgcc gatttcggcc tattggttaa aaaatgagct gatttaacaa 7920 aaatttaacg cgaattttaa caaaatatta acgtttacaa ttttatggtg cactctcagt 7980 acaatctgct ctgatgccgc atagttaagc cagccccgac acccgccaac acccgctgac 8040 gcgccctgac gggcttgtct gctcccggca tccgcttaca gacaagctgt gaccgtctcc 8100 gggagctgca tgtgtcagag gttttcaccg tcatcaccga aacgcgcgag acgaaagggc 8160 ctcgtgatac gcctattttt ataggttaat gtcatgataa taatggtttc ttagacgtca 8220 ggtggcactt ttcggggaaa tgtgcgcgga acccctattt gtttattttt ctaaatacat 8280 tcaaatatgt atccgctcat gagacaataa ccctgataaa tgcttcaata atattgaaaa 8340 aggaagagta tgagtattca acatttccgt gtcgccctta ttcccttttt tgcggcattt 8400 tgccttcctg tttttgctca cccagaaacg ctggtgaaag taaaagatgc tgaagatcag 8460 ttgggtgcac gagtgggtta catcgaactg gatctcaaca gcggtaagat ccttgagagt 8520 tttcgccccg aagaacgttt tccaatgatg agcactttta aagttctgct atgtggcgcg 8580 gtattatccc gtattgacgc cgggcaagag caactcggtc gccgcataca ctattctcag 8640 aatgacttgg ttgagtactc accagtcaca gaaaagcatc ttacggatgg catgacagta 8700 agagaattat gcagtgctgc cataaccatg agtgataaca ctgcggccaa cttacttctg 8760 acaacgatcg gaggaccgaa ggagctaacc gcttttttgc acaacatggg ggatcatgta 8820 actcgccttg atcgttggga accggagctg aatgaagcca taccaaacga cgagcgtgac 8880 accacgatgc ctgtagcaat ggcaacaacg ttgcgcaaac tattaactgg cgaactactt 8940 actctagctt cccggcaaca attaatagac tggatggagg cggataaagt tgcaggacca 9000 cttctgcgct cggcccttcc ggctggctgg tttattgctg ataaatctgg agccggtgag 9060 cgtgggtctc gcggtatcat tgcagcactg gggccagatg gtaagccctc ccgtatcgta 9120 gttatctaca cgacggggag tcaggcaact atggatgaac gaaatagaca gatcgctgag 9180 ataggtgcct cactgattaa gcattggtaa ctgtcagacc aagtttactc atatatactt 9240 tagattgatt taaaacttca tttttaattt aaaaggatct aggtgaagat cctttttgat 9300 aatctcatga ccaaaatccc ttaacgtgag ttttcgttcc actgagcgtc agaccccgta 9360 gaaaagatca aaggatcttc ttgagatcct ttttttctgc gcgtaatctg ctgcttgcaa 9420 acaaaaaaac caccgctacc agcggtggtt tgtttgccgg atcaagagct accaactctt 9480 tttccgaagg taactggctt cagcagagcg cagataccaa atactgtcct tctagtgtag 9540 ccgtagttag gccaccactt caagaactct gtagcaccgc ctacatacct cgctctgcta 9600 atcctgttac cagtggctgc tgccagtggc gataagtcgt gtcttaccgg gttggactca 9660 agacgatagt taccggataa ggcgcagcgg tcgggctgaa cggggggttc gtgcacacag 9720 cccagcttgg agcgaacgac ctacaccgaa ctgagatacc tacagcgtga gctatgagaa 9780 agcgccacgc ttcccgaagg gagaaaggcg gacaggtatc cggtaagcgg cagggtcgga 9840 acaggagagc gcacgaggga gcttccaggg ggaaacgcct ggtatcttta tagtcctgtc 9900 gggtttcgcc acctctgact tgagcgtcga tttttgtgat gctcgtcagg ggggcggagc 9960 ctatggaaaa acgccagcaa cgcggccttt ttacggttcc tggccttttg ctggcctttt 10020 gctcacatgt cctgcaggca g 10041 <210> 9 <211> 10035 <212> DNA <213> Artificial Sequence <220> <223> pAAV_ATG5_C4-CD28CD3z-CAR.xdna <400> 9 ctgcgcgctc gctcgctcac tgaggccgcc cgggcaaagc ccgggcgtcg ggcgaccttt 60 ggtcgcccgg cctcagtgag cgagcgagcg cgcagagagg gagtggccaa ctccatcact 120 aggggttcct gcggcctaag cttgagcgga gttccaattg tactgtacag cacatagact 180 tgcaggtgtg agttaatgga ttatgtattt tacaaacact tttcaaatgt cttctgattt 240 tggtgtgctt tgtttccctt ttctaagtgc atgtataatc ccagtttatg cctctgtcag 300 agatgacatc ctgcctgttc actgaatagc ccataatagg caaagatatt ctcaattgtc 360 gttactgttt tttctttttg tgtctcaggt atgcattcta gtgtttacct ggagatgatg 420 tggaaaagta gaagtgtatt tgtgatgagg aaatgcttct tctgtttcac tttaatgaag 480 tctgcccttt gctttccccc tcatctctct gagaggcagt gctgctcctc agcctgctcc 540 agctacggaa agtcagatta ctggaggaag ctacttatta aggagcccat tcgctcactt 600 tttgggtata ggactgtttt tttgtttttg ttttcctctg tgcatcctca gcatctggca 660 caggctcctc aaaagcttct gacctcttct cttcctccca cagggcctcg agagatctgg 720 cggcggagag ggcagaggaa gtcttctaac atgcggtgac gtggaggaga atcccggccc 780 tatggcctta ccagtgaccg ccttgctcct gccgctggcc ttgctgctcc acgccgccag 840 gccgggatcc cagctggtgg agtctggggg aggcttggta cagccagggc ggtccctgag 900 actctcctgc acaacttctg gattcacttt tggtgattat gctatgatct gggcccgcca 960 ggctccaggg aaggggctgg agtgggtctc atccattagt agtagtagta gttacatata 1020 ctacgcagac tcagtgaagg gccgattcac catctccaga gacaacgcca agaactcact 1080 gtatctgcaa atgaacagcc tgagagccga ggacacggct gtgtattact gtgcgagaga 1140 acgatacgat ttttggagtg gaatggacgt ctggggcaaa gggaccacgg tcaccgtctc 1200 gagtggtgga ggcggttcag gcggaggtgg ctctggcggt agtgcacagt ctgccctgac 1260 tcagcctgcc tccgtgtctg ggtctcctgg acagtcgatc accatctcct gcactggaac 1320 cagcagtgat gttgggagtt ataaccttgt ctcctggtac caacagcacc caggcaaagc 1380 ccccaaactc atgatttatg agggcagtaa gcggccctca ggggtttcta atcgcttctc 1440 tggctccaag tctggcaacg cggcctccct gacaatctct gggctccagg ctgaggacga 1500 ggctgattat tactgccagt cctatgacag cagcctgagt gtggtattcg gcggagggac 1560 caagctgacc gtcctaggtg ctagcaccac gacgccagcg ccgcgaccac caacaccggc 1620 gcccaccatc gcgtcgcagc ccctgtccct gcgcccagag gcgtgccggc cagcggcggg 1680 gggcgcagtg cacacgaggg ggctggactt cgcctgtgat ttttgggtgc tggtggtggt 1740 tggtggagtc ctggcttgct atagcttgct agtaacagtg gcctttatta ttttctgggt 1800 gaggagtaag aggagcaggc tcctgcacag tgactacatg aacatgactc cccgccgccc 1860 cgggcccacc cgcaagcatt accagcccta tgccccacca cgcgacttcg cagcctatcg 1920 ctccatcgat agagtgaagt tcagcaggag cgcagacgcc cccgcgtacc agcagggcca 1980 gaaccagctc tataacgagc tcaatctagg acgaagagag gagtacgatg ttttggacaa 2040 gagacgtggc cgggaccctg agatgggggg aaagccgaga aggaagaacc ctcaggaagg 2100 cctgtacaat gaactgcaga aagataagat ggcggaggcc tacagtgaga ttgggatgaa 2160 aggcgagcgc cggaggggca aggggcacga tggcctttac cagggtctca gtacagccac 2220 caaggacacc tacgacgccc ttcacatgca ggccctgccc cctcgctgat aagcggccgc 2280 ctgtgccttc tagttgccag ccatctgttg tttgcccctc ccccgtgcct tccttgaccc 2340 tggaaggtgc cactcccact gtcctttcct aataaaatga ggaaattgca tcgcattgtc 2400 tgagtaggtg tcattctatt ctggggggtg gggtggggca ggacagcaag ggggaggatt 2460 gggaagacaa tagcaggcat gctggggatg cggtgggctc tatgggtcga cgtggtacta 2520 ctcggtgcat gaatgtttcc ccaggctcat gttgggattt tgtttgaaat catctttatg 2580 ggttttctta ctagaaatga tagttttaga gaagttcggc aatcttgtta ctggtactca 2640 agcttatata cacgtgagta atcttaactt tggaaatatc aaccgttttc tgtctagaaa 2700 aacatccaca gttaaaaacc aagtatggtc atagttttat ttttagaaga atttcatttg 2760 ttagaggtat tttttctgtt cttgttctgt aatataggtt aggataccat tttttttttc 2820 caaacaagtt tttgctgttt taattacaac ttttaacctt cattggcttt gtaatagtat 2880 ataagagtat gtgagagtat aagagtatat ttggccaaat tgacaacaac tgggtaccct 2940 cgagcgcagg aacccctagt gatggagttg gccactccct ctctgcgcgc tcgctcgctc 3000 actgaggccg cccgggcttt gcccgggcgg cctcagtgag cgagcgagcg cgcagctgcc 3060 tgcaggggca gcttgaagga aatactaagg caaaggtact gcaagtgctc gcaacattcg 3120 cttatgcgga ttattgccgt agtgccgcga cgccgggggc aagatgcaga gattgccatg 3180 gtacaggccg tgcggttgat attgccaaaa cagagctgtg ggggagagtt gtcgagaaag 3240 agtgcggaag atgcaaaggc gtcggctatt caaggatgcc agcaagcgca gcatatcgcg 3300 ctgtgacgat gctaatccca aaccttaccc aacccacctg gtcacgcact gttaagccgc 3360 tgtatgacgc tctggtggtg caatgccaca aagaagagtc aatcgcagac aacattttga 3420 atgcggtcac acgttagcag catgattgcc acggatggca acatattaac ggcatgatat 3480 tgacttattg aataaaattg ggtaaatttg actcaacgat gggttaattc gctcgttgtg 3540 gtagtgagat gaaaagaggc ggcgcttact accgattccg cctagttggt cacttcgacg 3600 tatcgtctgg aactccaacc atcgcaggca gagaggtctg caaaatgcaa tcccgaaaca 3660 gttcgcaggt aatagttaga gcctgcataa cggtttcggg attttttata tctgcacaac 3720 aggtaagagc attgagtcga taatcgtgaa gagtcggcga gcctggttag ccagtgctct 3780 ttccgttgtg ctgaattaag cgaataccgg aagcagaacc ggatcaccaa atgcgtacag 3840 gcgtcatcgc cgcccagcaa cagcacaacc caaactgagc cgtagccact gtctgtcctg 3900 aattcattag taatagttac gctgcggcct tttacacatg accttcgtga aagcgggtgg 3960 caggaggtcg cgctaacaac ctcctgccgt tttgcccgtg catatcggtc acgaacaaat 4020 ctgattacta aacacagtag cctggatttg ttctatcagt aatcgacctt attcctaatt 4080 aaatagagca aatcccctta ttgggggtaa gacatgaaga tgccagaaaa acatgacctg 4140 ttggccgcca ttctcgcggc aaaggaacaa ggcatcgggg caatccttgc gtttgcaatg 4200 gcgtaccttc gcggcagata taatggcggt gcgtttacaa aaacagtaat cgacgcaacg 4260 atgtgcgcca ttatcgcctg gttcattcgt gaccttctcg acttcgccgg actaagtagc 4320 aatctcgctt atataacgag cgtgtttatc ggctacatcg gtactgactc gattggttcg 4380 cttatcaaac gcttcgctgc taaaaaagcc ggagtagaag atggtagaaa tcaataatca 4440 acgtaaggcg ttcctcgata tgctggcgtg gtcggaggga actgataacg gacgtcagaa 4500 aaccagaaat catggttatg acgtcattgt aggcggagag ctatttactg attactccga 4560 tcaccctcgc aaacttgtca cgctaaaccc aaaactcaaa tcaacaggcg ccggacgcta 4620 ccagcttctt tcccgttggt gggatgccta ccgcaagcag cttggcctga aagacttctc 4680 tccgaaaagt caggacgctg tggcattgca gcagattaag gagcgtggcg ctttacctat 4740 gattgatcgt ggtgatatcc gtcaggcaat cgaccgttgc agcaatatct gggcttcact 4800 gccgggcgct ggttatggtc agttcgagca taaggctgac agcctgattg caaaattcaa 4860 agaagcgggc ggaacggtca gagagattga tgtatgagca gagtcaccgc gattatctcc 4920 gctctggtta tctgcatcat cgtctgcctg tcatgggctg ttaatcatta ccgtgataac 4980 gccattacct acaaagccca gcgcgacaaa aatgccagag aactgaagct ggcgaacgcg 5040 gcaattactg acatgcagat gcgtcagcgt gatgttgctg cgctcgatgc aaaatacacg 5100 aaggagttag ctgatgctaa agctgaaaat gatgctctgc gtgatgatgt tgccgctggt 5160 cgtcgtcggt tgcacatcaa agcagtctgt cagtcagtgc gtgaagccac caccgcctcc 5220 ggcgtggata atgcagcctc cccccgactg gcagacaccg ctgaacggga ttatttcacc 5280 ctcagagaga ggctgatcac tatgcaaaaa caactggaag gaacccagaa gtatattaat 5340 gagcagtgca gatagagttg cccatatcga tgggcaactc atgcaattat tgtgagcaat 5400 acacacgcgc ttccagcgga gtataaatgc ctaaagtaat aaaaccgagc aatccattta 5460 cgaatgtttg ctgggtttct gttttaacaa cattttctgc gccgccacaa attttggctg 5520 catcgacagt tttcttctgc ccaattccag aaacgaagaa atgatgggtg atggtttcct 5580 ttggtgctac tgctgccggt ttgttttgaa cagtaaacgt ctgttgagca catcctgtaa 5640 taagcagggc cagcgcagta gcgagtagca tttttttcat ggtgttattc ccgatgcttt 5700 ttgaagttcg cagaatcgta tgtgtagaaa attaaacaaa ccctaaacaa tgagttgaaa 5760 tttcatattg ttaatattta ttaatgtatg tcaggtgcga tgaatcgtca ttgtattccc 5820 ggattaacta tgtccacagc cctgacgggg aacttctctg cgggagtgtc cgggaataat 5880 taaaacgatg cacacagggt ttagcgcgta cacgtattgc attatgccaa cgccccggtg 5940 ctgacacgga agaaaccgga cgttatgatt tagcgtggaa agatttgtgt agtgttctga 6000 atgctctcag taaatagtaa tgaattatca aaggtatagt aatatctttt atgttcatgg 6060 atatttgtaa cccatcggaa aactcctgct ttagcaagat tttccctgta ttgctgaaat 6120 gtgatttctc ttgatttcaa cctatcatag gacgtttcta taagatgcgt gtttcttgag 6180 aatttaacat ttacaacctt tttaagtcct tttattaaca cggtgttatc gttttctaac 6240 acgatgtgaa tattatctgt ggctagatag taaatataat gtgagacgtt gtgacgtttt 6300 agttcagaat aaaacaattc acagtctaaa tcttttcgca cttgatcgaa tatttcttta 6360 aaaatggcaa cctgagccat tggtaaaacc ttccatgtga tacgagggcg cgtagtttgc 6420 attatcgttt ttatcgtttc aatctggtct gacctccttg tgttttgttg atgatttatg 6480 tcaaatatta ggaatgtttt cacttaatag tattggttgc gtaacaaagt gcggtcctgc 6540 tggcattctg gagggaaata caaccgacag atgtatgtaa ggccaacgtg ctcaaatctt 6600 catacagaaa gatttgaagt aatattttaa ccgctagatg aagagcaagc gcatggagcg 6660 acaaaatgaa taaagaacaa tctgctgatg atccctccgt ggatctgatt cgtgtaaaaa 6720 atatgcttaa tagcaccatt tctatgagtt accctgatgt tgtaattgca tgtatagaac 6780 ataaggtgtc tctggaagca ttcagagcaa ttgaggcagc gttggtgaag cacgataata 6840 atatgaagga ttattccctg gtggttgact gatcaccata actgctaatc attcaaacta 6900 tttagtctgt gacagagcca acacgcagtc tgtcactgtc aggaaagtgg taaaactgca 6960 actcaattac tgcaatgccc tcgtaattaa gtgaatttac aatatcgtcc tgttcggagg 7020 gaagaacgcg ggatgttcat tcttcatcac ttttaattga tgtatatgct ctcttttctg 7080 acgttagtct ccgacggcag gcttcaatga cccaggctga gaaattcccg gacccttttt 7140 gctcaagagc gatgttaatt tgttcaatca tttggttagg aaagcggatg ttgcgggttg 7200 ttgttctgcg ggttctgttc ttcgttgaca tgaggttgcc ccgtattcag tgtcgctgat 7260 ttgtattgtc tgaagttgtt tttacgttaa gttgatgcag atcaattaat acgatacctg 7320 cgtcataatt gattatttga cgtggtttga tggcctccac gcacgttgtg atatgtagat 7380 gataatcatt atcactttac gggtcctttc cggtgatccg acaggttacg gcctgatgcg 7440 gtattttctc cttacgcatc tgtgcggtat ttcacaccgc atacgtcaaa gcaaccatag 7500 tacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg cagcgtgacc 7560 gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc ctttctcgcc 7620 acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg gttccgattt 7680 agtgctttac ggcacctcga ccccaaaaaa cttgatttgg gtgatggttc acgtagtggg 7740 ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt ctttaatagt 7800 ggactcttgt tccaaactgg aacaacactc aaccctatct cgggctattc ttttgattta 7860 taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta acaaaaattt 7920 aacgcgaatt ttaacaaaat attaacgttt acaattttat ggtgcactct cagtacaatc 7980 tgctctgatg ccgcatagtt aagccagccc cgacacccgc caacacccgc tgacgcgccc 8040 tgacgggctt gtctgctccc ggcatccgct tacagacaag ctgtgaccgt ctccgggagc 8100 tgcatgtgtc agaggttttc accgtcatca ccgaaacgcg cgagacgaaa gggcctcgtg 8160 atacgcctat ttttataggt taatgtcatg ataataatgg tttcttagac gtcaggtggc 8220 acttttcggg gaaatgtgcg cggaacccct atttgtttat ttttctaaat acattcaaat 8280 atgtatccgc tcatgagaca ataaccctga taaatgcttc aataatattg aaaaaggaag 8340 agtatgagta ttcaacattt ccgtgtcgcc cttattccct tttttgcggc attttgcctt 8400 cctgtttttg ctcacccaga aacgctggtg aaagtaaaag atgctgaaga tcagttgggt 8460 gcacgagtgg gttacatcga actggatctc aacagcggta agatccttga gagttttcgc 8520 cccgaagaac gttttccaat gatgagcact tttaaagttc tgctatgtgg cgcggtatta 8580 tcccgtattg acgccgggca agagcaactc ggtcgccgca tacactattc tcagaatgac 8640 ttggttgagt actcaccagt cacagaaaag catcttacgg atggcatgac agtaagagaa 8700 ttatgcagtg ctgccataac catgagtgat aacactgcgg ccaacttact tctgacaacg 8760 atcggaggac cgaaggagct aaccgctttt ttgcacaaca tgggggatca tgtaactcgc 8820 cttgatcgtt gggaaccgga gctgaatgaa gccataccaa acgacgagcg tgacaccacg 8880 atgcctgtag caatggcaac aacgttgcgc aaactattaa ctggcgaact acttactcta 8940 gcttcccggc aacaattaat agactggatg gaggcggata aagttgcagg accacttctg 9000 cgctcggccc ttccggctgg ctggtttatt gctgataaat ctggagccgg tgagcgtggg 9060 tctcgcggta tcattgcagc actggggcca gatggtaagc cctcccgtat cgtagttatc 9120 tacacgacgg ggagtcaggc aactatggat gaacgaaata gacagatcgc tgagataggt 9180 gcctcactga ttaagcattg gtaactgtca gaccaagttt actcatatat actttagatt 9240 gatttaaaac ttcattttta atttaaaagg atctaggtga agatcctttt tgataatctc 9300 atgaccaaaa tcccttaacg tgagttttcg ttccactgag cgtcagaccc cgtagaaaag 9360 atcaaaggat cttcttgaga tccttttttt ctgcgcgtaa tctgctgctt gcaaacaaaa 9420 aaaccaccgc taccagcggt ggtttgtttg ccggatcaag agctaccaac tctttttccg 9480 aaggtaactg gcttcagcag agcgcagata ccaaatactg tccttctagt gtagccgtag 9540 ttaggccacc acttcaagaa ctctgtagca ccgcctacat acctcgctct gctaatcctg 9600 ttaccagtgg ctgctgccag tggcgataag tcgtgtctta ccgggttgga ctcaagacga 9660 tagttaccgg ataaggcgca gcggtcgggc tgaacggggg gttcgtgcac acagcccagc 9720 ttggagcgaa cgacctacac cgaactgaga tacctacagc gtgagctatg agaaagcgcc 9780 acgcttcccg aagggagaaa ggcggacagg tatccggtaa gcggcagggt cggaacagga 9840 gagcgcacga gggagcttcc agggggaaac gcctggtatc tttatagtcc tgtcgggttt 9900 cgccacctct gacttgagcg tcgatttttg tgatgctcgt caggggggcg gagcctatgg 9960 aaaaacgcca gcaacgcggc ctttttacgg ttcctggcct tttgctggcc ttttgctcac 10020 atgtcctgca ggcag 10035 <210> 10 <211> 10782 <212> DNA <213> Artificial Sequence <220> <223> pAAV_AAVS1_C4-CD27CD3z-CAR.xdna <400> 10 ctgcgcgctc gctcgctcac tgaggccgcc cgggcaaagc ccgggcgtcg ggcgaccttt 60 ggtcgcccgg cctcagtgag cgagcgagcg cgcagagagg gagtggccaa ctccatcact 120 aggggttcct gcggcctaag cttgagcgga gttccaattg tactgtacag ccctttgctt 180 tctctgacca gcattctctc ccctgggcct gtgccgcttt ctgtctgcag cttgtggcct 240 gggtcacctc tacggctggc ccagatcctt ccctgccgcc tccttcaggt tccgtcttcc 300 tccactccct cttccccttg ctctctgctg tgttgctgcc caaggatgct ctttccggag 360 cacttccttc tcggcgctgc accacgtgat gtcctctgag cggatcctcc ccgtgtctgg 420 gtcctctccg ggcatctctc ctccctcacc caaccccatg ccgtcttcac tcgctgggtt 480 cccttttcct tctccttctg gggcctgtgc catctctcgt ttcttaggat ggccttctcc 540 gacggatgtc tcccttgcgt cccgcctccc cttcttgtag gcctgcatca tcaccgtttt 600 tctggacaac cccaaagtac cccgtctccc tggctttagc cacctctcca tcctcttgct 660 ttctttgcct ggacaccccg ttctcctgtg gattcgggtc acctctcact cctttcattt 720 gggcagctcc cctacccccc ttacctctct agtctgtgct agctcttcca gccccctgtc 780 atggcatctt ccaggggtcc gagagctcag ctagtcttct tcctccaacc cgggccccta 840 tgtccacttc aggacagcat gtttgctgcc tccagggatc ctgtgtcccc gagctgggac 900 caccttatat tcccagggcc ggttaatgtg gctctggttc tgggtacttt tatctgtccc 960 ctccacccca cagtggggca agcttctgac ctcttctctt cctcccacag ggcctcgaga 1020 gatctggcgg cggagagggc agaggaagtc ttctaacatg cggtgacgtg gaggagaatc 1080 ccggccctat ggccttacca gtgaccgcct tgctcctgcc gctggccttg ctgctccacg 1140 ccgccaggcc gggatcccag ctggtggagt ctgggggagg cttggtacag ccagggcggt 1200 ccctgagact ctcctgcaca acttctggat tcacttttgg tgattatgct atgatctggg 1260 cccgccaggc tccagggaag gggctggagt gggtctcatc cattagtagt agtagtagtt 1320 acatatacta cgcagactca gtgaagggcc gattcaccat ctccagagac aacgccaaga 1380 actcactgta tctgcaaatg aacagcctga gagccgagga cacggctgtg tattactgtg 1440 cgagagaacg atacgatttt tggagtggaa tggacgtctg gggcaaaggg accacggtca 1500 ccgtctcgag tggtggaggc ggttcaggcg gaggtggctc tggcggtagt gcacagtctg 1560 ccctgactca gcctgcctcc gtgtctgggt ctcctggaca gtcgatcacc atctcctgca 1620 ctggaaccag cagtgatgtt gggagttata accttgtctc ctggtaccaa cagcacccag 1680 gcaaagcccc caaactcatg atttatgagg gcagtaagcg gccctcaggg gtttctaatc 1740 gcttctctgg ctccaagtct ggcaacgcgg cctccctgac aatctctggg ctccaggctg 1800 aggacgaggc tgattattac tgccagtcct atgacagcag cctgagtgtg gtattcggcg 1860 gagggaccaa gctgaccgtc ctaggtgcta gcaccacgac gccagcgccg cgaccaccaa 1920 caccggcgcc caccatcgcg tcgcagcccc tgtccctgcg cccagaggcg tgccggccag 1980 cggcgggggg cgcagtgcac acgagggggc tggacttcgc ctgtgatatc tacatctggg 2040 cgcccttggc cgggacttgt ggggtccttc tcctgtcact ggttatcacc ctttactgcc 2100 aacgaaggaa atatagatca aacaaaggag aaagtcctgt ggagcctgca gagccttgtc 2160 gttacagctg ccccagggag gaggagggca gcaccatccc catccaggag gattaccgaa 2220 aaccggagcc tgcctgctcc cccagagtga agttcagcag gagcgcagac gcccccgcgt 2280 accagcaggg ccagaaccag ctctataacg agctcaatct aggacgaaga gaggagtacg 2340 atgttttgga caagagacgt ggccgggacc ctgagatggg gggaaagccg agaaggaaga 2400 accctcagga aggcctgtac aatgaactgc agaaagataa gatggcggag gcctacagtg 2460 agattgggat gaaaggcgag cgccggaggg gcaaggggca cgatggcctt taccagggtc 2520 tcagtacagc caccaaggac acctacgacg cccttcacat gcaggccctg ccccctcgct 2580 gataagcggc cgcctgtgcc ttctagttgc cagccatctg ttgtttgccc ctcccccgtg 2640 ccttccttga ccctggaagg tgccactccc actgtccttt cctaataaaa tgaggaaatt 2700 gcatcgcatt gtctgagtag gtgtcattct attctggggg gtggggtggg gcaggacagc 2760 aagggggagg attgggaaga caatagcagg catgctgggg atgcggtggg ctctatgggt 2820 cgacagtact aagctttact agggacagga ttggtgacag aaaagcccca tccttaggcc 2880 tcctccttcc tagtctcctg atattgggtc taacccccac ctcctgttag gcagattcct 2940 tatctggtga cacaccccca tttcctggag ccatctctct ccttgccaga acctctaagg 3000 tttgcttacg atggagccag agaggatcct gggagggaga gcttggcagg gggtgggagg 3060 gaaggggggg atgcgtgacc tgcccggttc tcagtggcca ccctgcgcta ccctctccca 3120 gaacctgagc tgctctgacg cggctgtctg gtgcgtttca ctgatcctgg tgctgcagct 3180 tccttacact tcccaagagg agaagcagtt tggaaaaaca aaatcagaat aagttggtcc 3240 tgagttctaa ctttggctct tcacctttct agtccccaat ttatattgtt cctccgtgcg 3300 tcagttttac ctgtgagata aggccagtag ccagccccgt cctggcaggg ctgtggtgag 3360 gaggggggtg tccgtgtgga aaactccctt tgtgagaatg gtgcgtccta ggtgttcacc 3420 aggtcgtggc cgcctctact ccctttctct ttctccatcc ttctttcctt aaagagtccc 3480 cagtgctatc tgggacatat tcctccgccc agagcagggt cccgcttccc taaggccctg 3540 ctctgggctt ctgggtttga gtccttggca agcccaggag aggcgctcag gcttccctgt 3600 cccccttcct cgtccaccat ctcatgcccc tggctctcct gccccttccc tacaggggtt 3660 cctggctctg ctctaagggg gtaccctcga gcgcaggaac ccctagtgat ggagttggcc 3720 actccctctc tgcgcgctcg ctcgctcact gaggccgccc gggctttgcc cgggcggcct 3780 cagtgagcga gcgagcgcgc agctgcctgc aggggcagct tgaaggaaat actaaggcaa 3840 aggtactgca agtgctcgca acattcgctt atgcggatta ttgccgtagt gccgcgacgc 3900 cgggggcaag atgcagagat tgccatggta caggccgtgc ggttgatatt gccaaaacag 3960 agctgtgggg gagagttgtc gagaaagagt gcggaagatg caaaggcgtc ggctattcaa 4020 ggatgccagc aagcgcagca tatcgcgctg tgacgatgct aatcccaaac cttacccaac 4080 ccacctggtc acgcactgtt aagccgctgt atgacgctct ggtggtgcaa tgccacaaag 4140 aagagtcaat cgcagacaac attttgaatg cggtcacacg ttagcagcat gattgccacg 4200 gatggcaaca tattaacggc atgatattga cttattgaat aaaattgggt aaatttgact 4260 caacgatggg ttaattcgct cgttgtggta gtgagatgaa aagaggcggc gcttactacc 4320 gattccgcct agttggtcac ttcgacgtat cgtctggaac tccaaccatc gcaggcagag 4380 aggtctgcaa aatgcaatcc cgaaacagtt cgcaggtaat agttagagcc tgcataacgg 4440 tttcgggatt ttttatatct gcacaacagg taagagcatt gagtcgataa tcgtgaagag 4500 tcggcgagcc tggttagcca gtgctctttc cgttgtgctg aattaagcga ataccggaag 4560 cagaaccgga tcaccaaatg cgtacaggcg tcatcgccgc ccagcaacag cacaacccaa 4620 actgagccgt agccactgtc tgtcctgaat tcattagtaa tagttacgct gcggcctttt 4680 acacatgacc ttcgtgaaag cgggtggcag gaggtcgcgc taacaacctc ctgccgtttt 4740 gcccgtgcat atcggtcacg aacaaatctg attactaaac acagtagcct ggatttgttc 4800 tatcagtaat cgaccttatt cctaattaaa tagagcaaat ccccttattg ggggtaagac 4860 atgaagatgc cagaaaaaca tgacctgttg gccgccattc tcgcggcaaa ggaacaaggc 4920 atcggggcaa tccttgcgtt tgcaatggcg taccttcgcg gcagatataa tggcggtgcg 4980 tttacaaaaa cagtaatcga cgcaacgatg tgcgccatta tcgcctggtt cattcgtgac 5040 cttctcgact tcgccggact aagtagcaat ctcgcttata taacgagcgt gtttatcggc 5100 tacatcggta ctgactcgat tggttcgctt atcaaacgct tcgctgctaa aaaagccgga 5160 gtagaagatg gtagaaatca ataatcaacg taaggcgttc ctcgatatgc tggcgtggtc 5220 ggagggaact gataacggac gtcagaaaac cagaaatcat ggttatgacg tcattgtagg 5280 cggagagcta tttactgatt actccgatca ccctcgcaaa cttgtcacgc taaacccaaa 5340 actcaaatca acaggcgccg gacgctacca gcttctttcc cgttggtggg atgcctaccg 5400 caagcagctt ggcctgaaag acttctctcc gaaaagtcag gacgctgtgg cattgcagca 5460 gattaaggag cgtggcgctt tacctatgat tgatcgtggt gatatccgtc aggcaatcga 5520 ccgttgcagc aatatctggg cttcactgcc gggcgctggt tatggtcagt tcgagcataa 5580 ggctgacagc ctgattgcaa aattcaaaga agcgggcgga acggtcagag agattgatgt 5640 atgagcagag tcaccgcgat tatctccgct ctggttatct gcatcatcgt ctgcctgtca 5700 tgggctgtta atcattaccg tgataacgcc attacctaca aagcccagcg cgacaaaaat 5760 gccagagaac tgaagctggc gaacgcggca attactgaca tgcagatgcg tcagcgtgat 5820 gttgctgcgc tcgatgcaaa atacacgaag gagttagctg atgctaaagc tgaaaatgat 5880 gctctgcgtg atgatgttgc cgctggtcgt cgtcggttgc acatcaaagc agtctgtcag 5940 tcagtgcgtg aagccaccac cgcctccggc gtggataatg cagcctcccc ccgactggca 6000 gacaccgctg aacgggatta tttcaccctc agagagaggc tgatcactat gcaaaaacaa 6060 ctggaaggaa cccagaagta tattaatgag cagtgcagat agagttgccc atatcgatgg 6120 gcaactcatg caattattgt gagcaataca cacgcgcttc cagcggagta taaatgccta 6180 aagtaataaa accgagcaat ccatttacga atgtttgctg ggtttctgtt ttaacaacat 6240 tttctgcgcc gccacaaatt ttggctgcat cgacagtttt cttctgccca attccagaaa 6300 cgaagaaatg atgggtgatg gtttcctttg gtgctactgc tgccggtttg ttttgaacag 6360 taaacgtctg ttgagcacat cctgtaataa gcagggccag cgcagtagcg agtagcattt 6420 ttttcatggt gttattcccg atgctttttg aagttcgcag aatcgtatgt gtagaaaatt 6480 aaacaaaccc taaacaatga gttgaaattt catattgtta atatttatta atgtatgtca 6540 ggtgcgatga atcgtcattg tattcccgga ttaactatgt ccacagccct gacggggaac 6600 ttctctgcgg gagtgtccgg gaataattaa aacgatgcac acagggttta gcgcgtacac 6660 gtattgcatt atgccaacgc cccggtgctg acacggaaga aaccggacgt tatgatttag 6720 cgtggaaaga tttgtgtagt gttctgaatg ctctcagtaa atagtaatga attatcaaag 6780 gtatagtaat atcttttatg ttcatggata tttgtaaccc atcggaaaac tcctgcttta 6840 gcaagatttt ccctgtattg ctgaaatgtg atttctcttg atttcaacct atcataggac 6900 gtttctataa gatgcgtgtt tcttgagaat ttaacattta caaccttttt aagtcctttt 6960 attaacacgg tgttatcgtt ttctaacacg atgtgaatat tatctgtggc tagatagtaa 7020 atataatgtg agacgttgtg acgttttagt tcagaataaa acaattcaca gtctaaatct 7080 tttcgcactt gatcgaatat ttctttaaaa atggcaacct gagccattgg taaaaccttc 7140 catgtgatac gagggcgcgt agtttgcatt atcgttttta tcgtttcaat ctggtctgac 7200 ctccttgtgt tttgttgatg atttatgtca aatattagga atgttttcac ttaatagtat 7260 tggttgcgta acaaagtgcg gtcctgctgg cattctggag ggaaatacaa ccgacagatg 7320 tatgtaaggc caacgtgctc aaatcttcat acagaaagat ttgaagtaat attttaaccg 7380 ctagatgaag agcaagcgca tggagcgaca aaatgaataa agaacaatct gctgatgatc 7440 cctccgtgga tctgattcgt gtaaaaaata tgcttaatag caccatttct atgagttacc 7500 ctgatgttgt aattgcatgt atagaacata aggtgtctct ggaagcattc agagcaattg 7560 aggcagcgtt ggtgaagcac gataataata tgaaggatta ttccctggtg gttgactgat 7620 caccataact gctaatcatt caaactattt agtctgtgac agagccaaca cgcagtctgt 7680 cactgtcagg aaagtggtaa aactgcaact caattactgc aatgccctcg taattaagtg 7740 aatttacaat atcgtcctgt tcggagggaa gaacgcggga tgttcattct tcatcacttt 7800 taattgatgt atatgctctc ttttctgacg ttagtctccg acggcaggct tcaatgaccc 7860 aggctgagaa attcccggac cctttttgct caagagcgat gttaatttgt tcaatcattt 7920 ggttaggaaa gcggatgttg cgggttgttg ttctgcgggt tctgttcttc gttgacatga 7980 ggttgccccg tattcagtgt cgctgatttg tattgtctga agttgttttt acgttaagtt 8040 gatgcagatc aattaatacg atacctgcgt cataattgat tatttgacgt ggtttgatgg 8100 cctccacgca cgttgtgata tgtagatgat aatcattatc actttacggg tcctttccgg 8160 tgatccgaca ggttacggcc tgatgcggta ttttctcctt acgcatctgt gcggtatttc 8220 acaccgcata cgtcaaagca accatagtac gcgccctgta gcggcgcatt aagcgcggcg 8280 ggtgtggtgg ttacgcgcag cgtgaccgct acacttgcca gcgccctagc gcccgctcct 8340 ttcgctttct tcccttcctt tctcgccacg ttcgccggct ttccccgtca agctctaaat 8400 cgggggctcc ctttagggtt ccgatttagt gctttacggc acctcgaccc caaaaaactt 8460 gatttgggtg atggttcacg tagtgggcca tcgccctgat agacggtttt tcgccctttg 8520 acgttggagt ccacgttctt taatagtgga ctcttgttcc aaactggaac aacactcaac 8580 cctatctcgg gctattcttt tgatttataa gggattttgc cgatttcggc ctattggtta 8640 aaaaatgagc tgatttaaca aaaatttaac gcgaatttta acaaaatatt aacgtttaca 8700 attttatggt gcactctcag tacaatctgc tctgatgccg catagttaag ccagccccga 8760 cacccgccaa cacccgctga cgcgccctga cgggcttgtc tgctcccggc atccgcttac 8820 agacaagctg tgaccgtctc cgggagctgc atgtgtcaga ggttttcacc gtcatcaccg 8880 aaacgcgcga gacgaaaggg cctcgtgata cgcctatttt tataggttaa tgtcatgata 8940 ataatggttt cttagacgtc aggtggcact tttcggggaa atgtgcgcgg aacccctatt 9000 tgtttatttt tctaaataca ttcaaatatg tatccgctca tgagacaata accctgataa 9060 atgcttcaat aatattgaaa aaggaagagt atgagtattc aacatttccg tgtcgccctt 9120 attccctttt ttgcggcatt ttgccttcct gtttttgctc acccagaaac gctggtgaaa 9180 gtaaaagatg ctgaagatca gttgggtgca cgagtgggtt acatcgaact ggatctcaac 9240 agcggtaaga tccttgagag ttttcgcccc gaagaacgtt ttccaatgat gagcactttt 9300 aaagttctgc tatgtggcgc ggtattatcc cgtattgacg ccgggcaaga gcaactcggt 9360 cgccgcatac actattctca gaatgacttg gttgagtact caccagtcac agaaaagcat 9420 cttacggatg gcatgacagt aagagaatta tgcagtgctg ccataaccat gagtgataac 9480 actgcggcca acttacttct gacaacgatc ggaggaccga aggagctaac cgcttttttg 9540 cacaacatgg gggatcatgt aactcgcctt gatcgttggg aaccggagct gaatgaagcc 9600 ataccaaacg acgagcgtga caccacgatg cctgtagcaa tggcaacaac gttgcgcaaa 9660 ctattaactg gcgaactact tactctagct tcccggcaac aattaataga ctggatggag 9720 gcggataaag ttgcaggacc acttctgcgc tcggcccttc cggctggctg gtttattgct 9780 gataaatctg gagccggtga gcgtgggtct cgcggtatca ttgcagcact ggggccagat 9840 ggtaagccct cccgtatcgt agttatctac acgacgggga gtcaggcaac tatggatgaa 9900 cgaaatagac agatcgctga gataggtgcc tcactgatta agcattggta actgtcagac 9960 caagtttact catatatact ttagattgat ttaaaacttc atttttaatt taaaaggatc 10020 taggtgaaga tcctttttga taatctcatg accaaaatcc cttaacgtga gttttcgttc 10080 cactgagcgt cagaccccgt agaaaagatc aaaggatctt cttgagatcc tttttttctg 10140 cgcgtaatct gctgcttgca aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg 10200 gatcaagagc taccaactct ttttccgaag gtaactggct tcagcagagc gcagatacca 10260 aatactgtcc ttctagtgta gccgtagtta ggccaccact tcaagaactc tgtagcaccg 10320 cctacatacc tcgctctgct aatcctgtta ccagtggctg ctgccagtgg cgataagtcg 10380 tgtcttaccg ggttggactc aagacgatag ttaccggata aggcgcagcg gtcgggctga 10440 acggggggtt cgtgcacaca gcccagcttg gagcgaacga cctacaccga actgagatac 10500 ctacagcgtg agctatgaga aagcgccacg cttcccgaag ggagaaaggc ggacaggtat 10560 ccggtaagcg gcagggtcgg aacaggagag cgcacgaggg agcttccagg gggaaacgcc 10620 tggtatcttt atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg atttttgtga 10680 tgctcgtcag gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc 10740 ctggcctttt gctggccttt tgctcacatg tcctgcaggc ag 10782 <210> 11 <211> 10776 <212> DNA <213> Artificial Sequence <220> <223> pAAV_AAVS1_C4-CD28CD3z-CAR.xdna <400> 11 ctgcgcgctc gctcgctcac tgaggccgcc cgggcaaagc ccgggcgtcg ggcgaccttt 60 ctgcgcgctc gctcgctcac tgaggccgcc cgggcaaagc ccgggcgtcg ggcgaccttt 60 ggtcgcccgg cctcagtgag cgagcgagcg cgcagagagg gagtggccaa ctccatcact 120 ggtcgcccgg cctcagtgag cgagcgagcg cgcagagagg gagtggccaa ctccatcact 120 aggggttcct gcggcctaag cttgagcgga gttccaattg tactgtacag ccctttgctt 180 aggggttcct gcggcctaag cttgagcgga gttccaattg tactgtacag ccctttgctt 180 tctctgacca gcattctctc ccctgggcct gtgccgcttt ctgtctgcag cttgtggcct 240 tctctgacca gcattctctc ccctgggcct gtgccgcttt ctgtctgcag cttgtggcct 240 gggtcacctc tacggctggc ccagatcctt ccctgccgcc tccttcaggt tccgtcttcc 300 gggtcacctc tacggctggc ccagatcctt ccctgccgcc tccttcaggt tccgtcttcc 300 tccactccct cttccccttg ctctctgctg tgttgctgcc caaggatgct ctttccggag 360 tccactccct cttccccttg ctctctgctg tgttgctgcc caaggatgct ctttccggag 360 cacttccttc tcggcgctgc accacgtgat gtcctctgag cggatcctcc ccgtgtctgg 420 cacttccttc tcggcgctgc accacgtgat gtcctctgag cggatcctcc ccgtgtctgg 420 gtcctctccg ggcatctctc ctccctcacc caaccccatg ccgtcttcac tcgctgggtt 480 gtcctctccg ggcatctctc ctccctcacc caaccccatg ccgtcttcac tcgctgggtt 480 cccttttcct tctccttctg gggcctgtgc catctctcgt ttcttaggat ggccttctcc 540 cccttttcct tctccttctg gggcctgtgc catctctcgt ttcttaggat ggccttctcc 540 gacggatgtc tcccttgcgt cccgcctccc cttcttgtag gcctgcatca tcaccgtttt 600 gacggatgtc tcccttgcgt cccgcctccc cttcttgtag gcctgcatca tcaccgtttt 600 tctggacaac cccaaagtac cccgtctccc tggctttagc cacctctcca tcctcttgct 660 tctggacaac cccaaagtac cccgtctccc tggctttagc cacctctcca tcctcttgct 660 ttctttgcct ggacaccccg ttctcctgtg gattcgggtc acctctcact cctttcattt 720 ttctttgcct ggacaccccg ttctcctgtg gattcgggtc acctctcact cctttcattt 720 gggcagctcc cctacccccc ttacctctct agtctgtgct agctcttcca gccccctgtc 780 atggcatctt ccaggggtcc gagagctcag ctagtcttct tcctccaacc cgggccccta 840 tgtccacttc aggacagcat gtttgctgcc tccagggatc ctgtgtcccc gagctgggac 900 caccttatat tcccagggcc ggttaatgtg gctctggttc tgggtacttt tatctgtccc 960 ctccacccca cagtggggca agcttctgac ctcttctctt cctcccacag ggcctcgaga 1020 gatctggcgg cggagagggc agaggaagtc ttctaacatg cggtgacgtg gaggagaatc 1080 ccggccctat ggccttacca gtgaccgcct tgctcctgcc gctggccttg ctgctccacg 1140 ccgccaggcc gggatcccag ctggtggagt ctgggggagg cttggtacag ccagggcggt 1200 ccctgagact ctcctgcaca acttctggat tcacttttgg tgattatgct atgatctggg 1260 cccgccaggc tccagggaag gggctggagt gggtctcatc cattagtagt agtagtagtt 1320 acatatacta cgcagactca gtgaagggcc gattcaccat ctccagagac aacgccaaga 1380 actcactgta tctgcaaatg aacagcctga gagccgagga cacggctgtg tattactgtg 1440 cgagagaacg atacgatttt tggagtggaa tggacgtctg gggcaaaggg accacggtca 1500 ccgtctcgag tggtggaggc ggttcaggcg gaggtggctc tggcggtagt gcacagtctg 1560 ccctgactca gcctgcctcc gtgtctgggt ctcctggaca gtcgatcacc atctcctgca 1620 ctggaaccag cagtgatgtt gggagttata accttgtctc ctggtaccaa cagcacccag 1680 gcaaagcccc caaactcatg atttatgagg gcagtaagcg gccctcaggg gtttctaatc 1740 gcttctctgg ctccaagtct ggcaacgcgg cctccctgac aatctctggg ctccaggctg 1800 aggacgaggc tgattattac tgccagtcct atgacagcag cctgagtgtg gtattcggcg 1860 gagggaccaa gctgaccgtc ctaggtgcta gcaccacgac gccagcgccg cgaccaccaa 1920 caccggcgcc caccatcgcg tcgcagcccc tgtccctgcg cccagaggcg tgccggccag 1980 cggcgggggg cgcagtgcac acgagggggc tggacttcgc ctgtgatttt tgggtgctgg 2040 tggtggttgg tggagtcctg gcttgctata gcttgctagt aacagtggcc tttattattt 2100 tctgggtgag gagtaagagg agcaggctcc tgcacagtga ctacatgaac atgactcccc 2160 gccgccccgg gcccacccgc aagcattacc agccctatgc cccaccacgc gacttcgcag 2220 cctatcgctc catcgataga gtgaagttca gcaggagcgc agacgccccc gcgtaccagc 2280 agggccagaa ccagctctat aacgagctca atctaggacg aagagaggag tacgatgttt 2340 tggacaagag acgtggccgg gaccctgaga tggggggaaa gccgagaagg aagaaccctc 2400 aggaaggcct gtacaatgaa ctgcagaaag ataagatggc ggaggcctac agtgagattg 2460 ggatgaaagg cgagcgccgg aggggcaagg ggcacgatgg cctttaccag ggtctcagta 2520 cagccaccaa ggacacctac gacgcccttc acatgcaggc cctgccccct cgctgataag 2580 cggccgcctg tgccttctag ttgccagcca tctgttgttt gcccctcccc cgtgccttcc 2640 ttgaccctgg aaggtgccac tcccactgtc ctttcctaat aaaatgagga aattgcatcg 2700 cattgtctga gtaggtgtca ttctattctg gggggtgggg tggggcagga cagcaagggg 2760 gaggattggg aagacaatag caggcatgct ggggatgcgg tgggctctat gggtcgacag 2820 tactaagctt tactagggac aggattggtg acagaaaagc cccatcctta ggcctcctcc 2880 ttcctagtct cctgatattg ggtctaaccc ccacctcctg ttaggcagat tccttatctg 2940 gtgacacacc cccatttcct ggagccatct ctctccttgc cagaacctct aaggtttgct 3000 tacgatggag ccagagagga tcctgggagg gagagcttgg cagggggtgg gagggaaggg 3060 ggggatgcgt gacctgcccg gttctcagtg gccaccctgc gctaccctct cccagaacct 3120 gagctgctct gacgcggctg tctggtgcgt ttcactgatc ctggtgctgc agcttcctta 3180 cacttcccaa gaggagaagc agtttggaaa aacaaaatca gaataagttg gtcctgagtt 3240 ctaactttgg ctcttcacct ttctagtccc caatttatat tgttcctccg tgcgtcagtt 3300 ttacctgtga gataaggcca gtagccagcc ccgtcctggc agggctgtgg tgaggagggg 3360 ggtgtccgtg tggaaaactc cctttgtgag aatggtgcgt cctaggtgtt caccaggtcg 3420 tggccgcctc tactcccttt ctctttctcc atccttcttt ccttaaagag tccccagtgc 3480 tatctgggac atattcctcc gcccagagca gggtcccgct tccctaaggc cctgctctgg 3540 gcttctgggt ttgagtcctt ggcaagccca ggagaggcgc tcaggcttcc ctgtccccct 3600 tcctcgtcca ccatctcatg cccctggctc tcctgcccct tccctacagg ggttcctggc 3660 tctgctctaa gggggtaccc tcgagcgcag gaacccctag tgatggagtt ggccactccc 3720 tctctgcgcg ctcgctcgct cactgaggcc gcccgggctt tgcccgggcg gcctcagtga 3780 gcgagcgagc gcgcagctgc ctgcaggggc agcttgaagg aaatactaag gcaaaggtac 3840 tgcaagtgct cgcaacattc gcttatgcgg attattgccg tagtgccgcg acgccggggg 3900 caagatgcag agattgccat ggtacaggcc gtgcggttga tattgccaaa acagagctgt 3960 gggggagagt tgtcgagaaa gagtgcggaa gatgcaaagg cgtcggctat tcaaggatgc 4020 cagcaagcgc agcatatcgc gctgtgacga tgctaatccc aaaccttacc caacccacct 4080 ggtcacgcac tgttaagccg ctgtatgacg ctctggtggt gcaatgccac aaagaagagt 4140 caatcgcaga caacattttg aatgcggtca cacgttagca gcatgattgc cacggatggc 4200 aacatattaa cggcatgata ttgacttatt gaataaaatt gggtaaattt gactcaacga 4260 tgggttaatt cgctcgttgt ggtagtgaga tgaaaagagg cggcgcttac taccgattcc 4320 gcctagttgg tcacttcgac gtatcgtctg gaactccaac catcgcaggc agagaggtct 4380 gcaaaatgca atcccgaaac agttcgcagg taatagttag agcctgcata acggtttcgg 4440 gattttttat atctgcacaa caggtaagag cattgagtcg ataatcgtga agagtcggcg 4500 agcctggtta gccagtgctc tttccgttgt gctgaattaa gcgaataccg gaagcagaac 4560 cggatcacca aatgcgtaca ggcgtcatcg ccgcccagca acagcacaac ccaaactgag 4620 ccgtagccac tgtctgtcct gaattcatta gtaatagtta cgctgcggcc ttttacacat 4680 gaccttcgtg aaagcgggtg gcaggaggtc gcgctaacaa cctcctgccg ttttgcccgt 4740 gcatatcggt cacgaacaaa tctgattact aaacacagta gcctggattt gttctatcag 4800 taatcgacct tattcctaat taaatagagc aaatcccctt attgggggta agacatgaag 4860 atgccagaaa aacatgacct gttggccgcc attctcgcgg caaaggaaca aggcatcggg 4920 gcaatccttg cgtttgcaat ggcgtacctt cgcggcagat ataatggcgg tgcgtttaca 4980 aaaacagtaa tcgacgcaac gatgtgcgcc attatcgcct ggttcattcg tgaccttctc 5040 gacttcgccg gactaagtag caatctcgct tatataacga gcgtgtttat cggctacatc 5100 ggtactgact cgattggttc gcttatcaaa cgcttcgctg ctaaaaaagc cggagtagaa 5160 gatggtagaa atcaataatc aacgtaaggc gttcctcgat atgctggcgt ggtcggaggg 5220 aactgataac ggacgtcaga aaaccagaaa tcatggttat gacgtcattg taggcggaga 5280 gctatttact gattactccg atcaccctcg caaacttgtc acgctaaacc caaaactcaa 5340 atcaacaggc gccggacgct accagcttct ttcccgttgg tgggatgcct accgcaagca 5400 gcttggcctg aaagacttct ctccgaaaag tcaggacgct gtggcattgc agcagattaa 5460 ggagcgtggc gctttaccta tgattgatcg tggtgatatc cgtcaggcaa tcgaccgttg 5520 cagcaatatc tgggcttcac tgccgggcgc tggttatggt cagttcgagc ataaggctga 5580 cagcctgatt gcaaaattca aagaagcggg cggaacggtc agagagattg atgtatgagc 5640 agagtcaccg cgattatctc cgctctggtt atctgcatca tcgtctgcct gtcatgggct 5700 gttaatcatt accgtgataa cgccattacc tacaaagccc agcgcgacaa aaatgccaga 5760 gaactgaagc tggcgaacgc ggcaattact gacatgcaga tgcgtcagcg tgatgttgct 5820 gaactgaagc tggcgaacgc ggcaattact gacatgcaga tgcgtcagcg tgatgttgct 5820 gcgctcgatg caaaatacac gaaggagtta gctgatgcta aagctgaaaa tgatgctctg 5880 gcgctcgatg caaaatacac gaaggagtta gctgatgcta aagctgaaaa tgatgctctg 5880 cgtgatgatg ttgccgctgg tcgtcgtcgg ttgcacatca aagcagtctg tcagtcagtg 5940 cgtgatgatg ttgccgctgg tcgtcgtcgg ttgcacatca aagcagtctg tcagtcagtg 5940 cgtgaagcca ccaccgcctc cggcgtggat aatgcagcct ccccccgact ggcagacacc 6000 cgtgaagcca ccaccgcctc cggcgtggat aatgcagcct ccccccgact ggcagacacc 6000 gctgaacggg attatttcac cctcagagag aggctgatca ctatgcaaaa acaactggaa 6060 gctgaacggg attatttcac cctcagagag aggctgatca ctatgcaaaa acaactggaa 6060 ggaacccaga agtatattaa tgagcagtgc agatagagtt gcccatatcg atgggcaact 6120 ggaacccaga agtatattaa tgagcagtgc agatagagtt gcccatatcg atgggcaact 6120 catgcaatta ttgtgagcaa tacacacgcg cttccagcgg agtataaatg cctaaagtaa 6180 catgcaatta ttgtgagcaa tacacacgcg cttccagcgg agtataaatg cctaaagtaa 6180 taaaaccgag caatccattt acgaatgttt gctgggtttc tgttttaaca acattttctg 6240 taaaaccgag caatccattt acgaatgttt gctgggtttc tgttttaaca acattttctg 6240 cgccgccaca aattttggct gcatcgacag ttttcttctg cccaattcca gaaacgaaga 6300 cgccgccaca aattttggct gcatcgacag ttttcttctg cccaattcca gaaacgaaga 6300 aatgatgggt gatggtttcc tttggtgcta ctgctgccgg tttgttttga acagtaaacg 6360 aatgatgggt gatggtttcc tttggtgcta ctgctgccgg tttgttttga acagtaaacg 6360 tctgttgagc acatcctgta ataagcaggg ccagcgcagt agcgagtagc atttttttca 6420 tctgttgagc acatcctgta ataagcaggg ccagcgcagt agcgagtagc atttttttca 6420 tggtgttatt cccgatgctt tttgaagttc gcagaatcgt atgtgtagaa aattaaacaa 6480 tggtgttatt cccgatgctt tttgaagttc gcagaatcgt atgtgtagaa aattaaacaa 6480 accctaaaca atgagttgaa atttcatatt gttaatattt attaatgtat gtcaggtgcg 6540 atgaatcgtc attgtattcc cggattaact atgtccacag ccctgacggg gaacttctct 6600 gcgggagtgt ccgggaataa ttaaaacgat gcacacaggg tttagcgcgt acacgtattg 6660 cattatgcca acgccccggt gctgacacgg aagaaaccgg acgttatgat ttagcgtgga 6720 aagatttgtg tagtgttctg aatgctctca gtaaatagta atgaattatc aaaggtatag 6780 taatatcttt tatgttcatg gatatttgta acccatcgga aaactcctgc tttagcaaga 6840 ttttccctgt attgctgaaa tgtgatttct cttgatttca acctatcata ggacgtttct 6900 ataagatgcg tgtttcttga gaatttaaca tttacaacct ttttaagtcc ttttattaac 6960 acggtgttat cgttttctaa cacgatgtga atattatctg tggctagata gtaaatataa 7020 tgtgagacgt tgtgacgttt tagttcagaa taaaacaatt cacagtctaa atcttttcgc 7080 acttgatcga atatttcttt aaaaatggca acctgagcca ttggtaaaac cttccatgtg 7140 atacgagggc gcgtagtttg cattatcgtt tttatcgttt caatctggtc tgacctcctt 7200 gtgttttgtt gatgatttat gtcaaatatt aggaatgttt tcacttaata gtattggttg 7260 cgtaacaaag tgcggtcctg ctggcattct ggagggaaat acaaccgaca gatgtatgta 7320 aggccaacgt gctcaaatct tcatacagaa agatttgaag taatatttta accgctagat 7380 gaagagcaag cgcatggagc gacaaaatga ataaagaaca atctgctgat gatccctccg 7440 tggatctgat tcgtgtaaaa aatatgctta atagcaccat ttctatgagt taccctgatg 7500 ttgtaattgc atgtatagaa cataaggtgt ctctggaagc attcagagca attgaggcag 7560 cgttggtgaa gcacgataat aatatgaagg attattccct ggtggttgac tgatcaccat 7620 aactgctaat cattcaaact atttagtctg tgacagagcc aacacgcagt ctgtcactgt 7680 caggaaagtg gtaaaactgc aactcaatta ctgcaatgcc ctcgtaatta agtgaattta 7740 caatatcgtc ctgttcggag ggaagaacgc gggatgttca ttcttcatca cttttaattg 7800 atgtatatgc tctcttttct gacgttagtc tccgacggca ggcttcaatg acccaggctg 7860 agaaattccc ggaccctttt tgctcaagag cgatgttaat ttgttcaatc atttggttag 7920 gaaagcggat gttgcgggtt gttgttctgc gggttctgtt cttcgttgac atgaggttgc 7980 cccgtattca gtgtcgctga tttgtattgt ctgaagttgt ttttacgtta agttgatgca 8040 gatcaattaa tacgatacct gcgtcataat tgattatttg acgtggtttg atggcctcca 8100 cgcacgttgt gatatgtaga tgataatcat tatcacttta cgggtccttt ccggtgatcc 8160 gacaggttac ggcctgatgc ggtattttct ccttacgcat ctgtgcggta tttcacaccg 8220 catacgtcaa agcaaccata gtacgcgccc tgtagcggcg cattaagcgc ggcgggtgtg 8280 gtggttacgc gcagcgtgac cgctacactt gccagcgccc tagcgcccgc tcctttcgct 8340 ttcttccctt cctttctcgc cacgttcgcc ggctttcccc gtcaagctct aaatcggggg 8400 ctccctttag ggttccgatt tagtgcttta cggcacctcg accccaaaaa acttgatttg 8460 ggtgatggtt cacgtagtgg gccatcgccc tgatagacgg tttttcgccc tttgacgttg 8520 gagtccacgt tctttaatag tggactcttg ttccaaactg gaacaacact caaccctatc 8580 tcgggctatt cttttgattt ataagggatt ttgccgattt cggcctattg gttaaaaaat 8640 gagctgattt aacaaaaatt taacgcgaat tttaacaaaa tattaacgtt tacaatttta 8700 tggtgcactc tcagtacaat ctgctctgat gccgcatagt taagccagcc ccgacacccg 8760 ccaacacccg ctgacgcgcc ctgacgggct tgtctgctcc cggcatccgc ttacagacaa 8820 gctgtgaccg tctccgggag ctgcatgtgt cagaggtttt caccgtcatc accgaaacgc 8880 gcgagacgaa agggcctcgt gatacgccta tttttatagg ttaatgtcat gataataatg 8940 gtttcttaga cgtcaggtgg cacttttcgg ggaaatgtgc gcggaacccc tatttgttta 9000 tttttctaaa tacattcaaa tatgtatccg ctcatgagac aataaccctg ataaatgctt 9060 caataatatt gaaaaaggaa gagtatgagt attcaacatt tccgtgtcgc ccttattccc 9120 ttttttgcgg cattttgcct tcctgttttt gctcacccag aaacgctggt gaaagtaaaa 9180 gatgctgaag atcagttggg tgcacgagtg ggttacatcg aactggatct caacagcggt 9240 aagatccttg agagttttcg ccccgaagaa cgttttccaa tgatgagcac ttttaaagtt 9300 ctgctatgtg gcgcggtatt atcccgtatt gacgccgggc aagagcaact cggtcgccgc 9360 atacactatt ctcagaatga cttggttgag tactcaccag tcacagaaaa gcatcttacg 9420 gatggcatga cagtaagaga attatgcagt gctgccataa ccatgagtga taacactgcg 9480 gccaacttac ttctgacaac gatcggagga ccgaaggagc taaccgcttt tttgcacaac 9540 atgggggatc atgtaactcg ccttgatcgt tgggaaccgg agctgaatga agccatacca 9600 aacgacgagc gtgacaccac gatgcctgta gcaatggcaa caacgttgcg caaactatta 9660 actggcgaac tacttactct agcttcccgg caacaattaa tagactggat ggaggcggat 9720 aaagttgcag gaccacttct gcgctcggcc cttccggctg gctggtttat tgctgataaa 9780 tctggagccg gtgagcgtgg gtctcgcggt atcattgcag cactggggcc agatggtaag 9840 ccctcccgta tcgtagttat ctacacgacg gggagtcagg caactatgga tgaacgaaat 9900 agacagatcg ctgagatagg tgcctcactg attaagcatt ggtaactgtc agaccaagtt 9960 tactcatata tactttagat tgatttaaaa cttcattttt aatttaaaag gatctaggtg 10020 aagatccttt ttgataatct catgaccaaa atcccttaac gtgagttttc gttccactga 10080 gcgtcagacc ccgtagaaaa gatcaaagga tcttcttgag atcctttttt tctgcgcgta 10140 atctgctgct tgcaaacaaa aaaaccaccg ctaccagcgg tggtttgttt gccggatcaa 10200 gagctaccaa ctctttttcc gaaggtaact ggcttcagca gagcgcagat accaaatact 10260 gtccttctag tgtagccgta gttaggccac cacttcaaga actctgtagc accgcctaca 10320 tacctcgctc tgctaatcct gttaccagtg gctgctgcca gtggcgataa gtcgtgtctt 10380 accgggttgg actcaagacg atagttaccg gataaggcgc agcggtcggg ctgaacgggg 10440 ggttcgtgca cacagcccag cttggagcga acgacctaca ccgaactgag atacctacag 10500 cgtgagctat gagaaagcgc cacgcttccc gaagggagaa aggcggacag gtatccggta 10560 agcggcaggg tcggaacagg agagcgcacg agggagcttc cagggggaaa cgcctggtat 10620 ctttatagtc ctgtcgggtt tcgccacctc tgacttgagc gtcgattttt gtgatgctcg 10680 tcaggggggc ggagcctatg gaaaaacgcc agcaacgcgg cctttttacg gttcctggcc 10740 ttttgctggc cttttgctca catgtcctgc aggcag 10776 <210> 12 <211> 32 <212> DNA <213> Homo sapiens <400> 12 gctccagcta cggaaagtca gattactgga gg 32 <210> 13 <211> 32 <212> DNA <213> Homo sapiens <400> 13 cctccagtaa tctgactttc cgtagctgga gc 32 <210> 14 <211> 32 <212> DNA <213> Homo sapiens <400> 14 caggctcctc aagtggtact actcggtgca tg 32 <210> 15 <211> 32 <212> DNA <213> Homo sapiens <400> 15 catgcaccga gtagtaccac ttgaggagcc tg 32 <210> 16 <211> 32 <212> DNA <213> Homo sapiens <400> 16 agagaagttc ggcaatcttg ttactggtac tc 32 <210> 17 <211> 32 <212> DNA <213> Homo sapiens <400> 17 gagtaccagt aacaagattg ccgaacttct ct 32 <210> 18 <211> 32 <212> DNA <213> Homo sapiens <400> 18 tggaccctta acattaggca gcgatccgtt ta 32 <210> 19 <211> 32 <212> DNA <213> Homo sapiens <400> 19 taaacggatc gctgcctaat gttaagggtc ca 32 <210> 20 <211> 30 <212> DNA <213> Homo sapiens <400> 20 cgatccgttt atgtatcctt agtcaggtgt 30 <210> 21 <211> 30 <212> DNA <213> Homo sapiens <400> 21 acacctgact aaggatacat aaacggatcg 30 <210> 22 <211> 32 <212> DNA <213> Homo sapiens <400> 22 tcaatgtcac gttctcctac ctagttggtt gg 32 <210> 23 <211> 32 <212> DNA <213> Homo sapiens <400> 23 ccaaccaact aggtaggaga acgtgacatt ga 32 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Target 56 <400> 24 catcaagttc agctcttcct 20 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Target 150 <400> 25 gatcacaagc aactctggat 20

Claims

1. A lymphocyte comprising an antigen-targeting receptor and an autophagy-related (ATG) gene that has been disrupted, wherein the autophagy-related (ATG) gene comprises ATG5 or ATG14, wherein the antigen-targeting receptor comprises a synthetic receptor, and wherein the lymphocyte is a CD8+ T cell.

2. The lymphocyte according to claim 1, comprising a nucleic acid encoding the antigen-targeting receptor, wherein the nucleic acid is inserted into the locus of the autophagy-related (ATG) gene to disrupt the expression of the autophagy-related (ATG) gene.

3. The lymphocyte according to claim 2, wherein the nucleic acid encoding the antigen-targeting receptor is inserted into the locus of the autophagy gene such that the expression of the antigen-targeting receptor is regulated by the endogenous promoter of the autophagy-related (ATG) gene.

4. The lymphocyte according to any one of claims 1 to 3, wherein the nucleic acid encoding the antigen-targeting receptor is inserted into an exon of the autophagy-related (ATG) gene.

5. The lymphocyte according to any one of claims 1 to 3, wherein the nucleic acid encoding the antigen-targeting receptor is inserted into an intron of the autophagy-related (ATG) gene.

6. The lymphocyte according to claim 5, wherein the autophagy-related (ATG) gene is ATG5 and the nucleic acid encoding the antigen-targeting receptor is inserted into intron 2 of the ATG5 gene.

7. The lymphocyte according to claim 6, wherein the nucleic acid for inserting the antigen-targeting receptor has a sequence of either SEQ ID NO:8 or SEQ ID NO:

9.

8. The lymphocyte according to claim 1, wherein the autophagy-related (ATG) gene is located at a first locus in the genome of the lymphocyte, and the lymphocyte comprises a nucleic acid encoding the antigen-targeting receptor located at a second locus in the genome, and the first locus is different from the second locus.

9. The lymphocyte according to claim 8, wherein the expression of the antigen-targeting receptor is regulated by a heterologous promoter.

10. A lymphocyte for immunotherapy, comprising an antigen-targeting receptor and an autophagy-related (ATG) gene that has been disrupted, wherein the antigen-targeting receptor comprises a synthetic receptor, wherein the autophagy-related (ATG) gene comprises ATG5 or ATG14, and wherein the lymphocyte is a CD8+ T cell.

11. Use of the lymphocyte according to any one of claims 1 to 10 in the preparation of a medicament for immunotherapy for treating breast cancer, prostate cancer, ovarian cancer or lung cancer.

12. The use according to claim 11, wherein the lymphocytes are used for preparing a medicament for treating cancer that expresses α-folate receptor as a tumor-specific antigen.

13. A method for preparing lymphocytes for immunotherapy, the method comprising the steps of modifying the lymphocytes to eliminate autophagy-related (ATG) genes, and modifying the lymphocytes to express an antigen-targeting receptor, wherein the antigen-targeting receptor comprises a synthetic receptor, wherein the autophagy-related (ATG) genes comprise ATG5 or ATG14, and wherein the lymphocytes are CD8+ T cells.

14. The method according to claim 13, wherein one or both of the step of modifying the lymphocytes to eliminate the autophagy-related (ATG) genes and the step of modifying the lymphocytes to express the antigen-targeting receptor are carried out using a gene editing method or using RNAi.

15. The method according to claim 14, wherein the gene editing method comprises CRISPR-Cas.

16. The method according to claim 14, wherein the gene editing method is used to insert a nucleic acid encoding the antigen-targeting receptor at the locus of the autophagy-related (ATG) gene.

17. The method according to claim 14, wherein the gene editing method is used to insert a nucleic acid encoding the antigen-targeting receptor such that the expression of the antigen-targeting receptor is regulated by the endogenous promoter of the autophagy-related (ATG) gene.

18. The method according to claim 16, wherein the gene editing method is used to insert the nucleic acid encoding the antigen-targeting receptor into an intron of the autophagy-related (ATG) gene.

19. The method according to claim 18, wherein the autophagy gene is ATG5 and the nucleic acid encoding the antigen-targeting receptor is inserted into intron 2 of the ATG5 gene.

20. The method according to claim 19, wherein the nucleic acid construct for inserting the antigen-targeting receptor comprises a sequence of SEQ ID NO:8 or SEQ ID NO:

9.

21. The method according to claim 20, wherein the gene editing method comprises CRISPR-Cas, and the sgRNA for carrying out the CRISPR-Cas gene editing comprises one of SEQ ID NO:1 to 7.

22. The method according to claim 13, wherein the step of modifying the lymphocytes to express the antigen-targeting receptor comprises inserting a nucleic acid encoding the antigen-targeting receptor into the genome of the lymphocytes at a first locus.

23. The method according to claim 22, wherein the step of modifying the lymphocyte to eliminate the autophagy-related (ATG) gene comprises knocking out the autophagy-related (ATG) gene at a second locus of the genome, the second locus being different from the first locus.

24. The method according to claim 22, wherein the step of modifying the lymphocyte to express the antigen-targeting receptor comprises inserting a nucleic acid encoding a heterologous promoter to drive the expression of the antigen-targeting receptor.

25. The method according to claim 13, wherein the autophagy-related (ATG) gene is eliminated by knocking out the autophagy-related (ATG) gene.

26. The method according to claim 25, wherein the autophagy-related (ATG) gene is ATG5.

27. The method according to claim 26, wherein the step of knocking out the autophagy-related (ATG) gene comprises disrupting ATG5 at exon 4 or exon 5.

28. The method according to claim 13, wherein the step of modifying the lymphocyte to eliminate the autophagy-related (ATG) gene comprises using CRISPR-Cas, zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), sleeping beauty (SB), RNAi, meganuclease or megaTAL.

29. Use of lymphocytes prepared by the method according to claim 13 in the preparation of a medicament for performing immunotherapy for treating breast cancer, prostate cancer, ovarian cancer or lung cancer.

30. The use according to claim 29, wherein the lymphocytes comprise lymphocytes having tumor cell killing activity.

31. The use according to claim 29, wherein the lymphocytes comprise cytotoxic lymphocytes.

32. The lymphocyte according to any one of claims 1 to 8, wherein the autophagy-related (ATG) gene is ATG5.

33. The lymphocyte according to any one of claims 1 to 8, wherein the autophagy-related (ATG) gene is ATG14.

34. The method according to any one of claims 13 to 25 or 28, wherein the autophagy-related (ATG) gene is ATG5.

35. The lymphocyte according to any one of claims 13 to 25 or 28, wherein the autophagy-related (ATG) gene is ATG14.

36. The lymphocyte according to any one of claims 1 to 10, wherein the antigen-targeting receptor comprises a chimeric antigen receptor (CAR) or a modified T cell receptor.

37. The lymphocyte according to any one of claims 1 to 10, wherein the antigen-targeting receptor is specific for a tumor-specific antigen.

38. The lymphocyte according to claim 37, wherein the tumor-specific antigen comprises folate receptor (FR), CD19, CD20, CD133, CD138, CEA, Claudin 18.2, EGFR, EGFRvIII, EphA2, EpCAM, GD2, GPC3, HER2, MSLN, MG7, MUC1, NY-ESO-1, LMP1, prostate-specific membrane antigen (PSMA), Fra, NKG2Dl, BCMA, IL13Rα2, LeY, CD70, B7-H3, ROR1 or PSCA.

39. The lymphocyte according to claim 38, wherein the folate receptor (FR) comprises alpha-folate receptor, beta-folate receptor and gamma-folate receptor.

40. The lymphocyte according to claim 37, wherein the antigen-targeting receptor comprises a chimeric antigen receptor (CAR), and wherein the antigen-binding fragment of the CAR is specific for the tumor-specific antigen.

41. The lymphocyte according to any one of claims 1 to 10, wherein the antigen-targeting receptor comprises a chimeric antigen receptor (CAR), and wherein the CAR is an alpha-folate receptor CAR.

42. The lymphocyte according to claim 41, wherein the nucleotide construct for inserting the CAR into the lymphocyte has the nucleic acid sequence of any one of SEQ ID NO:8 or SEQ ID NO:9.

Images